PseKNC-General User Manual
Contents
1. j 3 After running the above command the following result will be found in output txt file gt Example1 AGTCAGTTATGACATGACACACACAACATAGTCAGATCGACGA Properties Tilt Shift GEARY 1 268 1 481 5 GUI usages For the convenience of users who are not familiar with command line options the GUI shell is provided The main interface of the GUI based shell program is shown in Figure 1 It includes three modules namely PseKNC Autocorrelation and K tuple Composition that can be used to calculate the pseudo k tuple nucleotide compositions autocorrelation coefficient and k tuple nucleotide compositions respectively Autocorrelation Ktuple Composition Figure 1 The main interface of GUI shell Click the PseKNC button the interface for calculating pseudo k tuple nucleotide compositions will appear as shown in Figure 2 Upload the fasta file containing the query sequences see section 3 1 for more detail and the physicochemical properties selection file see section 3 3 for more detail Input the values for the two parameters lambda and weight Choose the type of pseudo k tuple nucleotide compositions Type 1 or Type 2 Click Get sequence and Get Properties then the names of the query sequences and available properties will be listed on the interface When all the parameters are set click the Calculate button to2. H Determination of common structural features in Escherichia coli promoters by computer analysis Eur J Biochem 1994 223 823 830 17 Gromiha MM Ponnuswamy PK Hydrophobic distribution and spatial arrangement of amino acid residues in membrane proteins Int J Pept Protein Res 1996 48 452 460 18 SantaLucia J Jr Allawi HT Seneviratne PA Improved nearest neighbor parameters for predicting DNA duplex stability Biochemistry 1996 35 3555 3562 19 Sarai A Mazur J Nussinov R Jernigan RL Sequence dependence of DNA conformational flexibility Biochemistry 1989 28 7842 7849 20 Gotoh O Tagashira Y Stabilities of nearest neighbor doublets in double helical DNA determined by fitting calculated melting profiles to observed profiles Biopolymers 1981 20 1033 1042 21 Lewis JP Sankey OF Geometry and energetics of DNA basepairs and triplets from first principles quantum molecular relaxations Biophys J 1995 69 1068 1076 22 Goni JR Perez A Torrents D Orozco M Determining promoter location based on DNA structure first principles calculations Genome Biol 2007 8 R263 23 Sponer J Gabb HA Leszczynski J Hobza P Base base and deoxyribose base stacking interactions in B DNA and Z DNA a quantum chemical study Biophys J 1997 73 76 87 24 Karas H Knuppel R Schulz W Sklenar H Wingender E Combining structural analysis of DNA with search routines for the detection of transcription regulatory elements Comput Appl Biosci 19
3. Sequences Supp Into File O SuppinfoOiONA bt Browse Got Properties Lambda v Basestacking SelecuDesetect All Proteininduceddetormatety HSBGPG Human gene for bone gia protein PGP B DNAtwist e EES HSGLTH1 Human theta 3 globin gene DinucteotideGCContent A philicity Propetertwist Ouplexstability frecenergy Duptextabaity drsruptenergy ONtAdenaturapon Bendingsttiness ProtoinDtuatwtst SlabiisingemergyotZ OMA Alda_BA_transinion Brestauer_oG CSV format Brostauer_aH Moran Awtocorretation Geary Autocorrelation Moreau Autocorretation Save vi SVM format Tab Delimited format Electron_interaction Nartman_trans_free_energy Helix Coll_trans tion Manov BA transition Figure 3 The interface of Autocorrelation module in the GUI shell Click the Ktuple Composition button the interface for calculating k tuple nucleotide compositions will appear as shown in Figure 4 Upload the fasta file containing the query sequences see section 3 1 for more detail Input the characters considered A C G and T are accepted for DNA sequences while A C G and U are accepted for RNA sequences Enter the value of k into the box to the right of size of nucleotide Click Get sequence then the names of the query sequences will be listed on the interface When all the parameters are well set click the Calculate button to generate the corresponding k tuple n
4. generate the desired pseudo k tuple nucleotide compositions The results not only can be shown on the screen but also can be saved into a file with three optional formats namely tab svm or csv formats E Psexne gt msl vi Basestacking SetectiDesetect All e Proteaninducoddetormataity one gia protein BGP a 1 ghobin gene Stapmaingonergyot DNA Aida DA transition Bresiawer o Figure 2 The interface of PseKNC module in the GUI shell Click the Autocorrelation button the interface for calculating pseudo k tuple nucleotide compositions will appear as shown in Figure 3 Upload the fasta file containing the query sequences see section 3 1 for more detail and the physicochemical properties selection file see section 3 3 for more detail Input the value of the interspaces parameter into the box to the right of Lambda Click Get sequence and Get Properties then the names of the query sequences and available properties will be listed on the interface When all the parameters are set click the Moran Autocorrelation Geray Autocorrelation or Moreau Autocorrelation button to generate the corresponding types of autocorrelation coefficients The results not only can be shown on the screen but also can be saved into a file with three optional formats namely tab svm or csv formats Autocorrelation cores _ _ FASTA Fite DFASTADt Browse Got
5. 96 12 441 446 25 Hogan ME Austin RH Importance of DNA stiffness in protein DNA binding specificity Nature 1987 329 263 266 26 Gotoh O Tagashira Y Stabilities Of Nearest Neighbor Doublets In Double Helical DNA Determined by Fitting Calculated Melting Profiles To Observed Profiles Biopolymers 1981 20 1033 1042 27 Gartenberg MR Crothers DM DNA sequence determinants of CAP induced bending and protein binding affinity Nature 1988 333 824 829 28 Delcourt SG Blake RD Stacking energies in DNA J Biol Chem 1991 266 15160 15169 29 Lankas F Sponer J Langowski J Cheatham TE 3rd DNA basepair step deformability inferred from molecular dynamics simulations Biophys J 2003 85 2872 2883 30 Shpigelman ES Trifonov EN Bolshoy A CURVATURE software for the analysis of curved DNA Comput Appl Biosci 1993 9 435 440 31 Packer MJ Dauncey MP Hunter CA Sequence dependent DNA structure dinucleotide conformational maps J Mol Biol 2000 295 71 83 32 SantaLucia J Jr Hicks D The thermodynamics of DNA structural motifs Annu Rev Biophys Biomol Struct 2004 33 415 440 33 Perez A Noy A Lankas F Luque FJ Orozco M The relative flexibility of B DNA and A RNA duplexes database analysis Nucleic Acids Res 2004 32 6144 6151 34 Barzilay I Sussman JL Lapidot Y Further studies on the chromatographic behaviour of dinucleoside monophosphates Journal of Chromatography A 1973 79 139 146 35 Freier SM Kierzek R Jaeg
6. PseKNC General User Manual Contents 1 Introduction of PseeKNC General Cy 2 Jnstallati n EE 3 Input Output formats voct ts jetesea cidade eee ahaa 3 1 Input OTM E cave ede wt dee eege 3 2 Output ir EE 3 3 Physicochemical Properties Selection 4 Commands Pm meme rere rece cere r err eee se resrerer rere seseeseereseeserseseereseseescecece 4 1 Command line parameters for Pech NC py 2 4 2 Command line parameters for Autocorrelation py 3 4 3 Nr TEE 3 Se E D RE 4 6 AP POM EE 7 1 Introduction of PseKNC General PseKNC General the general form of pseudo k tuple nucleotide composition is a cross platform stand alone and open source package that can be used to represent a DNA or RNA sequence with a discrete model or vector yet still keeping considerable sequence order information particularly the global or long range sequence order information via the physicochemical properties of its constituent oligonucleotides 2 Installation The PseXNC General package can be run on Linux Mac and Windows systems It not only provides a command line environment but also a user friendly graphical user interface GUI Download the package from http lin uestc edu cn server pseknc and extract it to a directory for example usr To execute the PseKNC General in command line environment navigate to the usr pseknc directory and you will find two python files namely pse
7. PseKNC algorithm can be any integer that smaller than the length of query DNA sequence default 1 For user s convenience some examples of how to process a query sequence using command line are given below Example 1 List the text files including the physicochemical properties pseknc py p Example 2 Calculate the dinucleotide composition of the query sequence and output the result in Libsvm format pseknc py i test txt s k 2 f svm o output txt After running the above command the following result will be found in output txt file gt Examplel AGTCAGTTATGACATGACACACACAACATAGTCAGATCGACGA 1 0 023 2 0 095 3 0 095 4 0 166 5 0 047 6 0 023 7 0 047 8 0 071 9 0 119 10 0 071 11 0 0 12 0 0 13 0 19 14 0 0 15 0 047 16 0 0 Example 3 Calculate the Type 1 pseudo dinucleotide composition of the query sequence and output the result in Libsvm format pseknc py i test txt x propNames txt k 2 j 3 w 0 5 f svm o out txt After running the above command the following result will be found in output txt file gt Example1 1 0 0 2 0 03 3 0 0 4 0 018 5 0 024 6 0 006 7 0 042 8 0 024 9 0 012 10 0 048 11 0 0 12 0 0 13 0 012 14 0 012 15 0 018 16 0 006 17 0 277 18 0 196 19 0 271 Example 4 Calculate the Geary autocorrelation of the query sequence and output the result in Libsvm format autocorrelations py a Geary i test txt o out txt x propNames txt k 2
8. Res 1996 24 4501 4505 8 Breslauer KJ Frank R Blocker H Marky LA Predicting DNA duplex stability from the base sequence Proc Natl Acad Sci U S A 1986 83 3746 3750 9 Blake RD Encyclopedia of Molecular Biology and Molecular Medicine New York VCH Publishers 1996 10 Sivolob AV Khrapunov SN Translational positioning of nucleosomes on DNA the role of sequence dependent isotropic DNA bending stiffness J Mol Biol 1995 247 918 931 11 Ho PS Ellison MJ Quigley GJ Rich A A computer aided thermodynamic approach for predicting the formation of Z DNA in naturally occurring sequences EMBO J 1986 5 2737 2744 12 Aida M An ab initio molecular orbital study on the sequence dependency of DNA conformation an evaluation of intra and inter strand stacking interaction energy J Theor Biol 1988 130 327 335 13 Hartmann B Malfoy B Lavery R Theoretical prediction of base sequence effects in DNA Experimental reactivity of Z DNA and B Z transition enthalpies J Mol Biol 1989 207 433 444 14 Chalikian TV Volker J Plum GE Breslauer KJ A more unified picture for the thermodynamics of nucleic acid duplex melting a characterization by calorimetric and volumetric techniques Proc Natl Acad Sci U S A 1999 96 7853 7858 15 Ivanov VI Krilov DY Shchyolkina AK Chernov BK Minchenkov LE Decimal code controlling the B to A transition of DNA Journal of Biomolecular Structure and Dynamics 1995 12 102 108 16 Lisser S Margalit
9. arameters for Autocorrelation py Options h help i lt input file name gt REQUIRED o lt output file name gt REQUIRED x lt property file name gt REQUIRED a lt Geary Moran and or Moreau gt REQUIRED k lt 2 or 3 gt P j lt lambda parameter gt 4 3 Examples Interpretations Display a help screen The input file should be a valid FASTA format that consists of a single initial line beginning with a greater than symbol gt in the first column followed by lines of sequence data The words right after the gt symbol in the single initial line are optional and only used for the purpose of identification and description required The results could be found in the output file The program will overwrite the file if it has already existed Property file is a text file that contains the names of selected physicochemical properties Every line of this file contains the name of one physicochemical property Type of autocorrelation one or more may be entered separated by commas ex a geary moran moreau Moreau or moreau Normalized Moreau Broto autocorrelation Moran or moran Moran autocorrelation Geary or geary Geary autocorrelation Kind of oligonucleotide 2 Dinucleotide default 3 Trinucleotide List the text files including the physicochemical properties for which data is available for use in this program Nothing needs to be entered after p The lambda parameter in the
10. er JA Sugimoto N Caruthers MH Neilson T Turner DH Improved free energy parameters for predictions of RNA duplex stability Proc Natl Acad Sci U S A 1986 83 9373 9377 36 Munteanu MG Vlahovicek K Parthasarathy S Simon I Pongor S Rod models of DNA sequence dependent anisotropic elastic modelling of local bending phenomena Trends Biochem Sci 1998 23 341 347 37 Vlahovicek K Kajan L Pongor S DNA analysis servers plot it bend it model it and IS Nucleic Acids Res 2003 31 3686 3687 38 Goodsell DS Dickerson RE Bending and curvature calculations in B DNA Nucleic Acids Res 1994 22 5497 5503 39 Gromiha MM Ponnuswamy PK Hydrophobic distribution and spatial arrangement of amino acid residues in membrane proteins Int J Pept Protein Res 1996 48 452 460 40 Brukner I Sanchez R Suck D Pongor S Sequence dependent bending propensity of DNA as revealed by DNase I parameters for trinucleotides EMBO J 1995 14 1812 1818 41 Satchwell SC Drew HR Travers AA Sequence periodicities in chicken nucleosome core DNA J Mol Biol 1986 191 659 675 10
11. ference Properties Reference Properties Reference Bendability DNAse 36 Consensus_roll 37 39 MW Daltons 37 Bendability consensus 36 Consensus_Rigid 37 39 MW kg 37 Trinucleotide GC Content 37 Dnase I 40 Nucleosome 41 Nucleosome positioning 38 Dnase I Rigid 40 Nucleosome Rigid 41 7 Reference 1 Ornstein RL Rein R Breen DL Macelroy RD An optimized potential function for the calculation of nucleic acid interaction energies Biopolymers 1978 17 2341 2360 2 Olson WK Gorin AA Lu XJ Hock LM Zhurkin VB DNA sequence dependent deformability deduced from protein DNA crystal complexes Proc Natl Acad Sci U S A 1998 95 11163 11168 3 Gorin AA Zhurkin VB Olson WK B DNA twisting correlates with base pair morphology J Mol Biol 1995 247 34 48 4 Vlahovicek K Kajan L Pongor S DNA analysis servers plot it bend it model it and IS Nucleic Acids Res 2003 31 3686 3687 5 Ivanov VI Minchenkova LE Chernov BK McPhie P Ryu S Garges S Barber AM Zhurkin VB Adhya S CRP DNA complexes inducing the A like form in the binding sites with an extended central spacer J Mol Biol 1995 245 228 240 6 el Hassan MA Calladine CR Propeller twisting of base pairs and the conformational mobility of dinucleotide steps in DNA J Mol Biol 1996 259 95 103 7 Sugimoto N Nakano S Yoneyama M Honda K Improved thermodynamic parameters and helix initiation factor to predict stability of DNA duplexes Nucleic Acids
12. knc py and autocorrelations py The pseknc py is used for calculating the K tuple nucleotide compositions and pseudo k tuple nucleotide compositions The autocorrelations py is used for calculating Moreau Broto autocorrelation coefficient Moran autocorrelation coefficient and Geary autocorrelation coefficient To execute the PseKNC General in GUI navigate to the usr gui directory and then double click the PseKNC jar to execute the program 3 Input Output formats 3 1 Input format The input file should be a valid FASTA format that consists of a single initial line beginning with a greater than symbol gt in the first column followed by lines of sequence data The words right after the gt symbol in the single initial line are optional and only used for the purpose of identification and description required 3 2 Output format The output file formats support three choices that are suitable for downstream computational analyses such as machine learning The first and the default choice is the csv format In this format all data are separated by commas The second one is the libsvm s sparse data format For this format each line contains an instance and is ended by a n character like lt index1 gt lt valuel gt lt index2 gt lt value2 gt The pair lt index gt lt value gt gives a feature attribute value lt index gt is an integer starting from 1 and lt value gt is a rea
13. l number The third output format is the tab format This format is similar to the csv format The only difference is the separation characters between data are tabs 3 3 Physicochemical Properties Selection The Physicochemical Properties Selection file is a text file that contains a list of properties used for pseudo k tuple nucleotide composition and autocorrelation calculations For example if you are interested in Tilt and Shift of DNA dinucleotides the Physicochemical Properties Selection file should be written as follows Tilt Shift After saving this file as propNames txt and specifying it using the command x propNames txt the above two properties will be used in calculations A complete list of Physicochemical Properties for DNA and RNA are provided as an Appendix of this guide 4 Commands 4 1 Command line parameters for PseKNC py Options h help i lt input file name gt REQUIRED o lt output file name gt REQUIRED x lt property file name gt REQUIRED t lt l or 2 gt k lt 2 or 3 gt j lt lambda parameter gt w lt weight factor gt f lt tab or svm or csv gt Interpretations Display a help screen The input file should be a valid FASTA format that consists of a single initial line beginning with a greater than symbol gt in the first column followed by lines of sequence data The words right after the gt symbol in the single ini
14. r_dG 8 Major Groove Depth 24 Tilt_shift 29 Breslauer_dH 8 Major Groove Size 3 Tilt_slide 29 Breslauer_dS 8 Major Groove Distance 3 Tilt_rise 29 Electron_interaction 4 Minor Groove Width 24 Roll_shift 29 Hartman_trans_free_energy 13 Minor Groove Depth 24 Roll_slide 29 Helix Coil_transition 14 Minor Groove Size 3 Roll_rise 29 Ivanov_BA_transition 15 Minor Groove Distance 3 Slide stiffness 22 Lisser_BZ_transition 16 Persistance Length 25 Shift stiffness 22 Polar_interaction 17 Melting Temperature 26 Roll stiffness 22 Mobility to bend towards SantaLucia_dG 18 27 Rise stiffness 22 major groove Mobility to bend towards SantaLucia_dH 18 27 Tilt stiffness 22 minor groove SantaLucia_dS 18 Propeller Twist 3 Twist stiffness 22 Sarai_flexibility 19 Clash Strength 3 Wedge 30 Stability 20 Enthalpy 7 Direction 30 Stacking_energy 1 Free energy 28 Flexibility_slide 31 Sugimoto_dG 18 Twist_twist 29 Flexibility_shift 31 Sugimoto_dH 18 Tilt_tilt 29 Entropy 32 Sugimoto_dS 18 Roll_roll 29 Table A2 The physicochemical properties for RNA dinucleotides Properties Reference Properties Reference Properties Reference Shift 33 Tilt 33 Enthalpy 22 Hydrophilicity 34 Roll 33 Entropy 35 Slide 33 Twist 33 Free energy 35 Rise 33 Stacking energy 33 Table A3 The physicochemical properties for DNA tinucleotides Properties Re
15. tial line are optional and only used for the purpose of identification and description The results could be found in the output file The program will overwrite the file if it has already existed Property file is a text file that contains the names of selected physicochemical properties Every line of this file contains the name of a physicochemical property Type of PseK NC 1 Type 1 PseKNC default 2 Type 2 PseKNC Kind of oligonucleotide in PseKNC 2 Dinucleotide default 3 Trinucleotide List the text files including the physicochemical properties for which data is available for use in this program Nothing needs to be entered after p The lambda parameter in the PseKNC algorithm can be any integer that smaller than the length of query DNA sequence default 1 The weight parameter in the PseKNC algorithm can be a value between 0 1 default 1 If this argument is entered it will calculate the k tuple nucleotide composition of the query sequence Therefore the j w and x arguments are not required any more But k must be specified At this case k can be 1 2 or 6 and its default value is 2 The output format can be selected from followings 1 csv This format can be loaded into a spreadsheet program This is designated as the default format 2 svm The libS VM training data format 3 tab Simple format delimited by TAB If this option is omitted the csv format will be default 4 2 Command line p
16. ucleotide compositions The results not only can be shown on the screen but also can be saved into a file with 39 66 three optional formats namely tab svm or csv formats Nucleotide Composition of x FASTA File DFASTAD Browse Get Sequences Size of nucieotide 3 Characters consideredicsv AC T G SelectDesetect Au v HSBGPG Human gene for bone gta protein BGP HSGLTH1 Human theta T globin gene CSV format Cate Save e SVM format Tab Delimited format Figure 4 The interface of Ktuple Composition module in the GUI shell 6 Appendix Table A1 The physicochemical properties for DNA dinucleotides Properties Reference Properties Reference Properties Reference Base stacking 1 Sugimoto_dS 18 Roll_roll 29 Protein induced 2 Watson Crick_interaction 21 Twist_tilt 29 deformability B DNA twist 3 Twist 22 Twist_roll 29 Dinucleotide GC Content 4 Tilt 22 Tilt_roll 29 A philicity 5 Roll 22 Shift_shift 29 Propeller twist 6 Shift 22 Slide_slide 29 Duplex stability free 7 Slide 22 Rise_rise 29 energy Duplex tability disrupt 8 Rise 22 Shift_slide 29 energy DNA denaturation 9 Stacking energy 23 Shift_rise 29 Bending stiffness 10 Bend 24 Slide_rise 29 Protein DNA twist 2 Tip 24 Twist_shift 29 Stabilising energy of 11 Inclination 24 Twist_slide 29 Z DNA Aida_BA_transition 12 Major Groove Width 24 Twist_rise 29 Breslaue
Download Pdf Manuals
Related Search