User Guide : version 2.0
Contents
1. 2 67 44 GCATTGAATTGCTCTCTACCAAGC gt sequence 2 66 43 CATTGAATTGCTCTCTACCAAGCA gt sequence 2 50 27 ACCAAGCACATGATTATCCTCAGT 3 Checking the hybridization sites ithos_chk For each primer the program checks that there are no secondary hybridization sites elsewhere on the whole genome e g for a primer 5 T G A 3 the following hybridization sites must be checked G 5t G 3 n H P H A Aa genome O G Q A A Q Q A G G pap I w Detection of a secondary hybridization site is not based on the percentage of identity but on the calculation of the thermodynamic stability of the duplex cf filter auto complementarity A maximal deltaG is calculated on the whole primer length and a maximal deltaG in 3 is calculated on sizeDeltaGHybrid3 nucleotides A deltaG value is calculated on consecutive matches including putative mismatches 1 mismatch surrounded by 2 matchs A hybridization site is recognized if one of the two conditions is true e deltaG lt maxDeltaGHybrid e deltaG in 3 lt maxDeltaGHybrid3 For example sizeDeltaGHybrid3 Ss ae ies ae Fe are ae gt 5 ATGCCGGAAGCCATATCTATGCTACTQIG CT 3 primer 3 GCTCCGAGATACATGGAAGGAC 5 genome NAP NANT KANIN Gl G2 G3 deltaG max G1 G2 G3 and deltaG in 3 G3 The values for G1 G2 and G3 are the sum of the thermodynamic values between 2 consecutive nucleotide pairs The default values a2. 3 11 35 ACACGATGCGAGCAATCAAATTTCA ACACGATGCGAGCAATCAAATTTCA 3 TGTGCTTCGCTCGTTAGTTGAACTG 5 5 3 gt exemple 3 13 37 ACGATGCGAGCAATCAAATTTCAGG ACGATGCGAGCAATCAAATTTCAGG 3 TGCTTCGCTCGTTAGTTGAACTGGA 5 5 3 gt exemple 3 44 68 GGATAGAAATACACGAAGCGAGCAA GGATAGAAATACACGAAGCGAGCAA 3 5 LIH BESSE Z TCTATCTTTATGTGCTACGCTCGTT 5 gt exemple 3 49 73 GAAATACACGAAGCGAGCAATCAAC GAAATACACGAAGCGAGCAATCAAC 3 5 ETER 3 CTTTATGTGCTACGCTCGTTAGTTT 5 gt exemple 3 70 94 ACTTGACCTAGGTGAGGGATAGGAC ACTTGACCTAGGTGAGGGATAGGAC 3 TGAACTGGATCCACTCCCTATCCTG 5 5 3 seq primer genome seq primer genome seq primer genome seq primer genome seq primer genome seq primer genome start 48 start 54 start 56 start start start 72 end 72 end 78 end 80 end 25 end 30 end 96 dG max 29134 dG max 23644 dG max 20254 dG max 26614 dG max 27174 dG max 31714 dG 3 9654 dG 3 2054 dG 3 236 dG 3 10734 dG 3 8084 dG 3 9574 NB1 if the option n had been omitted the program would have generated an empty prime_ok file because all the primers would have had at least one hybridization site at their own position NB2 the same command must be carried out on the complementary strand of the
3. AATACACGAAGCGAGCAATCAACTTGACCTAGGTGAGGGATAGGACCAGA Primer design is launched by the command line ithos gen ex3 parameters primer This gives a file named primer This file contains for example the following primer list gt exemple 3 5 29 AGAAATACACGATGCGAGCAATCAA gt exemple 3 11 35 ACACGATGCGAGCAATCAAATTTCA gt exemple 3 13 37 ACGATGCGAGCAATCAAATTTCAGG gt exemple 3 44 68 GGATAGAAATACACGAAGCGAGCAA gt exemple 3 49 73 GAAATACACGAAGCGAGCAATCAAC gt exemple 3 59 83 AAGCGAGCAATCAACTTGACCTAGG gt exemple 3 64 88 AGCAATCAACTTGACCTAGGTGAGG gt exemple 3 70 94 ACTTGACCTAGGTGAGGGATAGGAC gt exemple 3 76 100 GACCTAGGTGAGGGATAGGACCAGA Checking of the hybridization sites is carried out by the command line ithos chk ex3 primer parameters primer ok primer hyb n This produces 3 output files primer_ok gt exemple 3 59 83 AAGCGAGCAATCAACTTGACCTAGG gt exemple 3 64 88 AGCAATCAACTTGACCTAGGTGAGG gt exemple 3 76 100 GACCTAGGTGAGGGATAGGACCAGA primer_hyb gt exemple 3 5 29 AGAAATACACGATGCGAGCAATCAA gt exemple 3 11 35 ACACGATGCGAGCAATCAAATTTCA gt exemple 3 13 37 ACGATGCGAGCAATCAAATTTCAGG gt exemple 3 44 68 GGATAGAAATACACGAAGCGAGCAA gt exemple 3 49 73 GAAATACACGAAGCGAGCAATCAAC gt exemple 3 70 94 ACTTGACCTAGGTGAGGGATAGGAC Primer_hyb info gt exemple 3 5 29 AGAAATACACGATGCGAGCAATCAA AGAAATACACGATGCGAGCAATCAA 3 TCTTTATGTGCTTCGCTCGTTAGTT 5 5 3 gt exemple
4. IThOS User Guide version 2 0 Nouri Ben Zakour Yves Le Loir Dominique Lavenier 1 Introduction IThOS is a software package dedicated to the design of primers The input is one or several genome sequences FASTA files and the output is a list of primer candidates that fulfill criteria set by the user IThOS also determines putative hybridization sites for these primers IThOS works in a two step procedure 1 Primer design 2 Verification of hybridization sites Each step relies on a dedicated program e Step 1 ithos gen lt genome gt lt parameters gt lt primers gt c e Step 2 ithos_ chk lt genome gt lt primers gt lt parameters gt lt pr out gt lt pr hyb gt n Both programs can be used separately A third program completes the package and enables the visualization of the primer features ithos viz lt primers gt lt parameters gt Parameters of the different programs are lt genome gt File containing one or several DNA sequences FASTA format lt parameters gt File specifying criteria for primer selection lt primers gt lt pr in gt lt pr out gt lt pr_hyb gt Files containing a primer list FASTA format Option enabling the search of primers on the complementary strand Option indicating that ithos chk is used after ithos gen the same genome seguence is given as an input and the output file lt primers gt of ithos gen is given as an input to ithos_chk without modification to make
5. genome 4 Visualization of the primers features ithos_viz This utility displays the primer features For each primer it gives e the GC percent e the melting temperature Tm e the maximal suite of identical nucleotides e the size of the biggest stem loop structure maximal deltaG for the complementary primer maximal deltaG in 3 for the complementary primer e Stability in 5 e Stability in 3 Software Execution The program is launched by the command line ithos viz lt primers gt lt parameters gt Results are displayed on monitor screen Input files lt primers gt isa text file FASTA format that contains a primers list lt parameters gt is a text file that contains parameters of the different filters Example 4 visualization of primer_ok file The execution of the following command line ithos_viz primer_ok parameters Displays on the monitor screen gt exemple 3 59 83 SGC Tm rep Hpin Cp dG Cp dG3 Sta 5 Sta 3 AAGCGAGCAATCAACTTGACCTAGG 48 58 2 3 210 1960 6690 4980 gt exemple 3 64 88 SGC Tm rep Hpin Cp dG Cp dG3 Sta 5 Sta 3 AGCAATCAACTTGACCTAGGTGAGG 48 58 2 3 1960 1960 5970 5870 gt exemple 3 76 100 SGC Tm rep Hpin Cp dG Cp dG3 Sta 5 Sta 3 GACCTAGGTGAGGGATAGGACCAGA 56 59 3 4 1960 1960 5860 5870 5 Parameters file This is a text file that enables modifying the default parameters of the filters The same file is read by the three programs Example IThOS PARAMETERS primers leng
6. ol maxDeltaGAuto3p 7kcal mol e sizeDeltaGAuto 6 e sizeDeltaGAuto3p 8 Filtre 6 thermodynamic stability at primer ends This filter calculates a deltaG on the 5 and 3 ends of the primers The size of the 5 end to be considered is given by sizeExt5 The size of the 3 end to be considered is given by sizeExt3 A primer is removed if The value in 5 is above deltaG5 e The value in 3 is out of the interval deltaG3Min deltaG3Max The default values are e sizeExt5 5 e sizeExt3 5 e deltaG5 4 kcal mol e deltaG3Min 6 kcal mol e deltaG3Max 4 kcal mol Software execution The software is launched by the command line ithos gen lt genome gt lt parameters gt lt primers gt c input files lt genome gt is a text file FASTA that contains a genome that can be cut into several sequences lt parameters gt is a text file that contains the parameters for the different filters output files lt primers gt isa text file FASPTA format that contains all the selected primers Coordinates of the selected primers are given as comments in between brackets e The software generates an additional file lt primers log gt that gives a few statistical data on the filtering process Option e c allows researching on the complementary strand of the genome Example 1 search for primers on the leading strand If a file containing the 2 following sequences is considered gt seq
7. phy A Unified View of Polymer Dumbbell and Oligonucleotide DNA Nearest Neighbor Thermodynamics John SantaLucia Proceedings of the National Academy of Sciences of the United States of America Vol 95 No 4 Feb 17 1998 pp 1460 1465 Filter 3 Number of repeats This filter removes oligonucleotides with N consecutive identical nucleotides or dinucleotides nbRepeat For example if noRepeat 4 the following primers will be removed 1 GGGATGGACACGGATTTTGGACCAGC 2 TTAGCTATATATAGGCAGGGATTAGG The first one presents a suit of 4 T The second one a suite of 4 TA The default value is e nbRepeat 5 Filter 4 Hairpin This filter removes oligonucleotides with hairpin loops that present the following features e stem size gt or to maxHpDup loop size gt or to MaxHpLoop TOTA cT E TGA A G TGGTACT m loop stem The default values are e maxHpDup 4 e maxHpLoop 4 Filter 5 self complementarity This filter checks that a primer will not hybridize with itself during PCR Thus primers that form a duplex with their complementary strand are removed Criteria for selection are as follow e For the full length of the pirmer the authorized deltaG value must not exceed maxDeltaGAuto e For the 3 end and a distance of sizeDeltaGAuto3 the authorized deltaG value must not exceed maxDeltaGAuto3 e The minimal size of a tested duplex is sizeDeltaGAuto The default values are maxDeltaGAuto 10kcal m
8. re maxDeltaGHybrid 16 kcal mol e maxDeltaGHybrid3 9 kcal mol e sizeDeltaGHybrid3 8 Software execution The software is launched by the following command line ithos chk lt genome gt lt primers gt lt parameters gt lt pr_out gt lt pr_hyb gt n Input files e lt genome gt is a text file FASTA format containing a genome sequence lt primers gt isa text file FASTA format containing a list of primers e lt parameters gt is a text file containing the parameters for the different filters Output file lt pr_out gt a text file containing all the primers that have no hybridization sites lt pr_hyb gt a text file containing all the primers that have at least one hybridization site e The program generate an additional file lt pr hyb info gt that indicates for each primer of the file lt pr_hyb gt the positions of hybridization on the genome as well as the deltaG values Option e n indicates that ithos chk is used after ithos gen the same genome is given as input file and the output file lt primers gt of ithos_gen is given as input for ithos chk without modification this way the own coordinates of the primers are not considered as secondary hybridization sites Example 3 Primer design on a genome and elimination of the primers that hybridize at other positions If the following genome is considered and memorized in a file named ex3 gt exemple 3 AAGATAGAAATACACGATGCGAGCAAT CAAATTTCAGGTAGAAAGGATAGA
9. sure that the real hybridization sites for the selected primers are not being considered as secondary hybridization sites 2 Design of the primers ithos_gen Starting from one or several DNA sequences the goal is to design primers that fulfill criteria set by the user The ithos_gen program considers all the words whose size is in an interval that corresponds to the minimum and maximum primer length For each word a suite of filters is applied All oligonucleotides passing successfully through the filters are proposed as primer candidates For each filter several parameters can be set by the user to refine the primer selection according to the application Six filters are implemented They are described in the following sections Filter 1 G C For a primer of size T filter 1 works as follows e Counts the number of G and C nucleotides GC e Calculates the percentage P 4 GC 100 T e Discard the primer if P lt pcGCMin or P gt pcGCMax The default values are e pcGCMin 40 pcGCMax 60 Filter 2 Tm Melting temperature The nearest neighbor method is used to calculate the primer Santa Lucia et al 1998 It also takes into account the concentration of nucleotides dnaConc and the concentration of salt saltConc This filter removes primers if e Tm lt oligoTmMin Tm gt oligo TmMax The default values are e oligoTmMin 57 C oligoTmMax 62 C e dnaConc 500 nM e saltConc 50 nM Bibliogra
10. th lengthMin 25 lengthMax 25 filter 1 GC percentage pcGCMin 40 pcGCMax 60 filter 2 tm oligoTmMin 57 oligoTmMax 67 dnaConc 500 saltConc 50 filter 3 hairpin maxHpDup 4 maxHpLoop 4 filter 4 repeat nbRepeat 6 filter 5 auto complementarity maxDeltaGAuto 10000 maxDeltaGAuto3 6000 sizeDeltaGAuto 8 sizeDeltaGAuto3 8 filter 6 internal stability to 3 amp 5 extremities sizeExt5 5 sizeExt3 5 deltaG5 4000 deltaG3min 6000 deltaG3max 3000 site hybridation only used by ithos chk sizeDeltaGHybria3 8 maxDeltaGHybrid3 12000 maxDeltaGHybrid 18000
11. uence 1 CGATTAAAGATAGAAATACACGATGCGAGCAATCAAATTTCA gt sequence 2 GAAACAACAAAACCTTCTACTGAAACAACTGAGGATAAT CATGTGCTTGGTAGAGAGCAATTCAATGCCC The software ithos_gen will produce the following file gt sequence 1 8 31 GATAGAAATACACGATGCGAGCAA gt sequence 1 10 33 TAGAAATACACGATGCGAGCAATC gt sequence 1 11 34 AGAAATACACGATGCGAGCAATCA gt sequence 1 12 35 GAAATACACGATGCGAGCAATCAA gt sequence 1 17 40 ACACGATGCGAGCAAT CAAATTTC gt sequence 1 18 41 CACGATGCGAGCAATCAAATTTCA gt sequence 2 27 50 ACTGAGGATAATCATGTGCTTGGT gt sequence 2 44 67 GCTTGGTAGAGAGCAATTCAATGC The numbers in brackets indicate the coordinates begin and end of the primer in the sequence Example 2 search for primers on the complementary strand option c The search for primers is done on the complementary strand of the genome sequence The software generates exactly the same type of file The only difference is that the primer coordinates are inverted Thus if we consider the previous example the program will generate gt sequence 1 35 12 TTGATTGCTCGCATCGTGTATTTC gt sequence 1 34 11 TGATTGCTCGCATCGTGTATTTCT gt sequence 1 33 10 GATTGCTCGCATCGTGTATTTCTA gt sequence 1 31 8 TTGCTCGCATCGTGTATTTCTATC gt sequence 1 30 7 TGCTCGCATCGTGTATTTCTATCT gt sequence 1 29 6 GCTCGCATCGTGTATTTCTATCTT gt sequence 2 69 46 GGGCATTGAATTGCTCTCTACCAA gt sequence 2 68 45 GGCATTGAATTGCTCTCTACCAAG gt sequence
Download Pdf Manuals
Related Search