Home

MiSeq System User Guide - sb

1. Part 15027617 Rev H Loading Sample Libraries onto Cartridge i NOTE If required for your library type denature and dilute libraries and add optional PhiX v3 control See Preparing DNA Libraries for Sequencing on the MiSeq Part 15039740 This step does not apply to all library types Some Illumina sample preparation methods result in a ready to use normalized concentration of pooled libraries Refer to the sample preparation guide for the kit used to prepare sample libraries NOTE If you are using custom primers prepare primers and set up the sample sheet as described in Using Custom Primers on the MiSeg Part 15041638 When the reagent cartridge is fully thawed and ready for use you are ready to load prepared libraries onto the cartridge 1 Use a clean 1 ml pipette tip to pierce the foil seal over the reservoir labeled Load Samples 1 NOTE Do not pierce any other reagent positions Other reagent positions are pierced automatically during the seguencing run 2 Pipette 600 ul of prepared libraries into the Load Samples reservoir Avoid touching the foil seal as you dispense the sample Figure 31 Load Libraries Proceed directly to the run setup steps using the MiSeq Control Software MCS interface MiSeq System User Guide 6 obpuven ouo soeuejgr sjdwes Bulpeo7 Setting Up a Run Using MCS 1 Optional From the Run Options screen check the folder locations for recipes sample sheets manifests an
2. 1 NOTE Illumina recommends repeating the standby wash every 30 days that the instrument remains idle User Supplied Consumables Tween 20 Sigma Aldrich catalog P7949 Laboratory grade water Procedure 1 Make sure that a used flow cell is loaded on the instrument 2 From the Welcome screen select Perform Wash 3 From the Wash Options screen select Standby Wash The software automatically raises the sippers in the reagent chiller Perform First Wash 1 Prepare fresh wash solution with Tween 20 and laboratory grade water as follows a Add 5 ml 100 Tween 20 to 45 ml laboratory grade water This results in 10 Tween 20 b Add 25 ml 10 Tween 20 to 475 ml laboratory grade water This results in a 0 5 Tween 20 wash solution c Invert several times to mix 2 Prepare the wash components with fresh wash solution as follows a Add 6 ml wash solution to each reservoir of the wash tray o 6 Part 15027617 Rev H b Add 350 ml wash solution to the 500 ml wash bottle 3 Load the wash tray and wash bottle onto the instrument a Open the reagent compartment door and reagent chiller door and remove the used reagent cartridge or wash tray from the previous run The reagent cartridge should slide easily from the chiller b Slide the wash tray into the reagent chiller until it stops Close the reagent chiller door c Raise the sipper handle in front of the PR2 bottle and waste bottle until it locks into place and replace the PR2 bottl
3. MISeg Control Software Please load the flow cell SU89J99 dnjas uny Flow Cell Barcode FC1234567 ABCDE When the flow cell is loaded the software reads and records the RFID A confirmation that the RFID was successfully read appears in the lower right corner of the screen In the event that the RFID cannot be read you can obtain a temporary bypass code from Humina that enables you to proceed with the run setup steps For more information see Resolving RFID Read Failure on page 95 Select the help icon in the upper right corner of the screen The help file contains a video that illustrates the steps for loading the flow cell Load Reagents Screen The Load Reagents screen has two steps first load the PR2 bottle and empty waste bottle and then load the reagent cartridge When the PR bottle and reagent cartridge are loaded the software reads and records the RFID A confirmation that the RFID was successfully read appears in the lower right corner of the screen MiSeq System User Guide 3 9 MiSeq Software Figure 18 Load PR2 Bottle and Waste Bottle MiSeq Control Software Please load the PR2 and waste bottles PR2 Bottle ID PR1234567 ABCDE a ds LTD Flow Coll Barcode FC1234567 ABCDE LAAT kag na AA Pa s Y Waste Bottle Empty w 44 Back m LA 00000 40 2500 Figure 19 Load Reagent Cartridge MiSeq Control Software Load Flow Load Cell Reagents Please load the reagent cartridge 5 Y Reagent ca
4. Reagent Kit Sizes Reagent kit size is measured by the number of cycles that can be performed with one kit Possible sizes are 500 cycles 300 cycles and 50 cycles Kit Size 500 Cy cle Kit 300 Cy cle Kit 50 Cycle Kit 10 Number of Cycles Provides reagents for up to 525 cycles of sequencing which is sufficient for up to a 251 cycle paired end run plus two eight cycle index reads Provides reagents for up to 325 cycles of sequencing which is sufficient for up to a 151 cycle paired end run plus two eight cycle index reads Provides reagents for up to 75 cycles of sequencing which is sufficient for up to a 26 cycle paired end run plus two eight cycle index reads Part 15027617 Rev H MiSeq Reagent Kit v2 Consumable Catalog MiSeq Reagent Kit v2 500 Cycles Catalog MS 102 2003 MiSeq Reagent Kit v2 300 Cycles Catalog MS 102 2002 TG MiSeq Reagent Kit v2 300 Cycles Catalog TG 142 1003 MiSeq Reagent Kit v2 50 Cycles Catalog MS 102 2001 MiSeq Reagent Micro Kit v2 Consumable Catalog MiSeq Reagent Micro Kit v2 300 Cycles Catalog MS 103 1002 TG MiSeq Reagent Micro Kit v2 300 Cycles Catalog TG 142 1002 MiSeq Reagent Nano Kit v2 Consumable Catalog MiSeq Reagent Nano Kit v2 500 Cycles Catalog MS 103 1003 MiSeq Reagent Nano Kit v2 300 Cycles Catalog MS 103 1001 TG MiSeq Reagent Nano Kit v2 300 Cycles Catalog TG 142 1001 MiSeg System User Guide syy Juabesy basin Getting Started Kit Cont
5. Upload Files Available for sample sheets manifests genomes and recipes If the MiSeq is not connected to a network use this feature to upload files to the instrument computer from a USB drive Select Upload and browse to the location on a USB drive where the file resides The file is uploaded to the folder indicated in the Directory field Rename Available only for sample sheets Select the checkbox next to the sample sheet file and then select Rename Use the on screen keyboard to rename the sample sheet MiSeq System User Guide 2 9 U9SI9S SA Y 9BEUEWN Run Options Screen The Run Options screen has three tabs for specifying the default settings for a run Run Settings Folder Settings and Email Notifications Figure 9 Run Settings Tab on Run Options Screen Mumina MiSeg Please make any needed changes to the Run Options MiSeq Software Run Settings older Settings Email Notifications Post Run Wash Option O Post Run Wash O Maintenance Wash Send Instrument health information to Illumina to ald technical support Ea When using BaseSpace replicate analysis locally on MiSeq di Save and Cancel Return 00000 Run Settings Tab Post Run Wash Option An instrument wash is required after each run You must perform a wash before the software will proceed to the run setup steps for a subsequent run You can specify which type of wash is performed by default A post run wash takes about 20 minutes and a mainten
6. 20 to 475 ml laboratory grade water This results in a 0 5 Tween 20 wash solution Invert several times to mix 2 When the first wash is complete remove the wash tray and wash bottle and discard the remaining wash solution 3 Refill the wash components with fresh wash solution as follows a b Add 6 ml wash solution to each reservoir of the wash tray Add 350 ml wash solution to the 500 ml wash bottle 4 Load the freshly filled wash tray and wash bottle as follows a b Slide the wash tray into the reagent chiller until it stops Close the reagent chiller door Load the wash bottle and slowly lower the sipper handle making sure that the sippers lower into the wash bottle and waste bottle Part 15027617 Rev H c Close the reagent compartment door 9 Select Next The second wash begins Perform Final Wash 1 Prepare fresh wash solution with Tween 20 and laboratory grade water as follows a Add 5 ml 100 Tween 20 to 45 ml laboratory grade water This results in 10 Tween 20 b Add 25 ml 10 Tween 20 to 475 ml laboratory grade water This results in a 0 5 Tween 20 wash solution c Invert several times to mix 2 When the second wash is complete remove the wash tray and wash bottle and discard the remaining wash solution 3 Refill the wash components with fresh wash solution as follows a Add 6 ml wash solution to each reservoir of the wash tray b Add 350 ml wash solution to the 500 ml wash bottle 4 Lo
7. BaseCalls L001 CX X Data Intensities BaseCalls L001 CX X Data Intensities BaseCalls Data RTALogs Data Intensities L001 CX X Data Intensities BaseCalls L001 Thumbnail Images LOO1XCX X Description A marker file generated when base call analysis is complete The presence of this file triggers the start of secondary analysis This file is read and copied to the run folder before the run and later used for secondary analysis Identifies the boundaries of the reads including index reads and the quality table selected for run Each bcl file contains RTA base calling and base quality scoring results for one cycle one tile stats files contain RTA base calling statistics for a given cy cle tile filter files contain filter results per tile Log files from primary analysis Each binary cif file contains RTA image analysis results for one cycle one tile For more information see Flow Cell Tile Numbering on page 51 Reports the cluster coordinates There is one locs file for each tile Thumbnail images generated for each cycle and base and can be used to troubleshoot a run These files are not required for secondary analysis and are not copied to the Analysis folder Part 15027617 Rev H Flow Cell Tile Numbering When the tiles are imaged during the seguencing run one output file is generated for each tile and named with the tile number in a four digit format The sta
8. Check Screen The System Check screen is typically used by an Illumina Technical Support representative during a Live Help session Use of this feature is not required during normal operation or for instrument maintenance Some system checks can be performed prior to contacting Ilumina Technical Support such as the Volume Test A volume test checks the health of the fluidics system by estimating the flow volume as bubbles pass by the sensors This test is followed by a line wash For more information see Performing a Volume Test on page 98 Upon completion of a system check the test results appear on the screen Select Show Details to see a summary of the results on the software interface Select Export Results to export the results in a csv file format to a USB drive 3 6 Part 15027617 Rev H Figure 15 System Check Options Mumina MiSeq Please select the system check options to perform Select All Motion System Optics Other m Y Stage Test LED Power Test a Prime Reagent Lines a M3 Mirror Test C Tip TM Test C Conduct Volume Test E Z Stage Tesi C Autofocus Test C Thermal Ramp Test C Full Oplics Test ma Z Manual Update Screen Use the Manual Update feature to update instrument control software and analysis software from the MiSeq interface by browsing to the location of the installable software file Select Browse to browse to the location where the installable file for the new software version is located Whe
9. For example a paired end 150 cycle run performs two 151 cycle reads 2 x 151 for a total of 302 cycles At the end of the run 2 x 150 cycles are analyzed In this guide read lengths are listed as the number of cycles performed including the final cycle Part 15027617 Rev H Regulred Disk Space The integrated instrument computer has approximately 550 GB of storage capacity Before starting a run the software checks available disk space If there is not enough disk space for the run a software prompt appears The message indicates how much disk space is required for the run and how much disk space must be cleared before the run can proceed If prompted to make disk space available go to the Welcome screen and select Manage Files From the Manage Files screen select the Runs tab Move or delete older run folders as appropriate For more information see Manage Files Screen on page 28 After clearing adequate disk space select Restart Check MiSeq System User Guide 5 3 90eds ysiq poJinbeH MiSeq Software Pausing or Stopping a Run The MiSeq is designed to complete a run from beginning to end without user intervention However it is possible to pause a run or stop a run from the Sequencing screen Pausing a Run You can temporarily pause a run before it has completed using the Pause button on the Sequencing screen You might pause a run if you suspect that the waste bottle is full or to check the volume in the PR2 bottle
10. You can resume a paused run 1 CAUTION Do not pause a run during cluster generation or within the first five cycles of seguencing Runs paused prior to cycle six cannot be resumed When you select Pause the current command is completed after which the run is paused and the flow cell is placed in a safe state To pause a run from the Seguencing screen select Pause The button changes to Resume At this point you can empty the waste bottle for example When you are ready to resume the run select Resume Figure 24 Seguence Screen of a Paused Run Mumina MiSeg Workflow Resequencing 151 151 BaseSpace User None sop 2 ot Pr ed yen a302 Intensity Q Score All Cycles Flow Cell A RG1234567 00CDE 2X101PE PhIX v2 6pM 1 080 0 60 0 40 0 20 Values Update After Cycle 5 Resume Cluster Density Kmm2 Clusters Passing Filter Estimated Yield MB a JS a 00000 O Score 5 A Part 15027617 Rev H Stopping a Run You can stop a run during seguencing before the run has completed using the Stop button on the Sequencing screen You might stop a run if the run was set up incorrectly if the data quality is bad or if you experience a hardware error When a run is stopped the current command is not completed and the flow cell stage moves to the forward position Primary analysis will continue for the last completed cycle Figure 25 Stopping a Run Te Confirm Stopping a run is final You can not res
11. an alcohol wipe or a lint free tissue moistened with ethanol or isopropanol Carefully wipe the surface of the flow cell stage until it is clean and dry Hold the flow cell by the edges of the flow cell cartridge near the Illumina label Make sure the label is facing upward and place the flow cell on the flow cell stage Figure 37 Place Flow Cell on Stage Gently press down on the flow cell latch to close it over the flow cell MiSeq System User Guide Va 2D mo 4 ay buipeo Performing a Run 2 km NOTE L As the flow cell latch is closed two alignment pins near the hinge of the flow cell latch properly align and position the flow cell An audible click indicates the flow cell latch is secure Figure 38 Close Flow Cell Latch Check the lower left corner of the screen to confirm that the flow cell RFID was successfully read Y NOTE L If the RFID is not read by the system the software prompts you through the steps to obtain a temporary bypass code and proceed with setting up the run For more information see Resolving RFID Read Failure on page 95 Close the flow cell compartment door Select Next on the Load Flow Cell screen The Load Reagents screen opens Part 15027617 Rev H Loading Reagents There are two steps to loading reagents First load the PR2 bottle and make sure that the waste bottle is empty and then load the reagent cartridge Load PR2 and Check the Waste Bottle 1 Remove the bottle of P
12. and then automatically deleted when RTA analysis is complete MiSeq Reporter MiSeg Reporter is the secondary analysis software on the MiSeg that processes base calls generated during primary analysis and produces information about alignment variants and contig assemblies for each genome requested and each sample based on the analysis workflow specified in the sample sheet For more information see MiSeg Reporter Overview on page 57 2 Part 15027617 Rev H MiSeg Concepts The following concepts and terms are common to the run setup steps on the MiSeq Concept Analysis Workflow Manifest Reference Genome Run Folder Sample Sheet Description A secondary analysis procedure performed by MiSeg Reporter The analysis workflow for each run is specified in the sample sheet The file that specifies a reference genome and targeted reference regions to be used in the alignment step For workflows that require a manifest the manifest file is specified in the sample sheet and copied to the manifest folder designated in MCS A FASTA format file that contains the genome sequences used during analysis For most analysis workflows the reference genome file is specified in the sample sheet The folder structure populated by RTA primary analysis software MiSeqOutput folder or the folder populated by MiSeq Reporter MiSegAnalysis For more information see Run Folders on page 48 A comma separated values file csv tha
13. begins secondary analysis immediately after the completion of primary analysis of the sequencing run MiSeq Reporter runs on the instrument computer However the software interface must be viewed through a web browser on another computer that is connected to the same network as the MiSeq Reporter When secondary analysis is complete a file named CompletedJobInfo xml is written to the run folder For more information see the MiSeg Reporter User Guide Part 15028784 MiSeq System User Guide 5 VA suolido sis ieuy JepuoDeg MiSeq Software 55 Sequencing During Analysis If a new sequencing run is started on the MiSeq before secondary analysis of an earlier run is complete secondary analysis is stopped automatically MiSeq computing resources are dedicated to either sequencing or analysis and the system is designed in such a way that the sequencing run setup command overrides the analysis command To restart secondary analysis use the Requeue feature on the MiSeq Reporter interface after the new sequencing run is complete At that point secondary analysis starts from the beginning Part 15027617 Rev H Live Help The MiSeg must be connected to a network with internet access to enable Live Help The Live Help feature is an online assistance tool that enables a representative from Illumina Technical Support to view the MiSeg screen with your permission and share control of the instrument You have overriding control and can e
14. cell clamp 6 flow cell compartment 5 6 flow cell door sensor 23 flow rate troubleshooting 97 fluidics troubleshooting 97 98 washing 83 86 folder locations default settings 30 for current run 42 G genome references 28 H help Live Help 59 help technical 107 103 Index 104 icons activity indicators 23 errors and warnings 23 sensors 23 status alert 23 idling the instrument 86 initialization 94 instrument setup 34 intensities 45 InterOp folder 49 IP address 35 L Live Help 59 loading flow cell 38 loading reagents 39 cartridge 74 PR2 73 M maintenance wash 26 83 manifest file copying to instrument 28 definition 21 micro flow cell 14 MiSeg Reporter 2 credentials 35 overview 57 MiSeq Self Service 95 monitoring the run 45 77 moving files and folders 28 N nano flow cell 14 network connection 94 network settings 35 O optics module 5 L password 18 password changing 35 pausing a run 54 post run wash 81 E switch 18 R2 loading 73 Q O scores 45 R read length 52 reagent cartridge 8 reagent cartridge contents 13 reagent chiller temperature 23 reagent compartment 5 8 reagents itted 10 loading 39 73 Real Time Analysis 2 results 50 run folder 48 template generation 46 rebooting software 34 recipes managing 28 reference genome file format 21 RFID flow cell 71 PR 73 oa cartridge 74 tracking 2 troubleshooting 95 RTAcomplete txt 50 run duration 52
15. conditions during run setup or during the run MiSeq System User Guide 2 3 MiSeq Software Status Icon Status Name Description Status OK No change System is normal Attention Information that might require attention Warning Warnings do not stop a run but might require action before proceeding Error Errors usually stop a run and generally require action before proceeding with the run When a change in condition occurs the icon changes to the associated image and blinks to alert you If this happens select the icon to open the status window which contains a general description of the condition Select any item listed to see a detailed description of the condition and instructions to resolve the condition if applicable Select Acknowledge to accept the message and Close to close the dialog box You can filter the types of messages that appear in the status window by selecting the icons along the top margin of the window Selecting an icon toggles the condition to show or hide Software Updates If your system is connected to a network with internet access you can automatically update the instrument software from the Welcome screen When software updates are available the Update Available button appears on the Welcome screen Otherwise this button is not visible Part 15027617 Rev H Figure 6 Update Available Button on Welcome Screen Mumina MiSeg Welcome to lllumina MiSeq AR A OCASO TATEA TANGAT ACT TGATO A
16. indexing reagents Integrated radio frequency identification RFID tracking enables accurate consumable tracking Interface Controls The MiSeq Control Software MCS interface provides controls to configure the instrument set up and monitor runs and perform maintenance procedures Convenient Flow Cell Loading A clamping mechanism auto positions the flow cell as it is loaded onto the instrument Integrated radio frequency identification RFID tracking enables accurate consumable tracking Innovative Fluidics Architecture The MiSeg fluidics system enables unmatched efficiency in chemistry cycle time during sequencing Real Time Analysis RTA Integrated primary analysis software performs real time on instrument data analysis during the sequencing run which includes image analysis and base calling and saves valuable downstream analysis time MiSeq Reporter Integrated secondary analysis software processes data from primary analysis to perform alignment and provide information about each sample analyzed Additional Resources The following documentation is available for download from the Illumina website Part 15027617 Rev H Resource MiSeq System Site Prep Guide MiSeq System Safety and Compliance Guide MiSeq Workflow Quick Reference Cards Ilumina Experiment Manager User Guide MiSeq Sample Sheet Quick Reference Guide MiSeq Reagent Prep Guide Preparing DNA Libraries for Sequencing on the MiSeq Using Custom P
17. instructions and expected cluster density of prepared PhiX control to 1000 1200 K mm e Noted that the procedure for denaturing and diluting libraries Preparing Your Libraries does not apply to Nextera XT libraries as well as TruSeq Amplicon libraries e Changed upgrade name from MiSeq Expansion Pack to MiSeg hardware upgrade e Add the MiSeg Reporter User Guide to Additional Resources list IV Part 15027617 Rev H Part 7 Revision 15027617 D MiSeq System User Guide Description of Change Updated software descriptions to MCS v2 0 Added the following new information e Added a section titled What s New in MCS to describe new software features interface changes and workflow changes e Added catalog number and description of the MiSeq Reagent Kit v2 500 Cycles e Added Version Compatibility and Requirements section e Added description of MiSeq Expansion Pack which is required for 14 tile dual surface flow cell imaging e Added description of dual surface flow cell tile numbering e Added the PCR Amplicon analysis workflow for Nextera XT libraries e Added the use of 10 Tween 20 in wash procedures and expected wash volumes e Added the reagent cartridge version to the RFID read failure procedure Updated the following information e Changed reagent acronyms for IMF CMF and AMX to v2 reagent names IMS CMS and AMS respectively e Changed the PhiX concentration from 8 pM to 12 5 pM e Changed the maximum recomm
18. run folder definition 21 run folders contents 48 managing 28 naming 48 primary analysis files 50 temp output analysis 48 run options 30 run setup screens 38 RunInfo xml 49 50 runParameters xml 49 Part 15027617 Rev H S V XapUu dae N sheet version compatibility 15 changing 41 volume test 98 copying to instrument 28 definition 21 W in run folder 50 wash volumes 101 not found 94 washes secondary analysis 57 Bon at BO sensor indicators 23 seguencing 63 Seguencing Analysis Viewer 47 77 sequencing screen 45 77 shutting down the instrument 34 89 sipper handle 8 software disk space checking 53 initialization 18 instrument setup 34 on instrument 20 run duration 52 updating 24 37 standby wash 26 86 status alerticon 23 status xml 50 stopping a run 55 system account name 35 system settings 35 T technical assistance 107 template generation 46 47 tile numbering 51 troubleshooting flow rate 9 fluidics 98 RFID 95 run specific files for 92 run setup errors 94 turning on the instrument 18 U updating software 24 37 user supplied consumables 16 user name 18 expected volumes 101 maintenance 26 83 post run 81 post run wash settings 30 prepare to idle 86 prepare to shut down 89 standby 26 86 waste bottle 8 welcome screen 22 Windows minimize to 34 workflow 63 run duration 52 MiSeg System User Guide 1 O T Index 106 Part 15027617 Rev H Technical Assistance For tec
19. s FAILURE TO COMPLETELY READ AND EXPLICITLY FOLLOW ALL OF THE INSTRUCTIONS CONTAINED HEREIN MAY RESULT IN DAMAGE TO THE PRODUCT S INJURY TO PERSONS INCLUDING TO USERS OR OTHERS AND DAMAGE TO OTHER PROPERTY ILLUMINA DOES NOT ASSUME ANY LIABILITY ARISING OUT OF THE IMPROPER USE OF THE PRODUCT S DESCRIBED HEREIN INCLUDING PARTS THEREOF OR SOFTWARE OR ANY USE OF SUCH PRODUCT S OUTSIDE THE SCOPE OF THE EXPRESS WRITTEN LICENSES OR PERMISSIONS GRANTED BY ILLUMINA IN CONNECTION WITH CUSTOMER S ACQUISITION OF SUCH PRODUCT S FOR RESEARCH USE ONLY 2011 2013 Illumina Inc All rights reserved Illumina IlluminaDx BaseSpace BeadArray Bead Xpress cBot CSPro DASL DesignStudio Eco GAIIx Genetic Energy Genome Analyzer GenomeStudio GoldenGate HiScan HiSeq Infinium iSelect MiSeq Nextera NuPCR SeqMonitor Solexa TruSeq TruSight VeraCode the pumpkin orange color and the Genetic Energy streaming bases design are trademarks or registered trademarks of Illumina Inc All other brands and names contained herein are the property of their respective owners This software contains the SeqAn Library which is licensed to Illumina and distributed under the following license Copyright 2010 Knut Reinert FU Berlin All rights reserved Redistribution and use in source and binary forms with or without modification are permitted provided that the following conditions are met 1 Redistributions of source code must retain the above c
20. the run and lists the sample sheet name and parameters provided in the sample sheet MiSeq System User Guide 41 MiSeq Software Figure 20 Review Screen Mumina MiSeg Please review the run setup Experiment Name 2X151PE PhiX v2 6pM Sample Sheet Name Default csv Analysis Workflow Resequencing Chemistry Default Read 1 Read 2 151 151 BaseSpace User None Read Length Change Folders 00000 Change Folders In the lower left corner of the Review screen the current folder locations for recipes sample sheets manifests and output folders are listed To change folder locations select Change Folders and browse to a preferred location Using this option from the Review screen changes folder locations for the current run only Sample Sheet Not Found If a sample sheet was not specified from the Load Reagents screen and the software cannot locate a sample sheet named with the barcode number of the reagent cartridge loaded for the run a screen appears for browsing to the sample sheet associated with the run After browsing to the sample sheet select Restart Check A 2 Part 15027617 Rev H Figure 21 Sample Sheet Not Found Mumina Miseq Base Space Load Flow Load pagan Options Cell Reagents The RG1234567 CDE csv file was not found In the target folder Please select the sample sheet folder and file to be used for this run Sample Sheet File RG1234567 CDE Pre Run Check Screen The software automaticall
21. the screen to confirm that the RFID of the reagent cartridge was read successfully V y NOTE NY If the RFID is not read by the system the software prompts you through the steps to obtain a temporary bypass code and proceed with setting up the run For more information see Resolving RFID Read Failure on page 95 If the reagent cartridge is not compatible with the flow cell a message appears Select Back to load a compatible cartridge or select Exit to return to the Welcome screen 9 Close the reagent compartment door 6 Select Next on the Load Reagents screen The Review screen opens MiSeg System User Guide 7 5 sjuoDeoH Buipeor Starting the Run After loading the flow cell and reagents review the run parameters and perform a pre run check before starting the run Review Run Parameters 1 Review Experiment Name Analysis Workflow and Read Length These parameters are specified in the sample sheet Performing a Run 2 Review the folder locations in the lower left corner If any changes are needed select Change Folders When the changes are complete select Save and then select Next 3 Select Next The Pre Run Check screen opens Review Pre Run Check The system performs a check of all run components disk space and network connections before starting the run If any items do not pass the pre run check a message appears on the screen with instructions on how to correct the error For more information see Resolvin
22. you to review metrics during a run as metrics are generated and later after a run has completed You must install SAV onto a computer independent of the MiSeq with access to the same network connected to the instrument After launching the software you can browse to the output folder for your run After cycle four following template generation SAV provides metrics generated by RTA and organizes the metrics into plots graphs and tables 1 NOTE SAV is universal to Illumina seguencers most of which use an eight lane flow cell Some views include drop down lists showing lanes 1 8 The MiSeq flow cell is a single lane flow cell so your data appears when you select All or Lane 1 For more information see the Sequencing Analysis Viewer User Guide Part 15020619 MiSeq System User Guide 4 ueeJog Bulousnbes MiSeq Software Run Folders Each run on the MiSeq generates three run folders each with a specific purpose DIlluminalMMiSeqTemp When the run begins a temporary run folder is written to the local drive of the instrument computer and used as a working area for MCS and RTA There is no need to access the Temp folder Contents of this folder are deleted after seven days DAIlluminaMiSe gOutput RTA copies files from the Temp folder to the Output folder As primary analysis files are generated RTA copies files back to the Temp folder and populates the Analysis folder Focus images and thumbnail images are not copied to th
23. 27617 Rev H Files The files that are copied to the output and analysis folders include the following SampleSheet csv Provides parameters for the run and subseguent analysis At the start of the run the sample sheet is copied to the root folder and renamed SampleSheet csv Additional copies are located in Data Intensities and Data Intensities BaseCalls runParameters xml Contains a summary of run parameters and information about run components such as the RFID of the flow cell and reagents associated with the run SJ9P O0 UNH Runlnfo xml Contains high level run information such as the number of reads and cycles in the sequencing run and whether or not a read is indexed Folders The folders that are copied to the output and analysis folders include the following folders generated during the sequencing run lt Run folder name gt Config Contains configuration files for the run lt Run folder name gt Data Contains subfolders Intensities BaseCalls and Alignment Data generated from MiSeg Reporter are located in the Alignment subfolder lt Run folder name gt Data RTA Logs Contains log files that describe each step performed by RTA for each Read lt Run folder name gt Data Intensities BaseCalls Contains subfolders with base call bcl files matrix files and phasing files MiSeq Reporter writes FASTO files to this folder during secondary analysis For more information see the MiSeg Reporter User Guide
24. 8 Manage Files Screen MiSeg Control Software Runs Sample Sheets Manage Files 2 Manifests Genomes Recipes Directory D lllumina MiSeq Control SoftwarelSampleSheet Browse SamplesheetName O Detaun O Sample5heetAmphcon O SempleSheelDenovo O Sampleshect brary OC O SampleSheetReseq Manage Files Options ExpenmentName 2X101PE PMX v2 6PM EnterExperimental Details Here EnterExpenmental Details Here Enterkxpenmental Details Here EnterExperimental Details Here 40 Worktiow Resequencing Amplic on DenovoAssembly LibraryOC Resequencing 3 From any tab on the Manage Files screen select Browse to view files located in folders other than those currently selected Tab Runs Sample Sheets Manifests Genomes Recipes 20 Features Delete or Move Delete Upload or Rename Delete or Upload Delete or Upload Delete or Upload Part 15027617 Rev H Delete Select the checkbox next to the file or folder listed and then select Delete The Delete feature is available on all tabs Move Available only for run folders Select the checkbox next to the folder name select Move and then browse to an appropriate location Move will copy the run folder to the new location and then delete the folder from the old location Select All Files Select the checkbox to the left of the Delete button and then select an action Delete or Move The action is applied to all files or folders
25. AAGATTACTTGATCCACTGATTCAACGTACCGTAAAGATTACTTGATCCACTGATTCAACGTACCGTAACGAACGTATCAATTGAGACTAAATATTAACGTACCATTAAGAGCTACC GATAACAGTAACACACTTCTGT TAACCTTAAGATTACTTGATCCACTGATTCAACGTACCGTAACGAACGTATCAATTGAGACTAAATATTAACGTACCATTAAGAGCTACCGTGCAACGACGAAAAGAATGATAACAGTAACACA SIS ACCATTAAGAGCTACCGTGCAACAGTAACACACTTCTGTTAACCTTAAGATTACTTGATCCACTGATTCAACGTACCGTAACGAACGTATCAATTGAGACTAAATAT TAACGTACCAT TAAGAGCTACCGT GCAACGACGAAAAGAAT GAT GATAACAGTAACACACTTCTGTTAACCT TAAGAT TACT TGATCCACT GATT CAACGTACCGTAACGAACGTAT CAAT T GAGACTAAATAT TAACGTACCAT TAAGAGCTACCGTCTTCTGT TI Spee Tle TIACTTGATCCACTGATICAACC GTACCGTAACGAACGTATCATTAAGATTACTTGATCCACTGATTCAACGTACCGTAACGAACGTATCAATTGAGACTAAATAT TAACGTACCAT TAAGAGCTACCGT GCAACGACGAAAAGAAT GATAACAGTAACACACTTCTGT TAACCT Ti JH as y A STO VN AL GAAAAGAATGATAACAGTAACACACTTCTGTTAACCTTAAGATTACTTGATCCACTGATTCAACGTACCGTAAAGATTACTTGATCCACTGATTCAACGTACCGTAACGAACGTATCAATTGAGACTAAATATTAACGTACCAT TAAGAGCTACC GATAACAGTAACACACTTCTGT TAACCTTAAGATTACTTGATCCACTGATTCAACGTACCGTAACGAACGTATCAATTGAGACTAAATAT TAACGTACCATTAAGAGCTACCGTCTTCTGTTAACCTTAAGATTACTTGATCCACTGATTCAAC GTACCGTAACGAACGTATCATTAAGATTACTTGATCCACTGATTCAACGTACCGTAACGAACGTATCAATTGAGACTAAATAT TAACGTACCATTAAGAGCTACCGTGCAACGACGAAAAGAATGATAACAGTAACACACTTCTGTTAACCTT GAAAAGAATGATAACAGTAACACACTTCTGTTAACCTTAAGATTACTTGATCCACTGATTCAACGTACCGTAAAGATTACTTGATCCACTGATTCAACGTACCGTAACGAACGTATCAATTGAGACTAAATAT TAACGTACCAT TAAGAGCTACC ACCAT TAAGAGCTACCGTGCAACAGTAACACACTTCTGTTAACCTTAAGAT TACT T GAT CCACTGAT TCAA
26. AAT CA GACTAAAT T TAAC TACCATTAA GAGCIACCGTCITOTGTTAA CC AA GATACI TGATOCACTGAT TGAA I T TGAGAC TAAATAT TAACGT TGT TAACCTTAAGATTACTTGATCCACTGATTCAACGTACCGTAACGAACGTATCAATTGAGACTAAATAT TAACGTACCATTAAGAGCTTCTGT TAACCTTAAGATTACTTGATCCACTGATTCAACGTACCGTA TATCAATTGAGACTAAATAT TAACGTACTTAACCTTAAGATTACTTGATCCACTGATTCAACGTACCGTAACGAACGTCTTCTGTTAACCTTAAGATTACTTGATCCACTGATTCAACGTACCG A AB ANA GACTAAATAT TAACGTACCATTAAGAGCTACAACCTTAAGATTACTTGATCCACTGATTCAACGTACCGTAACGAACGTATCAATTGAGACTAAATATTAACGTACCATTAAGAGCTACCGTGCAACGACGAAAAGAATGATAACAGTAACACA GATAACAGTAACACACTTCTGT TAACCTTAAGATTACTTGATCCACTGATTCAACGTACCGTAACGAACGTATCAATTGAGACTAAATATTAACGTACCATTAAGAGCTACCGTCTTCTGTTAACCTTAAGATTACTTGATCCACTGATTCAAC ACCATTAAGAGCTACCGTGCAACTTAACCTTAAGATTACTTGATCCACTGATTCAACGTACCGTAACGAACGTATCAATTGAGAC TAAATATTAACGTACCAT TAAGAGCTACCGTGCAACGACGAACT ICTGTTAACCTTAAGAT T ACTTGAI GCTACCGTGCAACGAAAATAACCTIAAGATTACTTGATCCACTGATTCAACGTACTICTGTITAACCTIAAGATTACTIGATCCACIF G GAAAAGAATGATAACAGTAACACACTTCTGTTAACCTTAAGATTACTTGATCCACTGATTCAACGTACCGTAAAGATTACTIGATCA WT AAGAGCTACC GATAACAGTAACACACTTCTGTTAACCTTAAGATTACTTGATCCACTGATTCAACGTACCGTAACGAACGTATCAATTGAGACTAA CACACTTCTGT ACCATTAAGAGCTACCGTGCAACAGTAACACACTTCTGTTAACCTTAAGATTACTTGATCCACTGATTCAACGTACCGTAACGAB INAAGAATGATAA GATAACAGTAACACACTTCTGTTAACCTTAAGATTACTTGATCCACTGATTCAACGTACCGTAACGAACGTATCAATTGAGACTAS GTACCGTAACGAACGTATCATTAAGATTACTTGATCCACTGATTCAACGTACCGTAACGAACGTATCAATTGAGACTAAATATTAA CTGTTAACCTT CTTGATCCACTGATTCAACGTTAAGATTAC
27. ACGAAAAGAATGATAA TT CAACGT TAAGAT T GTAC C AA TT TTAACCTTAAGATTACTT G CC GTATC AG 3AAAAGAATGATAACAGTAACACACTTCTGTTAACCTTAAGA TACITOATO gt A gt GATTCA GTA CCGTAAAGATTACTTGATCCACTGATTCAACGTACCGTAACGAACGTATCAATTGAGACTAAATATTAACGTACCAT TAAGAGCTACCI GATAACAGTAACACACTICTGTIAACCTTAAGATTACTTGATCCACTGATTCAACGTACCGTAACGAACGTATCAATTGAGACTAAATATTAACGTACCATTAAGAGCTACCGTCTICTGTIAACCTIAAGATTACTTIGATCCACTGATTCAACG GTACCGTAACGAACGTATCATTAAGATTACTTGATCCACTGATTCAACGTACCGTAACGAACGTATCAATTGAGACTAAATAT TAACGTACCATTAAGAGCTACCGTGCAACGACGAAAAGAATGATAACAGTAACACACTTCTGTTAACCTTA 3AAAAGAATGATAACAGTAACACACTT a AA ACCAT TAAGAGCTACCGTGCAACAGTAACACACTTCTGTTAACCTTAAGATTACTTGATCCACTGATTCAACGTACCGTAACGAACGTATCAATTGAGACTAAATATTAACGTACCATTAAGAGCTACCGTGCAACGACGAAAAGAATGATAAL GATAACAGTAACACACTTCTGTTAACCTTAAGATTACTTGATCCACTGATTCAACGTACCGTAACGAACGTATCAATTGAGACTAAATATTAACGTACCATTAAGAGCTACCGTCTTCTGTTAACCTTAAGATTACTTGATCCACTGATTCAACG STTGATCCACTGATTCAACGT TAAGAT TACT T GATCCACTGAT TCAACGTACCGTAACGAACGTATCAAT TGAGCTTCTG EE ee dee Aa Fy les PAG L ie a ayy poor CAATTGAGACTAAATAT TAACGTACCATTAAGAGTCTGTTAACCTTAAG ee a vt ULE GACTAAATATTAACGTACCATTAAGAGCTACCGTGCAACGAAAAGAATGATAACAGTA GTACCGTAACGAACGTATCATTAAGATTACTTGATCCACTGATTCAACGTACCGTAACGAACGTATCAATTGAGACTAAATA SF AACGTACCATIRAGAGCTACCGTECAACGA CGAAAAGAATGATAACAGTAACACACTTCTGTTAACCTTA O TAACGAACGTATCAATTGAGCTTCTGTTAACCT TAAGATTACTTGATCCACTGATTCAACGTACCGTAACGAACGTATCAATTGAGACTAGCAACGACGEA 3AAAAGAATGATAACAGTAACACACTTCTGTTAACCTTAAGATTACTTGATCCACTGATTCA
28. ACGTACCGTAAAGATTACTTGATCCACTGATTCAACGTACCGTAACGAACGTATCAATTGAGACTAAATATTAACGTACCATTAAGAGCTACC GATAACAGTAACACACTTCTGTTAACCT TAAGATTACTTGTTGATCCACTGATTCAACGTACCGTATCAATTGAGACTAAATATTAACGTACCATTAAGAGCTACCGTCTTCTGTTAACCTTAAGATTACTTGATCCACTGATTCAACGTACCGTE AA aa UA NG AG y e E AG La EN GA E UA SABA LANA AA HUA ee SAAAA CAGTAACACACTTC C ACTTGATCCACTGATTCAACGTACCGTAAAGATTACTTGATCCACTGATTCAACGTA AACGAA TCAATTGAGACTAAATATTAAC CATTAAGAGCTACC GATAACAGTAACACAC C GATTACTTGATCCACTGATTCAACGT AACGAACGTATCAATTGAG TATT ATTAAGAGCTACCGTCTTCT C ACTTGATCCACTGATTC A CTTAAGATTACTTGATCCA ATTCAA GTAACGAACGTATCAATTGAGACTAAATATTAACGTACCA TTGATCCACTGATTCAACGTACCGTA ATCAAT TGAGACTAAATAI T TACTTAACCTTAAG TTGATCCACTGATTCAACGTACCGTAACGAACGTCTTCTGTTAACCTTAAGATTACTTGATCCACTGATTCAACGTA TAACGAACGTATCAATTGAGACTAA CG TAT TAACGTACCATTAAGAGCTACAACC ACTTGATCC GATTCAAC CGTAACGAACGTATCAATTGAGACTAAATATTAA T TAAGAGCTACCGTGC CAGTAACACA GATAACAG CAC CCTTAAGATTACTTGATCCACTGATTCAA CGTAACGAACGTATCAATTGAGACTAAATATTAACGTACCATTAAGAGCTACCGTCTTCT C ATTACTTGATCCACTGATTC CATTAAGAGCTACCGTGCAACTT A ATCCACTGATTCAACGTACCGTAACGAACGTATC GA TAT TAACGTACCAT TAAGAGCTACCGTGCAACG ACT TGAT C FNS GATTACTTGATCCACTGATTC A TT GATTACTTGATCCACTGATTCAACGTACCGTAACG ATC AGACTAAGCTACCGTGCAA CGAAAATAACC T 7 CT AACGTACTTCTGTTAAC AC CGT CGT CGACGAAAAGAAT GAT AATGATAACAGTAACACACTTCTGTTAACCTTIAAGAT TACT TGATCCACTGAT TCAACGTACCGTAAAGAT TACT T GATCCACTGAT TCAACGTACCGTAACGAACGTATCAAT TGAGAC TAAATAT TAACGTACCAT TAAGAGCTACC GATAACAG
29. C NANGAGBAAAAGAATGAT AACAGTAACACACTTCTGTTAACCTTAA SEQUENCE u98109 9WO02 9M PERFORM WASH To start a software update select Update Available A dialog box opens to confirm the command at which time a reboot of the instrument is required Installation of the update begins automatically upon reboot If your instrument is not connected to a network with internet access you can update the software manually For more information see Manual Update Screen on page 37 MiSeq System User Guide 2 5 MiSeq Software Perform Wash Screen You can initiate three types of washes from the Perform Wash screen maintenance wash standby wash and post run wash Maintenance Wash The maintenance wash consists of three consecutive wash cycles that thoroughly flush the system Perform a maintenance wash at least every 30 days See Procedure on page 83 Standby Wash The standby wash properly prepares the fluidics lines for sitting idle and consists of two consecutive wash cycles Perform a standby wash if the instrument will be idle for up to seven days See Performing a Standby Wash on page 86 After the instrument has been placed in an idle state you must perform a maintenance wash before beginning a new sequencing run Post Run Wash The post run wash is the standard instrument wash performed between sequencing runs and consists of a single wash cycle If you need to perform a post run wash at a time other than directly following a run use t
30. C GATAACAGTAACACACTTCTGTTAACCTTAAGATTACTTGATCCACTGATTCAACGTACCGTAACGAACGTATCAATTGAGACTAAATATTAACGTACCATTAAGAGCTACCGTCTTCTGTTAACCTTAAGATTACTTGATCCACTGATTCAACG TGAGACTAAATAT TAACGT TGTTAACCTTAAGATTACTTGATCCACTGATTCAACGTACCGTAACGAACGTATCAATTGAGACTAAATATTAACGTACCAT TAAGAGCTTCTGT TAA CC T TAAGATTACTTGATCCACTGATTCAACGTACCGTA ATCAAT TGAGACTAAATAT TAACGTACTTAACCTTAAGATTACT TGATCCACTGATTCAACGTACCGTAACGAACGTCTTCTGTTAACCT TAAGATTACTTGATCCACTGATTCAACGTACCGTAACGAACGTATCAATTGAGACTAACGACGA GACTAAATAT TAACGTACCAT TAAGAGCTACAACCT TAAGAT TACTTGATCCACTGAT TCAACGTACCGTAACGAACGTATCAAT TGAGACTAAATAT TAACGTACCAT TAAGAGCTACCGT GCAACGACGAAAAGAAT GATAACAGTAACACA GATAACAGTAACACACTTCTGT TAACCTTAAGATTACTTGATCCACTGATTCAACGTACCGTAACGAACGTA Pa AHE a CTAAATATTAACGTACCATTAAGAGCTACCGTCTTCTGTTAACCTTAAGATTACTTGATCCACTGATTCAACG ACCAT TAAGAGCTACCGTGCAACTTAACCTTAAGATTACTTGATCCACTGATTCAACGTACCGTAACGAACGTATCAATTGAGACTAAATAT TAACGTACCAT TAAGAGCTACCGTGCAACGACGAACTTCTGTTAACCTTAAGAT TACT TGAT 3CTACCGTGCAACGAAAATAACCTTAAGATTACTTGATCCACTGATTCAACGTACTTCTGTTAACCTTAAGATTACTTGATCCACTGATTCAACGTACCGTAACGAACGTATCAATTGAGACTAAGCTACCGTGCAACGACGAAAAGAATGAT 3AAAAGAATGATAACAGTAACACACTTCTGTTAACCTTAAGATTACTTGATCCACTGATTCAACGTACCGTAAAGATTACTTGATCCACTGATTCAACGTACCGTAACGAACGTATCAATT GAGACTAAATATTAACGTACCATTAAGAGCTACC GATAACAGTAACACACTTCTGTTAACCTTAAGATTACTTGATCCACTGATTCAACGTACCGTAACGAACGTATCAATTGAGACTAAATATTAACGTACCATTAAGAGCTACCGTGCAACGACGAAAAGAATGATAACAGTAACACACTTCTGTT A CTGTTAACCTTAAGATTA G CCGT GT ACTAAATA CGTACC CG
31. CGTACCGTAACGAACGTAT CAAT TGAGACTAAATAT TAACGTACCAT TAAGAGCTACCGT GCAACGACGAAAAGAAT GATAA GATAACAGTAACACACTTCTGT TAACCT TAAGAT TACT TGAT CCACT GAT TCAACGTACCGTAACGAACGTAT CAAT TGAGACTAAATAT TAACGTACCAT TAAGAGCTACCGTCTTCTGTTAACCT TAAGAT TACTT GATCCACTGAT TCAACC CTTGATCCACTGATTCAACGTTAAGAT TACTTGATCCACT GATT CAACGTACCGTAACGAACGTATCAATTGAGCT TCT GT TAACCTTAAGAT TACT TGATCCACTGAT TCAACGTACCGTAACGAACGTAT CAAT T GAGACTAGCAACGACG CAATTGAGACTAAA G GTCTGTTAACCTTAAGATT C TTGAGACTAAA AACGTACC TA GCAACGAAAAGAATGATAA TAT TAACGTACCATTAAGA ACTTGATCCACTGATTCAACGTACCGTAACGAACGTATCAA TA TACCATTAAGAGCTACCGT CAGT GTACCGTAACGAACGTATCATTAAGATTACTTGATCCACTGATTCAACGTACCGTAACGAAC I TGAGACT ATTAACGTACCATTAAGAGCTACCGTGC CAGTAA ACTTCT CTT CTTGATCCACTGATT TT T TACTTGATCCACTGATTCAAC CGTAACG ATCAATTGAGCTTCTG CC TT GATCCACTGATTCAACGTACCGTAACGAACG AATTGAGACTAGCAACGAC CAGTAACACACTTC GAT CTGATTCAACG AAAGATTACTTGATCCACTGATTCAA AACGAACGTATCAATTG TAT TAACGTA T TAAGAGCTACC GATAACAGTAACACAC TTGATCCACTGAI TCAACGTACCGTATCAAT TGAGACTAAATAT TAACGTAC AAGAGCTACCGTCTTCTGTT G CTTGAT ATTC GTACCGI CAC US GATTACTTGATCCACTGATTCAACGTACCGTAACG ATCAATT TAAATATTAA CCATTAAGAGCTACCGTCTT CTT I TACTTGATCCACTGATTCAA TAACGA AA GT G AACGTATC G CGTACC C CTGTTAACCTTAAGA GTACCG AAAA AACAGTAACACACTTCTGT TAACCTTAAGATTACTTGATCCACTGATTCAACGTACCGTAAAGATTACTTGATCCACTGATTCAACGTACCGTAACGAACGTATCAATTGAGACTAAATATTAACGTACCAT TAAGAGCTACC GATAA AGTAACA CA CI ICTGTTA CCI TAAGATTAGITGATOGA CTGATT CAA GTA CCGTAAC GAACGTATC
32. If any settings need to be changed due to a network or facility change use the System Settings feature Figure 13 System Settings MiSeg Control Software Please select from the following options in order to set up your IP settings L Obtain an IP address automatically Obtain DNS server address automatically Use the following IP address O Use the following DNS server addresses IP address 10 12 37 156 Preferred DNS server 10 10 1 10 Subnet mask 255 255 254 0 MM Alternate DNS server 10 10 48 5 Default gateway 10 12 36 1 44 Back Contact the facility administrator to get information about what network settings to enter Changing System Credentials To change the system user name and password make the change on the Systems Settings screen Select System Settings on the Manage Instrument screen and then select Save and Continue to progress to the third screen in the series of screens Select This account Enter the domain name Domain MiSeg for example and password Select Save and Continue The credentials for MiSeg Reporter and BaseSpace are also updated MiSeg System User Guide 35 U9BJOS juaun1 su abeue ny MiSeq Software Figure 14 System Settings Please enter a Domain Username and password with write access for the analysis software O Local System account O This account Domainluser name HWUSisbsuser Password 24 x Save and Back Cancel Continue 00000 System
33. K 1300K mn is acceptable Clusters Passing Filter Shows the percentage of clusters passing filter based on the Illumina chastity filter which measures quality This data appears only after cycle 20 NOTE i The chastity of a base call is the ratio of the intensity of the greatest signal divided by the sum of the two greatest signals Reads do not pass the quality filter if more than one base call has a chastity value of less than 0 6 in the first 25 cycles Estimated Yield Mb Shows the projected number of bases called for the run measured in megabases This data appears only after cycle 25 Template Generation Real Time Analysis RTA uses the first four cycles of the sequencing run for template generation Template generation is the process by which cluster positions over the entire flow cell surface are defined according to X and Y coordinate position 4 6 Part 15027617 Rev H After the template of cluster positions has been generated the images produced over every subseguent cycle of imaging are aligned against the template so that individual cluster intensities in all four nucleotide color channels can be extracted and base calls produced from the normalized cluster intensities Sequencing Analysis Viewer You can monitor your run in greater detail without interfering with the run using the Ilumina Sequencing Analysis Viewer SAV Your MiSeq must be networked to view primary analysis results with SAV SAV allows
34. Part 15028784 lt Run folder name gt Recipe Contains the recipe used for the run lt Run folder name gt Logs Contains log files that describe every step performed by the instrument for each cycle lt Run folder name gt Interop Contains binary files used by Sequencing Analysis Viewer SAV to summarize various primary analysis metrics such as cluster density intensities quality scores and overall run quality All other files and folders created in the temporary run folder are not copied to the output and analysis folders They contain temporary files that are not required for analysis or troubleshooting MiSeq System User Guide 4 9 MiSeq Software Additional folders such as the Alignment folder are added by MiSeg Reporter during secondary analysis For more information see the MiSeg Reporter User Guide Part 15028784 Primary Analysis Results The primary analysis output from a seguencing run is a set of guality scored base call files bcl which are generated from the raw image files The following table describes the folders and files generated by Real Time Analysis RTA during primary analysis Many of these files are used for secondary analysis by the MiSeq Reporter software Key File RTACo m plete txt SampleSheet csv Runlnfo xml bel files stats files filter files txt cif files locs files jpg files 50 Subfolder Root folder Root folder Root folder Datal Intensities
35. R2 from 2 to 8 C storage Gently invert the bottle to mix the PR2 bottle and then remove the lid sjuoDeoH Buipeor 2 Open the reagent compartment door 3 Raise the sipper handle until it locks into place 4 Place the PR2 bottle in the indentation to the right of the reagent chiller Figure 39 Load the PR2 Bottle 5 Make sure that the waste bottle is empty If it is not empty empty the contents into the appropriate waste container 6 Slowly lower the sipper handle Make sure that the sippers lower into the PR2 and waste bottles MiSeq System User Guide Fi 3 Figure 40 Lower Sipper Handle Performing a Run 7 Check the lower left corner of the screen to confirm that the RFID of the PR2 bottle was read successfully 1 lay NOTE If the RFID is not read by the system the software prompts you through the steps to obtain a temporary bypass code and proceed with setting up the run For more information see Resolving RFID Read Failure on page 95 8 Select Next on the Load Reagents screen Load the Reagent Cartridge ia NOTE 4 4 Do not leave the reagent chiller door open for extended periods of time 1 Open the reagent chiller door 2 Hold the reagent cartridge on the end with the Illumina label and slide the reagent cartridge into the reagent chiller until the cartridge stops 4 Part 15027617 Rev H Figure 41 Load Reagent Cartridge 3 Close the reagent chiller door 4 Check the lower left corner of
36. T AACACACTTCTGTTAACCTTAAGATTACTTGATCCACTGATTCAACGTACCGTAACGAACGTATCAATTGAGACTAAATATTAACGTACCATTAAGAGCTACCGTGCAACGACGAAAAGAATGATAACAGTAACACACTTCTGTT AA ABA AA GATAACAGTAACACACTTCTGTTAACCTTAAGATTACTTGATCCACTGATTCAACGTACCGTAACGAACGTATCAATTGAGACTAAATAT TAACGTACCATTAAGAGCTACCGTCTTCTGTTAACCTTAAGATTACTTGATCCACTGATTCAACG GTACCGTAACGAACGTATCATTAAGATTACTTGATCCACTGATTCAACGTACCGTAACGAAGCGTATCAATTGAGACTAAATATTAACG aR CCGTGCAACGACGAAAAGAATGATAACAGTAACACACTTCTGTTAACCTTA cTTGATCCACTGATTCAACGTTAAGATTACTTGATCCACTGATTCAACGTACCGTAACGAACGTATCAATTGAGCTTCTGT TAACCT TAAGATTACTTGATCCACTGATTCAACGTACCGTAACGAACGTATCAATTGAGACTAGCAACGACG 3AAAAGAATGATAACAGTAACACACTTCTGTTAACCTTAAGATTACTTGATCCACTGATTCAACGTACCGTAAAGATTACTTGATCCACTGATTCAACGTACCGTAACGAACGTATCAATTGAGACTAAATATTAACGTACCATTAAGAGCTACC lumina San Diego California 92122 U S A 1 800 809 ILMN 4566 1 858 202 4566 outside North America techsupport illumina com www illumina com
37. TTGATCCACTGATTCAACGTACCGTAACGAACGTATCAATTGAGCTTCTGTTAAC ITAGCAACGACG GAAAAGAATGATAACAGTAACACACTTCTGTTAACCT TAAGATTACTTGATCCACTGATTCAACGTACCGTAAAGATTACTTGATC TTAAGAGCTACC FOR RESEARCH USE ONLY ILLUMINA PROPRIETARY Part 15027617 Rev H March 2013 od This document and its contents are proprietary to Illumina Inc and its affiliates Tllumina and are intended solely for the contractual use of its customer in connection with the use of the product s described herein and for no other purpose This document and its contents shall not be used or distributed for any other purpose and or otherwise communicated disclosed or reproduced in any way whatsoever without the prior written consent of Illumina Illumina does not convey any license under its patent trademark copyright or common law rights nor similar rights of any third parties by this document The Software is licensed to you under the terms and conditions of the Illumina Sequencing Software License Agreement in a separate document If you do not agree to the terms and conditions therein Ilumina does not license the Software to you and you should not use or install the Software The instructions in this document must be strictly and explicitly followed by gualified and properly trained personnel in order to ensure the proper and safe use of the product s described herein All of the contents of this document must be fully read and understood prior to using such product
38. a 1 Loading Reagents i 3 Starting A 76 Monitoring the RUN occ eee ee ee ee ee ee eee ee ee eee ee eee eee TT H inni a a a OOV ila VT aane f a KET Ke B CRA ef A t M N a e MiSeq System User Guide 61 Jaj atyo Performing a Run Introduction 62 To perform a run on the MiSeq follow the setup steps described in this chapter After the run begins the MiSeq is completely automated and no other user intervention is required The sequencing run can be monitored from the Sequencing screen or monitored remotely using the Sequencing Analysis Viewer SAV an optional software application that you can download from the Illumina website After the run is complete always perform an instrument wash Part 15027617 Rev H MiSeq Workflow MiSeq System User Guide Denature and dilute libraries does not apply to all library types See Preparing DNA Libraries for Sequencing on the MiSeg Part 15039740 Prepare the pre filled reagent cartridge for use Load the library mix onto the reagent cartridge in the designated reservoir From the software interface select Sequence to start the run set up steps Optional Connect to BaseSpace Wash and thoroughly dry the flow cell Load the flow cell Load the PR2 bottle and make sure that the waste bottle is empty Load the reagent cartridge Review run parameters and pre run check results Select Start Ru
39. ad the freshly filled wash tray and wash bottle as follows a Slide the wash tray into the reagent chiller until it stops Close the reagent chiller door b Load the wash bottle and slowly lower the sipper handle making sure that the sippers lower into the wash bottle and waste bottle c Close the reagent compartment door 5 Select Next The final wash begins After the Wash When the wash is complete leave the used flow cell wash tray and wash bottle containing the remaining wash solution on the instrument L NOTE The sippers will remain in the down position This is normal Leave the unused wash solution in the wash tray and wash bottle to prevent the sippers from drying out and air from entering the system MiSeq System User Guide o D USEM 99UBEUSILIEW e BUIUUJOLS9 d Maintenance Procedures Performing a Standby Wash If the instrument will not be used within the next seven days prepare the instrument to sit idle by performing a standby wash A standby wash performs two consecutive washes that flush each position of any remaining reagents or salt accumulation Each wash takes approximately 60 minutes Allow approximately 2 hours to complete the standby wash When the standby wash is complete the instrument is in standby mode and a message appears on the Welcome screen stating the status of the instrument When the instrument is in standby mode a maintenance wash must be performed before a sequencing run can be initiated
40. ance wash takes about 1 hour Send Instrument Health Illumina recommends selecting this option to help Illumina Technical Support in troubleshooting possible problems The only files sent to Illumina are log files interop files and log files The instrument must be connected to a network with internet access to use this feature Replicate Analysis Locally This setting provides the option to perform analysis both locally on the instrument and in BaseSpace If you are using BaseSpace and select this option MiSeq Reporter will launch automatically after the run and perform analysis locally 3 O Part 15027617 Rev H If you are using BaseSpace and do not select this option MiSeg Reporter will not launch automatically after the run and analysis will only be performed in BaseSpace Folder Settings Tab You can specify the default folder locations on the Folder Settings tab For ease of access the folders can be located on a local network or on the instrument computer Figure 10 Folder Settings Tab Mumina Miseq Please make any needed changes to the Run Options Run Settings Folder Settings Email Notifications Recipe Folder C rrabago lllumina instrumentation Dev Trunk App MCS bin Deb Mali Sample Sheet Folder D illumina MiSeq Control Software SampleSheets Manifest Folder D illumina MiSeq Control Software Manifests Output Folder D illumina MiSeqOutput Save and Return 0000 Recipes Sets the default location for
41. d Slowly lower the sipper handle making sure that the sippers lower into the wash bottle and waste bottle 7 Following the on screen prompts remove any droplets from the wash bottle sipper as follows a When prompted slowly raise the sipper handle and check the wash bottle sipper for the presence of a large water droplet b When prompted slowly lower the sipper handle far enough into the water to allow the surface tension to remove the droplet c When prompted slowly raise the sipper handle and check the wash bottle sipper for the presence of a large water droplet d When prompted slowly lower the sipper handle completely making sure that the sippers lower into the wash bottle and waste bottle Figure 46 Remove Droplet from Sipper ittumina MiSeg Please lift the PR2 sipper Remove any large droplets on the tip by dipping the sipper slightly back Into water Surface tenslon should puli the droplet off Y Insert PR2 and waste bottle Y Insert Wash Tray Y Insert MiSeq Flow Cell Conduct Volume Test x Stop Test P P VolumeCheckTest KI VA awt una 8 Select Next The volume test begins When the volume test is complete the results appear on the screen MiSeq System User Guide O 9 159 awnjo 4 e BUILUJOLI9 J Troubleshooting Figure 47 Volume Test Results Mumina MiSeq System Check is complete Results are displayed below Conduct Volume Test Show Details Export Results m B Z 3 If the test did
42. d the MiSeqOutput folder For more information see Run Options Screen on page 30 2 From the Welcome screen select Sequence to begin the run set up steps The BaseSpace Options screen opens Performing a Run Set BaseSpace Option The first screen in the run setup steps provides the option to use BaseSpace for storage and analysis To enable access you need a network connection 1 From the BaseSpace Options screen do one of the following a Select the checkbox Use BaseSpace for storage and analysis Analysis will be performed in BaseSpace b Clear the checkbox Use BaseSpace for storage and analysis Analysis will be performed on the instrument 2 Select Next The Load Flow Cell screen opens 6 o Part 15027617 Rev H Cleaning the Flow Cell The flow cell is Immersed in storage buffer in a flow cell container The cap color of the flow cell container indicates the flow cell type The standard 14 tile flow cell container cap is clear The micro 4 tile flow cell container cap is green The nano 2 tile flow cell container cap is yellow 1 Put on a new pair of powder free gloves 2 Using plastic forceps grip the flow cell by the base of the plastic cartridge and remove it from the flow cell container Figure 32 Remove Flow Cell 3 Lightly rinse the flow cell with laboratory grade water making sure that both the glass and plastic cartridge are thoroughly rinsed of excess salts Excess salts can affect flow cell seati
43. e Analysis folder You can change the location of the output folder in the Output Folder field on the Run Options screen For more information see Run Options Screen on page 30 Dilllumina MiSeq Analysis When primary analysis is complete MiSeq Reporter accesses the Analysis folder on the instrument local drive to begin secondary analysis All files written to the Analysis folder are copied back to the Output folder For more information see MiSegOutput Folder Contents on page 48 If you are using BaseSpace for analysis without replicating analysis locally the Analysis folder on the instrument local drive is empty Root Folder Naming The root run folder name identifies the date of the run the instrument number and the flow cell used for the run For any one run each run folder has the same root folder name By default the folder name uses the following format YYMMDD lt lnstrumentNumber gt lt Run Numbers A lt FlowCellBarcode gt The run number increments by one each time a run is performed on a given instrument MiSegOutput Folder Contents 48 After primary analysis the MiSeqOutput folder is populated with files necessary for secondary analysis by MiSeg Reporter When secondary analysis is complete the MiSegOutput and MiSegAnalysis folders are identical with one exception that the MiSegOutput folder contains two subfolders for images files Images and Thumbnail Images These are not used for secondary analysis Part 150
44. e fluidics lines is suspected perform a volume test A volume test checks the health of the fluidics system by estimating the volume between two bubbles as they pass by the sensors To perform a volume test the wash tray and wash bottle must be loaded with laboratory grade water and a used flow cell must be in place Follow the onscreen prompts to perform the test 1 Make sure that a used flow cell is loaded on the instrument 2 From the Manage Instrument screen select System Check 3 Select Conduct Volume Test and then select Next Figure 45 System Check Screen ittumina MiSeq Please select the system check options to perform L Select All Motion System Optics Other Y Stage Test a LED Power Test a Prime Reagent Lines M3 Mirror Test a Tip TM Test Conduct Volume Test s Z Slage Tesi a Autofocus Test Thermal Ramp Test Full Optics Test imt nur 4 Fill each reservoir of the wash tray with 6 ml laboratory grade water 5 Fill the 500 ml wash bottle with 350 ml laboratory grade water 6 Load the wash tray and wash bottle onto the instrument a Open the reagent compartment door and reagent chiller door and slide the wash tray into the reagent chiller until it stops Close the reagent chiller door Part 15027617 Rev H b Raise the sipper handle until it locks into place and load the wash bottle c Remove the waste bottle and discard the contents appropriately Return the waste bottle to the reagent compartment
45. e with the wash bottle L NOTE Discard the PR2 bottle after each run Do not reuse any remaining PR2 d Remove the waste bottle and discard the contents appropriately Return the waste bottle to the reagent compartment e Slowly lower the sipper handle making sure that the sippers lower into the wash bottle and waste bottle f Close the reagent compartment door 4 Select Next The first wash begins Perform Second Wash y NOTE Always use fresh wash solution for each wash step Reusing wash solution from the previous wash can return waste to the fluidics lines 1 Prepare fresh wash solution with Tween 20 and laboratory grade water as follows a Add 5 ml 100 Tween 20 to 45 ml laboratory grade water This results in 10 Tween 20 b Add25 ml 10 Tween 20 to 475 ml laboratory grade water This results in a 0 5 Tween 20 wash solution c Invert several times to mix 2 When the first wash is complete remove the wash tray and wash bottle and discard the remaining wash solution 3 Refill the wash components with fresh wash solution as follows a Add 6 ml wash solution to each reservoir of the wash tray b Add 350 ml wash solution to the 500 ml wash bottle MiSeq System User Guide O USEM JPUEIS e buiwopad Maintenance Procedures 4 Load the freshly filled wash tray and wash bottle as follows a Slide the wash tray into the reagent chiller until it stops Close the reagent chiller door b Load the wash bottle and slowl
46. en a 30 Manage Instrument Screen iii 34 Run Setup Screens laaa nro 38 Sequencing Screen cc 45 Run Folders aa ko o eo En Aun os soda biela 48 Run Duration iii 52 Required Disk Space aaao aoaaa aa 20a a 22an ii 53 Pausing or Stopping a Run 222 54 Secondary Analysis Options 2i 96 LIVE Help 25s eee k Ronal b o nn bubuhay 59 Chapter 3 Performing a RUN ino nooo oooo nooo noone 61 ic AA uss ceseeueeeneaotuesteesoee 62 MiSeq Workflow iii 63 Preparing Reagents a 65 Loading Sample Libraries onto Cartridge ooo 67 MiSeq System User Guide VI Setting Up a Run Using NIG aaa 68 Cleaning the Flow Cell ii 69 Loading the Flow Cell i 1 Loading R en as KROS CN Ah lo EU 13 Staring the RUM aaa o aa b la ori 76 Monitoring the Run 2 22 22 cnn cnn TT Chapter 4 Maintenance Procedures none 19 MTOQUCION 6 123 postin tte eN settee AA 80 Performing a Post Run Wash 0 cece ce cee cece cence ceccecceceeces 81 Performing a Maintenance Wash o a 83 Performing a Standby Wash o cece eee cece eee e cece ceeeeeeeeeeees 86 Shutting Down the Instrument 0 202 L ee cee cee cece nc 89 Chapter 5 Troubleshooting 91 MUO CUI TOWN kesa toon ak tte cope cera ad bala ii ohna nn 92 Resolving Run Setup Errors iii 93 Resolving RFID Read Failure ccoo 95 Troublesho
47. ended NaOH concentration to 1 mM in final solution e Noted that a maintenance wash is required to remove the instrument from standby mode and begin the setup steps for a subsequent run e Removed Sample Sheet Parameters section and sample sheet setup step in the workflow Illumina recommends creating the sample sheet prior to sample preparation See the MiSeq Sample Sheet Quick Reference Guide Part 15028392 and the Illumina Experiment Manager User Guide Part 15031335 J01SIH UOISIABY Part 15027617 15027617 15027617 Revision C B A Date April 2012 December 2011 September 2011 Description of Change Updated software descriptions to MCS v1 2 Added the following new procedures and sections BaseSpace overview Using Custom Primers Generating F ASTO files Troubleshooting Flow Rate Error Performing a Volume Test Performing a Maintenance Wash and Idling the Instrument which includes a standby wash Updated the following information e Updated name of Amplicon workflow to Custom Amplicon updated name of DenovoAssembly workflow to Assembly added GenerateF ASTO workflow e Added descriptions of run folders and files updated run folder naming added output file size e Listed genome folder as reguired for amplicon seguencing in Sample Sheet Parameters e Added instructions for diluting NaOH to denature libraries e Updated Resolving RFID Read Failure to include MiSeg Self Service in
48. ents and Storage Requirements Box 1 Store at 15 to 25 C Quantity Component Storage Description 1 Reagent Cartridge 15 to 25 C Single use pre filled cartridge 1 15 to 25 C 9 ml tube Hybridization Buffer Box 2 Store at 2 to 8 C Ouantity Component Storage Description 1 PR Bottle 2 to 8 C 500 ml bottle Incorporation Buffer 1 MiSeq Flow Cell Single use PE flow cell Reagent Cartridge Contents Figure 1 Reagent Cartridge 1 2 Part 15027617 Rev H Table 1 Reagent Cartridge Contents Position Reagent Name 1 IMS 2 SRE 4 CMS 5 AMS1 6 AMS2 ra LPM 8 LDR a LMX1 10 LMX2 11 RMF 12 HP 10 13 Hr 12 14 HP11 15 PW1 16 PW1 17 Empty 18 Empty 19 Empty 20 Empty 21 PW1 22 Empty L NOTE Description Incorporation Mix Scan Mix Cleavage Mix Amplification Mix Read 1 Amplification Mix Read 2 Linearization Premix Formamide Linearization Mix Read 2 Linearization Mix Resynthesis Mix Read 1 Primer Mix Index Primer Mix Read 2 Primer Mix Laboratory grade water Laboratory grade water Load Samples Reserved for sample libraries Optional use for custom Read 1 primer Optional use for custom Index Read primer Optional use for custom Read 2 primer Laboratory grade water Empty For more information about using custom primers on the MiSeq reagent cartridge see Using Custom Primers on the MiSeq Part 4 15041638 MiSeq System User Guide 13 sjuswalinbay SBEJOJS pue SIUSIUOCJ yy Gettin
49. g Run Setup Errors on page 93 When all items successfully pass the pre run check select Start Run Important Note Before Starting the Run 1 WARNING y The MiSeq is sensitive to vibration Touching the instrument after starting a run i could adversely impact sequencing results After selecting Start Run do not open the flow cell compartment or the reagent compartment door or touch the instrument monitor except to pause the run For more information see Pausing a Run on page 54 6 Part 15027617 Rev H Monitoring the Run 1 During the run monitor run progress intensities and quality scores appear on the Sequencing screen The Sequencing screen is view only For more information see Sequencing Screen on page 45 To monitor the run in greater detail use the Sequencing Analysis Viewer SAV installed on another computer independent of the instrument computer A network connection is required For more information see Sequencing Analysis Viewer on page 47 Alternatively if you are connected to BaseSpace you can monitor your run using SAV in BaseSpace 2 When the run is complete the Next button appears Review the results on the Sequencing screen before proceeding 1 NOTE The Sequencing screen remains viewable until Next is selected After Next is selected it is not possible to return to the Sequencing screen 3 Select Next to exit the Sequencing screen and proceed to a post run wash Run Metrics Run metrics a
50. g Started How Cell Types The flow cell is immersed in storage buffer in a flow cell container The flow cell container cap color indicates the flow cell type Clear cap Cap color for a standard 14 tile flow cell Green cap Cap color for a micro 4 tile flow cell Yellow cap Cap color for a nano 2 tile flow cell Flow cell types differ in output and number of tiles imaged Dual surface imaging which is possible on the standard and micro flow cells doubles the number of tiles imaged Flow cell output depends on the number of reads possible from each flow cell Reads are measured as the number of clusters passing filter Flow Cell Output of Reads Standard Flow Cell 15 M Micro Flow Cell 4M Nano Flow Cell 1M Flow Cell Flow Cell Tiles Flow Cell Standard Flow Cell Micro Flow Cell Nano Flow Cell 14 Kit Size Output Cycles Max 50 300 500 7 5 Gb 300 1 2 Gb 300 500 500 Mb Tiles Imaging Surface 14 tiles Top and bottom 4 tiles Top and bottom 2 tiles Top only 2x75 Output 2 25 Gb 600 Mb 150 Mb 2 x 150 2 x 250 Output Output 4 5 Gb 7 5 Gb 1 2 Gb 300 Mb 500 Mb Total Tiles Imaged 28 tiles total 8 tiles total 2 tiles total Part 15027617 Rev H Version Compatibility and Requirements The following table lists version compatibility of MiSeq reagents MiSeq Control Software MCS and supported read lengths MiSeq Reagent Kit Version MiSeq Reagent Kit v2 MiSeq Reagent Micro Kit
51. ge barcode number and kit version number a ly CAUTION y Entering the incorrect reagent kit version can negatively impact sequencing data 11 Select Enter Part 15027617 Rev H Troubleshooting How Rate Error The flow rate is the speed in which fluids pass through the fluidics system ul min It is measured before each run during the pre run check If the system is unable to measure the flow rate you are prompted to pump a volume of reagent PR2 through the system before checking the flow rate again 1 Use the drop down list or on screen keyboard to enter the following information Solution PR2 Volume 250 ul Aspirate Rate 2500 l min Dispense Rate 2500 ul min 2 Select Pump Figure 44 Measure Flow Rate Mumina MiSeg Unable to Measure Flow Rate Please check the fluidics and press Restart Check to continue Solution PR2 3 Volume 250 UL Aspirate Rate 2500 uLimin Dispense Rate 2500 L min di Restart Back Check 00000 3 When the pump step is complete select Restart Check 4 If the error persists set the volume to pump 500 ul PR2 and repeat the process one more time Contact Illumina Technical Support if the second attempt does not resolve the error MiSeq System User Guide 9 10113 97EH MOJ BUIJOOUSEIJINOJ Troubleshooting Performing a Volume Test 95 An obstruction in the fluidics lines might be the cause of poor reagent delivery or sequencing results If an obstruction in th
52. he command on the Perform Wash screen to initiate the wash You can configure your instrument to perform a maintenance wash between runs For more information see Run Options Screen on page 30 Figure 7 Perform Wash Screen ilumina MiSeq Please select a wash activity Perform he Maintenance Wash should be performed every 30 days for optimal performance Maintenance Wash Last performed N A The Standby Wash should be performed when the instrument will be idle for more than seven days Note If a Standby Wash is performed a maintenance wash must be conducted before sequencing Last performed N A The Post Run Wash is performed after every sequencing run Last performed 9 19 2012 Raise Sippers 00000 2 6 Part 15027617 Rev H Introduced in MCS v2 1 select Raise Sippers to manually raise the reagent cartridge sippers You might need to use this command if the run was interrupted unexpectedly or if an error occurred during the run and you need to remove the reagent cartridge from the instrument Following standard run procedures the sippers are raised by the software at the end of the seguencing run and prior to beginning a post run wash MiSeg System User Guide 2 U8919S USEM Wo sd MiSeq Software Manage Files Screen Use the Manage Files feature to move upload or delete files on the instrument computer The screen is divided into five tabs Runs Sample Sheets Manifests Genomes and Recipes Figure
53. he instrument must be turned off follow the shut down procedure described in Shutting Down the Instrument on page 89 and then wait a minimum of 60 seconds before turning the power switch back to the ON position If the MiSeq is not already on reach around the right side of the instrument to locate the power switch on the back panel It is in the lower corner directly above the power cord Figure 2 Power Switch Location Turn the power switch to the ON position The integrated instrument computer starts It might take several seconds before the touch screen shows activity Log in to the operating system using the default user name and password User name sbsuser Password sbs123 Wait until the operating system has finished loading When the system is ready the MiSeq Control Software MCS launches and initializes the system automatically After initialization is complete the Welcome screen appears Part 15027617 Rev H Miseg Software Introduction ne 20 MISCO ke elec oc sro r ee ee O SLO does 21 Welcome Screen o cee cee cece cee cce cee ceeccecceccceccecccceecceecceceeceeceees 22 Perform Wash Screen 22 22 22 occ eee ccc ninia 26 Manage Files Screen eo cece cece nn 28 PUN ODUONS A 30 Manage Instrument Screen 22 aa 34 Run Setup Screens ns 38 Sequencing Screen a 45 Run Folders denedarderesmetnccanedneetleceseesesaded 48 Run Duration AA 52 Required Disk SPACE cuina de 53 Pa sing o
54. he waste bottle throughout the process Reagent Cartridge The MiSeg reagent cartridge is a single use consumable consisting of foil sealed reservoirs pre filled with clustering and seguencing reagents sufficient for sequencing one flow cell Part 15027617 Rev H Each reservoir on the cartridge is numbered Sample libraries are loaded onto the cartridge in position 17 which is labeled Load Samples For more information see Reagent Cartridge Contents on page 12 MiSeg System User Guide 9 SJUS9UOdUlo 9 Getting Started Miseq Reagent Kits To perform a run on the MiSeq you need one single use MiSeq Reagent Kit which is available in three kit types Each type of MiSeq reagent kit includes a kit specific flow cell type and reagents required for performing one run Kit Type Flow Cell Type Available Kit Sizes MiSeq Reagent Kit v2 Includes a standard 14 tile flow cell 500 cycles 300 cycles 50 cycles MiSeq Reagent Micro Kit v2 Includes a micro 4 tile flow cell 300 cycles MiSeq Reagent Nano Kit v2 Includes a nano 2 tile flow cell 500 cycles 300 cycles The flow cell PR2 bottle and reagent cartridge provided in the kit use radio frequency identification RFID for accurate consumable tracking and compatibility You must use the reagent cartridge associated with your flow cell type If the reagent cartridge is not compatible a message appears during the run setup steps To proceed you must load a compatible reagent cartridge
55. hnical assistance contact Illumina Technical Support Table 4 Illumina General Contact Information Illumina Website www illumina com Email techsupport illumina com Table 5 Ilumina Customer Support Telephone Numbers Region Contact Number Region Contact Number North America 1 800 809 4566 Italy 800 874909 Austria 0800 296575 Netherlands 0800 0223859 Belgium 0800 81102 Norway 800 16836 Denmark 80882346 Spain 900 812168 Finland 0800 918363 Sweden 020790181 France 0800 911850 Switzerland 0800 563118 Germany 0800 180 8994 United Kingdom 0800 917 0041 Ireland 1 800 812949 Other countries 44 1799 534000 MSDSs Material safety data sheets MSDSs are available on the Illumina website at www illumina com msds Product Documentation Additional product documentation in PDF is available for download from the Illumina website Go to www illumina com support select a product then click Documentation amp Literature MiSeg System User Guide 1 O 99ULJSISSY E2IUUD9 3AAAAGAATGATAACAGTAACACACTTCTGTTAACCTTAAGATTACTTGATCCACTGATTCAACGTACCGTAAAGATTACTTGATCCACTGATTCAACGTACCGTAACGAACGTATCAATTGAGACTAAATATTAACGTACCATTAAGAGCTACC GATAACAGTAACACACTTCTGTTAACCT TAAGATTACTTGTTGATCCACTGATTCAACGTACCGTATCAATTGAGACTAAATATTAACGTACCATTAAGAGCTACCGTCTTCTGTTAACCTTAAGATTACTTGATCCACTGATTCAACGTACCGTE AA O ee 3AAAAGAATGATAACAGTAACACACTTCTGTTAACCTTAAGATTACTTGATCCACTGATTCAACGTACCGTAAAGATTACTTGATCCACTGATTCAACGTACCGTAACGAACGTATCAATT GAGACTAAATATTAACGTACCAT TAAGAGCTAC
56. ich catalog P7949 McMaster Carr catalog 7003 A22 General lab supplier Guidelines for Laboratory Grade Water Always use laboratory grade water to perform instrument procedures Never use tap water or deionized water Any of the following are acceptable examples 16 Ilumina PW1 18 Megohm MQ water Milli Q water Super Q water Molecular biology grade water Purpose Denaturing sample libraries Denaturing sample libraries and PhiX control DNA Cleaning the flow cell holder General use Cleaning the flow cell stage Cleaning the flow cell Washing the instrument Removing flow cell from flow cell shipping container Washing the instrument Part 15027617 Rev H Anti Virus Software Humina strongly recommends that you purchase and install the anti virus software of your choice to protect the computer against viruses To avoid interfering with MiSeq operation or losing data configure the anti virus software updates as follows Set for manual scans not automatic scans Perform scans only when the instrument is not in use Set updates to download but not install without user authorization Do not automatically reboot the computer upon update Exclude the data drive and application directory from any real time file system protection MiSeq System User Guide 1 SJEMYOS SNII I UY Getting Started Starting the MiSeg 18 NOTE e It is best to leave the instrument on at all times However if t
57. il a red icon X appears next to the item to indicate the item is not ready and a message appears on the screen that describes the error and the action needed to correct 1t Error X Flow Rate Measured X Free Disk Space X Network Connection Active X Primary Analysis Ready MiSeq System User Guide Action The flow rate check screen opens Use the drop down list or on screen keyboard to enter the following e Solution PR2 e Volume 250 e Aspirate Rate 2500 e Dispense Rate 2500 Select Pump If the error persists set the volume to pump 500 ul PR2 and repeat the process When fluids have been pumped select Restart Check When the pre run check is successful the Start Run button becomes active If the flow check fails again reseat the flow cell to make sure that flow is not interrupted due to misalignment Inspect the flow cell gasket for lint or irregularities that might prevent flow If disk space is low a message appears indicating how much disk space is required Use the Manage Files feature to clear the required space from the instrument computer Make sure the network cable is plugged into the instrument If the network connection is not restored select Reboot on the Manage Instrument screen to reboot the software If the connection is still not restored select Shut Down on the Manage Instrument screen and then turn off the instrument using the power switch Wait at least 60 seconds and then turn on
58. ilitates the transfer of files and data to the instrument computer from the touch screen monitor F Reagent Compartment Holds reagents at proper temperatures wash solutions and the waste bottle The reagent compartment door is secured by a magnetic latch The MiSeg interface guides you through the run setup steps using the touch screen monitor To load run components you need to access the reagent compartment and the flow cell compartment MiSeg System User Guide 5 Getting Started Flow Cell Compartment Flow Cell Stage Flow Cell Compartment Door Flow Cell Latch Flow Cell Flow Cell Latch Release Button m 0 OU The flow cell compartment houses the flow cell stage thermal station and fluidics connections to the flow cell The flow cell stage moves in and out of the optics module and holds the flow cell which is secured by the flow cell latch When the flow cell latch closes two pins near the latch hinge auto position the flow cell The thermal station located beneath the flow cell stage controls changes in flow cell temperature reguired for cluster generation and seguencing 6 Part 15027617 Rev H Flow Cell A Outlet Port B Imaging Area C Inlet Port The MiSeq flow cell is a single use glass based substrate on which clusters are generated and the sequencing reaction is performed Reagents enter the flow cell through the inlet port pass through the single lane imaging area and then exit the flow cell thr
59. illumina Miseg System User Guide AA AA aa c GATAACAGTAACACACTTCTGTTAACCTTAAGATTACTTGTTGATCCACTGATTCAACGTACCGTATCAATTGAGACTAAATATTAACGTACCATTAAGAGCTACCGTCTTCTGTTAACCTTAAGATTACTTGATCCACTGATTCAACGTACCGT CACTGATTCAACGTACCAAGATTACTTGATCCACTGATTCAACGTACCGTAACGAACGTATCAATTGAGACTAAATATTAACGTACCATTAAGAGCTACCGTCTTCTGT TAACCT TAAGAT TACT TGAT CCACT GAT TCAACGTACCGTAACGA GAAAAGAATGATAACAGTAACACACTTCTGT TAACCTTAAGAT TACT TGATCCACTGAT TCAACGTACCGTAAAGAT TACTT GATCCACT GAT TCAACGTACCG MEAS Sea S ee eee GATAACAGTAACACACTTCTGTTAACCTTAAGATTACTTGATCCACTGATTCAACGTACCGTAACGAACGTATCAATTGAGACTAAATATTAACGTACCATTAAGAGCTACCGTCTTCTGTTAACC ACTTGATCCACTGATTCAA TTGA TTAAGATTACTTGATCCACTGATTCAACGTACCGTAACGAACGTATCAATTGAGACTAAATATTAACGTACC CTTAAGATTACTTGATCCACTGATTCAACGTACCGTA TATCAATTGAGACTAAATAT T CTTAACCTTAAGATTACTTGATCCACT GATT CAACGTACCGTAACGAACGTCTTC AACCTTAAGAT TACT TGATCCACTGAT TCAACGTACCGTAACGAACGTAT CAAT TGAGACTAACGACGA GACTAAATAT TAACGTACCAT TAAGAGCTACAACCT TAA ACTTGATCCACTGATTCAACG GTAACGAACGTATCAATTGAGACTAAATATTAA AT TAAGAGCTACCGTGC CAGTAACAC GATAACAG ACACTTC ATTACTTGATCCACTGATTCAAC CGTAACG GTATCAATTGA TAT TAACGTACCAT TAAGA G C C ATTACTTGATCCACTGATTCAAC AT TAAGAGCTACCGTGCAACTTAACC GATCCACTGATTCAACGTACCGTAACGAACGTATCAATTGAGACTAAATAT TAACGTAC AAGAGCTACCGTGCAACGA GAT GCTACC GATTACTTGATCCA ATTC I TACTTGATCCACTGATTCAACGTACCGTAAC TC GACTAAGCTACCGTGCAACG CGAAAATAACCTTAA CTG AACGTACTTCTGTTAACCTTAAGA A C GTACC GAACGTA ANY CGACGAAAAGAATG G GAATGATAACAGTAACACACTTCTGT TAACCTT
60. intenance procedures at the intervals shown below Table 2 Maintenance During Normal Operation Activity Frequency Post Run Wash After every run Maintenance Wash Monthly Standby Wash To prepare for idle mode if unused for gt 7 days Instrument Shutdown As needed Table 3 Maintenance During Idle Mode 27 days unused Activity Frequency Standby Wash Monthly Instrument Shutdown As needed SO Part 15027617 Rev H Performing a Post Run Wash Always perform an instrument wash after completing a sequencing run Follow the software prompts to load the wash components and perform the wash The post run wash takes approximately 20 minutes Humina recommends that you perform the wash directly following the completion of a run If the wash is not performed at this time you must perform a wash prior to the next run y NOTE Leave the used flow cell on the instrument A flow cell must be loaded on the instrument to perform an instrument wash User Supplied Consumables Tween 20 Sigma Aldrich catalog P7949 Laboratory grade water Procedure 1 Prepare fresh wash solution with Tween 20 and laboratory grade water as follows a Add 5 ml 100 Tween 20 to 45 ml laboratory grade water This results in 10 Tween 20 b Add 25 ml 10 Tween 20 to 475 ml laboratory grade water This results in a 0 5 Tween 20 wash solution c Invert several times to mix 2 Prepare the wash components with fresh wash solution as follows a Add 6 ml wash
61. lows a Add 6 ml wash solution to each reservoir of the wash tray b Add 350 ml wash solution to the 500 ml wash bottle 3 Load the wash tray and wash bottle onto the instrument a Open the reagent compartment door and reagent chiller door and remove the used reagent cartridge or wash tray from the previous run The reagent cartridge should slide easily from the chiller MiSeq System User Guide o 3 USEM 99UBEUSILIEW e bulwopsg Maintenance Procedures 84 f Slide the wash tray into the reagent chiller until it stops Close the reagent chiller door Raise the sipper handle in front of the PR2 bottle and waste bottle until it locks into place and replace the PR2 bottle with the wash bottle NOTE Discard the PR bottle after each run Do not reuse any remaining PR2 Remove the waste bottle and discard the contents appropriately Return the waste bottle to the reagent compartment Slowly lower the sipper handle making sure that the sippers lower into the wash bottle and waste bottle Close the reagent compartment door Select Next The first wash begins Perform Second Wash L NOTE Always use fresh wash solution for each wash step Reusing wash solution from the previous wash can return waste to the fluidics lines 1 Prepare fresh wash solution with Tween 20 and laboratory grade water as follows d b C Add 5 ml 100 Tween 20 to 45 ml laboratory grade water This results in 10 Tween 20 Add 25 ml 10 Tween
62. m User Guide 6 5 sjuabeay Duned ld Performing a Run Figure 30 Maximum Water Line Allow the reagent cartridge to thaw in the room temperature water bath for approximately 1 hour or until completely thawed Remove the cartridge from the water bath and gently tap it on the bench to dislodge water from the base of the cartridge Dry the base of the cartridge Inspect the Reagent Cartridge 56 1 Invert the reagent cartridge ten times to mix the thawed reagents and then visually inspect that all positions are thawed Visually inspect the reagent in position 1 to make sure that it is fully mixed and free of precipitates Gently tap the cartridge on the bench to reduce air bubbles in the reagents L NOTE The MiSeg sipper tubes go to the bottom of each reservoir to aspirate the reagents so it is important that the reservoirs are free of air bubbles Place the reagent cartridge on ice or set aside at 2 to 8 C up to 6 hours until ready to set up the run For best results proceed directly to loading the sample and setting up the run x WARNING IN This set of reagents contains formamide an aliphatic amide that is a probable j reproductive toxin Personal injury can occur through inhalation ingestion skin contact and eye contact Dispose of containers and any unused contents in accordance with applicable local governmental safety standards For more information see the MSDS for this kit at www illumina com msds
63. mum of 60 seconds before turning the power switch back to the ON position MiSeq System User Guide o 9 90 Part 15027617 Rev H Troubleshooting Introduction ns 92 Resolving Run Setup Errors 2 2 aman ir 93 Resolving RFID Read Failure 0 aa 95 Troubleshooting Flow Rate Error a 97 Performing a Volume Test aa 98 Measuring Expected Wash Volumes cle cece cece cee ee ee eee eee 101 o mo pene CE SS AC ea a le U NATGCGGCATE ta serca re MiSeq System User Guide 9 g 19IdeyO Troubleshooting Introduction 92 This section describes common troubleshooting steps to take before contacting lumina Technical Support For most errors an on screen message appears with instructions for correcting the error For technical questions visit the MiSeq support pages on the Illumina website for access to frequently asked questions or log in to your Mylllumina account for access to support bulletins For problems with run quality or performance contact Illumina Technical Support For more information see Technical Assistance on page 107 The Illumina Technical Support representative might ask for copies of run specific files for troubleshooting purposes The following files are located at the root level of the output run folder SampleSheet csv RunParameters xml RunInfo xml Interop folder Part 15027617 Rev H Resolving Run Setup Errors If any checks in the pre run check fa
64. n Monitor your run from the MCS interface or from another computer using Sequencing Analysis Viewer SAV Perform a post run wash using laboratory grade water mixed with Tween 20 63 MO LDJOM SIN Performing a Run 64 Cluster Generation During cluster generation single DNA molecules are bound to the surface of the flow cell and then bridge amplified to form clusters Sequencing Following cluster generation clusters are imaged using LED and filter combinations specific to each of the four fluorescently labeled dideoxynucleotides After imaging of one tile of the flow cell is complete the flow cell is moved into place to expose the next tile The process is repeated for each cycle of sequencing Following image analysis the software performs primary analysis which includes base calling filtering and quality scoring Analysis When the run is complete the Illumina Experiment Manager analysis software launches automatically to perform secondary analysis which includes alignment and variant calling You can monitor secondary analysis using an internet connection from another computer For more information see MiSeg Reporter Overview on page 57 Part 15027617 Rev H Preparing Reagents The MiSeq Reagent Kit contains a tube of HT1 the reagent cartridge and a bottle of PR2 For best results carefully follow the reagent preparation instructions Component Storage Preparation Requirements HT1 15 to Thaw f
65. n the path to the installable software file appears on the screen select Update Alternatively you can update your software automatically if your instrument is connected to a network For more information see Software Updates on page 24 MiSeq System User Guide 3 U9BJOS JUSLUNIISU LeueN Run Setup Screens When you select Seguence on the Welcome screen a series of run setup screens open in the following order BaseSpace Option Load Flow Cell Load Reagents Review and Pre Run Check BaseSpace Options Screen The first screen in the run setup steps provides the option to use BaseSpace for storage and analysis To enable access you need a network connection and a Mylllumina account For more information see BaseSpace Overview on page 56 MiSeq Software Figure 16 BaseSpace Options Screen Mumina MiSeq Base Space pas Options Please select BaseSpace option Y Use BaseSpace for storage and analysis all raw data from this run will also be stored on this instrument Enter your Mylllumina account Email Password If you do not have an account please go to hitps my illumina com to sign up Load Flow Cell Screen The Load Flow Cell screen prompts you to load the flow cell After the flow cell is in place close the flow cell latch and flow cell compartment door Both the latch and compartment door must be closed before beginning the run 3 o Part 15027617 Rev H Figure 17 Load Flow Cell Screen
66. nd the screen sharing session at any time Access Live Help from the help icon on the Welcome screen Figure 28 Help Menu LIVE HELP ABOUT To enable a connection obtain a unique access code from Illumina Technical Support enter that code on the Live Help screen and then select Next Figure 29 Live Help Screen Mumina MiSeg Please follow below instructions to log into MiSeg Live Help Enter the access code provided to you by your Illumina Representative in the Access Code field below using the keyboard icon and select Next to start the screen sharing session You might be prompted to download a small virus free plug in This plug in will not stay on the instrument and will be removed once the support session is closed When your session has started your Illumina support representative will ask to take control of your instrument You have overnding control and can end the screen sharing session at any time Instrument ID M99999 Machine Name CONFIG376VMOE dd Back MiSeq System User Guide 5 9 dieu BAN 50 Part 15027617 Rev H Performing a Run 1 nn n nn nn na bos si land n osi kan ud dod oso a zni io bb ban oz koi s So Bn v 62 MiSeq Workflow gt nas TO O O I DO RO A aooaa 63 Preparing Reagents res 65 Loading Sample Libraries onto Cartridge o 67 Setting Up a Run Using MCS aa 68 Cleaning the Flow AA AA 69 Loading the Flow Cell a
67. ndard flow cell is imaged in 14 tiles on the top surface and 14 tiles on the bottom surface which results in the following tile numbering format Image files named 1101 through 1114 are tiles 1 14 on the top surface Image files named 2101 through 2114 are tiles 1 14 on the bottom surface The same tile numbering format is used with micro flow cells Image files named 1101 through 1104 are tiles 1 4 on the top surface Image files named 2101 through 2104 are tiles 1 4 on the bottom surface For nano flow cells image files are named for tiles one and two on the top surface 1101 and 1102 The output files for each tile are located in the run folder in Data Intensities L001 MiSeg System User Guide D SJ9P O0 UNH MiSeq Software Run Duration Run duration depends on the number of cycles you perform You can perform a paired end run up to 2 x 251 sequencing cycles plus any Index Reads with MCS v2 0 Additionally run duration depends on the version of MiSeq reagents you are using and any performance enhancing upgrades installed on your instrument For expected durations and other specifications visit the MiSeq System specifications page on the Illumina website www illumina com systems miseg performance specifications ilmn Number of Cycles in a Read 52 The number of cycles performed in a read is one more cycle than the number of cycles analyzed The one extra cycle is required for phasing and prephasing calculations
68. ng on the instrument If salts dry in the imaging area imaging can also be affected Figure 33 Rinse Flow Cell R i MiSeq System User Guide 6 9 189 Moj ay Bulueej9 Performing a Run 70 Using care around the black flow cell port gasket outlined in orange in the illustration below thoroughly dry the flow cell and cartridge using a lint free lens cleaning tissue Gently pat dry in the area of the gasket and adjacent glass Figure 34 Flow Cell Ports and Gasket illumina Using an alcohol wipe clean the flow cell glass making sure that the glass is free of streaks and fingerprints and that the flow cell is completely free of lint or tissue fibers Avoid using the alcohol wipe on the flow cell port gasket Figure 35 Dry Flow Cell Dry any excess alcohol with a lint free lens cleaning tissue and visually inspect to make sure that the flow cell ports are free of obstructions and that the gasket is well seated around the flow cell ports If the gasket appear to be dislodged gently press it back into place until it sits securely around the flow cell ports Part 15027617 Rev H Loading the How Cell 1 4 Raise the flow cell compartment door and then press the release button to the right of the flow cell latch The flow cell latch opens Figure 36 Open Flow Cell Latch Visually inspect the flow cell stage to make sure it is free of lint If lint or other debris is present clean the flow cell stage using
69. not pass perform a maintenance wash See Procedure on page 83 9 When the maintenance wash is complete repeat the volume test 1 00 Part 15027617 Rev H Measuring Expected Wash Volumes Measuring expected wash volumes confirms that wash fluidics are performing efficiently 1 Before beginning a wash empty the waste bottle 2 When the wash is complete measure the wash volume in the waste bottle Wash Type Expected Wash Volume Post Run Wash 17 25 ml Standby Wash 46 ml Maintenance Wash 17 25 ml MiSeq System User Guide 1 01 saunjoA USEM paj dadxa buunsea 1 1 O 2 Part 15027617 Rev H Index A activity indicators 23 analysis during sequencing 58 options 56 analysis workflow definition 21 B base calls 45 BaseSpace connection 23 credentials 35 run setup 68 screen 38 C chastity filter 45 cluster density 45 cluster generation 63 components ow cell 7 flow cell compartment 5 6 optics module 5 reagent cartridge 8 reagent compartment 5 8 consumables compatibility 15 Illumina supplied 10 user supplied 16 copying files and folders 28 customer support 107 cycles in a read 52 D deleting files and folders 28 disk space checking 53 MiSeq System User Guide XapUu low disk space 94 documentation 107 domain name 35 E email alerts 30 flow cell cap color 14 69 cleaning 69 letter designator 95 loading 38 71 micro 14 nano 14 overview 7 single lane 47 tile numbering 51 flow
70. on page 30 Manage Instrument Provides options to go to system settings to perform a systems check to manually update software and to reboot or shut down the instrument See Manage Instrument Screen on page 34 Updates Available This option appears on the Welcome screen only if a software update is available Your MiSeq must be connected to a network with internet access to enable this option See Software Updates on page 24 Part 15027617 Rev H Activity Indicators A series of icons are located in the lower right corner of each interface screen Each icon is an activity indicator that shows which activity the instrument is performing Figure 4 Activity Indicators Uu99J9S 9U1J09 9M From left to right the activity indicators represent the following activities Moving the Y stage Moving the Z stage Activating electronics functionality Using the camera Pumping through the fluidics system Sensor lndicators Four sensor indicators are located at the base of each interface screen each representing the status of an instrument component Figure 5 Sensor Indicators From left to right the sensor indicators represent the following components Flow cell compartment door closed or open Temperature of the reagent chiller in C Temperature of the flow cell in C Status of BaseSpace connection not connected shown Status Icons In the top right corner of the Welcome screen is a status icon that signals any change in
71. opyright notice this list of conditions and the following disclaimer 2 Redistributions in binary form must reproduce the above copyright notice this list of conditions and the following disclaimer in the documentation and or other materials provided with the distribution 3 Neither the name of the FU Berlin or Knut Reinert nor the names of its contributors may be used to endorse or promote products derived from this software without specific prior written permission THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS AS IS AND ANY EXPRESS OR IMPLIED WARRANTIES INCLUDING BUT NOT LIMITED TO THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE ARE DISCLAIMED IN NO EVENT SHALL THE COPYRIGHT HOLDER OR CONTRIBUTORS BE LIABLE FOR ANY DIRECT INDIRECT INCIDENTAL SPECIAL EXEMPLARY OR CONSEQUENTIAL DAMAGES INCLUDING BUT NOT LIMITED TO PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES LOSS OF USE DATA OR PROFITS OR BUSINESS INTERRUPTION HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY WHETHER IN CONTRACT STRICT LIABILITY OR TORT INCLUDING NEGLIGENCE OR OTHERWISE ARISING IN ANY WAY OUT OF THE USE OF THIS SOFTWARE EVEN IF ADVISED OF THE POSSIBILITY OF SUCH DAMAGE Part 15027617 Rev H Revision History Part Revision Date 15027617 H March 2013 15027617 G January 2013 15027617 F November 2012 MiSeq System User Guide Description of Change Added section titled MiSeg Concepts that in
72. or use in diluting denatured libraries if applicable 20C Reagent Cartridge 15 to Thoroughly thaw and inspect prior to use P PR2 Bottle 2 to 8 C Use directly from 2 to 8 C storage Prepare HT 1 The tube of HT1 Hybridization Buffer is used to dilute denatured libraries prior to loading them onto the reagent cartridge for sequencing This step does not apply to TruSeq Amplicon libraries either Custom Amplicon or Cancer Panel or Nextera XT libraries For all other libraries you need to thaw H11 1 Remove the tube of HT1 Hybridization Buffer from 15 to 25 C storage and set aside at room temperature to thaw 2 When thawed store at 2 to 8 C until you are ready to dilute denatured libraries For more information see Preparing DNA Libraries for Sequencing on the MiSeg Part 15039740 Thaw Reagent Cartridge The following instructions describe how to thaw the reagent cartridge using a room temperature water bath This method requires approximately 1 hour 1 NOTE Alternatively you can thaw reagents overnight in 2 to 8 C storage Reagents are j stable up to one week when stored at this temperature 3 Remove the reagent cartridge from 15 to 25 C storage 4 Place the reagent cartridge in a water bath containing enough room temperature deionized water to submerge the base of the reagent cartridge Do not allow the water to exceed the maximum water line printed on the reagent cartridge MiSeq Syste
73. oting Flow Rate Error aa 97 Performing a Volume Test u a 98 Measuring Expected Wash Volumes 0202 101 O AA 103 Technical Assistance 107 VI Part 15027617 Rev H Getting Started Introduction ne 2 Components ES S O EE i b na 5 MiSeq Reagent Kits aaa 10 Kit Contents and Storage Requirements 2222222 12 Flow Cell Types nes 14 Version Compatibility and Requirements a 15 User Supplied Consumables iii 16 Anti Virus Software iii 1 Starting the MiSeg a 18 Poa e errr gt 3 ag ea eee y s a i l TE aa a A pi l nuas masara 6 Kang MiSeq System User Guide 1 JOJACUD Getting Started Introduction The Illumina MiSeq System combines proven sequencing by synthesis SBS technology with a revolutionary workflow that enables you to go from DNA to analyzed data in as Features little as eight hours The MiSeg integrates cluster generation seguencing and data analysis on a single instrument Walkaway Automation After setting up your run which includes loading the pre filled reagent cartridge buffer bottle and flow cell no additional hands on time is required Pre filled Reagent Cartridge A specially designed single use pre filled reagent cartridge provides reagents for cluster generation and sequencing including paired end sequencing reagents and
74. ough the outlet port Waste exiting the flow cell is delivered to the waste bottle Samples are loaded onto the reagent cartridge prior to beginning the run and then automatically transferred to the flow cell after the run begins During the sequencing run the single lane is imaged in small imaging areas called tiles All MiSeq flow cells have a single lane but the number of tiles differ depending on the type of flow cell you are using For more information see Flow Cell Types on page 14 MiSeq System User Guide s juauoduuo Getting Started Reagent Compartment Reagent Chiller Sipper Handle shown in raised position PR2 Bottle Waste Bottle Reagent Cartridge m 0 OU E The reagent compartment contains the reagent chiller and positions for the wash buffer PR2 bottle and the waste bottle During the run the reagent chiller holds a single use reagent cartridge During the instrument wash the reagent chiller holds the wash tray The software automatically lowers sippers into each reservoir of the reagent cartridge at the appropriate time during a run depending on the process being performed To the right of the reagent chiller are two form fitted slots one for the PR2 bottle and one for the waste bottle The sipper handle locks the bottles in place and lowers the appropriate sipper into each bottle Reagents are pumped through the sippers and fluidics lines and then to the flow cell Reagent waste is delivered to t
75. porter off line For more information see Run Folders on page 48 Email Notifications Tab MiSeq can be configured to send an email notification when primary analysis is complete when on instrument secondary analysis is complete or if a critical MiSeg software error occurs Figure 11 Email Notifications Tab Mumina MiSeq Please make any needed changes to the Run Options Run Settings Folder Settings Email Notifications Local SMTP email server address required Sender address required on SMTP server Notify vla emall when Primary analysis Is complete C On instrument analysis is complete a A critical MiSeq Software error occurs Cancel Return 412 00000 Local SMTP email server address Use the on screen keyboard to enter the local SMTP email server address If necessary contact the facility administrator for this information Sender email address Use the on screen keyboard to enter the sender email address This can be your email address or a different address specified for sending email Part 15027617 Rev H notifications The sender email address must have the same domain name as the email server address Email addresses Use the on screen keyboard to enter the email addresses of each recipient to receive notifications Separate each email address with a comma Select Test to send a test email to notification recipients Notify via email when Select the checkbox for each of the run events that
76. ppear on the Sequencing screen at different points in a run During cluster generation steps no metrics appear After sequencing begins the following metrics appear at the indicated cycles Cycle Metric Cycle 1 4 Intensity Cycle 4 25 Intensity and Cluster Density Cycle 25 through run completion Intensity Cluster Density PF Yield and Q scores For MiSeg run specifications visit the MiSeq System specifications page on the Illumina website www illumina com systems miseg performance specifications ilmn MiSeq System User Guide uny SU BUUOJIUOV 78 Part 15027617 Rev H Maintenance Procedures Introduction ns 80 Performing a Post Run Wash sb oso NO NE s r 81 Performing a Maintenance Wash 0 a 83 Performing a Standby Wash 222 2 0 aa 86 Shutting Down the Instrument aa 89 3 za eer baa KA m TEE we j Ee ln es a T Fol gt m Arca itt Pa x MiSeg System User Guide F 9 y 19IdeyO Maintenance Procedures Introduction Always perform an instrument wash following the completion of a sequencing run Regular instrument washes ensure continued performance in the following ways Flushes any remaining reagents from the fluidics lines and sippers Prevents salt accumulation and crystallization in the fluidics lines and sippers Prevents cross contamination from the previous run Maintenance Frequency Ilumina recommends that you perform the following ma
77. r Stopping a ST 54 Secondary Analysis Options i 56 Live Help a 59 m ih uf Clay F st EGA AT C AT H T Corra Icon L e MiSeq System User Guide 1 9 Z 491TEUJ MiSeq Software Introduction Three software applications are pre installed on the instrument computer MiSeq Control Software MCS Controls instrument operation Real Time Analysis RTA Performs primary analysis MiSeq Reporter Performs secondary analysis Optional software used off instrument includes the Sequencing Analysis Viewer SAV For more information see Sequencing Analysis Viewer on page 47 MiSeq Control Software MCS The MiSeq Control Software MCS interface guides you through the steps to load the flow cell and reagents prior to starting the run and then provides an overview of quality statistics that you can monitor as the run progresses During the run MCS operates the flow cell stage in the enclosed optics module gives commands to dispense reagents changes temperatures of the flow cell and captures images of clusters on the flow cell for image analysis MCS performs the run according to parameters specified in the sample sheet Real Time Analysis RT A The integrated primary analysis software Real Time Analysis RTA performs image analysis and base calling and assigns a quality score to each base for each cycle Images are temporarily stored in the run folder for processing by RTA
78. reagent compartment door 11 Select Next The post run wash begins When the wash is complete leave the used flow cell wash tray and wash bottle containing the remaining wash solution on the instrument I NOTE The sippers will remain in the down position This is normal Leave the unused wash solution in the wash tray and wash bottle to prevent the sippers from drying out and air from entering the system 8 2 Part 15027617 Rev H Performing a Maintenance Wash Perform a maintenance wash every 30 days to ensure optimal performance The maintenance performs a series of three wash steps using a wash solution of laboratory grade water mixed with Tween 20 The maintenance wash takes approximately 90 minutes User Supplied Consumables Tween 20 Sigma Aldrich catalog P7949 Laboratory grade water Procedure 1 Make sure that a used flow cell is loaded on the instrument 2 From the Welcome screen select Perform Wash 3 From the Perform Wash screen select Maintenance Wash The software automatically raises the sippers in the reagent chiller Perform First Wash 1 Prepare fresh wash solution with Tween 20 and laboratory grade water as follows a Add 5 ml 100 Tween 20 to 45 ml laboratory grade water This results in 10 Tween 20 b Add 25 ml 10 Tween 20 to 475 ml laboratory grade water This results in a 0 5 Tween 20 wash solution c Invert several times to mix 2 Prepare the wash components with fresh wash solution as fol
79. recipes Recipes are XML files that the software uses to perform the seguencing run A recipe is created at the start of the run based on parameters in the sample sheet After a run specific recipe is created it is copied to the output folder NOTE 7 By default custom recipes are stored in D VIllumina MiSeq Control Software CustomRecipes MiSeg Control Software MCS requires two subfolders V1 and V2 Any custom recipes created for use with the original MiSeg Reagent Kit v1 must be placed in the V1 subfolder and recipes created for use with the MiSeg Reagent Kit v2 must be placed in the V2 subfolder You can browse to the custom recipes folder and create subfolders from the Manage Files screen For more information see Manage Files Screen on page 28 MiSeq System User Guide 31 ue89J9S SUOIIdO uny MiSeq Software 32 Sample Sheets Sets the default location for sample sheets Sample sheets are files that you create prior to starting a run and that contain the parameters for your run Manifests Sets the default location for manifest files Manifests are files used only for seguencing TruSeg Custom Amplicon and Nextera XT libraries They contain the amplicon seguences to which clusters are aligned during analysis MiSeqOutput Sets the default location for analysis output files Ilumina recommends changing the default output folder to a network location for the purpose of sharing long term storage and optionally using MiSeg Re
80. rimers on the MiSeg MiSeq Reporter User Guide MiSeq Reporter Online Help BaseSpace Online Help MiSeq System User Guide Description Provides specifications for laboratory space electrical requirements and environmental considerations Provides information about instrument labeling compliance certifications and safety considerations Provides a two page graphical representation of the workflow for the experienced user The quick reference cards summarize sample prep run setup and run monitoring as well as provide an overview of the analysis performed by MiSeq Reporter Provides instructions for creating sample plates and sample sheets for different workflows and library types Illumina recommends that you create your sample sheet during the sample preparation step Provides information about sample sheet requirements The information in this guide is applicable whether you are creating a sample sheet manually or using the Illumina Experiment Manager Provides a description of kit contents and instructions for preparing the reagent cartridge before beginning your sequencing run Provides instructions for denaturing and diluting prepared sample libraries prior to sequencing on the MiSeq and preparing a PhiX control This step applies to most library types Provides instructions for preparing and loading custom primers and editing the samples sheet for custom primers Provides a comprehensive overview of analy
81. rtridge present RTE IGT e change na Flow Cell Barcode FC1234567 ABCDE Caller Door Closed Sample Sheet Kit Barcode 4 L 3 00000 it mae 4 Part 15027617 Rev H In the event that the RFID cannot be read you can obtain a temporary bypass code from Humina that enables you to proceed with the run setup steps For more information see Resolving RFID Read Failure on page 95 You must use the reagent cartridge associated with the type of flow cell that you loaded If the reagent cartridge is not compatible a message appears on the screen Select Back to load the appropriate reagent cartridge or Exit to return to the Welcome screen Select the help icon in the upper right corner of the screen The help file contains a video that illustrates the steps for loading the reagent cartridge and for loading the PR2 bottle Change Sample Sheet Every run must have a sample sheet By default the software looks for a sample sheet file with a name matching the barcode number of the reagent cartridge loaded on the instrument If a sample sheet is not found a message appears that prompts you to browse to the location of the correct sample sheet for your run susal19s dnjas uny To prevent the software from searching unsuccessfully use the Change Sample Sheet option on the Load Reagents screen to direct the software to the appropriate sample sheet Review Screen The Review screen confirms that the software has located the sample sheet for
82. sis procedures analysis workflows and output files generated by MiSeq Reporter as well as computing requirements off instrument installation instructions and troubleshooting information Provides instructions for using the MiSeq Reporter interface Provides instructions for using BaseSpace and descriptions of the graphs generated for each analysis workflow 3 UON INP04 U Getting Started Visit the MiSeq support page on the Illumina website for access to documentation software downloads and frequently asked questions To view a comprehensive list of MiSeq training courses go to www illumina com training miseq Part 15027617 Rev H Components The MiSeg has the following exterior components SJU9UOdUlo 9 A Flow Cell Compartment Contains the flow cell stage that houses the flow cell throughout the run The flow cell stage is controlled by motors that move the stage out of the enclosed optical module for flow cell loading and returns it when the run begins B Enclosed Optics Module Contains optical components that enable imaging of the flow cell C Status Bar Uses three colors to indicate instrument status Blue indicates the instrument is processing orange indicates the instrument needs attention and green indicates that the instrument is ready to begin the next run D Touch Screen Monitor Enables on instrument configuration and run setup using the software interface E External USB Ports Fac
83. solution to each reservoir of the wash tray b Add 350 ml wash solution to the 500 ml wash bottle 3 When the run is complete select Start Wash The software automatically raises the sippers in the reagent chiller 4 Open the reagent compartment door and reagent chiller door and remove the used reagent cartridge from the chiller The reagent cartridge should slide easily from the chiller 5 Slide the wash tray into the reagent chiller until it stops and then close the reagent chiller door MiSeq System User Guide 31 USE M UNH 1sOg e BUILUJOLI9 g Maintenance Procedures 6 Raise the sipper handle in front of the PR2 bottle and waste bottle until it locks into place 7 Remove the PR bottle and replace it with the wash bottle L NOTE Discard the PR bottle after each run Do not reuse any remaining PR2 8 Remove the waste bottle and discard the contents appropriately Return the waste bottle to the reagent compartment 1 WARNING F This set of reagents contains formamide an aliphatic amide that is a probable i reproductive toxin Personal injury can occur through inhalation ingestion skin contact and eye contact Dispose of containers and any unused contents in accordance with applicable local governmental safety standards For more information see the MSDS for this kit at www illumina com msds 9 Slowly lower the sipper handle making sure that the sippers lower into the wash bottle and waste bottle 10 Close the
84. structions e Listed files and folders used for troubleshooting run performance Updated software descriptions to MCS v1 1 Added information about anti virus protection Updated the following information e Instructions to resolve RFID failure e Preparing libraries Changed to 0 2 N NaOH e Run folder naming convention e Required disk space and storage capacity e Run setup steps Added more information to Setting Up the Sample Sheet e Run setup steps Added note to dispose of remaining PR2 e Analysis duration Added when analysis exceeds two hours e Analysis Input Requirements Listed manifest files as required for TruSeq Custom Amplicon libraries e Corrected HT1 tube size in MiSeq Reagent Kit Contents e Changed iCom references to Mylllumina Initial release Part 15027617 Rev H Table of Contents Revision History iii Table of Contents aaa anaana aoaaa iii vii Chapter 1 Getting Started 1 MTOGUCIOM T 2 Components ns 9 MiSeg Reagent Kits cono cno none 10 Kit Contents and Storage Requirements 2 020 12 Flow Cell Types 2222222 ii 14 Version Compatibility and Requirements o ooo 15 User Supplied Consumables a 16 Anti Virus Software o iii af Starting the MiSeg 2i 18 Chapter 2 MiSeq Software i n 19 Introduction 20 MiSeq Concepts nes 21 Welcome Screen a 22 Perform Wash Screen iu 26 Manage Files Screen 2 28 Run Options Scre
85. t contains information required to set up and analyze a sequencing run including a list of samples and their index sequences The sample sheet must be provided during the run setup steps on the MiSeq After the run begins the sample sheet is renamed to SampleSheet csv and copied to the run folders MiSeq Temp MiSeqOutput and MiSeq Analysis For more information about analysis workflows and manifest file formats see the MiSeg Reporter User Guide Part 15028784 For more information about sample sheets see the MiSeg Sample Sheet Quick Reference Guide Part 15028392 MiSeq System User Guide 2l S ABJU01 bDaISIIN MiSeq Software Welcome Screen 22 The MCS interface opens to the Welcome screen when the software launches Figure 3 Welcome Screen lumina Miseq Welcome to lllumina MiSeg MANAGE INSTRUMENT Sequence This option opens a series of run setup screens that guide you through the setup steps for your run See Run Setup Screens on page 38 Perform Wash Provides options to start two types of instrument washes either a maintenance wash or standby wash See Perform Wash Screen on page 26 Manage Files Provides controls for moving deleting and uploading files on the instrument computer See Manage Files Screen on page 28 Run Options Provides options for the post run wash changing default locations of data folders and specifying email notification preferences See Run Options Screen
86. t have an account please go to hitps my illumina com to sign up 5 6 Part 15027617 Rev H When you begin your seguencing run the BaseSpace icon changes to indicate that the MiSeq is connected to BaseSpace and data files are being transferred to your secure location Data files are encrypted in transit decrypted during analysis and encrypted again when stored Figure 27 Connected to BaseSpace Icon BaseSpace automatically disconnects from the MiSeq at the end of the run or as soon as all primary analysis files have finished uploading If the internet connection is interrupted analysis files will continue uploading after the connection is restored from the point when the interruption occurred As soon as the last base call file is uploaded to BaseSpace secondary analysis of your data begins The same analysis workflows are supported on BaseSpace as with on instrument analysis using MiSeq Reporter You can connect to BaseSpace at https basespace illumina com Log in using your Mylllumina account login The first time you visit you will be asked to accept the BaseSpace agreement After that you are ready to view your analysis results For more information about using BaseSpace see the BaseSpace online help on the Illumina website www illumina com help BaseSpaceHelp BaseSpaceHelp htm MiSeq Reporter Overview MiSeq Reporter is a Windows Service application that processes base calls generated by primary analysis MiSeq Reporter
87. tensity Q Score All Cycles Flow Cell 1 T 5 0 060 L L 0 070 10 zu K Score v M 40 a falues Update After Cycle 5 Cluster Density K mm2 Clusters Passing Filter Estimated Yield MB UM Gp ems b Z 00000 Run Progress Shows run progress in a status bar and lists the number of cycles completed BaseSpace User Shows the BaseSpace user name and shows the progress as files are uploaded to BaseSpace Intensity Shows the value of cluster intensities of the 90 percentile for each tile The graphic in the Intensity area represents the number of tiles and number of surfaces being imaged If the flow cell is imaged on the top surface only a single column graphic appears If the flow cell is image on the top surface and bottom surface a two column graphic appears MiSeq System User Guide A 5 usa 9s Hulduanbag MiSeq Software A Two tiles top surface only B Four tiles top and bottom surface Q Score All Cycles Shows the average percentage of bases greater than Q30 which is a quality score O score measurement A Q score is a prediction of the probability of a wrong base call Q scores are calculated after cycle 25 O Score Probability of Wrong Base Call 040 1 in 10 000 030 1 in 1 000 020 1 in 100 010 1 in 10 Cluster Density K mm Shows the number of clusters per square millimeter for the run Optimally the cluster density should be 800K mm However a range of 50
88. the instrument and start the software Primary analysis from the previous run is not complete The default time to allow primary analysis to complete is 1 hour and a countdown appears on the screen The options are to wait 1 hour or select Terminate Analysis Any incomplete cycles will not be available for secondary analysis 99 SIO dnjas uny BUIAJOSEH Troubleshooting 94 Error X Sample Sheet Present Action If you did not name your sample sheet with the reagent cartridge ID for your run the instrument cannot locate the appropriate sample sheet automatically Browse to the sample sheet for your run If you named your sample sheet with the reagent cartridge ID for your run make sure that the sample sheet is located in the default sample sheet folder Check the default folder location in Run Options on the Welcome screen Make sure that the sample sheet file extension is csv If the sample sheet is missing create one and copy it to the sample sheet locations specified in Run Options When you have located a sample sheet select Restart Check Part 15027617 Rev H Resolving RFID Read Failure In the event that the system cannot read the RFID of a consumable you can obtain a temporary bypass code from the Illumina website A temporary bypass code expires in seven days 1 Always select Retry before proceeding If the RFID failed a second time select Get Code 2 From a computer with internet access go to h
89. trigger a notification MiSeg System User Guide 3 3 ue89J9S SUOIIdO uny Manage Instrument Screen The Manage Instrument screen contains controls for system settings troubleshooting manually updating software and safely rebooting or shutting down the instrument software Figure 12 Manage Instrument Screen lumina MiSeq MiSeq Software Please select an activity System Settings Provides the option to change IP Settings machine name or domain See System Settings Screen on page 35 System Check Provides troubleshooting options for checking the operational status of instrument components See System Check Screen on page 36 Manual Update Provides the option to manually update software on the instrument computer See Manual Update Screen on page 37 Reboot Use the Reboot command to safely reboot the system software if needed for troubleshooting There is no requirement to periodically reboot the software Shut Down Use the Shut Down command to safely shut down the control software and Windows on the instrument computer See Shutting Down the Instrument on page 89 Minimize to Windows Provides quick access to the instrument operating system and any folders located on the instrument computer when MCS is running in kiosk mode opposed to Windows mode 3 4 Part 15027617 Rev H System Settings Screen System Settings are normally configured when the instrument is initially installed and started for the first time
90. troduces the analysis workflow manifest file and sample sheet Removed information about FASTO file generation manifest file formats analysis workflow details and sample sheet details For information about these topics see the MiSeq Reporter User Guide Part 15028784 or the MiSeq Sample Sheet Quick Reference Guide Part 15028392 Removed instructions for preparing custom primers For more information see Using Custom Primers on the MiSeq Part 15041638 Removed instructions for denaturing and diluting DNA libraries and preparing an Illumina PhiX control See Preparing DNA Libraries for Sequencing on the MiSeg Part 15039740 Updated instrument wash instructions to add 25 ml 10 Tween 20 to 475 ml laboratory grade water instead of 500 ml laboratory grade water Added the following new information e Added kit descriptions for new MiSeq reagent kits MiSeq Reagent Nano Kit and MiSeq Reagent Micro Kit e Added overview of flow cell types e Added description of Enrichment analysis workflow Updated the following information e New in MCS v2 1 updated Perform Wash screen to add a post run wash option and command to raise sippers e Updated version compatibility table to include nano and micro kit dependencies e Updated version compatibility information to include new reagent kits Part Revision Date Description of Change 15027617 E October Updated the following information 2012 e Corrected PhiX control preparation
91. ttps my illumina com and log in to your Mylllumina account 3 From the Mylllumina page click Account In the Resources column click MiSeg Self Service 4 On the MiSeq Self Service page enter the MiSeq serial number 5 From the Type of Override Code drop down list select RFID Override Figure 43 MiSeg Self Service Page Mylllumina Account MiSeg Self Service Self Service for MiSeq daa diosa Note The MiSeq serial number can be found under the title Instrument Name in the About menu Description of the Issue Type of Override Code GET CODE 6 To generate the code select Get Code 7 Return to the MCS interface and select Enter Code 8 Enter the temporary bypass code using the on screen keyboard and then select Next 9 Enter the barcode number of the flow cell PR2 bottle or reagent cartridge MiSeg System User Guide 9 5 a1n 1e 4 pesy q148 Bulnjosay Troubleshooting 96 Consumable Barcode Number Location Flow Cell Above the barcode on the flow cell container label Flow cell barcode numbers begin with an A standard D micro or G nano Example A0F61 PR2 Bottle Below the barcode on the PR bottle label Example MS0011881 PR2 Reagent Cartridge Below the barcode on the reagent cartridge label Example MS0010744 300 10 If you are entering a bypass code for the reagent cartridge enter the version number of the kit Version 1 or Version 2 Select Enter Reagent Kit Barcode to manually enter the reagent cartrid
92. ume the run Are you sure you want to stop the run DES Stopping a run is final A stopped run cannot be resumed The only option is to proceed to an instrument wash MiSeq System User Guide 5 5 ung e BuiddoJS Jo buisned MiSeq Software Secondary Analysis Options MiSeq sequencing data can be analyzed on the instrument computer using MiSeq Reporter or on the cloud using Base Space Both BaseSpace and MiSeq Reporter produce information about alignment variants and contig assemblies for each genome requested and for each sample of a multi sample run BaseSpace Overview BaseSpace is IIlumina s analysis environment Using BaseSpace to store and analyze your run data provides the following benefits Eliminates the need for onsite storage and computing Enables web based data management and analysis Provides tools for global collaboration and sharing When setting up runs on the MiSeq you have the option to log in to BaseSpace When logged in to BaseSpace raw data from the run is also stored on the instrument or in the location of the output folder that you specified in Run Options For more information see Run Options Screen on page 30 Figure 26 BaseSpace Option Screen Mumina MiSeq Base Space cm Options Please select BaseSpace option N Use BaseSpace for storage and analysis i all raw data from this run will also be stored on this instrumen Enter your Mylllumina account Email Password If you do no
93. v2 MiSeq Reagent Nano Kit v2 MCS Version Read Length MCS v2 0 or later Up to 2 x 231 cycles MCS v2 1 or later Up to 2 x 151 cycles MCS v2 0 or later Up to 2 x 251 cycles The following table lists requirements specific to workflow enhancements and components introduced in MCS v2 0 and MCS v2 1 Workflow Component 2 x251 cycle runs Imaging of 14 tiles on a standard flow cell Dual surface flow cell imaging Sequencing on a micro flow cell four tile dual surface imaging Sequencing on a nano flow cell two tile single surface imaging MiSeq System User Guide Requirement e MCS v2 0 or later e MiSeq Reagent Kit v2 500 Cycles e MCS v2 0 or later e MiSeq Reagent Kit v2 e MCS v2 0 or later e MiSeq Reagent Kit v2 e MCS v2 1 or later e MiSeq Micro Reagent Kit v2 e MCS v2 0 or later e MiSeq Nano Reagent Kit v2 15 SIUO9UI9JINDEH pue JIIIGITEdLIO UOISIEN Getting Started User Supplied Consumables Make sure the following user supplied consumables are available before beginning a run Consumable 1 N NaOH Alcohol wipes 70 Isopropyl Or Ethanol 7096 Disposable gloves powder free Lab tissue low lint Lens paper 4 x 6 in Tween 20 Tweezers sguare tip plastic optional Water laboratory grade or equivalent Supplier General lab supplier VWR catalog 15648 9817 General lab supplier General lab supplier VWR catalog 21905 026 VWR catalog 52846 0017 Sigma Aldr
94. y lower the sipper handle making sure that the sippers lower into the wash bottle and waste bottle c Close the reagent compartment door 9 Select Next The second wash begins After the Wash When the wash is complete leave the used flow cell wash tray and wash bottle containing the remaining wash solution on the instrument L NOTE The sippers will remain in the down position This is normal Leave the unused wash solution in the wash tray and wash bottle to prevent the sippers from drying out and air from entering the system 88 Part 15027617 Rev H Shutting Down the Instrument It is best to leave the instrument on at all times However if the instrument must be turned off use the following procedure to safely shut down Windows and prepare the fluidics lines 1 Perform a maintenance wash to thoroughly wash the system For more information see Procedure on page 83 2 Remove the waste bottle and discard the contents appropriately Return the waste bottle to the reagent compartment 3 Close the reagent compartment door 4 From the Manage Instrument screen select Shut Down This command safely shuts down the software Figure 42 Manage Instrument Screen ittumina MiSeq JUSUJUNJ SU ey umog buninyg Please select an activity Bot SYSTEM MANUAL SETTINGS UPDATE m MINIMIZE TO WINDOWS 5 Toggle the power switch to the OFF position 9 iuy NOTE E Any time that you turn off the instrument wait a mini
95. y performs a pre run check of required run components and conditions before allowing the run to begin If any errors occur during the pre run check a message appears on the screen that describes the error and the action to correct it For more information see Resolving Run Setup Errors on page 93 MiSeq System User Guide 4 3 su89J9S dnjes uny MiSeq Software Figure 22 Pre Run Check Screen umina MiSeq Pre Run Check is successful Select Start Run to begin seguencing Network Connection Active Sample Sheet Present Flow Cell Cartridge Loaded Free Disk Space 93 Waste Bottle Loaded PR2 Bottle Loaded Reagent Cartridge Loaded Flow Cell Door Closed Chiller Door Closed Flow Rate Measured Primary Analysis Ready Y Y Y Y Y Y Reagent ID RG1234567 00CDE PR2 Bottle ID PR1234567 ABCDE Flow Cell Barcode FC1234567 ABCDE mm Back Start Run 00000 When the pre run check is successful the Start Run button becomes active 44 Part 15027617 Rev H Sequencing Screen The Sequencing screen opens when the run begins This screen provides a visual representation of the run in progress including intensities and quality scores Q scores For MiSeg run specifications visit the MiSeq System specifications page on the Illumina website www illumina com systems miseg performance specifications ilmn Figure 23 Sequencing Screen Mumina MiSeg RG1234567 00CDE 2X101PE PhIX v2 6pM Workflow Resequencing 151 151 In

MiSeq System User Guide - sb

Contents

Download Pdf Manuals

Related Search

Related Contents