Home

pBAD/Thio His TOPO manual

1. continued on next page Kit Contents and Storage continued BL21 Star DE3 One Shot Reagents Genotype of TOP10 Genotype of BL21 Star DE3 The table below describes the items included in the BL21 Star DE3 One Shot Chemically Competent E coli kit Box 3 Transformation efficiency is at least 1x10 cfu ug DNA Store Box 3 at 80 C Item Composition Amount S O C Medium 2 Tryptone 6 ml may be stored at room 0 5 Yeast Extract temperature or 4 C 10 mM NaCl 2 5 mM KCl 10 mM MgCl 10 mM MgSO 20 mM glucose BL21 Star DE3 21 x 50 wl pUC19 Control DNA 10 pg ul in 5 mM Tris HCI 0 5 50 ul mM EDTA pH 8 Use this E coli strain for general cloning of blunt end PCR products into the pET TOPO vectors Genotype F mcrA A mrr hsdRMS mcrBC 80lacZAM15 AlacX74 recA1 araD139 A ara leu 7697 galU galK rpsL StrR endA1 nupG Use this E coli strain for expression only Do not use these cells to propagate or maintain your construct Genotype F ompT hsdSs rsm gal dcm rne131 DE3 The DE3 designation means this strain contains the lambda DE3 lysogen which carries the gene for T7 RNA polymerase under the control of the lacUV5 promoter IPTG is required to induce expression of the T7 RNA polymerase The strain is an E coli B r strain and does not contain the on protease It also has a mutation in the outer membrane protease OmpT The lack of these two key protease
2. Cloning reaction as directed below e If you are transforming electrocompetent E coli the amount of salt in the TOPO Cloning reaction must be reduced to 50 mM NaCl 2 5 mM MgCl to prevent arcing during electroporation Dilute the stock Salt Solution 4 fold with water to prepare a 300 mM NaCl 15 mM MgCl Dilute Salt Solution Use the Dilute Salt Solution to set up the TOPO Cloning reaction as directed below Use the procedure below to perform the TOPO Cloning reaction Set up the TOPO Cloning reaction depending on whether you plan to transform chemically competent E coli or electrocompetent E coli Reminder For optimal results be sure to use a 0 5 1 to 2 1 molar ratio of PCR product TOPO vector in your TOPO Cloning reaction Note The blue color of the TOPO vector solution is normal and is used to visualize the solution Reagents Chemically Competent E coli Electrocompetent E coli Fresh PCR product 0 5 to 4 ul 0 5 to 4 ul Salt Solution lul Es Dilute Salt Solution 1 4 1u Sterile Water add to a final volume of 5 pl add to a final volume of 5 pl TOPO vector 1 pl 1 pl Total Volume 6 ul 6 pl Store all reagents at 20 C when finished Salt solution and water can be stored at room temperature or 4 C 1 Mix reaction gently and incubate for 5 minutes at room temperature 22 23 C Note For most applications 5 minutes will yield plenty of colonies for analysis Depending on your
3. Restriction digests must demonstrate the correct banding pattern when electrophoresed on an agarose gel Once the supercoiled vectors have been adapted with topoisomerase I they are lot qualified using the control reagents included in the kit Under conditions described on pages 37 38 a 750 bp control PCR product is amplified using a forward primer containing CACC at its 5 end and a reverse primer The product is TOPO Cloned into the pET TOPO vector and subsequently transformed into the One Shot TOP10 chemically competent E coli included with the kit Each lot of vector should yield greater than 85 cloning efficiency Forty transformants are characterized by restriction digest Of the transformants characterized greater than 90 should contain an insert in the correct orientation Primers are lot qualified by DNA sequencing experiments using the dideoxy chain termination technique All competent cells are tested for transformation efficiency using the control plasmid included in the One Shot kit Transformed cultures are plated on LB plates containing 100 ug ml ampicillin and the transformation efficiency is calculated Test transformations are performed in duplicate Transformation efficiency should be e Greater than 1 x 10 cfu ug plasmid DNA for TOP10 e Greater than 1 x 10 cfu ug plasmid DNA for BL21 Star DE3 In addition untransformed cells are tested for the appropriate antibiotic sensitivity and absence
4. continued on next page 31 Purifying the Recombinant Fusion Protein continued Additional There may be cases when your specific fusion protein may not be completely Purification Steps purified by metal affinity chromatography Other protein purification techniques may be utilized in conjunction with ProBond or Ni NTA to purify the fusion protein see Deutscher 1990 for more information 32 Removing N terminal Fusion Tags Introduction Removal of the N terminal Fusion Tag Using Enterokinase Removal of the N terminal Fusion Tag Using TEV Protease If you have expressed your recombinant fusion protein from any N terminal fusion pET TOPO vector the presence of either the enterokinase EK or TEV recognition site in the vector allows removal of the N terminal fusion tag from the recombinant fusion protein after purification using enterokinase or TEV protease as appropriate General guidelines are provided below If you have expressed your recombinant fusion protein from pET TOPO vectors containing the EK recognition site see below you may use a recombinant preparation of the catalytic subunit of bovine enterokinase EKMax available from Invitrogen Catalog no E180 01 to remove the N terminal fusion tag Instructions for digestion are included with the product For more information contact Technical Service see page 56 To remove EKMax from the digest EK TM Away Catalog no R180 01 is also
5. or other suitable F episome containing host strain with M13 or lambda phage expressing 17 RNA polymerase 36 Appendix Performing the Control Reactions Introduction Before Starting Producing the Control PCR Product We recommend performing the following control TOPO Cloning reactions the first time you use the kit to help you evaluate your results Performing the control reactions involves producing a control PCR product using the reagents included in the kit and using this product directly in a TOPO Cloning reaction For each transformation prepare two LB plates containing the appropriate antibiotic see page 54 for a recipe Use your thermostable proofreading polymerase and the appropriate buffer to amplify the control PCR product Follow the manufacturer s recommendations for the polymerase you are using 1 To produce the 750 bp control PCR product set up the following 50 ul PCR Control DNA Template 100 ng 1 ul 10X PCR Buffer appropriate for enzyme 5 ul dNTP Mix 0 5 ul Control PCR Primers 0 1 ug ul each 11d Sterile Water 41 5 ul Thermostable polymerase 1 2 5 units ul 1 ul Total Volume 50 ul Overlay with 70 ul 1 drop of mineral oil if required Amplify using the following cycling parameters Step Time Temperature Cycles Initial Denaturation 2 minutes 94 C 1X Denaturation 1 minute 94 C Annealing 1 minute 55 C 25X Extension 1 minute 72 C Fi
6. you will need the following reagents and equipment e 42 C water bath or electroporator with cuvettes optional e LB plates containing the appropriate antibiotic for selection two for each transformation e 37 C shaking and non shaking incubator There is no blue white screening for the presence of inserts Most transformants will contain recombinant plasmids with the PCR product of interest cloned in the correct orientation reducing the number of colonies to be analyzed Sequencing primers are included in the kit to sequence across an insert in the multiple cloning site to confirm orientation and reading frame For each transformation you will need one vial of competent cells and two selective plates e Equilibrate a water bath to 42 C for chemical transformation or set up your electroporator if you are using electrocompetent E coli e Warm the vial of S O C medium from Box 2 to room temperature e Warm LB plates containing the appropriate antibiotic i e 50 100 ug ml ampicillin or 50 100 ug ml kanamycin as appropriate at 37 C for 30 minutes e Thaw on ice 1 vial of One Shot TOP10 cells from Box 2 for each transformation continued on next page 19 Transforming One Shot TOP10 Competent Cells continued Important One Shot TOP10 Chemical Transformation Protocol 20 The number of colonies obtained after transforming the pET TOPO vectors into One Shot TOP10 cells is generally lower w
7. 1600 Faraday Avenue LOOP X Bldg 6F Inchinnan Business Park Carlsbad CA 92008 USA 3 9 15 Kaigan 3 Fountain Drive Tel 1 760 603 7200 Minato ku Tokyo 108 0022 Paisley PA4 9RF UK Tel Toll Free 1 800 955 6288 Tel 81 3 5730 6509 Tel 44 0 141 814 6100 Fax 1 760 602 6500 Fax 81 3 5730 6519 Tech Fax 44 0 141 814 6117 E mail E mail E mail tech serviceQinvitrogen com jpinfo invitrogen com eurotech invitrogen com Material Data Safety Sheets MSDSs Limited Warranty 56 MSDSs are available on our Web site at www invitrogen com On the home page click on Technical Resources and follow instructions on the page to download the MSDS for your product Invitrogen is committed to providing our customers with high quality goods and services Our goal is to ensure that every customer is 100 satisfied with our products and our service If you should have any questions or concerns about an Invitrogen product or service contact our Technical Service Representatives Invitrogen warrants that all of its products will perform according to specifications stated on the certificate of analysis The company will replace free of charge any product that does not meet those specifications This warranty limits Invitrogen Corporation s liability only to the cost of the product No warranty is granted for products beyond their listed expiration date No warranty is applicable unless all product components are stored in accordance
8. D TOPO oeste tinet hare tne integre biete 12 Specific Requirements for Cloning into pET102 D TOPO ccscsssssssssssssessessessesssesssssesesssesseseessesneseesees 13 Specific Requirements for Cloning into pET151 D TOPO sssssssessssessessssessersssesseessscessessssessaveasenseneers 15 Producing Blunt End PCR Products nara siu cc anu cepa naria atras caue ciun h anna ana aaccE 16 TOPO Cloning Reaction and Transformation eeeeeeeeetetn ttes 17 Setting Up the POP OP Cloning B actofiasodenicti tts vm esit that de SO pendet dives digit eet NE 17 Transforming One Shot TOP10 Competent Cells cocto em tices cence eset A teens t bua Ue 19 Analyzing Transformant cccccccccsesseseesesssnsnssescsescecececeenenesesesesnsnensneseseseseececeesesesesesesesnenanesesesesesceceeeeenenenens 22 Expression and PUritiCatlon a aia 24 General Guidelines for EXpressiotu ses aid o se sheie toe eau edi dere ee bananas dah os 24 Expressing the PCR Product aeo aer pep pee eee OOS mete Pide nds 26 Analyzing Samples esit idea pei E ec e THU estie OU SEREEN EE to teh eb EASRA SESAR RRT KERES 28 Purifying the Recombinant Fusion Protein nnne rnnt 31 Removing N terminal Fusion Tags c cccccscsessessssseseececeseesesesesesnsanesesescscscacecesesesesesceceeuenenesesesesesceceeeueuenenees 33 TroubleShooUng iasci iiio i medie nbi eid edd eni ebd ed ante ae ite nda 34 AppendiX sciassscecteccisc
9. HHHHHH COOH Anti Thio Antibody Detects His Patch thioredoxin R920 25 fusion proteins Note The exact epitope detected by this antibody has not been mapped continued on next page Xii Accessory Products continued Products to Purify Recombinant Fusion Proteins If you clone your gene of interest in frame with a C terminal or N terminal peptide containing a polyhistidine 6xHis tag you may use Invitrogen s ProBond or Ni NTA resins to purify your recombinant fusion protein See the table below for ordering information Product Quantity Catalog no ProBond Nickel Chelating Resin 50 ml R801 01 150 ml R801 15 ProBond Purification System 6 purifications K850 01 ProBond Purification System with 1 kit K851 01 Anti Xpress HRP Antibody ProBond Purification System with 1 kit K853 01 Anti His C term HRP Antibody ProBond Purification System with 1 kit K854 01 Anti V5 HRP Antibody Ni NTA Agarose 10 ml R901 01 25 ml R901 15 100 ml R901 10 Ni NTA Purification System 6 purifications K950 01 Ni NTA Purification System with 1 kit K951 01 Anti Xpress HRP Antibody Ni NTA Purification System with 1 kit K953 01 Anti His C term HRP Antibody Ni NTA Purification System with 1 kit K954 01 Anti V5 HRP Antibody Polypropylene Columns empty 50 R640 50 xiii Xiv Overview Introduction Introduction The Ch
10. Rev Biochem 54 237 271 Katti S K LeMaster D M and Eklund H 1990 Crystal Structure of Thioredoxin from E coli at 1 68 Angstroms Resolution J Mol Biol 212 167 184 Kido M Yamanaka K Mitani T Niki H Ogura T and Hiraga S 1996 RNase E Polypeptides Lacking a Carboxyl terminal Half Suppress a mukB mutation in Escherichia coli J Bacteriol 178 3917 3925 LaVallie E R DiBlasio E A Kovacic S Grant K L Schendel P F and McCoy J M 1993 A Thioredoxin Gene Fusion Expression System That Circumvents Inclusion Body Formation in the E coli Cytoplasm Bio Technology 11 187 193 Lindner P Bauer K Krebber A Nieba L Kremmer E Krebber C Honegger A Klinger B Mocikat R and Pluckthun A 1997 Specific Detection of His tagged Proteins With Recombinant Anti His Tag scFv Phosphatase or scFv Phage Fusions BioTechniques 22 140 149 Lopez P J Marchand I Joyce S A and Dreyfus M 1999 The C terminal Half of RNase E Which Organizes the Escherichia coli Degradosome Participates in mRNA Degradation but not rRNA Processing in vivo Mol Microbiol 33 188 199 Lu Z DiBlasio Smith E A Grant K L Warne N W LaVallie E R Collins Racie L A Follettie M T Williamson M J and McCoy J M 1996 Histidine Patch Thioredoxins J Biol Chem 271 5059 5065 Miller J H 1992 A Short Course in Bacterial Genetics A Laboratory Manual and Handbook for Escheric
11. TCCGGCTGCT AACAAAGCCC GAAAGGAAGC TGAGTTGGCT GCTGCCACCG CTGAGCAATA ACTAGCATAA 15 Producing Blunt End PCR Products Introduction Materials Needed Producing PCR Products Checking the PCR Product Once you have decided on a PCR strategy and have synthesized the primers you are ready to produce your blunt end PCR product using any thermostable proofreading polymerase Follow the guidelines below to produce your blunt end PCR product You should have the following materials on hand before beginning Note dNTPs adjusted to pH 8 are provided in the kit e Thermocycler and thermostable proofreading polymerase e 10X PCR buffer appropriate for your polymerase e DNA template and primers for PCR product Set up a 25 ul or 50 ul PCR reaction using the guidelines below e Follow the instructions and recommendations provided by the manufacturer of your thermostable proofreading polymerase to produce blunt end PCR products e Use the cycling parameters suitable for your primers and template Make sure to optimize PCR conditions to produce a single discrete PCR product e Usea 7 to 30 minute final extension to ensure that all PCR products are completely extended e After cycling place the tube on ice or store at 20 C for up to 2 weeks Proceed to Checking the PCR Product below After you have produced your blunt end PCR product use agarose gel electrophoresis to verify the quality and quantity of your PCR
12. will be destroyed because the HP thioredoxin protein will be denatured The binding of nickel ion to the 6xHis tag is not affected by denaturing conditions We generally scale up expression to a 50 ml bacterial culture for purification using a 2 ml ProBond or Ni NTA column Depending on the expression level of your recombinant fusion protein you may need to adjust the culture volume to bind the maximum amount of recombinant fusion protein to your column To grow and induce a 50 ml bacterial culture 1 Inoculate 10 ml of S O B or LB containing the appropriate antibiotic with 500 pl of the culture of the transformation reaction see page 26 step 9 Grow overnight at 37 C with shaking 225 250 rpm to ODepo 1 2 The next day inoculate 50 ml of S O B or LB containing the appropriate antibiotic with 1 ml of the overnight culture Note You can scale up further and inoculate all of the 10 ml overnight culture into 500 ml of medium but you will need to adjust the bed volume of your ProBond or Ni NTA column accordingly 4 Grow the culture at 37 C with shaking 225 250 rpm to an OD6o 0 5 2 3 hours The cells should be in mid log phase Add 0 5 1 mM IPTG to induce expression Grow at 37 C with shaking until the optimal time point determined by the pilot expression is reached Harvest the cells by centrifugation 3000 x g for 10 minutes at 4 C 7 Proceed to purification or store the cells at 80 C for future use
13. E coli pBR322 origin of replication ori Permits replication and maintenance in E coli ROP ORF Interacts with the pBR322 origin to facilitate low copy replication in E coli lacI ORF Encodes lac repressor which binds to the T7lac promoter to block basal transcription of the gene of interest and to the JacUV5 promoter in the host chromosome to repress transcription of 17 RNA polymerase 43 Map and Features of pET101 D TOPO pET101 D TOPO The figure below shows the features of the pET101 D TOPO 5753 bp vector Map The complete sequence of the vector is available for downloading from our Web site www invitrogen com or by contacting Technical Service see page 56 44 Comments for pET101 D TOPO 5753 nucleotides T7 promoter bases 209 225 T7 promoter priming site bases 209 228 lac operator lacO bases 228 252 Ribosome binding site RBS bases 282 288 292 296 TOPO cloning site directional bases 297 310 V5 epitope bases 333 374 Polyhistidine 6xHis region bases 384 401 T7 reverse priming site bases 455 474 T7 transcription termination region bases 416 544 bla promoter bases 845 943 Ampicillin bla resistance gene ORF bases 944 1804 pBR322 origin bases 1949 2622 ROP ORF bases 2990 3181 complementary strand lacl ORF bases 4493 5584 complementary strand continued on next page Map and Features of pET101 D TOPO continued The pET1
14. E coli strain is specifically designed for expression of genes regulated by the T7 promoter Each time you perform an expression experiment you will transform your plasmid into BL21 Star DE3 Do not use this strain for propagation and maintenance of your plasmid Use TOP10 instead Basal level expression of T7 polymerase particularly in BL21 Star DE3 cells may lead to plasmid instability if your gene of interest is toxic to E coli TM Note If you are expressing a highly toxic gene the BL21 Star DE3 pLysS strain is also available from Invitrogen for expression purposes The BL21 Star DE3 pLysS strain contains the pLysS plasmid to further reduce basal level expression of the gene of interest For more information see page 6 Each Champion pET Directional TOPO Expression Kit includes a positive control vector for use as an expression control see the table below In each case the gene encoding f galactosidase is directionally TOPO Cloned into the appropriate pET TOPO vector see pages 50 53 for details Transform 10 ng of TM each plasmid into BL21 Star DE3 cells using the procedure on page 26 Kit Positive Control Champion pET100 Directional TOPO Expression Kit pET100 D lacZ Champion pET101 Directional TOPO Expression Kit pET101 D lacZ Champion pET102 Directional TOPO Expression Kit pET102 D lacZ Champion pET151 Directional TOPO Expression Kit pET151 D lacZ Champion pET200 Directional TOPO Exp
15. bases 360 380 TOPO cloning site directional bases 387 400 T7 reverse priming site bases 455 474 T7 transcription termination region bases 416 544 bla promoter bases 849 947 Ampicillin b a resistance gene bases 948 1808 pBR322 origin bases 1953 2626 ROP ORF bases 2997 3188 complementary strand lacl ORF bases 4500 5612 complementary strand continued on next page 48 Map and Features of pET151 D TOPO continued Features of The pET151 D TOPO 5760 bp vector contains the following elements All pET151 D TOPO features have been functionally tested Feature Benefit T7 promoter Permits high level IPTG inducible expression of your recombinant protein in E coli strains expressing the T7 RNA polymerase T7 forward priming site Allows sequencing in the sense orientation lac operator lacO Binding site for lac repressor that serves to reduce basal expression of your recombinant protein Ribosome binding site Optimally spaced from the TOPO Cloning site for efficient translation of PCR product N terminal 6xHis tag Permits purification of recombinant fusion protein on metal chelating resin i e ProBond or Ni NTA In addition allows detection of recombinant protein with the Anti HisG Antibodies V5 epitope Allows detection of the fusion protein by the Anti V5 Antibodies Southern et al 1991 TEV recognition site Allows removal of the N terminal tag from your re
16. bound by the provisions of this license agreement You may not distribute the BL21 Star strain to others even to those within your own institution You may only transfer modified altered or original material from the cell line to a third party following written notification of and written approval from Invitrogen so that the recipient can be licensed You may not assign sub license rent lease or otherwise transfer this license agreement or any of the rights or obligation there under except as expressly permitted by Invitrogen and CNRS This license agreement is effective until terminated You may terminate it at any time by destroying all BL21 Star products in your control It will also terminate automatically if you fail to comply with the terms and conditions of the license agreement You shall upon termination of the license agreement destroy all BL21 Star strains in your control and so notify Invitrogen in writing 59 Product Qualification Introduction Vectors TOPO Cloning Efficiency Primers One Shot Chemically Competent E coli 60 This section describes the criteria used to qualify the components of the Champion pET Directional TOPO Expression Kits Restriction analysis with the enzymes below is performed on the parent vector of each pET TOPO vector to confirm its identity In each case the supercoiled vector is qualified by restriction digest prior to adaptation with topoisomerase I
17. diagnostic use 62 invitrogen Corporate Headquarters Invitrogen Corporation 1600 Faraday Avenue Carlsbad CA 92008 T 1 760 603 7200 F 1 760 602 6500 E tech service invitrogen com For country specific contact information visit our web site at www invitrogen com
18. local legislation and guidelines including EC Directive 90 219 EEC on the contained use of genetically modified organisms The purchase of this product conveys to the buyer the non transferable right to use the purchased amount of the product and components of the product in research conducted by the buyer whether the buyer is an academic or for profit entity The buyer cannot sell or otherwise transfer a this product b its components or c materials made using this product or its components to a third party or otherwise use this product or its components or materials made using this product or its components for Commercial Purposes The buyer may transfer information or materials made through the use of this product to a scientific collaborator provided that such transfer is not for any Commercial Purpose and that such collaborator agrees in writing a not to transfer such materials to any third party and b to use such transferred materials and or information solely for research and not for Commercial Purposes Commercial Purposes means any activity by a party for consideration and may include but is not limited to 1 use of the product or its components in manufacturing 2 use of the product or its components to provide a service information or data 3 use of the product or its components for therapeutic diagnostic or prophylactic purposes or 4 resale of the product or its components whether or not such product or its compon
19. molar ratio of PCR product TOPO vector see figure below Note that the TOPO Cloning efficiency decreases significantly if the ratio of PCR product TOPO vector is lt 0 1 1 or gt 5 1 see figure below These results are generally obtained if too little PCR product is used i e PCR product is too dilute or if too much PCR product is used in the TOPO Cloning reaction If you have quantitated the yield of your PCR product you may need to adjust the concentration of your PCR product before proceeding to TOPO Cloning Tip For the pET TOPO vectors using 1 5 ng of a 1 kb PCR product or 5 10 ng of a 2 kb PCR product in a TOPO Cloning reaction generally results in a suitable number of colonies 100 50 Relative Activity colonies reaction 0 0 1 1 10 PCR Product Vector Molar Ratio continued on next page 17 Setting Up the TOPO Cloning Reaction continued Using Salt Solution in the TOPO Cloning Reaction Performing the TOPO Cloning Reaction You will perform TOPO Cloning in a reaction buffer containing salt i e using the stock salt solution provided in the kit Note that the amount of salt added to the TOPO Cloning reaction varies depending on whether you plan to transform chemically competent cells provided or electrocompetent cells see page xi for ordering information e Ifyou are transforming chemically competent E coli use the stock Salt Solution as supplied and set up the TOPO
20. product Check for the following outcomes below e Be sure you have a single discrete band of the correct size If you do not have a single discrete band follow the manufacturer s recommendations for optimizing your PCR with the polymerase of your choice Alternatively you may gel purify the desired product see page 40s e Estimate the concentration of your PCR product You will use this information when setting up your TOPO Cloning reaction see Amount of PCR Product to Use in the TOPO Cloning Reaction next page for details TOPO Cloning Reaction and Transformation Setting Up the TOPO Cloning Reaction Introduction Amount of PCR Product to Use in the TOPO Cloning Reaction Once you have produced the desired PCR product you are ready to TOPO Clone it into the pET TOPO vector and transform the recombinant vector into One Shot TOP10 E coli You should have everything you need set up and ready to use to ensure that you obtain the best possible results We suggest that you read the this section and the section entitled Transforming Competent Cells before beginning If this is the first time you have TOPO Cloned perform the control reactions on pages 37 39 in parallel with your samples When performing directional TOPO Cloning we have found that the molar ratio of PCR product TOPO vector used in the reaction is critical to its success To obtain the highest TOPO Cloning efficiency use a 0 5 1 to 2 1
21. room temperature S O C medium Incubate at 37 C for 1 hour with shaking Spread 100 200 ul of bacterial culture on a prewarmed selective plate and incubate overnight at 37 C Control Reaction We recommend using the Control PCR Template and the Control PCR Primers included with the kit to perform the control reaction See the protocol on pages 37 39 for instructions vi Kit Contents and Storage Types of Kits This manual is supplied with the following pET Directional TOPO Expression kits listed below Kit Quantity Catalog no Champion pET100 Directional TOPO 20 reactions K100 01 Expression Kit Champion pET101 Directional TOPO 20 reactions K101 01 Expression Kit Champion pET102 Directional TOPO 20 reactions K102 01 Expression Kit Champion pET151 Directional TOPO 20 reactions K151 01 Expression Kit Champion pET200 Directional TOPO 20 reactions K200 01 Expression Kit Shipping Storage The Champion pET Directional TOPO Expression Kits are shipped on dry ice Each kit contains three boxes Upon receipt store the boxes as detailed below Box Item Storage 1 pET TOPO Reagents 20 C 2 OneShot TOP10 Chemically Competent E coli 80 C 3 BL21 Star DE3 One Shot Chemically Competent E coli 80 C Vectors and Each Champion pET Directional TOPO Expression Kit contains a pET TOPO Primers vector an expression contr
22. strains expressing the T7 RNA polymerase T7 forward priming site Allows sequencing in the sense orientation lac operator lacO Binding site for lac repressor that serves to reduce basal expression of your recombinant protein Ribosome binding site Optimally spaced from the TOPO Cloning site for efficient translation of PCR product N terminal 6xHis tag Permits purification of recombinant fusion protein TM on metal chelating resin i e ProBond or Ni NTA In addition allows detection of recombinant protein with the Anti HisG Antibodies Xpress epitope Asp Leu Tyr Asp Asp Asp Asp Lys Allows detection of the fusion protein by the Anti Xpress Antibodies Enterokinase EK recognition site Asp Asp Asp Asp Lys Allows removal of the N terminal tag from your recombinant protein using an enterokinase such as EKMax TOPO Cloning site directional Permits rapid cloning of your PCR product for expression in E coli T7 Reverse priming site Allows sequencing of the insert T7 transcription termination region Sequence from bacteriophage T7 which permits efficient transcription termination bla promoter Allows expression of the ampicillin resistance gene Ampicillin resistance gene p lactamase pET100 D TOPO only Allows selection of the plasmid in E coli Kanamycin resistance gene pET200 D TOPO only Allows selection of the plasmid in
23. terminal 3 kDa pET151 D TOPO N terminal 4kDa pET200 D TOPO N terminal 3kDa If you are satisfied with expression of your gene of interest proceed to Purifying the Recombinant Fusion Protein page 31 If you have trouble expressing your protein or wish to optimize expression refer to the Troubleshooting section page 37 Purifying the Recombinant Fusion Protein Introduction ProBond and Ni NTA Important Scaling up Expression for Purification The presence of the N terminal or C terminal polyhistidine 6xHis tag in all pET TOPO vectors allows purification of your recombinant fusion protein with a metal chelating resin such as ProBond or Ni NTA ProBond and Ni NTA are nickel charged agarose resins that can be used for affinity purification of fusion proteins containing the 6xHis tag and or the HP thioredoxin protein Proteins bound to the resin may be eluted with either low pH buffer or competition with imidazole or histidine e To scale up your pilot expression for purification see below TM e To purify your fusion protein using ProBond or Ni NTA refer to the manual included with each product You may download the manuals from our Web site www invitrogen com e To purify your fusion protein using another metal chelating resin refer to the manufacturer s instructions Note that under denaturing conditions the Ni binding site encoded by the histidine patch in pET102 D TOPO
24. to 2 1 molar ratio of PCR product TOPO vector PCR product too dilute e Concentrate the PCR product e Usea 0 5 1 to 2 1 molar ratio of PCR product TOPO vector PCR primers contain 5 phosphates Do not add 5 phosphates to your PCR primers Incorrect PCR primer design Make sure that the forward PCR primer contains the sequence CACC at the 5 end Make sure that the reverse PCR primer does not contain the sequence CACC at the 5 end Used Taq polymerase or a Taq proofreading polymerase mixture for PCR Use a proofreading polymerase for PCR Large PCR product Increase the incubation time of the TOPO reaction from 5 minutes to 30 minutes Gel purify the PCR product to remove primer dimers and other artifacts PCR reaction contains artifacts i e does not run as a single discrete band on an agarose gel e Optimize your PCR using the proofreading polymerase of your choice e Gel purify your PCR product Cloning large pool of PCR products or a toxic gene e Increase the incubation time of the TOPO reaction from 5 minutes to 30 minutes e Usea 0 5 1 to 2 1 molar ratio of PCR product TOPO vector 34 continued on next page Troubleshooting continued TOPO Cloning Reaction and Transformation continued Problem Reason Solution Large percentage of inserts cloned in the incorrect orientation Incorrect PCR primer design
25. to include the following N terminus i e without the a stop codon to terminate the N terminal peptide desminal peptide a second ribosome binding site AGGAGG 9 10 base pairs 5 of the initiation ATG codon of your protein Note The first three base pairs of the PCR product following the 5 CACC overhang will constitute a complete codon TOPO Cloning Use the diagram below to help you design suitable PCR primers to clone your PCR Site of product into pET151 D TOPO Restriction sites are labeled to indicate the actual pET151 D TOPO cleavage site The sequence of pET151 D TOPO is available for downloading from our Web site or from Technical Service see page 56 For more information about pET151 D TOPO see pages 48 49 121 ATAGGCGCCA GCAACCGCAC CTGTGGCGCC GGTGATGCCG GCCACGATGC GTCCGGCGTA GAGGATCGAG ATCTCGATCC T7 promoter priming site T7 promoter lac operator r joe 1 201 CGCGAAATTA ATACGACTCA CTATAGGGGA ATTGTGAGCG GATAACAATT CCCCTCTAGA AATAATTTTG TTTAACTTTA RBS Polyhistidine region V5 epitope o T 281 AGAAGGAGAT ATACAT ATG CAT CAT CAC CAT CAC CAT GGT AAG CCT ATC CCT AAC CCT CTC CTC GGT CTC Met His His His His His His Gly Lys Pro Ile Pro Asn Pro Leu Leu Gly Leu TEV recognition site pF 1 351 GAT TCT ACG GAA AAC CTG TAT TTT CAG GGA ATT GAT CCC TT AAGGG CGAGCTCAGA GGG AAG TGG Asp Ser Thr Glu Asn Leu Tyr Phe Gln Gly Ile Asp Pro Phe Th A TEV cleavage site T7 reverse priming site r 1 411
26. with instructions Invitrogen reserves the right to select the method s used to analyze a product unless Invitrogen agrees to a specified method in writing prior to acceptance of the order Invitrogen makes every effort to ensure the accuracy of its publications but realizes that the occasional typographical or other error is inevitable Therefore Invitrogen makes no warranty of any kind regarding the contents of any publications or documentation If you discover an error in any of our publications please report it to our Technical Service Representatives Invitrogen assumes no responsibility or liability for any special incidental indirect or consequential loss or damage whatsoever The above limited warranty is sole and exclusive No other warranty is made whether expressed or implied including any warranty of merchantability or fitness for a particular purpose Purchaser Notification Introduction Information for European Customers Limited Use Label License No 5 Invitrogen Technology Limited Use Label License No 22 Vectors and Clones Encoding Histidine Hexamer Use of the Champion pET Directional TOPO Expression Kit is covered under a number of different licenses including those detailed below The BL21 Star DE3 strain is genetically modified and carries the bacteriophage X DE3 lysogen containing the T7 RNA polymerase gene As a condition of sale this product must be in accordance with all applicable
27. 01 D TOPO 5753 bp vector contains the following elements All features have been functionally tested Features of pET101 D TOPO Feature Benefit T7 promoter Permits high level IPTG inducible expression of your recombinant protein in E coli strains expressing the T7 RNA polymerase T7 forward priming site Allows sequencing in the sense orientation lac operator lacO Binding site for lac repressor that serves to reduce basal expression of your recombinant protein Ribosome binding site Optimally spaced from the TOPO Cloning site for efficient translation of PCR product TOPO Cloning site directional Permits rapid cloning of your PCR product for expression in E coli C terminal V5 epitope tag Gly Lys Pro Ile Pro Asn Pro Leu Leu Gly Leu Asp Ser Thr Allows detection of the fusion protein by the Anti V5 Antibodies Southern et al 1991 C terminal 6xHis tag Permits purification of recombinant fusion protein TM on metal chelating resins i e ProBond or Ni NTA In addition allows detection of recombinant protein with the Anti His C term Antibodies Lindner et al 1997 17 Reverse priming site Allows sequencing of the insert T7 transcription termination region Sequence from T7 bacteriophage which permits efficient transcription termination bla promoter Allows expression of the ampicillin resistance gene Ampicillin resistance
28. 2 3980 bla promoter 4476 4574 Ampicillin bla resistance gene 4575 5435 pBR322 origin 5580 6253 ROP ORF complementary strand 6621 6812 lacI ORF complementary strand 8124 9215 52 Map of pET151 D lacZ Description The pET151 D lacZ 8832 bp vector contains a lacZ gene that has been directionally TOPO Cloned into pET151 D TOPO in frame with the N terminal peptide containing the V5 epitope and the 6xHis tag The size of the B galacto sidase fusion protein is approximately 120 kDa The nucleotide sequence of the vector is available for downloading from Web site www invitrogen com or by contacting Technical Service see page 56 Comments for pET151 D lacZ 8832 nucleotides T7 promoter bases 209 225 T7 promoter priming site bases 209 228 lac operator lacO bases 228 252 Ribosome binding site RBS bases 282 289 Initiation ATG bases 297 299 Polyhistidine 6xHis region bases 300 317 V5 epitope bases 318 359 TEV recognition site bases 360 380 lacZ ORF bases 396 3467 T7 reverse priming site bases 3527 3546 T7 transcription termination region bases 3488 3616 bla promoter bases 3921 4019 Ampicillin b a resistance gene bases 4020 4880 pBR322 origin bases 5025 5698 ROP ORF bases 6069 6260 complementary strand lacl ORF bases 7572 8684 complementary strand 53 Recipes LB Luria Bertani Medium and Plates S O B Medium with Antibiotic 54 1 0 Tryptone 0 5 Yeast Extrac
29. 700 GGT AAG CCT ATC CCT AAC CCT CTC CTC GGT CTC GAT TCT ACG CGT ACC GGT CAT CAT CAC CAT CAC Gly Lys Pro Ile Pro Asn Pro Leu Leu Gly Leu Asp Ser Thr Arg Thr Gly His His His His His T7 reverse priming site VIE i 1 766 CAT TGA GTTTGATCC GGCTGCTAAC AAAGCCCGAA AGGAAGCTGA GTTGGCTGCT GCCACCGCTG AGCAATAACT AGCA Hi s kkk 14 Specific Requirements for Cloning into pET151 D TOPO Introduction pET151 D TOPO allows expression of recombinant protein with an N terminal tag containing the V5 epitope and a 6xHis tag The N terminal tag also includes a TEV protease cleavage site to enable removal of the tag after protein purification using TEV protease Additional Cloning In addition to the guidelines on page 9 consider the following when designing Considerations PCR primers to clone your DNA into pET151 D TOPO Be sure to include a stop codon in the reverse primer or design the reverse primer to hybridize downstream of the native stop codon If you wish to Then include the V5 epitope and 6xHis design the forward PCR primer to place the gene of interest in tag frame with the N terminal tag Note that a ribosome binding site RBS is included upstream of the initiation ATG in the N terminal tag to ensure optimal spacing for proper translation at least six nonnative amino acids will be present between the TEV cleavage site and the start of your gene express your protein with a native design the forward PCR primer
30. 7lac promoter in the pET TOPO vector and from the lacUV5 promoter in the E coli host chromosome see page 4 for more information Antibiotic resistance marker for selection in E coli pBR322 origin for low copy replication and maintenance in E coli How Directional TOPO Cloning Works How Topoisomerase Works Directional TOPO Cloning Topoisomerase I from Vaccinia virus binds to duplex DNA at specific sites and cleaves the phosphodiester backbone after 5 CCCTT in one strand Shuman 1991 The energy from the broken phosphodiester backbone is conserved by formation of a covalent bond between the 3 phosphate of the cleaved strand and a tyrosyl residue Tyr 274 of topoisomerase I The phospho tyrosyl bond between the DNA and enzyme can subsequently be attacked by the 5 hydroxyl of the original cleaved strand reversing the reaction and releasing topoisomerase Shuman 1994 TOPO Cloning exploits this reaction to efficiently clone PCR products Directional joining of double strand DNA using TOPO charged oligonucleotides occurs by adding a 3 single stranded end overhang to the incoming DNA Cheng amp Shuman 2000 This single stranded overhang is identical to the 5 end of the TOPO charged DNA fragment At Invitrogen this idea has been modified by adding a 4 nucleotide overhang sequence to the TOPO charged DNA and adapting it to a whole vector format In this system PCR products are directionally clo
31. ACAATT CCCCTCTAGA AATAATTTTG T7 promoter priming site T7 promoter r m ATCTCGATCC CGCGAAATTA ATACGACTCA CTATAGGGGA RBS RBS r l r l TTTAACTTTA AGAAGGAATT CAGGAGCCCT T eMPNeloRp Vc EN TAG oa 5 V5 epitope Sacl BstB l l I AAG GGC GAG CTC AAT TCG AAG CTT GAA GGT AAG Lys Gly Glu Leu Asn Ser Lys Leu Glu Gly Lys Age Polyhistidine region l r 1 ACG CGT ACC GGT CAT CAT CAC CAT CAC CAT TGA Thr Arg Thr Gly His His His His His His T7 reverse priming site 1 TGAGTTGGCT GCTGCCACCG CTGAGCAATA ACTAGCATAA CCT ATC CCT AAC CCT CTC CTC GGT CIC GAT TCT Pro Ile Pro Asn Pro Leu Leu Gly Leu Asp Ser GTTTGA TCCGGCTGCT AACAAAGCCC GAAAGGAAGC CCCCTTGGGG CCTCTAAACG Specific Requirements for Cloning into pET102 D TOPO Specific Features for Expression in pET102 D TOPO Additional Cloning Considerations pET102 D TOPO is designed with some specific features to facilitate expression They are e The initiation ATG is correctly spaced from the optimized ribosome binding site RBS to ensure optimal translation e HP thioredoxin acts to increase translation efficiency and in some cases solubility e HP thioredoxin can be removed after protein purification using enterokinase e g EKMax Catalog no E180 01 In addition to the guidelines on page 9 you should consider the following when designing PCR primers to clone your DNA into pET102 D TOPO Use the diagram on
32. Add 30 pl Gel Solubilization Buffer GS1 for every 10 mg of gel e For gt 2 agarose gels use sterile 5 ml polypropylene tubes and add 60 ul Gel Solubilization Buffer GS1 for every 10 mg of gel 5 Incubate the tube at 50 C for 15 minutes Mix every 3 minutes to ensure gel dissolution After gel slice appears dissolved incubate for an additional 5 minutes Preheat an aliquot of TE Buffer TE to 65 70 C 7 Place a Quick Gel Extraction Column into a Wash Tube Pipette the mixture from Step 5 above onto the column Use 1 column per 400 mg agarose 8 Centrifuge at 212 000 x g for 1 minute Discard the flow through Place the column back into the Wash Tube 9 Optional Add 500 ul Gel Solubilization Buffer GS1 to the column Incubate at room temperature for 1 minute Centrifuge at 212 000 x g for 1 minute Discard the flow through Place the column back into the Wash Tube 10 Add 700 pl Wash Buffer W9 with ethanol add 96 100 ethanol to the Wash Buffer according to instructions on the label of the bottle to the column and incubate at room temperature for 5 minutes Centrifuge at 212 000 x g for 1 minute Discard flow through 11 Centrifuge the column at 712 000 x g for 1 minute to remove any residual buffer Place the column into a 1 5 ml Recovery Tube 12 Add 50 ul warm 65 70 C TE Buffer TE to the center of the cartridge Incubate at room temperature for 1 minute 13 Centrifuge at 212 000 x g for 2 minutes The Recov
33. BL21 DE3 BL21 DE3 pLysS and BL21 DE3 pLysE CE6 BL21 SI Competent Cells and any derivatives that are made of them You may refuse this sub license by returning this product unused in which case Invitrogen accept return of the product with a full refund By keeping or using this product you agree to be bound by the terms of this license continued on next page Purchaser Notification continued Limited Use Label License No 50 rne131 Cells Invitrogen Corporation Invitrogen has an exclusive license to sell the rne131 genotype to scientists for research or commercial evaluation purposes only under the terms described below Use of the rne131 genotype by commercial entities for Commercial Purposes as defined below beyond evaluation requires the user to obtain a commercial license as detailed below Before using the BL21 Star strain please read the following license agreement If you do not agree to be bound by its terms contact Invitrogen within 10 days for authorization to return the unused BL21 Star product and to receive a full credit The rne131 genotype is covered by one or more French patents or patent applications and corresponding foreign patents or patent applications owned by CNRS Information about commercial licenses may be obtained from Centre National de la Recherche Scientifique CNRS 3 rue Michel Ange 75794 PARIS Cedex 16 France REF L00084 Contact Dale Roche fist fr Invitrogen grants you a non excl
34. Directional TOPO Expression System T7 RNA polymerase is supplied by the BL21 Star DE3 host E coli strain in a regulated manner see below When sufficient T7 RNA polymerase is produced it binds to the T7 promoter and transcribes the gene of interest The BL21 Star DE3 E coli strain is specifically included in each Champion pET Directional TOPO Expression kit for expression of T7 regulated genes This strain carries the DE3 bacteriophage lambda lysogen This ADE3 lysogen contains a lac construct consisting of the following elements e thelacl gene encoding the lac repressor e the T7 RNA polymerase gene under control of the lacLIV5 promoter e asmall portion of the lacZ gene This lac construct is inserted into the int gene such that it inactivates the int gene Disruption of the int gene prevents excision of the phage i e lysis in the absence of helper phage The lac repressor encoded by Jacl represses expression of T7 RNA polymerase Addition of the gratuitous inducer isopropyl B D thiogalacto side IPTG allows expression of T7 RNA polymerase from the lacUV5 promoter The BL21 Star DE3 strain also contains other features which facilitate high level expression of heterologous genes For more information see page 6 Studies have shown that there is always some basal expression of T7 RNA polymerase from the JacUV5 promoter in 1DE3 lysogens even in the absence of inducer Studier amp Moffatt 1986 In general this
35. Invitrogen Champion pET Directional TOPO Expression Kits Five minute directional TOPO Cloning of blunt end PCR products into vectors for high level inducible expression in E coli Catalog nos K100 01 K101 01 K102 01 K151 01 K200 01 Version H 30 October 2006 25 0400 Table of Contents Jable of Contents nier meutecb eoi OaE cancel nesses ada eie n ido etn ipu i ere ta iii TOPO Cloning Procedure for Experienced USeEsu iie netidsn e diserte ea eR RERO HM ei ve eM RR V Kit Contents and Storage ied ttm eee en detener eri te debe te re eiie ertet deett vii Accessory Products idoneo eed e HUE e e d dit de ape e E er dash bead xi Introduction a sssiss case nave set cncantven eve cxtecct und scesiis se eue cued ueceab esas eaaescevandseds secanesanesaetseveeadaaissents 1 OVERVIEW DM D P EE 1 How Directional TOPO Cloning MOERS dai pe Rede te and eti ona iiioucrdc dleststhe Gee eos Mata stall 3 T7 Regulated Expression iiia nte eae ene ede b e n b nga 4 BEZE Star c Eco Strains oco oes Ct ed tUm d eom mh di ona m hc um Den 6 Thioredoxin E 7 Expenmental Outlines sss eden glk Lane e Ie eani tpe eee Blah e EE OaE eae E edades 8 Designing PCR Primers occi ca corani risa eren i ca eor Orig a sa a FT Y Vig ra ara 9 Basic Requirements eR aoim e einen HB Ue e p EGER RU DIRE pares 9 Specific Requirements for Cloning into pET100 D TOPO and pET200 D TOPO sssseeee 11 Specific Requirements for Cloning into pET101
36. Make sure that the forward PCR primer contains the sequence CACC at the 5 end Reverse PCR primer is complementary to the GTGG overhang at the 5 end Make sure that the reverse PCR primer does not contain the sequence CACC at the 5 end Large number of incorrect inserts cloned PCR cloning artifacts Gel purify your PCR product to remove primer dimers and smaller PCR products Optimize your PCR Include a final extension step of 7 to 30 minutes during PCR Longer PCR products will need a longer extension time Incorrect PCR primer design Make sure that the forward and reverse PCR primers are designed correctly Few or no colonies obtained from sample reaction and the transformation control gave no colonies One Shot competent E coli stored incorrectly Store One Shot competent E coli at 80 C If you are using another E coli strain follow the manufacturer s instructions One Shot transformation protocol not followed correctly Follow the One Shot transformation protocol provided on page 20 Insufficient amount of E coli plated Increase the amount of E coli plated Transformants plated on selective plates containing the wrong antibiotic Use the appropriate antibiotic for selection continued on next page 35 Troubleshooting continued Expression The table below lists some potential problems and possible solutions tha
37. ac operator RBS es ot al r 231 ATTGTGAGCG GATAACAATT CCCCTCTAGA AATAATTTTG TTTAACTTTA AGAAGGAGAT ATACATA ATG GGA TCT GAT Met Gly Ser Asp His patch HP thioredoxin 310 AAA ATT ATT CAT CTG ACT GAT GAT TCT TTT GAT ACT GAT GTA CTT AAG GCA GAT GGT GCA ATC CTG Lys Ile Ile His Leu Thr Asp Asp Ser Phe Asp Thr Asp Val Leu Lys Ala Asp Gly Ala Ile Leu 376 GTT GAT TTC TGG GCA CAC TGG TGC GGT CCG TGC AAA ATG ATC GCT CCG ATT CTG GAT GAA ATC GCT Val Asp Phe Trp Ala His Trp Cys Gly Pro Cys Lys Met Ile Ala Pro Ile Leu Asp Glu Ile Ala 442 GAC GAA TAT CAG GGC AAA CTG ACC GTT GCA AAA CTG AAC ATC GAT CAC AAC CCG GGC ACT GCG CCG Asp Glu Tyr Gln Gly Lys Leu Thr Val Ala Lys Leu Asn Ile Asp His Asn Pro Gly Thr Ala Pro 508 AAA TAT GGC ATC CGT GGT ATC CCG ACT CTG CTG CTG TTC AAA AAC GGT GAA GTG GCG GCA ACC AAA Lys Tyr Gly Ile Arg Gly Ile Pro Thr Leu Leu Leu Phe Lys Asn Gly Glu Val Ala Ala Thr Lys TrxFus forward priming site 1 574 GTG GGT GCA CTG TCT AAA GGT CAG TTG AAA GAG TTC CTC GAC GCT AAC CTG GCC GGC TCT GGA TCC Val Gly Ala Leu Ser Lys Gly Gln Leu Lys Glu Phe Leu Asp Ala Asn Leu Ala Gly Ser Gly Ser Enterokinase EK recognition site EK cleavage site Sac Hind Ill I l l 640 GGT GAT GAC GAT GAC AAG CTG GGA ATT GAT CCC TT AAG GGC GAG CTC AAG CTT GAA GGG AAG TG TTC CCG CTC Gly Asp Asp Asp Asp Lys Leu Gly Ile Asp Pro Phe Th Lys Gly Glu Leu Lys Leu Glu V5 epitope Age Polyhistidine 6xHis region
38. age Expressing the PCR Product continued Pilot Expression 1 Inoculate 10 ml of LB containing the appropriate antibiotic and 1 glucose if desired with 500 ul of the overnight culture from Step 8 previous page Grow two hours at 37 C with shaking ODs should be about 0 5 0 8 mid log Split the culture into two 5 ml cultures Add IPTG to a final concentration of 0 5 1 mM to one of the cultures You will now have two cultures one induced one uninduced Remove a 500 ul aliquot from each culture centrifuge at maximum speed in a microcentrifuge for 30 seconds and aspirate the supernatant Freeze the cell pellets at 20 C These are the zero time point samples Continue to incubate the cultures at 37 C with shaking Take time points for each culture every hour for 4 to 6 hours For each time point remove 500 ul from the induced and uninduced cultures and process as described in Steps 4 and 5 Proceed to Analyzing Samples next page 27 Analyzing Samples Materials to Have on Hand Preparing Samples Preparing Samples for Soluble Insoluble Protein Polyacrylamide Gel Electrophoresis 28 Have the following materials on hand before starting e Lysis Buffer see page 55 for recipe e 1Xand 2X SDS PAGE sample buffer see page 55 for recipes e Reagents and apparatus to perform SDS PAGE electrophoresis e Boiling water bath Once you have finished your pilot expression you are ready to ana
39. al Service see page 56 For more information about pET100 D TOPO or pET200 D TOPO see pages 42 43 121 ATAGGCGCCA GCAACCGCAC CTGTGGCGCC GGTGATGCCG GCCACGATGC GTCCGGCGTA GAGGATCGAG ATCTCGATCC T7 promoter priming site T7 promoter lac operator r i 1 201 CGCGAAATTA ATACGACTCA CTATAGGGGA ATTGTGAGCG GATAACAATT CCCCTCTAGA AATAATTTTG TTTAACTTTA RBS Nde Polyhistidine region Nhe l l p r 1 281 AGAAGGAGAT ATACAT ATG CGG GGT TCT CAT CAT CAT CAT CAT CAT GGT ATG GCT AGC ATG ACT GGT GGA 351 CAG CAA ATG Gin Gln Met Met Arg Gly Ser His His His His His His Gly Met Ala Ser Met Thr Gly Gly Xpress epitope r 1 GGT CGG GAT CTG TAC GAC GAT GAC GAT AAG GAT CAT CCC TT AAGGGC GGG AAG TGG Gly Arg Asp Leu Tyr Asp Asp Asp Asp Lys Asp His Pro Phe Th l EK recognition site A EK cleavage site T7 reverse priming site r 1 411 GAGCTCAACG ATCCGGCTGC TAACAAAGCC CGAAAGGAAG CTGAGTTGGC TGCTGCCACC GCTGAGCAAT AACTAGCATA 11 Specific Requirements for Cloning into pET101 D TOPO Additional Cloning pET101 D TOPO allows expression of recombinant protein with a native Considerations TOPO Cloning Site of pET101 D TOPO 12 151 231 306 372 consider the following when de pET101 D TOPO N terminus and a C terminal fusion tag In addition to the guidelines on page 9 signing PCR primers to clone your DNA into For maximal expression of native protein the forward PCR primer should be
40. ampion pET Directional TOPO Expression Kits utilize a highly efficient 5 minute cloning strategy TOPO Cloning to directionally clone a blunt end PCR product into a vector for high level T7 regulated expression in E coli Blunt end PCR products clone directionally at greater than 90 efficiency with no ligase post PCR procedures or restriction enzymes required Depending on the vector chosen the pET TOPO vectors are available with e N terminal or C terminal peptide tags for production of recombinant fusion proteins that may be easily detected or purified e Protease recognition site for removal of the N terminal peptide tag from your recombinant fusion protein e Antibiotic resistance marker for selection of transformants See the table below for a list of the available pET TOPO vectors and the fusion tag cleavage site and selection marker for each vector pET TOPO vector Fusion Peptide Fusion Tag Cleavage Site Selection Marker pET100 D TOPO N terminal Xpress 6xHis EK Ampicillin pET200 D TOPO Kanamycin pET101 D TOPO C terminal V5 6xHis Ampicillin pET102 D TOPO N terminal His Patch thioredoxin EK Ampicillin C terminal V5 6xHis pET151 D TOPO N terminal V5 6xHis TEV protease Ampicillin EK enterokinase TEV tobacco etch virus The Champion pET Expression System The Champion pET Expression System is based on expression vectors orig
41. and or C terminal peptide tag see pages 11 15 for information about each pET TOPO vector To enable directional cloning the forward PCR primer must contain the sequence CACC at the 5 end of the primer The 4 nucleotides CACC base pair with the overhang sequence GTGG in each pET TOPO vector For example below is the DNA sequence of the N terminus of a theoretical protein and the proposed sequence for your forward PCR primer DNA sequence 5 ATG GGA TCT GAT AAA Proposed Forward PCR primer 5 C ACC ATG GGA TCT GAT AAA See pages 11 15 for other factors to consider when designing the forward primer In general design the reverse PCR primer to allow you to clone your PCR product in frame with any C terminal tag if desired To ensure that your PCR product clones directionally with high efficiency the reverse PCR primer MUST NOT be complementary to the overhang sequence GTGG at the 5 end A one base pair mismatch can reduce the directional cloning efficiency from 90 to 75 and may increase the chances of your ORF cloning in the opposite orientation We have not observed evidence of PCR products cloning in the opposite orientation from a two base pair mismatch but this has not been tested thoroughly Example Below is the sequence of the C terminus of a theoretical protein You want to clone in frame with the C terminal tag The stop codon is underlined DNA sequence AAG TCG GAG CAC TCG ACG ACG GTG TAG 3 One solution
42. ations on ice seem to have a minimal effect on transformation efficiency The length of the incubation is at the user s discretion Heat shock the cells for 30 seconds at 42 C without shaking Immediately transfer the tubes to ice Add 250 1 of room temperature S O C medium Cap the tube tightly and shake the tube horizontally 200 rpm at 37 C for 1 hour Spread 100 200 1 from each transformation on a prewarmed selective plate and incubate overnight at 37 C We recommend plating two different volumes to ensure that at least one plate will have well spaced colonies An efficient TOPO Cloning reaction may produce several hundred colonies Pick 5 colonies for analysis see Analyzing Positive Clones page 22 Note If you see few transformants refer to the Troubleshooting section page 34 for tips to optimize your TOPO Cloning and transformation reactions continued on next page Transforming Competent Cells continued Transformation by Use ONLY electrocompetent cells for electroporation to avoid arcing Do not Electroporation O E END 7 Nor use the One Shot TOP10 chemically competent cells for electroporation 1 Add 3 ul of the TOPO Cloning reaction from Performing the TOPO Cloning Reaction Step 2 page 18 into 50 ul of electrocompetent E coli and mix gently Do not mix by pipetting up and down Avoid formation of bubbles Transfer the electrocompetent cells to a 0 1 cm cuvette 2 Electro
43. available Note After digestion with enterokinase a number of vector encoded amino acids will remain at the N terminus of your protein see table below Vector Number of Amino Acids Remaining After EK Cleavage pET100 D TOPO 5 pET102 D TOPO 7 pET200 D TOPO 5 If you have expressed your recombinant fusion protein from pET151 D TOPO you may use recombinant TEV Protease available from Invitrogen Catalog no 12575 015 to remove the N terminal fusion tag Instructions for digestion are included with the product For more information contact Technical Service see page 56 Note After digestion with enterokinase six vector encoded amino acids will remain at the N terminus of your protein 33 Troubleshooting TOPO Cloning Reaction and Transformation The table below lists some potential problems and possible solutions that may help you troubleshoot the TOPO Cloning and transformation reactions To help evaluate your results we recommend that you perform the control reactions see pages 37 39 in parallel with your samples Problem Reason Solution Few or no colonies obtained Suboptimal ratio of PCR Use a 0 5 1 to 2 1 molar ratio of PCR from sample reaction and product TOPO vector used in product TOPO vector the transformation control the TOPO Cloning reaction gave colonies Too much PCR product used in Dilute the PCR product the TOPO Cloning reaction Use a 0 5 1
44. ax 250 units E180 01 1000 units E180 02 AcTEV Protease 1000 units 12575 015 continued on next page xi Accessory Products continued Products to Detect Expression of your recombinant fusion protein can be detected using an Recombinant antibody to the appropriate epitope The table below describes the products Proteins available from Invitrogen for detection of fusion proteins expressed using the appropriate pET TOPO vector see pages 11 15 for details about the N and or C terminal tags present on each pET TOPO vector The amount of antibody supplied is sufficient for 25 western blots Product Mechanism of Detection Catalog no Anti Xpress Antibody Detects 8 amino acid Xpress R910 25 Anti Xpress HRP Antibody amp P tope R911 25 DLYDDDDK Anti HisG Antibody Detects the N terminal R940 25 Anti HisG HRP Antibody Polyhistidine 6xHis tag R941 25 followed by glycine Anti HisG AP Antibody R942 25 HHHHHHG Anti V5 Antibody Detects 14 amino acid epitope R960 25 Anti V5 HRP Antibody derived from the P and V R961 25 proteins of the paramyxovirus Anti V5 AP Antibody SV5 Southern et al 1991 R962 25 GKPIPNPLLGLDST Anti His C term Antibody Detects the C terminal R930 25 Anti His C term HRP polyhistidine 6xHis tag R931 25 Antibody requires the free carboxyl group for detection Lindner et al Anti His C term AP 1997 R932 25 Antibody
45. bleshoot your experiment Refer to the Troubleshooting section page 34 for additional tips Once you have identified the correct clone be sure to purify the colony and make a glycerol stock for long term storage We recommend that you store a stock of plasmid DNA at 20 C 1 Streak the original colony out for single colony on LB plates containing the appropriate antibiotic 2 Isolate a single colony and inoculate into 1 2 ml of LB containing the appropriate antibiotic Grow until culture reaches stationary phase Mix 0 85 ml of culture with 0 15 ml of sterile glycerol and transfer to a cryovial 5 Store at 80 C 23 Expression and Purification General Guidelines for Expression Introduction BL21 Star Strains Positive Controls 24 BL21 Star DE3 One Shot E coli Box 3 are included with each Champion pET Directional TOPO Expression Kit for use as the host for expression You will need pure plasmid DNA of your pET TOPO construct to transform into BL21 Star DE3 for expression studies Since each recombinant protein has different characteristics that may affect optimal expression we recommend performing a time course of expression to determine the best conditions for expression of your protein Each Champion pET Directional TOPO Expression Kit also includes the appropriate pET TOPO vector containing the lacZ gene for use as a positive expression control see below The BL21 Star DE3
46. cols provided in the manual Step Action Design PCR Primers Include the 4 base pair sequences CACC necessary for directional cloning on the 5 end of the forward primer Design the primers such that your gene of interest will be optimally expressed and fused in frame with any epitope tags if desired Amplify Your Gene of Interest Use a thermostable proofreading DNA polymerase and the PCR primers above to produce your blunt end PCR product Use agarose gel electrophoresis to check the integrity and yield of your PCR product Perform the TOPO Cloning Reaction Set up the following TOPO Cloning reaction For optimal results use a 0 5 1 to 2 1 molar ratio of PCR product TOPO vector Note If you plan to transform electrocompetent E coli use Dilute Salt Solution in the TOPO Cloning reaction Fresh PCR product 0 5 to 4 pl Salt Solution 1 ul Sterile water add to a final volume of 5 pl TOPO vector 1ul Total volume 6 ul Mix gently and incubate for 5 minutes at room temperature Place on ice and proceed to transform One Shot TOP10 chemically competent E coli below Transform TOP10 Chemically Competent E coli Add 3 ul of the TOPO Cloning reaction into a vial of One Shot TOP10 chemically competent E coli and mix gently Incubate on ice for 5 to 30 minutes Heat shock the cells for 30 seconds at 42 C without shaking Immediately transfer the tube to ice Add 250 ul of
47. combinant protein using TEV protease Carrington amp Dougherty 1988 Dougherty et al 1988 TOPO Cloning site directional Permits rapid cloning of your PCR product for expression in E coli T7 Reverse priming site Allows sequencing of the insert T7 transcription termination region Sequence from bacteriophage T7 which permits efficient transcription termination bla promoter Allows expression of the ampicillin resistance gene Ampicillin resistance gene f lactamase Allows selection of the plasmid in E coli pBR322 origin of replication ori Permits replication and maintenance in E coli ROP ORF Interacts with the pBR322 origin to facilitate low copy replication in E coli lacI ORF Encodes lac repressor which binds to the T7lac promoter to block basal transcription of the gene of interest and to the JacUV5 promoter in the host chromosome to repress transcription of 17 RNA polymerase 49 Map of pET100 D lacZ and pET200 D lacZ Description pET100 D lacZ 8836 bp and pET200 D lacZ 8813 bp are vectors containing a lacZ gene that has been directionally TOPO Cloned into pET100 D TOPO and pET200 D TOPO respectively In each vector the lacZ gene is cloned in frame with the N terminal peptide containing the Xpress epitope and the 6xHis tag The size of the p galactosidase fusion protein is approximately 121 kDa The nucleotide sequence of each vector is available for do
48. ct into pET101 D TOPO In this example the N terminus of the protein is encoded by 5 ATGGCCCCCCCGACCGATGTCAGCCTGGGGGACGAA 1 Design the forward PCR primer to be 5 CACCATGGCCCCCCCGACCGAT 3 2 Forthe reverse primer analyze the C terminus of the protein The stop codon is underlined see the top strand below GCG GTT AAG TCG GAG CAC TCG ACG ACT GCA TAG 3 CGC CAA TTC AGC CTC GTG AGC TGC TGA CGT ATC 5 3 To fuse the ORF in frame with the V5 epitope and 6xHis tag remove the stop codon by starting with nucleotides homologous to the last codon TGC and continue upstream underlined sequence in the bottom strand above The reverse primer will be 5 TGC AGT CGT CGA GTG CTC CGA CTT 3 4 This will amplify the C terminus without the stop codon and allow you to clone the ORF in frame with the V5 epitope and 6xHis tag If you don t want the V5 epitope and 6xHis tag simply begin with the stop codon 5 CTA TGC AGT CGT CGA GTG CTC CGA CTT 3 Specific Requirements for Cloning into pET100 D TOPO and pET200 D TOPO Introduction Additional Cloning pET100 D TOPO and pET200 D TOPO allow expression of recombinant protein with an N terminal tag containing the Xpress epitope and a 6xHis tag The N terminal tag also includes an enterokinase EK recognition site to enable removal of the tag after protein purification using enterokinase e g EKMax In addition to the guidelines on page 9 consider the follo
49. d 5055 6146 continued on next page 46 Map and Features of pET102 D TOPO continued Features of The pET102 D TOPO 6315 bp vector contains the following elements All pET102 D TOPO features have been functionally tested Feature Benefit T7 promoter Permits high level IPTG inducible expression of your protein in E coli strains expressing the T7 RNA polymerase T7 forward priming site Allows sequencing in the sense orientation lac operator lacO Binding site for lac repressor that serves to reduce basal expression of your recombinant protein Ribosome binding site Optimally spaced from the TOPO Cloning site for efficient translation of PCR product His Patch HP thioredoxin Provides an efficient fusion partner for translation of the fusion protein TrxFus forward priming site Permits sequencing of the insert in the sense orientation Enterokinase EK recognition site Allows removal of the N terminal tag from your Asp Asp Asp Asp Lys protein using an enterokinase such as EKMax TOPO Cloning site directional Permits rapid cloning of your PCR product C terminal V5 epitope tag Allows detection of the fusion protein by the Anti V5 Antibodies Southern et al 1991 C terminal 6xHis tag Permits purification of recombinant fusion protein on metal chelating resins i e ProBond or Ni NTA In addition allows detection of the recombinant protein with the Anti His C te
50. d RNase E which lacks the C terminal 477 amino acids of the enzyme required for mRNA degradation Kido et al 1996 Lopez et al 1999 Thus mRNAs expressed in the RNase E defective BL21 Star strains exhibit increased stability when compared to other BL21 strains When heterologous genes are expressed in the BL21 Star strains from T7 based expression vectors the yields of recombinant proteins generally increase If you discover that your gene is toxic to BL21 Star DE3 cells you may want to perform your expression experiments in the BL21 Star DE3 pLysS strain see page xi for ordering information The BL21 Star DE3 pLyssS strain contains the pLysS plasmid which produces T7 lysozyme T7 lysozyme binds to 17 RNA polymerase and inhibits transcription This activity results in reduced basal levels of T7 RNA polymerase leading to reduced basal expression of T7 driven heterologous genes For more information about BL21 Star DE3 pLysS refer to our Web site www invitrogen com or call Technical Service see page 56 Note that while BL21 Star DE3 pLysS reduces basal expression from the gene of interest when compared to BL21 Star DE3 it also generally reduces the overall induced level of expression of recombinant protein Thioredoxin Introduction Thioredoxin His Patch Thioredoxin The pET102 D TOPO vector allows you to clone your gene of interest as a fusion to a mutated thioredoxin protein His Patch thior
51. designed to place the initial ATG codon of the desired protein approximately 9 to 10 base pairs from the ribosome binding site Gold 1988 Miller 1992 This will ensure the optimal spacing for proper translation If you wish to Then N terminus using the vector encoded ribosome binding site express your protein with a native design the forward PCR primer such that the initial ATG codon of your protein directly follows the 5 CACC overhang and 6xHis tag include the C terminal V5 epitope design the reverse PCR primer to remove the native stop codon in the gene of interest and preserve the reading frame through the C terminal tag not include the C terminal V5 epitope and 6xHis tag include the native sequence containing the stop codon in the reverse primer or make sure the stop codon is upstream from the reverse PCR primer binding site Note The first three base pairs of the PCR product following the 5 CACC overhang will constitute a complete codon Use the diagram below to help you design suitable PCR primers to clone your PCR product into pET101 D TOPO Restriction sites are labeled to indicate the actual cleavage site The sequence of the vector is available for downloading from our Web site or from Technical Service see page 56 For more information about pET101 D TOPO see pages 44 45 GGTGATGCCG GCCACGATGC GTCCGGCGTA GAGGATCGAG lac operator ATTGTGAGCG GATA
52. e overnight at 37 C Hundreds of colonies from the vector PCR insert reaction should be produced To analyze the transformations isolate plasmid DNA and digest with the appropriate restriction enzyme as listed below The table below lists the digestion patterns that you should see for inserts that are cloned in the correct orientation or in the reverse orientation Vector Restriction Expected Digestion Patterns bp Enzyme pET100 D TOPO Hind M Correct orientation 838 5674 Reverse orientation 500 6012 Empty vector 5764 pET101 D TOPO ClalI Correct orientation 599 5896 Reverse orientation 929 5566 Empty vector 5753 pET102 D TOPO PstI Correct orientation 1990 5065 Reverse orientation 1484 5571 Empty vector 6315 continued on next page Performing the Control Reactions continued Analysis of Results continued Transformation Control Vector Restriction Expected Digestion Patterns bp Enzyme pET151 D TOPO EcoRIandSstI Correct orientation 653 5861 Reverse orientation 101 6413 Empty vector 5760 pET200 D TOPO Hind III Correct orientation 845 5646 Reverse orientation 511 5980 Empty vector 5741 Greater than 90 of the colonies should contain the 750 bp insert in the correct orientation Relatively few colonies should be produced in the vector only reaction pUC19 plasmid is included to check the transformation eff
53. ect expression of your recombinant fusion protein by western blot analysis you may use e Antibodies against the appropriate epitope available from Invitrogen see page xii for ordering information e An antibody to your protein of interest TM In addition the Positope Control Protein Catalog no R900 50 is available from Invitrogen for use as a positive control for detection of fusion proteins containing an Xpress HisG V5 or C terminal 6xHis epitope The WesternBreeze Chromogenic Kits and WesternBreeze Chemiluminescent Kits are available from Invitrogen to facilitate detection of antibodies by colorimetric or chemiluminescence methods For more information refer to our Web site www invitrogen com or call Technical Service see page 56 continued on next page 29 Analyzing Samples continued Note The Next Step 30 Expression of your protein with the N and or C terminal tags will increase the size of your recombinant protein The table below lists the increase in the molecular weight of your recombinant fusion protein that you should expect from the particular N or C terminal fusion tag in each pET TOPO vector Be sure to account for any additional amino acids between the fusion tag and the start of your protein Vector Fusion Tag Expected Size Increase kDa pET100 D TOPO N terminal 3kDa pET101 D TOPO C terminal 3kDa pET102 D TOPO N terminal 13 kDa C
54. edoxin For more information about thioredoxin and His Patch thioredoxin see below The 11 7 kDa thioredoxin protein is found in yeast plants and mammals as well as in bacteria It was originally isolated from E coli as a hydrogen donor for ribonuclease reductase see Holmgren 1985 for a review The gene has been completely sequenced Wallace amp Kushner 1984 The protein has been crystallized and its three dimensional structure determined Katti et al 1990 When overexpressed in E coli thioredoxin is able to accumulate to approximately 40 of the total cellular protein and still remain soluble When used as a fusion partner thioredoxin can increase translation efficiency and in some cases solubility of eukaryotic proteins expressed in E coli Examples of eukaryotic proteins that have been produced as soluble C terminal fusions to the thioredoxin protein in E coli LaVallie et al 1993 include e Murine interleukins 2 4 and 5 and human interleukin 3 e Human macrophage colony stimulating factor e Murine steel factor e Murine leukemia inhibitory factor e Human bone morphogenetic protein 2 The thioredoxin protein in pET102 D TOPO has been mutated to contain a metal binding domain and is termed His Patch thioredoxin To create a metal binding domain in the thioredoxin protein the glutamate residues at position 32 and the glutamine residue at position 64 were mutated to histidine residues When His Patch
55. ents are resold for use in research Invitrogen Corporation will not assert a claim against the buyer of infringement of patents owned or controlled by Invitrogen Corporation which cover this product based upon the manufacture use or sale of a therapeutic clinical diagnostic vaccine or prophylactic product developed in research by the buyer in which this product or its components was employed provided that neither this product nor any of its components was used in the manufacture of such product If the purchaser is not willing to accept the limitations of this limited use statement Invitrogen is willing to accept return of the product with a full refund For information on purchasing a license to this product for purposes other than research contact Licensing Department Invitrogen Corporation 1600 Faraday Avenue Carlsbad California 92008 Phone 760 603 7200 Fax 760 602 6500 Email outlicensing invitrogen com This product is licensed under U S Patent Nos 5 284 933 and 5 310 663 and foreign equivalents from Hoffmann LaRoche Inc Nutley NJ and or Hoffmann LaRoche Ltd Basel Switzerland and is provided only for use in research Information about licenses for commercial use is available from QIAGEN GmbH Max Volmer Str 4 D 40724 Hilden Germany continued on next page 57 Purchaser Notification continued Limited Use Label License No 30 T7 Expression System 58 The composition and or use of this product is c
56. ery Tube contains the purified DNA Store DNA at 20 C Discard the column 14 Use 4 ul of the purified DNA for the TOPO Cloning reaction continued on next page Gel Purifying PCR Products continued Low Melt Agarose Method Note If you prefer to use low melt agarose use the procedure below Note that gel purification will result in dilution of your PCR product and a potential loss of cloning efficiency Use only chemically competent cells for transformation 1 Electrophorese as much as possible of your PCR reaction on a low melt agarose gel 0 8 to 1 2 in TAE buffer Visualize the band of interest and excise the band Place the gel slice in a microcentrifuge tube and incubate the tube at 65 C until the gel slice melts Place the tube at 37 C to keep the agarose melted Add 4 ul of the melted agarose containing your PCR product to the TOPO Cloning reaction as described on page 18 Incubate the TOPO Cloning reaction at 37 C for 5 to 10 minutes This is to keep the agarose melted Transform 2 to 4 ul directly into One Shot TOP10 cells using the method on page 20 The cloning efficiency may decrease with purification of the PCR product You may wish to optimize your PCR to produce a single band 41 Map and Features of pET100 D TOPO and pET200 D TOPO Map 42 The figure below shows the features of the pET100 D TOPO 5764 bp and pET200 D TOPO 5741 bp vectors The complete se
57. gene p lactamase Allows selection of the plasmid in E coli pBR322 origin of replication ori Permits replication and maintenance in E coli ROP ORF Interacts with the pBR322 origin to facilitate low copy replication in E coli lacI ORF Encodes lac repressor which binds to the T7lac promoter to block basal transcription of the gene of interest and to the JacUV5 promoter in the host chromosome to repress transcription of T7 RNA polymerase 45 Map and Features of pET102 D TOPO pET102 D TOPO The figure below shows the features of the pET102 D TOPO 6315 bp vector Map The complete sequence of the vector is available for downloading from our Web site www invitrogen com or by contacting Technical Service see page 56 TOPO PER HP thio CCC TT RE o E is 77 Mieco res isek ees RM e PE ois Sn um pET102 D TOPO T7 promoter 209 225 T7 promoter priming site 209 228 lac operator lacO 228 252 Ribosome binding site RBS 282 288 His patch HP thioredoxin ORF 298 627 TrxFus forward priming site 607 624 EK recognition site 643 657 TOPO Cloning site directional 670 683 V5 epitope 700 741 Polyhistidine 6xHis region 751 768 T7 reverse priming site 822 841 T7 transcription termination region 783 911 bla promoter 1407 1505 Ampicillin bla resistance gene 1506 2366 pBR322 origin 2511 3184 ROP ORF complementary strand 3552 3743 lacI ORF complementary stran
58. he antibiotic Since p lactamase is catalytic ampicillin is rapidly removed from the medium resulting in non selective conditions If your plasmid is unstable this may result in the loss of plasmid and low expression levels Carbenicillin is generally more stable than ampicillin and studies have shown that using carbenicillin in place of ampicillin may help to increase expression levels by preventing loss of the pET TOPO plasmid If you wish to use carbenicillin perform your transformation and expression experiments in LB containing 50 ug ml carbenicillin Note If your gene of interest is highly toxic increasing the concentration of carbenicillin used from 50 pg ml to 200 ug ml may help to increase expression levels Note that cyclic AMP mediated derepression of the lacUV5 promoter in ADE3 lysogens can result in an increase in basal expression of T7 RNA polymerase If you are expressing an extremely toxic gene the pET construct may be unstable in BL21 Star DE3 cells Adding 1 glucose to the bacterial culture medium may help to repress basal expression of T7 RNA polymerase and stabilize your pET construct 25 Expressing the PCR Product Materials to Have on Hand Transforming BL21 Star DE3 One Shot Cells 26 Be sure to have the following solutions and equipment on hand before starting your expression experiment Your pET TOPO expression construct 210 ug ml The appropriate pET D lacZ positive control
59. hen compared to the number of colonies obtained after transforming other prokaryotic TOPO vectors e g pCR T7 TOPO pBAD Thio TOPO This is due to the following Directional TOPO Cloning generally yields 2 to 5 fold fewer colonies than traditional bidirectional TOPO TA Cloning Transforming low copy number TOPO plasmids generally yields 2 to 5 fold fewer colonies than transforming high copy number TOPO plasmids If you have TOPO Cloned previously note that we have slightly modified the One Shot TOP10 transformation protocols see below and the next page to address this issue Briefly we recommend the following Increase the amount of TOPO Cloning reaction that you transform into TOP10 cells use 3 ul and Increase the amount of transformed cells that you plate use 100 200 ul for chemically competent cells and 50 100 ul for electrocompetent cells Example When directionally TOPO Cloning a 750 bp test insert into any of the pET TOPO vectors we generally obtain 500 1500 total colonies Although fewer total colonies are obtained greater than 9076 of the colonies will contain plasmid with your PCR insert in the correct orientation oO g m Add 3 ul of the TOPO Cloning reaction from Performing the TOPO Cloning Reaction Step 2 page 18 into a vial of One Shot TOP10 Chemically Competent E coli and mix gently Do not mix by pipetting up and down Incubate on ice for 5 to 30 minutes Note Longer incub
60. hia coli and Related Bacteria Cold Spring Harbor Laboratory Press Plainview New York Rosenberg A H Lade B N Chui D S Lin S W Dunn J J and Studier F W 1987 Vectors for Selective Expression of Cloned DNAs by 17 RNA Polymerase Gene 56 125 135 Shuman S 1991 Recombination Mediated by Vaccinia Virus DNA Topoisomerase I in Escherichia coli is Sequence Specific Proc Natl Acad Sci USA 88 10104 10108 Shuman S 1994 Novel Approach to Molecular Cloning and Polynucleotide Synthesis Using Vaccinia DNA Topoisomerase J Biol Chem 269 32678 32684 Southern J A Young D F Heaney F Baumgartner W and Randall R E 1991 Identification of an Epitope on the P and V Proteins of Simian Virus 5 That Distinguishes Between Two Isolates with Different Biological Characteristics J Gen Virol 72 1551 1557 61 Studier F W and Moffatt B A 1986 Use of Bacteriophage T7 RNA Polymerase to Direct Selective High Level Expression of Cloned Genes J Mol Biol 189 113 130 Studier F W Rosenberg A H Dunn J J and Dubendorff J W 1990 Use of T7 RNA Polymerase to Direct Expression of Cloned Genes Meth Enzymol 185 60 89 Wallace B J and Kushner S R 1984 Genetic and Physical Analysis of the Thioredoxin trxA Gene of Escherichia coli K 12 Gene 32 399 408 02001 2006 Invitrogen Corporation All rights reserved For research use only Not intended for any animal or human therapeutic or
61. ht in LB or S O B medium containing the appropriate antibiotic Isolate plasmid DNA using your method of choice We recommend using the PureLink HQ Mini Plasmid Purification Kit Catalog no K2100 01 Note Since the pET TOPO vectors are low copy number plasmids you may need to increase the amount of bacterial culture to obtain enough plasmid DNA for sequencing or analysis purposes Use extra care during purification to obtain plasmid DNA of sufficiently pure quality for sequencing see below Analyze the plasmids by restriction analysis to confirm the presence and correct orientation of the insert Use a restriction enzyme or a combination of enzymes that cut once in the vector and once in the insert Sequencing We recommend sequencing your construct to confirm that your gene is in frame with the appropriate N terminal or C terminal fusion tag if desired The table below lists the primers included in each kit to help you sequence your insert Vector Forward Primer Reverse Primer pET100 D TOPO T7 T7 Reverse pET101 D TOPO T7 T7 Reverse pET102 D TOPO TrxFus Forward T7 Reverse pET151 D TOPO T7 T7 Reverse pET200 D TOPO T7 T7 Reverse If you download the sequence from our Web site note that the overhang sequence Important GTGG will be shown already hybridized to CACC No DNA sequence analysis program allows us to show the overhang without the complementary sequence 22 c
62. iciency of the One Shot TOP10 competent cells Transform one vial of One Shot TOP10 cells with 10 pg of pUC19 using the protocol on page 20 Plate 10 ul of the transformation mixture plus 20 ul of S O C on LB plates containing 100 ug ml ampicillin Transformation efficiency should be 1 x 10 cfu ug DNA 39 Gel Purifying PCR Products Introduction Using the PureLink Quick Gel Extraction Kit 40 Smearing multiple banding primer dimer artifacts or large PCR products 73 kb may necessitate gel purification If you intend to purify your PCR product be extremely careful to remove all sources of nuclease contamination There are many protocols to isolate DNA fragments or remove oligonucleotides Refer to Current Protocols in Molecular Biology Unit 2 6 Ausubel et al 1994 for the most common protocols Two simple protocols are provided below The PureLink Quick Gel Extraction Kit page xi allows you to rapidly purify PCR products from regular agarose gels 1 Equilibrate a water bath or heat block to 50 C 2 Cutthe area of the gel containing the desired DNA fragment using a clean sharp blade Minimize the amount of surrounding agarose excised with the fragment 3 Weigh the gel slice 4 Add Gel Solubilization Buffer GS1 supplied in the kit as follows e For lt 2 agarose gels place up to 400 mg gel into a sterile 1 5 ml polypropylene tube Divide gel slices exceeding 400 mg among additional tubes
63. inally developed by Studier and colleagues and takes advantage of the high activity and specificity of the bacteriophage T7 RNA polymerase to allow regulated expression of heterologous genes in E coli from the 17 promoter Rosenberg et al 1987 Studier amp Moffatt 1986 Studier et al 1990 For more information about the Champion pET Expression System see page 4 continued on next page Overview continued Features of the Champion pET Directional TOPO Vectors The pET TOPO vectors are designed to facilitate rapid directional TOPO Cloning of blunt end PCR products for regulated expression in E coli Features of the vectors include T7lac promoter for high level IPTG inducible expression of the gene of interest in E coli Dubendorff amp Studier 1991 Studier et al 1990 Directional TOPO Cloning site for rapid and efficient directional cloning of blunt end PCR products see page 3 for more information N or C terminal fusion tags for detection and purification of recombinant fusion proteins choice of tag depends on the particular vector see the previous page Protease recognition site for cleavage of the fusion tag from the recombinant protein of interest present on N terminal fusion vectors N terminal His Patch thioredoxin for increased translation efficiency and solubility of heterologous proteins pET102 D TOPO only lacl gene encoding the lac repressor to reduce basal transcription from the T
64. is not a problem but if the gene of interest is toxic to the E coli host basal expression of the gene of interest may lead to plasmid instability and or cell death To address this problem the pET TOPO vectors have been designed to contain a T7lac promoter to drive expression of the gene of interest The T7lac promoter consists of a lac operator sequence placed downstream of the 17 promoter The lac operator serves as a binding site for the lac repressor encoded by the lacI gene and functions to further repress T7 RNA polymerase induced basal TM transcription of the gene of interest in BL21 Star DE3 cells continued on next page T7 Regulated Expression continued Expressing Toxic Genes Using TOP10 Cells TM In some cases the gene of interest is so toxic to BL21 Star DE3 cells that other E coli host strains may be required for expression For a discussion of other alternative strains that may be used see page 6 One Shot TOP10 competent E coli which do not contain T7 RNA polymerase are included in each Champion pET Directional TOPO Expression kit to provide a host for stable propagation and maintenance of recombinant plasmids As mentioned on the previous page the presence of T7 RNA polymerase even at basal levels can lead to expression of the desired gene even in the absence of inducer If the gene of interest is toxic to the E coli host plasmid instability and or cell death may result We reco
65. is to design the reverse PCR primer to start with the codon just up stream of the stop codon but the last two codons contain GTGG underlined below which is identical to the overhang sequence As a result the reverse primer will be complementary to the overhang sequence increasing the probability that the PCR product will clone in the opposite orientation You want to avoid this situation DNA sequence AAG TCG GAG CAC TCG ACG ACG GTG TAG 3 Proposed Reverse PCR primer sequence TG AGC TGC TGC CAC 5 Another solution is to design the reverse primer so that it hybridizes just down stream of the stop codon but still includes the C terminus of the ORF Note that you will need to replace the stop codon with a codon for an innocuous amino acid such as glycine or alanine continued on next page Basic Requirements continued Important Example of Primer Design e Remember that the pET TOPO vectors accept blunt end PCR products Refer to pages 11 15 for a discussion of specific factors to consider when designing PCR primers for cloning into each pET TOPO vector e Donotadd 5 phosphates to your primers for PCR This will prevent ligation into the pET TOPO vectors e We recommend gel purifying your oligonucleotides especially if they are long gt 30 nucleotides The example below uses a theoretical protein and is for illustration purposes only In this case PCR primers are designed to allow cloning of the PCR produ
66. laimed in one or more patents U S Patent Nos 4 952 496 and 5 693 489 and 5 869 320 licensed to Invitrogen Corporation by Brookhaven Science Associates LLC The T7 expression system is based on technology developed at Brookhaven National Laboratory under contract with the U S Department of Energy and is the subject of patents and patent applications assigned to Brookhaven Science Associates LLC BSA By provisions of the Distribution License Agreement granted to Invitrogen covering said patents and patent applications Invitrogen grants you a non exclusive sub license under patents assigned to BSA for the use of this technology including the enclosed materials based upon the following conditions 1 these materials are to be used for non commercial research purposes only A separate license under patents owned by BSA is required for any commercial use including the use of these materials for research purposes or production purposes by any commercial entity Information about commercial license may be obtained from The Office of Technology Transfer Brookhaven National Laboratory Bldg 475D P O Box 5000 Upton New York 11973 5000 Phone 516 344 7134 2 No materials that contain the cloned copy of the T7 gene 1 the gene for T7 RNA polymerase may be distributed further to third parties outside of your laboratory unless the recipient receives a copy of this sub license and agrees to be bound by its terms This limitation applies to strains
67. lyze the samples you have collected Before starting prepare SDS PAGE gels or use one of the pre cast polyacrylamide gels available from Invitrogen see below Note If you wish to analyze your samples for soluble protein see below 1 Thaw the samples from Pilot Expression Steps 5 and 7 previous page and resuspend each cell pellet in 80 ul of 1X SDS PAGE sample buffer 2 Boil 5 minutes and centrifuge briefly Load 5 10 ul of each sample on an SDS PAGE gel and electrophorese Save your samples by storing them at 20 C 1 Thaw and resuspend each cell pellet in 500 ul of Lysis Buffer see Recipes page 55 2 Freeze sample in dry ice or liquid nitrogen and then thaw at 42 C Repeat 2 to 3 times Note To facilitate lysis you may need to add lysozyme or sonicate the cells 3 Centrifuge samples at maximum speed in a microcentrifuge for 1 minute at 4 C to pellet insoluble proteins Transfer supernatant to a fresh tube and store on ice 4 Mix together equivalent amounts of supernatant and 2X SDS PAGE sample buffer and boil for 5 minutes 5 Add 500 ul of 1X SDS PAGE sample buffer to the pellets from Step 3 and boil 5 minutes 6 Load 10 ul of the supernatant sample and 5 ul of the pellet sample onto an SDS PAGE gel and electrophorese To facilitate separation and visualization of your recombinant fusion protein by polyacrylamide gel electrophoresis a wide range of pre cast NuPAGE and Novex Tris Glycine polyacr
68. mmend that you transform your TOPO Cloning reaction into TOP10 cells for characterization of the construct propagation and maintenance When you are ready to perform an expression TM experiment transform your construct into BL21 Star DE3 E coli BL21 Star E coli Strains BL21 Star Strains rne131 Mutation BL21 Star DE3 pLysS Strain Note The BL21 Star DE3 E coli strain is included in each Champion pET Directional TOPO Expression Kit for use as a host for expression Other BL21 Star strains are also available from Invitrogen see below In addition to the XADES3 lysogen which allows high level expression of T7 regulated genes see page 3 the BL21 Star strains also contain the rne131 mutation This particular TM mutation further enhances the expression capabilities of BL21 Star The rne gene encodes the RNase E enzyme an essential 1061 amino acid E coli endonuclease which is involved in rRNA maturation and mRNA degradation as a component of a protein complex known as a degradosome Grunberg Manago 1999 Lopez et al 1999 Various studies have shown that the N terminal portion of RNase E approximately 584 amino acids is required for rRNA processing and cell growth while the C terminal portion of the enzyme approximately 477 amino acids is required for mRNA degradation Kido et al 1996 Lopez et al 1999 The rne131 mutation present in the BL21 Star strains encodes a truncate
69. nal Extension 7 minutes 72 C 1X 4 Remove 10 ul from the reaction and analyze by agarose gel electrophoresis A discrete 750 bp band should be visible 5 Estimate the concentration of the PCR product and adjust as necessary such that the amount of PCR produce used in the control TOPO Cloning reaction results in an optimal molar ratio of PCR product TOPO vector i e 0 5 1 to 2 1 Proceed to Control TOPO Cloning Reactions next page continued on next page 37 Performing the Control Reactions continued Control TOPO Cloning Reactions Analysis of Results 38 Using the control PCR product produced on the previous page and the pET TOPO vector set up two 6 ul TOPO Cloning reactions as described below If you plan to transform electrocompetent E coli use Dilute Salt Solution in place of the Salt Solution Set up control TOPO Cloning reactions Reagent Vector Only Vector PCR Insert Sterile Water 4ul 3 pl Salt Solution Tul 1 ul Control PCR Product 1 ul pET TOPO vector 1 pl 1 ul Final volume 6 ul 6 ul Incubate at room temperature for 5 minutes and place on ice Transform 3 of each reaction into separate vials of One Shot TOP10 cells page 20 Spread 100 200 1 of each transformation mix onto LB plates containing the appropriate antibiotic Be sure to plate two different volumes to ensure that at least one plate has well spaced colonies Incubat
70. ncing Primer 0 1 ug l in TE Buffer pH 8 20 ul Reverse Sequencing Primer 0 1 ug l in TE Buffer pH 8 20 ul Control PCR Primers 0 1 ug ul each in TE Buffer pH8 10 ul Control PCR Template 0 1 ug ul in TE Buffer pH 8 10 ul Expression Control Plasmid 0 01 ug ul in TE buffer pH 8 10 ul continued on next page viii Kit Contents and Storage continued Sequences of the Primers One Shot TOP10 Reagents Each Champion pET Directional TOPO Expression Kit provides a forward and reverse sequencing primer to facilitate sequence analysis of your expression constructs see the table on page vii for the specific primers included with each kit The sequences of the forward and reverse primers are listed below Two micrograms of each primer are supplied Primer Sequence pMoles Supplied T7 5 TAATACGACTCACTATAGGG 3 327 TrxFus Forward 5 TICCTCGACGCTAACCTG 3 371 T7 Reverse 5 TAGTTATTGCTCAGCGGTGG 3 325 The table below lists the items included in the One Shot TOP10 Chemically Competent E coli kit Box 2 Transformation efficiency is at least 1 x 10 cfu ug DNA Store Box 2 at 80 C Item Composition Amount S O C Medium 2 Tryptone 6ml may be stored at room 0 5 Yeast Extract temperature or 4 C 10 mM NaCl 2 5 mM KCl 10 mM MgCl 10 mM MgSO 20 mM glucose TOP10 cells 21 x 50 ul pUC19 Control DNA 10 pg ul in 5 mM Tris HCI 50 ul 0 5 mM EDTA pH 8
71. ned by adding four bases to the forward primer CACC The overhang in the cloning vector GTGG invades the 5 end of the PCR product anneals to the added bases and stabilizes the PCR product in the correct orientation Inserts can be cloned in the correct orientation with efficiencies equal to or greater than 9076 Topoisomerase 9 CCCIT CACC ATG NNN NNN AAG GG GGGAAGTGG 6TGG TAC NNN NNN TIG Qo PCR product Overhang Overhang invades double stranded 0 DNA displacing the bottom strand Topoisomerase CCCTTCACC ATG NNN NNN AAG GG GGGAAGTGG TAC NNN NNN TTC CC T7 Regulated Expression The Basis of T7 Regulated Expression Regulating Expression of T7 RNA Polymerase T7lac Promoter The Champion pET Expression System uses elements from bacteriophage T7 to control expression of heterologous genes in E coli In the pET TOPO vectors expression of the gene of interest is controlled by a strong bacteriophage 17 promoter that has been modified to contain a lac operator sequence see below In bacteriophage T7 the 17 promoter drives expression of gene 10 10 T7 RNA polymerase specifically recognizes this promoter To express the gene of interest it is necessary to deliver I7 RNA polymerase to the cells by inducing expression of the polymerase or infecting the cell with phage expressing the polymerase In the Champion pET
72. needs the length of the TOPO Cloning reaction can be varied from 30 seconds to 30 minutes For routine subcloning of PCR products 30 seconds may be sufficient For large PCR products gt 1 kb or if you are TOPO Cloning a pool of PCR products increasing the reaction time may yield more colonies 2 Place the reaction on ice and proceed to Transforming One Shot TOP10 Competent Cells next page Note You may store the TOPO Cloning reaction at 20 C overnight Transforming One Shot TOP10 Competent Cells Introduction p MOSQMN 7 E c o E Materials Supplied by the User Note Preparing for Transformation Once you have performed the TOPO Cloning reaction you will transform your pET TOPO construct into competent E coli One Shot TOP10 Chemically Competent E coli Box 2 are included with the kit to facilitate transformation however you may also transform electrocompetent cells Protocols to transform chemically competent or electrocompetent E coli are provided in this section To maintain the stability of your construct we recommend that you transform your TOPO Cloning reaction into TOP10 cells and characterize transformants in TOP10 before proceeding to expression studies using BL21 Star DE3 Expression of T7 RNA polymerase in BL21 Star DE3 may be leaky and may lead to rearrangement or loss of your plasmid In addition to general microbiological supplies i e plates spreaders
73. ntsasdenntadcdsnsdsasdiandacodenedescdtandaanstaasmastecuiessisnrdeaniucsducsvassinasiaansccatucetes 37 Performing the Control ReacHhonS sheik eeen uha tenente nennen tenente nennen Gel Purifying PCR Products siesta ie e RI H e HUI erben de hth refe e RE ite Hee dee Hae ke eerte e toad Map and Features of pET100 D TOPO and pET200 D TOPO isses nennen Map and Features of p ET101 D TOPO 4a pisonegodte tiU rae er pda nei pode Menit de dca Ple debi sie Map and Features of pET102 D TOPO iirinn spent n eiie a on nete Map and Features of pETISLZD TOPQ P oceacescittei eo tene ttt M IER LE Rhet east coe RUN EU LE Map of pET100 D lacZ and pET200 D lacZ seeeeeeeeeeeeeneeenennnnnee ene Map of pETIOT D7IACZ x etnia deste eade elit aede dae eid e PRU s Map o pETI02 7D acZ thea eub n deae et egt e Map ot pETIo17B lacZ 3 3 ente mitte edente e itte re eee eit ben mw ede eee dee Recipes m C TECHNICAL GeV CE ac autetn ettet rte e bte ver e etel oe tete i He e E et tei Purchaser Notifications eee e Re p e eee e e e a REUNIR s b AER eee Product Qualification i5 ie eee atas Referencesccono nre odo con ctt om E e Su RM em iU ee mit D ede en ier TOPO Cloning Procedure for Experienced Users Introduction This quick reference sheet is provided for experienced users of the TOPO Cloning procedure If you are performing the TOPO Cloning procedure for the first time we recommend that you follow the detailed proto
74. of phage contamination References Ausubel F M Brent R Kingston R E Moore D D Seidman J G Smith J A and Struhl K 1994 Current Protocols in Molecular Biology Greene Publishing Associates and Wiley Interscience New York Carrington J C and Dougherty W G 1988 A Viral Cleavage Site Cassette Identification of Amino Acid Sequences Required for Tobacco Etch Virus Polyprotein Processing Proc Natl Acad Sci USA 85 3391 3395 Cheng C and Shuman S 2000 Recombinogenic Flap Ligation Pathway for Intrinsic Repair of Topoisomerase IB Induced Double Strand Breaks Mol Cell Biol 20 8059 8068 Deutscher M P ed 1990 Guide to Protein Purification Vol 182 Methods in Enzymology Edited by Abelson J N and Simon M I Academic Press San Diego CA Dougherty W G Carrington J C Cary S M and Parks T D 1988 Biochemical and Mutational Analysis of a Plant Virus Polyprotein Cleavage Site EMBO J 7 1281 1287 Dubendorff J W and Studier F W 1991 Controlling Basal Expression in an Inducible T7 Expression System by Blocking the Target T7 Promoter with lac Repressor J Mol Biol 219 45 59 Gold L 1988 Posttranscriptional Regulatory Mechanisms in Escherichia coli Ann Rev Biochem 57 199 233 Grunberg Manago M 1999 Messenger RNA Stability and its Role in Control of Gene Expression in Bacteria and Phages Annu Rev Genet 33 193 227 Holmgren A 1985 Thioredoxin Ann
75. ol and primers for sequencing The pET TOPO vector expression control and primers differ depending on the kit The table below lists the vectors and primers supplied with each kit For details on the amount of each component provided see the next page pET TOPO Kit Catalog no TOPO Vector Expression Control Primers pET100 K100 01 pET100 D TOPO pET100 D lacZ T7 T7 Reverse pET101 K101 01 pET101 D TOPO pET101 D lacZ 17 17 Reverse pET102 K102 01 pET102 D TOPO pET102 D lacZ TrxFus Forward T7 Reverse pET151 K151 01 pET151 D TOPO pET151 D lacZ T7 T7 Reverse pET200 K200 01 pET200 D TOPO pET200 D lacZ T7 T7 Reverse continued on next page vii Kit Contents and Storage continued pET TOPO pET TOPO Reagents Box 1 are listed below Each box includes PCR reagents Reagents and the appropriate vectors and primers Note that the user must supply a thermostable proofreading polymerase and the appropriate PCR buffer Store Box 1 at 20 C Item Concentration Amount pET TOPO vector 15 20 ng l linearized plasmid 20 ul TOPO adapted DNA in 50 glycerol 50 mM Tris HCI pH 7 4 at 25 C 1mM EDTA 2mM DTT 0 1 Triton X 100 100 ug ml BSA 30 uM bromophenol blue dNTP Mix 12 5 mM dATP 10 ul 12 5 mM dCTP 12 5 mM dGTP 12 5 mM dTTP in water pH 8 Salt Solution 1 2M NaCl 50 pl 0 06 M MgCl Sterile Water 1ml Forward Seque
76. ontinued on next page Analyzing Transformants continued Analyzing Transformants by PCR Important Long Term Storage You may analyze positive transformants using PCR For PCR primers use a combination of the Forward sequencing primer or the Reverse sequencing primer and a primer that hybridizes within your insert You will have to determine the amplification conditions If you are using this technique for the first time we recommend performing restriction analysis in parallel Artifacts may be obtained because of mispriming or contaminating template The protocol below is provided for your convenience Other protocols are suitable Materials Needed PCR SuperMix High Fidelity Invitrogen Catalog no 10790 020 Appropriate forward and reverse PCR primers 20 uM each Procedure 1 For each sample aliquot 48 ul of PCR SuperMix High Fidelity into a 0 5 ml microcentrifuge tube Add 1 ul each of the forward and reverse PCR primer 2 Pick 5 colonies and resuspend them individually in 50 ul of the PCR cocktail from Step 1 above Incubate reaction for 10 minutes at 94 C to lyse cells and inactivate nucleases Amplify for 20 to 30 cycles For the final extension incubate at 72 C for 10 minutes Store at 4 C 9x gr gd c9 Visualize by agarose gel electrophoresis If you have problems obtaining transformants or the correct insert perform the control reactions described on page 37 39 These reactions will help you trou
77. plasmid BL21 Star DE3 One Shot cells Box 3 supplied with the kit S O B or LB containing the appropriate antibiotic for selection plus 1 glucose if desired 37 C incubator shaking and nonshaking 42 C water bath 1 M isopropyl B D thiogalactoside IPTG Invitrogen Catalog no 15529 019 Liquid nitrogen To transform your construct or the positive control 10 ng each into BL21 Star DE3 One Shot cells follow the instructions below You will need one vial of cells per transformation Note You will not plate the transformation reaction but inoculate it into medium for growth and subsequent expression 1 2 DL gy Qr seo c9 Thaw on ice one vial of BL21 Star DE3 One Shot cells per transformation Add 5 10 ng plasmid DNA in a 1 to 5 ul volume into each vial of BL21 Star DE3 One Shot cells and mix by stirring gently with the pipette tip Do not mix by pipetting up and down Incubate on ice for 30 minutes Heat shock the cells for 30 seconds at 42 C without shaking Immediately transfer the tubes to ice Add 250 ul of room temperature S O C medium Cap the tube tightly tape the tube on its side for better aeration and incubate at 37 C for 30 minutes with shaking 200 rpm Add the entire transformation reaction to 10 ml of LB containing the appropriate antibiotic and 1 glucose if desired Grow overnight at 37 C with shaking Proceed to Pilot Expression next page continued on next p
78. porate your samples using your own protocol and an electroporator Note If you have problems with arcing see below Immediately add 250 ul of room temperature S O C medium Transfer the solution to a 15 ml snap cap tube i e Falcon and shake for at least 1 hour at 37 C to allow expression of the antibiotic resistance marker 5 Spread 50 100 ul from each transformation on a prewarmed selective plate and incubate overnight at 37 C We recommend plating two different volumes to ensure that at least one plate will have well spaced colonies 6 Anefficient TOPO Cloning reaction may produce several hundred colonies Pick 5 colonies for analysis see Analyzing Positive Clones page 22 Note If you see few transformants refer to the Troubleshooting section page 34 for tips to optimize your TOPO Cloning and transformation reactions To prevent arcing of your samples during electroporation the volume of cells should be between 50 and 80 pl 0 1 cm cuvettes or 100 to 200 pl 0 2 cm cuvettes If you experience arcing during transformation try one of the following suggestions e Reduce the voltage normally used to charge your electroporator by 10 e Reduce the pulse length by reducing the load resistance to 100 ohms e Ethanol precipitate the TOPO Cloning reaction and resuspend in water prior to electroporation 21 Analyzing Transformants Analyzing Positive 1 Clones 2 Pick 5 colonies and culture them overnig
79. promoter priming site bases 209 228 lac operator lacO bases 228 252 Ribosome binding site RBS bases 282 288 292 296 lacZ ORF bases 306 3362 V5 epitope bases 3405 3446 Polyhistidine 6xHis region bases 3456 3473 T7 reverse priming site bases 3527 3546 T7 transcription termination region bases 3488 3616 bla promoter bases 3917 4015 Ampicillin bla resistance gene ORF bases 4016 4876 pBR322 origin bases 5021 5694 ROP ORF bases 6062 6253 complementary strand lacl ORF bases 7565 8656 complementary strand 51 Map of pET102 D lacZ Description pET102 D lacZ 9384 bp is a vector containing a lacZ gene that has been directionally TOPO Cloned into pET102 D TOPO The lacZ gene is cloned in frame with the N terminal HP thioredoxin and the C terminal peptide tag The size of the p galactosidase fusion protein is approximately 133 kDa The nucleotide sequence of the vector is available for downloading from Web site www invitrogen com or by contacting Technical Service see page 56 HP thio V5 FTT deco nes ee o eo pET102 D lacZ T7 promoter 209 225 T7 promoter priming site 209 228 lac operator lacO 228 252 Ribosome binding site RBS 282 288 His patch HP thioredoxin ORF 298 627 TrxFus forward priming site 607 624 EK recognition site 643 657 lacZ ORF 679 3732 V5 epitope 3769 3810 Polyhistidine 6xHis region 3820 3837 T7 reverse priming site 3891 3910 17 transcription termination region 385
80. quence of each vector is available for downloading from our Web site www invitrogen com or by contacting Technical Service see page 56 Z T7 promoter T7 promoter priming site lac operator lacO Ribosome binding site RBS Initiation ATG Polyhistidine 6xHis region Xpress epitope EK recognition site TOPO Cloning site directional T7 reverse priming site T7 transcription termination region bla promoter Ampicillin bla resistance gene Kanamycin resistance gene pBR322 origin ROP ORF complementary strand lacI ORF complementary strand 0 X M X eec uui E acd RBS ATG 6xHis XPress EK ccc TTEA ccc pET100 D TOPO amp pET200 D TOPO TOPO pET100 D TOPO pET200 D TOPO 209 225 209 225 209 228 209 228 228 252 228 252 282 288 282 288 297 299 297 299 309 326 309 326 366 389 366 389 375 389 375 389 396 409 396 409 466 485 466 485 427 555 427 555 856 954 856 954 955 1815 m 955 1749 2022 2757 1969 2610 3001 3192 2978 3169 4507 5595 4481 5572 continued on next page Map and Features of pET100 D TOPO and pET200 D TOPO continued Features of The pET100 D TOPO 5764 bp and pET200 D TOPO 5741 bp vectors pET1 00 D TOPO contain the following elements All features have been functionally tested and pET200 D TOPO Feature Benefit T7 promoter Permits high level IPTG inducible expression of your recombinant protein in E coli
81. ression Kit pET200 D lacZ continued on next page General Guidelines for Expression continued Basic Strategy Plasmid Preparation Ampicillin Selection Using Carbenicillin Note TM The basic steps needed to induce expression of your gene in BL21 Star DE3 E coli are outlined below 1 Isolate plasmid DNA using standard procedures and transform your construct and the positive control separately into BL21 Star DE3 One Shot cells 2 Grow the transformants and induce expression with IPTG over several hours Take several time points to determine the optimal time of expression 3 Optimize expression to maximize the yield of protein You may prepare plasmid DNA using your method of choice We recommend using the PureLink HQ Mini Plasmid Purification Kit Catalog no K2100 01 for isolation of pure plasmid DNA Note that since you are purifying a low copy number plasmid you may need to increase the amount of bacterial culture that you use to prepare your plasmid construct For pET TOPO vectors containing the ampicillin resistance gene ampicillin generally works well for selection of transformants and expression experiments However if you find that your expression levels are low you may want to use carbenicillin instead The resistance gene for ampicillin encodes the protein p lactamase p lactamase is secreted into the medium where it hydrolyzes ampicillin inactivating t
82. rm Antibodies Lindner et al 1997 17 Reverse priming site Allows sequencing of the insert T7 transcription termination region Sequence from T7 bacteriophage which permits efficient transcription termination bla promoter Allows expression of the ampicillin resistance gene Ampicillin resistance gene f lactamase Allows selection of the plasmid in E coli pET102 D TOPO only pBR322 origin of replication ori Permits replication and maintenance in E coli ROP ORF Interacts with the pBR322 origin to facilitate low copy replication in E coli lacI ORF Encodes lac repressor which binds to the T7lac promoter to block basal transcription of the gene of interest and to the JacUV5 promoter in the host chromosome to repress transcription of 17 RNA polymerase 47 Map and Features of pET151 D TOPO Map of The figure below shows the features of the pET151 D TOPO 5760 bp vector pET151 D TOPO The complete sequence of the vector is available for downloading from our Web site www invitrogen com or by contacting Technical Service see page 56 lacO Soe a Comments for pET151 D TOPO 5760 nucleotides T7 promoter bases 209 225 T7 promoter priming site bases 209 228 lac operator lacO bases 228 252 Ribosome binding site RBS bases 282 289 Initiation ATG bases 297 299 Polyhistidine 6xHis region bases 300 317 V5 epitope bases 318 359 TEV recognition site
83. s reduces degradation of heterologous proteins expressed in the strain The strain carries a mutated rne gene rrie131 which encodes a truncated RNase E enzyme that lacks the ability to degrade mRNA resulting in an increase in mRNA stability see page 6 Accessory Products Introduction Additional Products The products listed in this section are intended for use with the Champion pET Directional TOPO Expression Kits For more information refer to our Web site www invitrogen com or call Technical Service see page 56 Many of the reagents supplied in the Champion pET Directional TOPO Expression Kits and other reagents suitable for use with the kits are available separately from Invitrogen Ordering information for these reagents is provided below Item Quantity Catalog no One Shot TOP10 Chemically Competent 10 x 50 ul C4040 10 cy 20 x 50 pl C4040 03 BL21 Star DE3 One Shot Chemically 20 x 50 ul C6010 03 Competent E coli BL21 Star DE3 pLysS One Shot 20 x 50 ul C6020 03 Chemically Competent E coli BL21 AI One Shot Chemically 20 x 50 ul C6070 03 Competent E coli PureLink HQ Mini Plasmid Purification 100 reactions K2100 01 Kit PureLink Quick Gel Extraction Kit 50 reactions K2100 12 Ampicillin 200 mg 11593 027 Kanamycin Sulfate 5g 11815 024 25g 11815 032 Carbenicillin 5g 10177 012 Isopropylthio B galactoside IPTG 1g 15529 019 EKM
84. solutions of KH PO and KxHPOsg For 100 ml dissolve the following reagents in 90 ml of deionized water 2 3 g NaCI 0 75 g KCl 10 ml glycerol 0 5 ml Triton X 100 68 mg imidazole Mix thoroughly and adjust pH to 7 8 with HCL Bring the volume to 100 ml Store at 4 C 1 Combine the following reagents 0 5 M Tris HCl pH 6 8 25ml Glycerol 10076 2 0 ml B mercaptoethanol 0 4 ml Bromophenol Blue 0 02 g SDS 0 4 Bring the volume to 10 ml with sterile water Aliquot and freeze at 20 C until needed Combine the following reagents 0 5 M Tris HCl pH 6 8 1 25 ml Glycerol 100 1 0 ml B mercaptoethanol 0 2 ml Bromophenol Blue 0 01 g SDS 0 2 Bring the volume to 10 ml with sterile water Aliquot and freeze at 20 C until needed 55 Technical Service Web Resources Visit the Invitrogen Web site at www invitrogen com for e Technical resources including manuals vector maps and sequences application notes MSDSs FAQs formulations citations handbooks etc e Complete technical service contact information e Access to the Invitrogen Online Catalog e Additional product information and special offers Contact Us For more information or technical assistance call write fax or email Additional international offices are listed on our Web page www invitrogen com Corporate Headquarters Japanese Headquarters European Headquarters Invitrogen Corporation Invitrogen Japan Invitrogen Ltd
85. t 1 0 NaCl pH 7 0 1 For 1 liter dissolve 10 g tryptone 5 g yeast extract and 10 g NaCl in 950 ml deionized water 2 Adjust the pH of the solution to 7 0 with NaOH and bring the volume up to 1 liter 3 Autoclave on liquid cycle for 20 minutes Allow solution to cool to 55 C and add antibiotic if needed 4 Store at room temperature or at 4 C LB agar plates 1 Prepare LB medium as above but add 15 g L agar before autoclaving 2 Autoclave on liquid cycle for 20 minutes 3 After autoclaving cool to 55 C add antibiotic and pour into 10 cm plates 4 Let harden then invert and store at 4 C in the dark 2 Tryptone 0 5 Yeast Extract 0 05 NaCl 2 5 mM KCl 10 mM MgCl 1 Dissolve 20 g tryptone 5 g yeast extract and 0 5 g NaCl in 950 ml deionized water 2 Make a 250 mM KCI solution by dissolving 1 86 g of KCI in 100 ml of deionized water Add 10 ml of this stock KC solution to the solution in Step 1 3 Adjust pH to 7 5 with 5 M NaOH and add deionized water to 1 liter Autoclave this solution cool to 55 C and add 10 ml of sterile 1 M MgCL You may also add antibiotic if needed 5 Store at 4 C Medium is stable for only 1 2 weeks continued on next page Recipes continued Lysis Buffer 2X SDS PAGE Sample Buffer 1X SDS PAGE Sample Buffer 50 mM potassium phosphate pH 7 8 400 mM NaCl 100 mM KCl 10 glycerol 0 5 Triton X 100 10 mM imidazole Prepare 1 M stock
86. t may help you troubleshoot your expression experiment To help evaluate your results we recommend including the expression control supplied with kit in your experiment Problem Reason Solution No expression of recombinant protein Gene of interest not in frame with the epitope tag Sequence your construct to verify if the insert is in frame with the epitope tag If not in frame redesign your PCR primers Incorrect antibody used for detection Use an antibody to your protein or one of the antibodies listed on page xii as appropriate Low expression Plasmid instability observed when using ampicillin for selection Substitute carbenicillin for ampicillin in your transformation and expression experiments see page 25 Toxic gene Note Evidence of toxicity includes loss of plasmid or slow growth relative to the control e Add 1 glucose to the bacterial culture medium during transformation and expression e Transform BL21 Star DE3 cells using the protocol on page 26 then perform the expression by growing cells at room temperature rather than 37 C for 24 48 hours e Transform your expression construct into a pLysS containing strain e g BL21 Star DE3 pLysS e Transform your expression construct into an E coli strain in which expression of T7 RNA polymerase is tightly regulated e g BL21 AI available from Invitrogen see our Web site for more information e Infect TOP10F
87. the next page to help you design your PCR primers If you wish to Then clone in frame with thioredoxin design the forward PCR primer to ensure that your protein is in frame with the N terminal leader peptide include the C terminal V5 epitope and 6xHis tag design the reverse PCR primer to remove the native stop codon in the gene of interest and preserve the reading frame through the C terminal tag not include the C terminal V5 epitope and 6xHis tag include the native sequence containing the stop codon in the reverse primer or make sure the stop codon is upstream from the reverse PCR primer binding site Note The first three base pairs of the PCR product following the 5 CACC overhang will constitute a complete codon continued on next page 13 Specific Requirements for Cloning into pET102 D TOPO continued TOPO Cloning Site Use the diagram below to help you design appropriate PCR primers to clone of pET1 02 D TOPO your PCR product into pET102 D TOPO Restriction sites are labeled to indicate the actual cleavage site The complete sequence of the vector is available for downloading from our Web site or from Technical Service see page 56 For more information about pET102 D TOPO refer to the Appendix pages 46 47 T7 promoter priming site T7 promoter r M 151 GGTGATGCCG GCCACGATGC GTCCGGCGTA GAGGATCGAG ATCTCGATCC CGCGAAATTA ATACGACTCA CTATAGGGGA l
88. thioredoxin folds the histidines at positions 32 and 64 interact with a native histidine at position 8 to form a patch This histidine patch has been shown to have high affinity for divalent cations Lu et al 1996 His Patch thioredoxin HP thioredoxin proteins can therefore be purified on metal TM chelating resins e g ProBond or Ni NTA Experimental Outline Flow Chart The flow chart below describes the general steps required to clone and express your blunt end PCR product Determine strategy for PCR Produce blunt end PCR product using properly designed PCR primers TOPO Cloning Reaction Mix together PCR product and pET TOPO vector Incubate 5 minutes at room temperature Transform into TOP10 E coli cells Select and analyze colonies Choose a positive transformant and isolate plasmid DNA Transform BL21 Star DE3 and induce expression with IPTG Designing PCR Primers Basic Requirements Designing Your PCR Primers General Requirements for the Forward Primer General Requirements for the Reverse Primer The design of the PCR primers to amplify your gene of interest is critical for expression Depending on the pET TOPO vector you are using consider the following when designing your PCR primers e Sequences required to facilitate directional cloning see below e Whether or not you wish to clone your PCR product in frame with the appropriate N terminal
89. usive license to use the enclosed BL21 Star strain for research or for commercial evaluation purposes only The strain is being transferred to you in furtherance of and reliance on such license You may not use the strain or the materials contained therein for any Commercial Purpose as defined below beyond a one year evaluation without a license for such purpose from CNRS If you are a commercial entity each of your laboratories is allowed a one year evaluation not free use period after which time this right automatically terminates To use any portion of BL21 Star strain for a Commercial Purpose as defined below commercial entities must obtain a commercial license from CNRS for each of their laboratories Contact information for commercial entities purchasing a BL21 Star strain will be provided to CNRS who may contact them during the evaluation period regarding their desire for a commercial license Commercial Purposes include Any use of rne131 in a Commercial Product Any use of rne131 in the manufacture of a Commercial Product Any sale of rne131 or products having used in a commercial process the rne131 genotype Access to the BL21 Star strain must be limited solely to those officers employees and students of your institution who need access to perform the above described research or evaluation You must inform each such officer employee and student of the provisions of this license agreement and require them to agree to be
90. wing when designing Considerations PCR primers to clone your DNA into pET100 D TOPO or pET200 D TOPO Be sure to include a stop codon in the reverse primer or design the reverse primer to hybridize downstream of the native stop codon If you wish to Then include the Xpress epitope and 6xHis tag design the forward PCR primer to place the gene of interest in frame with the N terminal tag Note that e a ribosome binding site RBS is included upstream of the initiation ATG in the N terminal tag to ensure optimal spacing for proper translation e at least five nonnative amino acids will be present between the EK cleavage site and the start of your gene express your protein with design the forward PCR primer to include the following a native N terminus i e without the N terminal peptide e astop codon to terminate the N terminal peptide e asecond ribosome binding site AGGAGG 9 10 base pairs 5 of the initiation ATG codon of your protein Note The first three base pairs of the PCR product following the 5 CACC overhang will constitute a complete codon TOPO Cloning Site of pET100 D TOPO and pET200 D TOPO Use the diagram below to help you design suitable PCR primers to clone your PCR product into pET100 D TOPO or pET200 D TOPO Restriction sites are labeled to indicate the actual cleavage site The sequence of each vector is available for downloading from our Web site or from Technic
91. wnloading from Web site www invitrogen com or by contacting Technical Service see page 56 E E ROS ATG its SX pET100 D lacZ amp pET200 D lacZ pET100 D lacZ pET200 D lacZ T7 promoter 209 225 209 225 T7 promoter priming site 209 228 209 228 lac operator lacO 228 252 228 252 Ribosome binding site RBS 282 288 282 288 Initiation ATG 297 299 297 299 Polyhistidine 6xHis region 309 326 309 326 Xpress epitope 366 389 366 389 EK recognition site 375 389 375 389 lacZ ORF 405 3476 405 3476 T7 reverse priming site 3538 3557 3538 3557 T7 transcription termination region 3499 3627 3499 3627 bla promoter 3928 4026 3928 4026 Ampicillin bla resistance gene 4027 4887 Kanamycin resistance gene m 4027 4821 pBR322 origin 5032 5705 5009 5682 ROP ORF complementary strand 6073 6264 6050 6241 lacI ORF complementary strand 7576 8667 7553 8644 50 Map of pET101 D lacZ Description The pET101 D lacZ 8825 bp vector contains a lacZ gene that has been directionally TOPO Cloned into pET101 D TOPO in frame with the C terminal peptide containing the V5 epitope and the 6xHis tag The size of the B galacto sidase fusion protein is approximately 120 kDa The nucleotide sequence of the vector is available for downloading from Web site www invitrogen com or by contacting Technical Service see page 56 Gp a res es Ce Oe Comments for pET101 D lacZ 8825 nucleotides T7 promoter bases 209 225 T7
92. ylamide gels and electrophoresis apparatus are available from Invitrogen In addition Invitrogen also carries a large selection of molecular weight protein standards and staining kits For more information about the appropriate gels standards and stains to use to visualize your recombinant protein refer to our Web site www invitrogen com or call Technical Service see page 56 continued on next page Analyzing Samples continued Analyzing Samples Detecting Recombinant Fusion Proteins To determine the success of your expression experiment you may want to perform the following types of analyses 1 Stain the polyacrylamide gel with Coomassie blue and look for a band of increasing intensity in the expected size range for the recombinant protein Use the uninduced culture as a negative control 2 Perform a western blot to confirm that the overexpressed band is your desired protein see below 3 Use the positive control to confirm that growth and induction were performed properly The table below lists the size of the p galactosidase fusion protein expressed from each positive control vector Note B galactosidase Antiserum is available from Invitrogen Catalog no R901 25 to detect B galactosidase fusion proteins by western blot Vector Size of the Control Protein pET100 D lacZ 121 kDa pET101 D lacZ 120 kDa pET102 D lacZ 133 kDa pET151 D lacZ 120 kDa pET200 D lacZ 121 kDa To det

pBAD/Thio His TOPO manual

Contents

Download Pdf Manuals

Related Search

Related Contents