spring - Global Marketing Services
Contents
1. Mtcroducing SMARTer PCR cDNA Synthesis A sensitive method for generating high quality full length cDNA In This ssue MicroRNA Expression amp Quantification Coexpress MicroRNAs with Fluorescent Proteins 00 000 c cece e eee e terete eee 2 Mir X MicroRNA Quantification 0 0 ccc eee eee eee eee eee eens A Cloning amp Yeast one Hybrid Technologies Synthesize cDNA the SMARTer Way 0ccc cece cece ete tenet eee ee eet e rnrn 6 Easily Identify and Characterize Protein DNA Interactions with Our New Yeast One Hybrid System ccc eee nunnurnar 8 Antibody Microarray Analysis Proteome at Your Fingertips 0 cc ccc cece eet eee ee eee eee eeeeeeenaes 10 Adenoviral g Lentiviral Expression Systems Obtain Adenoviral Titers in Less than 4 HOUIS ccc cece eee eect ee ee eee eeaee 12 Live Cell Reporters Now with Lentiviral Delivery 0 00 ccc eee e eee eee ee eeee 14 Concentrate Lentivirus Effortlessly 0 00 ccc ccc cece eee eee eee aranana 16 Excellent Infection Rates with Lenti X Systems and the RetroNectin Reagent 18 This issue and all prior issues are available online at www clontech com Clontech fp NIQUE CH LONTE d Taf Coexpress MicroRNAs with Fluorescent Proteins These vectors coexpress your miRNA with either the mCherry or ZsGreen1 fluorescent protein marker e High level miRNA and fluor2. Reverse Transcriptase The template switching ability of SMARTScribe Reverse Transcriptase is enhanced when combined with the new SMARTer oligonucleotide together these new components increase the likelihood of cloning your entire gene sequence and result in high quality full length cDNA regardless of template size or abundance 2 Get High Quality cDNA from LESS RNA SMARTer cDNA Synthesis Kits are especially useful for researchers who have limited starting material such as RNA derived from laser capture microscopy samples cells sorted by flow cytometry or other extremely small samples The SMARTer PCR cDNA Synthesis Kit allows first strand cDNA synthesis from only 2 ng of total RNA Figure 1 Panel A much less starting material than is required 6 Clontech Laboratories Inc www clontech com SMARTer cDNA Synthesis Starting Bn poly A material ae SMARTScribe MMLV RT PCR adaptor First strand m 5 Sided A Single cDNA synthesis mmmm step oe Oligo dT primer with added sequence gt Second strand mmmmm cDNA synthesis LD PCR amplification or primer extension Full length m ds Di Menm dT Template Ss Probes for mate ae for arrays PCR Subtractive hybridization Next generation sequencing Direct gene RACE amplification Library construction SMARTer cDNA synthesis occurs in a single step reverse transcription reaction Following amplification SMARTer cDNA can be used for a variety of downstre
3. FRANCE Ozyme Tel 01 34 60 24 24 Fax 01 30 45 50 35 GERMANY Clontech Tel 0800 1825178 Fax 33 0 1 3904 6870 GREECE BioSure Tel 30 210 922 3246 Fax 30 210 922 3252 HONG KONG Bio Gene Technology Ltd Tel 852 2646 6101 Fax 852 2686 8806 HUNGARY Central European Biosystems KFT Tel 36 23 502 195 Fax 36 23 502 196 INDIA DSS Imagetech Pvt Ltd Tel 91 0 11 2695 0325 Fax 91 0 11 2695 9382 ISRAEL Danyel Biotech Ltd Tel 1 800 711 911 Tel 08 936 6066 Fax 008 936 6056 ITALY EuroClone S p A Tel 800 315 911 toll free Tel 02 381 951 Fax 02 3810 1465 JAPAN Takara Bio Inc Tel 81 0 77 543 6116 Fax 81 0 77 543 9254 KOREA Takara Korea Biomedical Inc Tel 82 0 2 2081 2525 Fax 82 0 2 2081 2500 LUXEMBURG Westburg Tel 31 33 495 0094 Fax 31 33 495 1222 MALAYSIA Interscience Sdn Bhd Tel 60 0 3 5740 9888 Fax 60 0 3 5740 9866 MEXICO Apco Inc Uniparts S A Tel 52 55 52 81 4718 Fax 52 55 52 81 4722 NETHERLANDS Westburg Tel 31 33 495 0094 Fax 31 33 495 1222 NEW ZEALAND Norrie Biotech Tel 64 0 9 534 3559 Fax 64 0 9 534 0397 NORWAY AH diagnostics as Tel 2323 3260 Fax 2323 3270 PAKISTAN Global Marketing Service GMS Tel 92 0 51 484 1641 92 0 51 111 145 236 Fax 92 0 51 484 1861 92 0 51 484 2377 PHILIPPINES Diamed Enterprise Tel 63 0 49 536 0625 Fax 63 0 49 536 0625 POLAND NO
4. e Preserve precious samples and maintain accurate gene representation e Higher specificity lower background and increased yield e Enrich for full length cDNA e No adaptor ligation necessary e Amplify longer genes and rare transcripts SMART Technology just Got SMARTer Clontech revolutionized cDNA synthesis with the invention of SMART Switching Mechanism At the 5 end of RNA Transcript technology This unique technology utilizes the intrinsic terminal transferase and template switching activity of Moloney Murine Leukemia Virus Reverse Transcriptase MMLYV RT to accurately synthesize full length cDNA in a single reverse transcription reaction 1 while incorporating adaptors on both ends of the cDNA Incorporation of these universal primer binding sites in a single step during first strand cDNA synthesis eliminates the need for tedious second strand synthesis and adaptor ligation and facilitates a number of downstream applications including RACE Rapid Amplification of cDNA Ends subtractive hybridization and library construction This simple and highly efficient CDNA synthesis method ensures higher specificity in amplifying your target CDNA compared to conventional methods Clontech has recently developed a new batch of kits featuring SMART technology with improved components the SMARTer Kits for all your cDNA synthesis applications These new SMAR Ter Kits include a modified SMARTer II A Oligonucleotide and SMARTScribe
5. 10 13 and the induction of miR 9 was followed and quantified using the Mir X miRNA qRT PCR SYBR Kit and primers specific for miR 9 and U6 as a normalization control by changes in the cellular miRNA pool Using the Mir X system we tracked the abundance of one such miRNA miR 9 which was induced by RA and continued to accumulate in these cells following a 5 day exposure to RA Figure 3 Summary Mir X miRNA gRI PCR SYBR Kits are complete dual function qPCR systems that have the flexibility to monitor the level of your favorite miRNA or any other RNA species in your RNA sample The single tube cDNA synthesis is faster and far less complicated than other available methods while the miRNA qPCR is very sensitive and extremely accurate Product Size Cat No Mir X miRNA qRT PCR SYBR Kit 200 rxns 638314 NEW 600 rxns 638316 Mir X miRNA First Strand Synthesis Kit 20 rxns 638313 NEW 60 rxns 638315 Includes a Mir X miRNA First Strand Synthesis Kit Visitour website for more details click here Notice to Purchaser Please see the Advantage and TITANIUM PCR Products Hot Start Antibody Molecular Probes Inc and PCR licensing statements at www clontech com licensing Clontech Laboratories Inc www clontech com Clontechniques Spring 2009 5 Synthesize cDNA the SMARTer Way Get better results with SMARTer PCR cDNA Synthesis Kits e Generate high quality cDNA from as little as 1 2 ng of total RNA
6. Lenti X Reporter Systems provide low background and high signal intensity HEK 293 cells were transduced with pLVX CRE MetLuc Reporter Vector Panel A or pLVX CRE DD ZsGreen1 Reporter Vector Panel B treated with forskolin and assayed according to the respective protocols RLU relative light units RFU relative fluorescence units Product Size Cat No Lenti X Ready To Glow Secreted Luciferase Reporter System each 631746 NEW Lenti X DD Cyan Reporter System each 631748 NEW Lenti X DD Green Reporter System each 631751 NEW Lenti X DD Red Reporter System each 631753 NEW Lenti X 293T Cell Line 1ml 632180 Shield1 60 ul 631037 200 ul 631038 500 ul 632189 The number of reactions depends on the concentration of Shield1 used At the maximum suggested concentration 1 000 nM 60 ul 30 plus reactions and 200 ul 1 000 plus reactions in a six well plate Notice to Purchaser Visit our website AOAO details click here Please see the BGH Poly A CMV Sequence cPPT Element Lentiviral Expression Products Living Colors Fluorescent Protein Products Metridia luciferase ProteoTuner Protein Stabilization Destabilization Products Retroviral Packaging Systems Tet Based Expression Products VSV G Technology and WPRE Technology licensing statements at www clontech com licensing Clontech Laboratories Inc www clontech com Clontechniques Spring 2009 15 New products Concentrate Lentivirus Ef
7. Titration Methods Titration Method Adeno X qPCR Titration Ratios Sample qPCR Fluor X Gal qPCR Fluor qPCR X Gal Type Virus copies ml IFU ml IFU ml copies IFU copies IFU Purified AdAcGFP1 5 62 x 10 3 03 x 10 N A 2 N A Crude AdAcGFP1 PrepA 1 44 x 10 1 90 x 10 N A 8 N A Prep B 1 46 x 10 2 26 x 10 N A 6 N A Prep C 1 38 x 101 2 73 x 10 N A 5 N A Purified AdLacZ 1 01 x 10 N A 1 54 x 10 N A 7 Crude AdLacZ PrepA 133 x 10 N A 2 67 x 10 N A 5 Prep B 1 24 x 10 N A 2 67 x 10 N A 5 Prep C 121x 10 N A 3 15 x 10 N A 4 a Adenoviral copy numbers were determined using the Adeno X qPCR Titration Kit Cat No 632252 b To determine fluorescence based infectivity titers adenoviral stocks were serially diluted tenfold and applied to HEK 293 cells After 48 hr fluorescent cells were scored with a fluorescence microscope 42 Clontech Laboratories Inc www clontech com Clontechniques Spring 2009 New products The qPCR Titration Method The protocol combines qPCR with SYBR Green chemistry sample is then determined by comparing its C value to a standard allowing you to determine the viral genome copy number in curve generated by plotting the C values of the diluted control adenoviral preparations i e crude lysates or purified stocks samples against their respective copy numbers Figure 1 Titration from a calibrated DNA standard curve Figure 1 The procedure assays demonstrating the
8. a variety of applications In principle any RNA that is or can be polyadenylated may be quantified using the Mir X method In mouse embryonic stem cells we were able to monitor the altera tions in expression for a panel of 12 miRNAs that respond to trichostatin A TSA treatment Figure 2 Exposing aggregated mouse P19 cell clusters to retinoic acid RA causes them to acquire neural cell phenotypes which are accompanied New products 5 c 4 2 29 3 ge 2 D L 1 a Maes S ey One a a ae ae a a Tae Tae wei JF vo ww amp amp F F FF eg SF YY Lf amp RE FF VN fe WwW ow ae Ss Ss MicroRNA Figure 2 Trichostatin A treatment alters miRNA expression in mouse ES cells Mouse embryonic stem cells were harvested either prior to or after being treated with trichostatin A TSA for 18 hr RNA was prepared from the cells and was then analyzed by MirX miRNA qRT PCR using primers specific for the 12 indicated miRNAs and for a p21 control MRNA known to be induced by TSA 1107 RA RA z 20 RA x 70 E 50 g 30 8 10 10 0 3 6 9 12 Days Figure 3 Induction of miR 9 in mouse P19 cells P19 mouse embryonal carcinoma cells were plated on agarose coated petri dishes and allowed to form embryoid bodies EB in the presence or absence of retinoic acid RA After five days of culture EBs were dissociated with trypsin and replated on tissue culture dishes without RA Cells were harvested on days 3 7 and
9. a Mir X miRNA First Strand Synthesis Kit Visitour website for more details AAKI ORI Notice to Purchaser Please see the Advantage and TITANIUM PCR Products CMV Sequence Fruit Fluorescent Protein Products Hot Start Antibody Living Colors Fluorescent Protein Products Molecular Probes Inc and PCR licensing statements at www clontech com licensing Clontech Laboratories Inc www clontech com Clontechniques Spring 2009 2 Mir X MicroRNA Quantification Quickly and accurately quantify your miRNAs and their mRNA targets with this complete qRT PCR kit e Quantify any miRNA and its target from the same RNA sample e 2 kits in 1 cDNA synthesis and qPCR e Simple single step cDNA synthesis reaction For the challenging task of unraveling microRNA miRNA expression profiles in tissues and cell lines Clontech scientists have developed a sensitive reliable and easy to use miRNA quantification system The Mir X miRNA qRT PCR SYBR Kits are complete dual function systems for performing first strand cDNA synthesis and quantitative PCR qPCR to precisely measure the level of your favorite miRNAs The kits are available in economical large sized formats that provide 200 or 600 qPCR reactions Simple and Sensitive A simple single step reaction uses an optimized mix of poly A polymerase and SMART MMLIV Reverse Transcriptase to synthesize first strand cDNA from your RNA sample The cDNA is then specifically amplified
10. hybrid system e Aureobasidin A selection eliminates background e Complete system for easy construction and screening of cDNA libraries directly in yeast Clontech s Matchmaker Gold Yeast One Hybrid Library Screening System provides a simple and efficient method for identifying and characterizing novel protein DNA interactions The system uses SMART cDNA synthesis technology which allows cDNA libraries to be created from any tissue source starting with as little as 100 ng of total RNA It also employs Aureobasidin A AbA 1 selection which provides the most stringent yeast one hybrid Y1H screening strategy available The system In the Matchmaker Gold Yeast One Hybrid Library Screening System 1 3 copies of your target DNA sequence i e the bait are cloned into the reporter vector pAbAi The resulting pBait AbAi construct is then integrated into the genome of the Y1HGold yeast strain by homologous recombination to generate a bait specific reporter strain A cDNA library expressing potential DNA binding proteins i e prey as fusions to the GAL4 transcription activation domain AD is constructed directly in the pBait AbAi reporter strain When a prey protein binds to the DNA target sequence see figure below transcription of the Aureobasidin A resistance gene AbA is activated allowing the cell to grow on medium containing the antibiotic Aureobasidin A AbA In library screens the plasmids encoding the library derived p
11. transcript miRNA expression can be selected for and or verified in transfected cells by monitoring red or green fluorescence 2 Clontech Laboratories Inc e www clontech com Clontechniques Spring 2009 MIRNA Expression Once an miRNA sequence is cloned in the multiple cloning site of these vectors miRNA expression can be delivered into any transfectable cell line We used the pmR ZsGreen1 and pmR mCherry vectors to express several different miRNAs in 293T cells Figure 2 The miRNA sequences were amplified from human genomic DNA and then cloned into the vectors The sequences included the indicated miRNA stem loop along with 300 bp of flanking DNA Following transfection into sepa rate cultures samples of total RNA were prepared and treated with DNase prior to quantifying the expressed miRNAs using Clontech s Mir X miRNA qRT PCR SYBR Kit Both vectors produced similarly high levels of expression for each miRNA which were elevated to a range of values between 75 and gt 3000 fold over the vector only controls pUC F mCherry ZsGreen1 HSVTK polyA pmR mCherry ZsGreen1 Vector Kan Neo SV40 P SV40 polyA pmR ZsGreen1 pmR mCherry Figure 1 The pmR mCherry and pmR ZsGreen1 Vectors Map of the vectors Panel A Cells transfected with the vectors exhibit red or green fluorescence Panel B New products MIRNA Quantification Clontech s Mir X miRNA qRT PCR SYBR Kit has a di
12. 9 2009 Fluorescent Ab Microarray Bethesda MD Proteins 500 Society for Neuroscience 2009 CD October 17 21 2009 SMARTer Chicago IL cDNA Synthesis http www sfn org ASCB 49th Annual Meeting Clontech microsites offer valuable solutions for a variety of applications December 5 9 2009 e Learn how to rapidly cycle your protein s concentration in order San Diego CA to understand its function at the ProteoTuner Microsite http www ascb org Select the best fluorescent protein for your experiment by color application or excitation emission wavelength at the Fluorescent Proteins Microsite Easily identify the best PCR enzyme for your experiment with our interactive selection guide at the PCR Microsite l Ea l Mixed Sources A Learn how to quickly and efficiently clone ANY insert plete ou Fonal aea CA into ANY location within ANY vector at the In Fusion Microsite recycled wood or fibre PSC fisercestevanchpeoune Learn how to simultaneously profile changes in expression of gt 500 proteins in a single one day experiment at the Antibody Microarray 500 Microsite Energy savings for this issue with environmentally friendly paper Total energy saved Greenhouse gas reduction 1 954 575 BTUs 255 Ibs Learn how to get high quality cDNA from less RNA at the Get SMARTer Microsite Wastewater reduction Solid waste reduction 1 172 gallons 130 Ibs The paper used for this issue of Clontechniques is 70 Nature 10 Recy
13. High data quality is achieved by using a Cy3 Cy5 dye swap detection technology together with an internally normalized ratio 2 This technology also has a built in concentration step that allows for the detection of low abundance proteins by accumulating antigens onto the antibody during the incubation step thus increasing the signal A one hour data analysis procedure yields highly sensitive reproducible and reliable data that are biologically relevant These data have been validated using Western blotting ELISA immuno histochemistry and literature references over 40 publications to date Microarray with gt 500 pairs Array incubated with Native antigens bound of unique monoclonal antibodies native protein extracts to antibodies on array cells tissues body fluids etc Western blot validation Labeled analyte Capture antibody Array surface Overview of the Ab Microarray 500 Protocol ELISA validation Immunohistochemistry validation Literature references lt lt r 10 Clontech Laboratories Inc e www clontech com Clontechniques Spring 2009 Product Overview 3 A 3 Tonsil MCL 1 MCL 2 MCL 3 D a AEST 2 ERTS D ene ete ert CRIK T E oath hemes Hf D INS nn Trey eee Cac 2 x S REEE A TOES a f aA ye p DY tte y gt 3 Br ar 5 s i y x Hsp90 is ie y See sae ee 5 eo Fs r i 5 J m a 0h gt 2 Tonu Xi Dya P a Yy r TT 1 2 3 4 5 6 Control 7 7 repe
14. I After 10 Titer IFU ml High Medium Low Starting Titer Figure 3 Concentrate virus from any starting titer Tenfold serial dilutions of a high titer lentiviral supernatant high medium and low were concentrated from a volume of 10 ml down to 100 ul using the Lenti X Concentrator Reagent Titrations were performed using HT1080 cells and flow cytometry 48 hr post transduction Visit our website H for more details click here jj Ordering Information Product Lenti X Concentrator Clontech Laboratories Inc www clontech com Size Cat No 100 ml 631231 NEW 500 ml 631232 Clontechniques Spring 2009 17 1383 Product Overview Excellent Infection Rates with Lenti X Systems and the RetroNectin Reagent A simple protocol for difticult to transduce cells Why a superinfection We have used our Lenti X viral systems together with RetroNectin coated dishes from Takara Bio to successfully transduce Jurkat T cells which can transduce inefficiently This double infection protocol increases the infection efficiency for Jurkat cells from lt 10 to gt 90 1 To read the specifics of our experiment please visit us on the web at www clontech com jurkat y A Culture for 24 hr Add viral supernatant Incubate or centrifuge allowing lentivirus to bind Add cells to RetroNectin coated dish Harvest cells Remove supernatant and wash with PBS Repeat adding cells to a second Ret
15. RTH DIAG MED Tel 48 22 8389 723 Fax 48 22 8389 732 POLAND SOUTH Immunogen sp z 0 0 Tel 48 32 249 40 20 Fax 48 32 241 31 84 PORTUGAL ENZlfarma S A Tel 21 421 9330 Fax 21 421 9339 REPUBLIC OF IRELAND amp NORTHERN IRELAND Unitech LTD Tel 01 4048300 Fax 01 4048333 SINGAPORE Biomed Diagnostics Private Ltd Tel 65 6 298 4347 Fax 65 6 298 4723 SLOVAKIA T A Intertact s r o Tel 420 224 810 196 Fax 420 222 314 055 SLOVENIA Medias International d o o Tel 386 1 5202 300 Fax 386 1 5202 495 SOUTH AFRICA Southern Cross Biotechnology Tel 27 21 6715 166 Fax 27 21 67 12 734 SPAIN Nucliber Tel 915 062 940 Fax 915 394 330 SWEDEN In vitro Sweden AB Tel 08 306 010 Fax 08 306 015 SWITZERLAND Clontech Tel 0800 563 629 Fax 33 0 1 3904 6870 TAIWAN Unimed Healthcare Inc Tel 886 0 2 2720 2215 Tel 886 0 2 2720 2216 Fax 886 0 22 723 3666 THAILAND ITS Thailand Co Ltd Tel 66 0 2 308 0611 Fax 66 0 2 308 0612 TURKEY TEZ Ileri Teknolojiler ve Tel 90 312 266 2470 Fax 90 312 266 2472 UNITED KINGDOM Clontech Tel 0808 234 8063 Fax 33 0 1 3904 6870 Clontech Laboratories Inc A Takara Bio Company 1290 Terra Bella Ave Mountain View CA 94043 USA Clontech Clontech logo and all other trademarks are the property of Clontech Laboratories Inc unless noted otherwise Clontech is a Takara Bio Company No part of th
16. RTer Il A Oligo increases the overall yield of the 5 RACE PCR products Note the difference in intensity between the 2 6 kb 5 RACE product in Lane 2 produced by the SMART II A oligo and that in Lane 6 produced by the SMARTer II A oligo both bands resulted from the amplification of only 2 ng of human placental total RNA template In the assay shown first strand cDNA synthesis and 5 RACE PCR amplification were performed as described in the user manual PT4096 1 Lanes 1 amp 5 No RNA 5 RACE control Lanes 2 amp 6 Transferrin Receptor TFR 5 RACE starting from 2 ng total RNA Lanes 3 amp 7 TFR 5 RACE starting from 50 ng total RNA Lanes 4 amp 8 5 cDNA internal control using 2 ng total RNA as template Lane M 1 kb DNA Ladder Product Size Cat No SMARTer PCR cDNA Synthesis Kit 10 rxns 634925 NEW 20 rxns 634926 SMARTer Pico PCR cDNA Synthesis Kit 10 rxns 634928 NEW SMARTer RACE cDNA Amplification Kit 10 rxns 634923 NEW 20 rxns 634924 Universal Primer Mix 100 rxns 634922 NEW Visit our website AOAO details click here Notice to Purchaser Please see the SMART Amplification Products licensing statement at www clontech com licensing Clontech Laboratories Inc www clontech com Clontechniques Spring 2009 7 3 Clontech Laboratories Inc www clontech com Easily Identify and Characterize Protein DNA Interactions with Our New Yeast One Hybrid System e Highest performing yeast one
17. ads to expression of secreted luciferase protein in the medium At desired time OOOOOOOOOO points assay Add luciferase OOOO OOCCOCOOCO uci age uciferase activit substrate OO000000000 y e eeo Secreted ESS li a luciferase ee ors wos Detection by luminometer Product Flowchart of the Lenti X Ready To Glow Secreted Luciferase Reporter System protocol Clontechniques Spring 2009 Don t MiSs Transient Activity The Lenti X Ready To Glow Secreted Luciferase Reporter System is based on a secreted reporter Metridia luciferase which exhibits superior performance compared to traditional cytosolic luciferase reporters Secreted luciferases are not degraded like cytosolic luciferase reporters so you can monitor intermittent short bursts of promoter activity that you might have missed previously In addition Metridia luciferase has higher sensitivity than Renilla or firefly luciferases 2 To remove background just wash out any reporter molecules synthesized prior to your experiment with a simple media change Then activate the promoter and monitor its activity by sampling the accumulated stable reporter from the media Measure Activity On Demand The Lenti X DD Fluorescent Protein Reporter Systems combine a bright fluorescent protein reporter for high signal intensity with Proteo Tuner technology to eliminate background 3 Ligand dependent on demand stabilization of the fluoresce
18. am applications Clontechniques Spring 2009 Al PCR Cycles B PCR Cycles M a18 21 24 27 M 18 21 24 27 10 0 3 0 2 0 1 5 1 0 a Ma Figure 1 Typical gel profile of ds cDNA synthesized with the SMARTer PCR cDNA Synthesis Kit Panel A and the SMARTer Pico PCR cDNA Synthesis Kit Panel B using the Control Human Placental Total RNA as a template 2 ng Panel A or 1 ng Panel B of the Control Human Placental Total RNA was subjected to first strand cDNA synthesis and purification followed by PCR amplification as described in the user manual for each kit 5 ul of each PCR product was electrophoresed on a 1 2 agarose EtBr gel in 1X TAE buffer following the indicated number of PCR cycles Lanes M 1 kb DNA ladder size markers The arrows indicate the strong band at 900 bp typically seen for human placental total RNA for the original SMART PCR cDNA Synthesis Kit Cat No 634902 Since extremely dilute RNA cannot be used in regular cDNA synthesis we designed the new SMARTer Pico PCR cDNA Synthesis Kit to synthesize high quality cDNA from even less starting material as little as 1 ng of total RNA at a concentration as low as 20 pg ul Figure 1 Panel B The SMARTer Pico Kit is the new and improved version of our original Super SMART PCR cDNA Synthesis Kit Cat No 635000 The SMARTer Pico cDNA synthesis protocol makes it possible to use the entire volume of purified single strand
19. and quantified by qPCR using your miRNA specific primer and our SYBR Advantage qPCR Premix Multiple miRNA species as well as the mRNA targets of the miRNAs can be amplified from a single cDNA sample The system is extremely sensitive and able to detect miRNAs down to 50 copies First strand Add cDNA to miRNA qPCR Data analysis cDNA synthesis specific primers and from any RNA SYBR Advantage Premix Mir X single step cDNA synthesis 5 3 l Poly A polymerase 5 AAAAAAAAAAAAA 3 miRNA primer SYBR Advantage qPCR l Oligo dT priming gt Co _ Se ae gt 5 AA AAA AAAAAAAA 3 SYBR Advantage 3 TTTTTTTTTTTT e 5 ORE E T T T SMART MMLV RT 5 AA AAAAAAAAAAA 3 lt 4 TE A TE E e E T T T a 9 Mir X miRNA qRT PCR SYBR Kits use a single step single tube reaction to produce first strand cDNA which is then specifically and quantitatively amplified using a miRNA specific primer and SYBR Advantage qPCR chemistry In the Mir X cDNA synthesis reaction RNAs are poly A tailed using poly A polymerase and then copied using a modified oligo dT primer and SMART MMLV Reverse Transcriptase 4 Clontech Laboratories Inc e www clontech com Clontechniques Spring 2009 Highly Specific Detection To demonstrate the specificity of Mir X miRNA quantification we used a series of 8 highly similar synthetic Let7 miRNA variants Figure 1 We first spiked each of the Let7 miRNAs i
20. ated MDM2 x E ET E MCL samples PE Se X ee Sooke dh ee Py Figure 1 Expression levels of the 13 overexpressed proteins in the MCL samples as compared to the control The data points B are colored in red orange indicating overexpression The samples Tonsil MCL 1 MCL 2 are numbered 1 to 7 MCL7 showed a reversed expression pattern 2 j compared to the other 6 MCL samples MCL7 was tested twice Rb2 and demonstrated a consistent expression pattern Data were analyzed using GeneSpring software Agilent Technologies Inc ae Ab Microarra 500 Analysis Paxillin of Mantle cell Lymphoma Bcl x W The Ab Microarray 500 was used in the proteomic analysis of mantle cell lymp homa MCL 1 Seven oe les were analyzed Figure 2 Immunohistochemistry was used to analyze false positive and compared to a control sample Six of the samples showed and false negative results Paraffin embedded tissue biopsies available 13 proteins that were overexpressed when compared to the control from the same patients were analyzed using antibodies present on and one sample displayed an inverted expression profile Figure 1 the array in order to test for false positives Panel A and false negatives Panel B The Panel A results are consistent with the antibody array in detecting increased levels of CRIK and MDM2 and the Western blot in failing to demonstrate elevated Hsp90 pata RE prod ucibility levels The Panel B results did not reveal any false nega
21. cled Gloss Book The inks used were soy based Clontech LELCIC EICON A Tel 81 0 77 543 6116 web clontech takara bio co jp Clontech Laboratories Inc Tel 1 650 919 7300 e mail tech clontech com Clontech Laboratories Inc Tel 1 650 919 7300 e mail tech clontech com Takara Bio Europe Clontech Tel 33 0 1 3904 6880 e mail info clontech europe com International Offices and Distributors AUSTRALIA Scientifix Pty Ltd Tel 61 0 3 8540 5900 Tel 1800 007 900 toll free Fax 61 0 3 9548 7177 AUSTRIA Clontech Tel 0800 296 141 Fax 33 0 1 3904 6870 Hanke Laboratory Products Tel 01 798 53 1112 Fax 01 798 53 1119 BALTIC STATES ESTONIA LATVIA LITHUANIA In vitro Eesti OU Tel 372 630 6523 Fax 372 630 6522 BELGIUM Westburg Tel 31 33 495 0094 Fax 31 33 495 1222 BRAZIL Sinapse Biotecnologia Tel 55 11 6605 5759 Fax 55 11 6605 5655 CANADA Clontech Laboratories Inc Tel 800 662 2566 Fax 800 424 1350 CHINA Takara Biomedical Biotechnology Beijing Co Ltd Tel 86 0 10 8072 0985 Tel 86 0 10 8072 0986 Fax 86 0 10 8072 0989 COLOMBIA LABB Luis Alfredo Bastidas Barajas Tel 57 1 6482566 Fax 57 1 2583028 CZECH REPUBLIC T A Intertact s r o Tel 420 224 810 196 Fax 420 222 314 055 DENMARK Medinova Scientific A S Tel 39 56 20 00 Fax 39 56 19 42 FINLAND In vitro Sweden AB Tel 0800 11 46 27 Fax 46 0 8 306015
22. consistency of this approach when used is simple viral DNA and control DNA provided are serially diluted with either crude lysate or purified virus are shown in Figure 2 and subjected to qPCR The DNA copy number of each viral A g 24 22 10 20 cc 3 18 o i cc E10 5 16 D o 14 g S 12 mma 10 10 2 8 6 0 5 10 15 20 25 30 35 40 103 104 10 10 10 108 Cycle no Initial quantity copies Figure 1 The Adeno X qPCR titration method exhibits a wide dynamic range Adeno X DNA Control Template was serially diluted to 108 103 copies per sample and analyzed with the Adeno X qPCR Titration Kit The amplification plots Panel A show a dynamic range of at least six orders of magnitude each dilution is represented by a different colored plot The standard curve Panel B demonstrates a strong linear correlation between the C and the DNA copy number log scale with R 1 000 and a PCR efficiency of 96 2 Once the genome copy number of your viral stock is determined Our method makes it possible to infect cells at a known multiplicity it can be correlated with the number of viral infectious units IFU of infection MOD allowing you to produce results that are precise determined independently to establish a copy number IFU consistent and interpretable The Adeno X qPCR Titration Kit relationship Table I Determination of the copy number IFU includes sufficient material for 200 qPCR reactions and allows relationship for a gi
23. ed cDNA for amplification via increased reaction volumes and an additional column purification step Both the SMARTer and SMARTer Pico protocols produce ds cDNA yields ranging from 1 2 pg Amplify Longer Transcripts Clontech s new SMARTer RACE cDNA Amplification Kit an improved version of our original SMART RACE cDNA Amplification Kit Cat No 634914 allows you to identify the complete sequence of your RNA transcript from a small region of known sequence within the transcript all the way to the 5 or 3 end of the RNA starting with as little as 2 ng of total RNA New products Following reverse transcription SMARTer cDNA can be used directly in 5 and 3 RACE PCR reactions without an additional adaptor ligation step A side by side test of the new SMARTer oligo and the SMART oligo included in the original kit revealed an increased overall yield of 5 RACE PCR products with the SMARyTer oligo Figure 2 The SMARTer RACE Kit facilitates RACE PCR via the included Universal Primer Mix which is also sold separately Additionally the kit includes random primers for researchers whose RNA lacks a poly A tail References 1 Chenchik A et al 1998 In Gene Cloning and Analysis by RT PCR Eds Siebert P amp Larrick J Bio Techniques Books MA Ch 22 2 Be SMARTI About First Strand cDNA Synthesis January 2009 Clontechniques XXIV 1 15 17 SMART IIA SMARTer lI A M 1 2 3 4 5 6 7 8 Figure 2 The SMA
24. enti X Concentrator reagent to clarified viral supernatant incubate for 30 min to overnight at 4 C and spin That s it 1 6 Clontech Laboratories Inc e www clontech com Clontechniques Spring 2009 Increase Titers by 100 fold Using the Lenti X Concentrator protocol we were able to increase the titer of a lentiviral supernatant from 107 to 10 IFU ml and recover 90 of the virus in 1 100 of the original volume Figure 1 You can achieve similar results starting with any volume of supernatant 3 mil 30 10 E S w H 10 Before After Total IFU 3 8 x 107 3 4 x 10 Figure 1 Efficient concentration with minimal loss Lentiviral supernatant from a pLVX ZsGreen1 vector was concentrated from 3 ml down to 30 ul using the Lenti X Concentrator reagent which reflected a 100 fold increase in viral titer Measuring the total amount of virus contained in each sample indicated that the resuspended pellet captured 90 of the virus present in the original sample Samples were titrated using HT1080 cells and analyzed by flow cytometry 48 hr post transduction Far Simpler Than ultracentrifugation In a side by side comparison between Lenti X Concentrator and ultracentrifugation the advantages of Lenti X are clearly evident Table I Lenti X Concentrator is more flexible faster easier and just as efficient as ultracentrifugation Table I Lenti X Concentrator vs Ultracentrifugation Feature Lenti X Concentrator Ul
25. escent protein coexpression e Simultaneously verify miRNA expression and transfection efficiency e Very bright fluorescent proteins Clontech offers two new vectors that provide high level miRNA expression and allow you to verify it with fluorescent protein expression Ihe pmR mCherry and pmR ZsGreen1 Vectors couple your miRNA expression cassette to a bright red or green fluorescent reporter for miRNA expression you can see and select How Does It work Clone your miRNA sequence into the vector s multiple cloning site MCS located in the 3 untranslated region of the fluorescent proteins mRNA transcript This enables both molecules to be expressed simultaneously from the vector s strong CMV promoter Each vector is equipped with the high level CMV promoter a selectable marker and a fluorescent protein miRNA expression cassette containing either mCherry or ZsGreen1 our two brightest Living Colors Fluorescent Proteins Figure 1 In short you can clone and express your favorite miRNA and then select sort and or visualize the cells in which it is expressed Coding region for mCherry ZsGreen1 3 untranslated region AAAAAAAAAAAAA mRNA translation Cleavage of 3 UTR ee miRNA processing LLLLLLLLLI Target gene inhibition Target gene mRNA 5 AAAAAAAAAAAAA ui je The pmR mCherry and pmR ZsGreen1 vectors will coexpress a fluorescent protein and an miRNA sequence that is embedded in the 3 UTR of the vector s mRNA
26. fortlessly Increase your viral titer 100 fold with Lenti Xx Concentrator without ultracentrifugation e Simply mix and spin e Hassle free and easily scaled up for large volumes e No ultracentrifugation required Need to concentrate your lentivirus preps but don t want the hassle of ultracentrifugation Use Lenti X Concentrator to increase your available titer up to 100 fold and infect your target cells at higher MOIs and in reduced volumes without making more virus Simple Protocol Mix wait Spin Lenti X Concentrator provides a fast simple and highly efficient method for concentrating any lentiviral stock In the simple protocol you just mix your lentiviral supernatant with the Lenti X Concentrator reagent incubate for a short period and spin the mixture in a standard centrifuge see below You ll increase your vector titer by up to 100 fold in 1 hr and obtain excellent recoveries with no ultracentrifugation Lenti X Concentrator works for all lentiviral supernatants including those made from any of Clontech s Lenti X Systems and the procedure can be scaled up or down to best suit your needs Add Lenti X Concentrator to clarified viral supernatant e Store at 80 C A ES e Infect targets Incubate at 4 C Centrifuge Collect pellet for 30 min at 1 500 x g at 4 C and resuspend to overnight for 45 min in 1 10 to 1 100 original volume The Lenti X Concentrator protocol Add L
27. iment Clontech s Lenti X Reporter Systems allow you to study your promoter of interest with a chemiluminescent or fluorescent on demand reporter in virtually any cell type including primary cultures dividing and nondividing cells stem cells terminally differentiated cells and neuronal cells These are complete systems which include our advanced 4th generation packaging systems and lentivirus transfection system plus your vector of choice 1 Figure 1 They deliver excellent signal to noise ratios by excluding reporter molecules that are expressed prior to the experiment Figure 2 and allow you to monitor promoter activity at any time point and for any length of time that you choose Because there is no cell lysis you can observe multiple promoter activation cycles using the same cells Table I How Do Choose My Reporter System Lenti X Lenti X Ready To Glow DD Fluorescent Secreted Luciferase Protein Reporter System Reporter Systems Chemiluminescent vi detection plate reader Fluorescent detection flow cytometry fluo v4 rescence microscopy Automatable Y v License required for y For Profit organizations 1 AmCyan1 ZsGreen1 or tdTomato 44 Clontech Laboratories Inc www clontech com Promoter of interest i RRE cPPT tTA Lentiphos HT B cy transfection gt B Lenti X HT Packaging Mix 293T cells 1 Collect virus after 48 hr 2 Transduce host cells Promoter activation le
28. is publication may be reproduced transmitted transcribed stored in retrieval systems or translated into any language or computer language in any form or by any means electronic mechanical magnetic optical chemical manual or otherwise without prior written permission from Clontech 2009 Clontech Laboratories Inc UD933047 IN 630873
29. ished active reporter i e positive Y1H interactions in less time and with greater confidence than ever before Aureobasidin A Selection Elaminates Background Matchmaker Gold Systems are unique because they use the AbA very straightforward Figure 1 as AbA effectively kills yeast cells gene as a novel reporter that confers resistance to AbA a potent that are not expressing the AbA reporter Aureobasidin A antifungal agent that is toxic to S cerevisiae Selecting for resistance and all of the required media are supplied in our Yeast Media to this highly stable depsipeptide makes Y1H library screening Set 1 Plus Reference 1 Takesako K et al 1991 J Antibiot 44 9 919 924 Product Size Cat No Matchmaker Gold Yeast One Hybrid Library Screening System 5 rxns 630491 NEW Yeast Media Set 1 Plus each 630493 NEW Matchmaker Insert Check PCR Mix 1 100 rxns 630496 NEW Matchmaker Insert Check PCR Mix 2 100 rxns 630497 NEW Easy Yeast Plasmid Isolation Kit 50 preps 630467 Visit our website for more details click here Notice to Purchaser Please see the HotStart Antibody PCR PCR Polymerase SMART Amplification Products and Aureobasidin Resistance Gene licensing statements at www clontech com licensing Clontech Laboratories Inc www clontech com Clontechniques Spring 2009 9 Product Overview Proteome at Your Fingertips Applications tor the Ab Microarray 500 Applications bioma
30. ms Tet Based Expression Products VSV G Technology and WPRE Technology licensing statements at www clontech com licensing Clontech Laboratories Inc www clontech com Clontechniques Spring 2009 Clontech Laboratories Inc products are intended to be used for research purposes only They are C O ntech n IQ UES not to be used for drug or diagnostic purposes nor are they intended for human use Products may not be resold modified for resale or used to manufacture commercial products without written approval Managing Editor Sharon Fried of Clontech Laboratories Inc Clontechniques is published quarterly in Winter Spring Summer and Fall by Clontech Laboratories Inc ee e 1290 Terra Bella Avenue Mountain View CA 94043 1837 USA Martina Niou Layout amp Design Trademarks Jennifer Kolanek Cy3 and Cy5 are trademarks of GE Healthcare GeneSpring is a trademark of Agilent Technologies Inc Contributing Editors RetroNectin is a registered trademark of Takara Bio Inc Dominique DeBold SYBR is a registered trademark of Molecular Probes Inc Ilene Kaufman Ph D Kurt Liittschwager Ph D Kathleen Wunderlich Clontech Microsite portal Upcoming conferences Visit our new Clontech Microsite Portal at 7 o ease visit us at these events www clontech com microsites to learn more about our products and technologies For an in depth exploration of the following product lines NIH Research Festival October 8
31. nt reporter allows you to start monitoring promoter activation whenever you choose cPPT RRE CTS 5 LTR H MH pLVX MetLuc pLVX DD FP Figure 1 Lenti X chemiluminescent Panel A and fluorescent Panel B reporter vectors Lenti X vectors contain sequence elements that facilitate lentiviral packaging and or boost expression of your reporter including the LTRs packaging signal Rev response element RRE and central polypurine tract central termination sequence cPPT CTS from HIV 1 and the woodchuck hepatitis virus post transcriptional regulatory element WPRE MetLuc Metridia luciferase DD ligand dependent destabilization domain FP fluorescent protein AmCyan1 ZsGreen1 or tdTomato New products Save Time and Money using Live Cell Reporters These systems are ideal for your studies with limited numbers of cells e g stem cells or to study multiple promoter activation cycles and or time points in order to produce many sets of data over time References 1 High Efficiency Lentiviral Packaging October 2007 Clontechniques XXII 4 1 2 2 Ready To Glow Secreted Luciferase System July 2006 Clontechniques XX1 2 12 13 3 The Next Generation of Promoter Reporters January 2009 Clontechniques XXIV 1 22 23 160 000 Forskolin Forskolin 120 000 3 80 000 ce 40 000 0 pLVX CRE MetLuc 140 120 100 80 60 40 20 RFU pLVX CRE DD ZsGreen1 Figure 2
32. nto separate samples of yeast polyA RNA and generated cDNA using the Mir X single tube reaction We then tested a panel of variant specific primers with each cDNA sample to determine each primer s ability to specifically and individually quantify the Let7 subtypes in the cDNA sample Despite the high degrees of similarity among the variants and the primers Figure 1 Panel A Mir X qPCR was highly specific in detecting each Let7 variant Figure 1 Panel B Al Let7a TGAGGTAGTAGGTTGTATAGTT Let7b TGAGGTAGTAGGTTGTGTGGTT Let7f TGAGGTAGTAGATTGTATAGTT Let7ec TGAGGTAGTAGGTTGTATGGTT Let7g TGAGGTAGTAGTTTGTACAGTT Let7d AGAGGTAGTAGGTTGCATAGTT Let7i TGAGGTAGTAGTTTGTGCTGTT Let7e TGAGGTAGGAGGTTGTATAGTT 100 miRNA E 80 I Let7a E Let7b 5 60 D Let7c ae E Let7d 40 E Let7e 2 Let7f S 20 a E Let7g E Let7i Let7a Let7b Let7c Let7d Let7e Let7f Let7g Let7i Primer Figure 1 Specific quantification of Let7 miRNA variants Using miRNA specific primers Panel A Mir X qRT PCR was able to specifically detect and quantify each member of a series of 8 synthetic Let7 variants that had been spiked into a background of yeast polyA RNA Panel B The primers detected each of their corresponding Let7 miRNA cognates but did not detect the off target variants in 63 of 64 possible combinations Diverse Research Applications Since the Mir X system is able to detect multiple miRNAs shRNAs or mRNA targets in a single RNA sample it can be used for
33. rey proteins can be rescued from the surviving yeast clones and subjected to further analysis Library Proteins V RNA Pol Il Target DNA Element Bait Sequence AbA mRNA Screening for protein DNA interactions with the Matchmaker Gold Yeast One Hybrid System Clontechniques Spring 2009 New products SMART Technology Get Screening Results Fast The cDNA inserts for the prey library are created by SMART i With the Matchmaker Gold Yeast One Hybrid Library Screenin cDNA synthesis which results in the incorporation of known 1 T z System one hybrid screening can be accomplished quickly primer sequences at both ends of the cDNA Consequently and easily with the following steps SMART generated cDNA Step 1 Create a bait construct by cloning 1 3 copies e is available for amplification by PCR allowing the construction of the target DNA binding sequence into pAbAi of libraries from nanogram amounts of starting RNA Step 2 Create a bait specific reporter strain by transforming e is flanked by sequences that are homologous to the cloning site of and integrating the linearized pBait AbAi construct into the Y1HGold yeast strain and selecting on SD Ura the linearized library vector pGADT7 Rec allowing homologous l l medium available in our Yeast Media Set 1 Plus recombination between the cDNA and the pGADT7 Rec vector upon transformation into the bait specific reporter strain Figure 1 Confirm the in
34. rker discovery cancer research profiling disease states amp more Rapid amp flexible Screen gt 500 antibodies in 1 day analyze data in 1 hour Highly reliable 280 correlation with Western blot analysis Validated technology over 40 papers to date Clontech s Ab Microarray 500 is a robust inexpensive tool for high throughput analysis of proteomic profiles This array can be used as a screening tool for biomarker discovery and target identification as well as for rapid expression profiling of proteins in a variety of samples including serum tissues cell lines and cancer vs normal or treated vs untreated samples For example this technology has been used to identify overexpressed proteins in mantle cell lymphoma 1 yielding results that were validated using Western blot and immunohistochemistry The Technology The Ab Microarray 500 is designed to perform rapid reliable characterization of changes in protein expression between two samples It allows scientists to focus their research on a smaller number of proteins that have biological relevance by screening gt 500 proteins in one day This array which contains specific monoclonal antibodies is incubated with Cy3 Cy5 labeled serum tissue or cell extract samples in order to profile disease states identify tumor associated antigens perform time course studies discover biomarkers and more The antibodies on the array recognize human mouse and rat proteins
35. roNectin coated dish Y Flowchart protocol for infecting Jurkat cells with Lenti X vectors using RetroNectin plates Using this protocol drastically increases transduction efficiency 1 Visitour website for more details Reference 1 Improve Viral Transductions with RetroNectin Reagent October 2008 Clontechniques XXIII 4 7 8 PA Hal ae Product Size Cat No Lenti X Expression System each 632164 Lenti X HT Packaging System 20 rxns 632160 40 rxns 632161 Lenti X HT Ecotropic Packaging System 20 rxns 632199 Lenti X 293T Cell Line 1 ml 632180 RetroNectin Reagent 0 5 mg TAKT100A 5 x 0 5 mg TAKT100B RetroNectin Precoated Dishes 10 dishes TAKT110A Notice to Purchaser For international orders of Takara products please refer to the Takara Bio website www takara bio com to locate a distributor in your area RetroNectin Reagent RetroNectin is intended for research use only Not for use in diagnostic or therapeutic procedures For clinical grade CH 296 please contact TaKaRa Bio Inc All trademarks are the property of their respective owners A method to increase the efficiency of retrovirus mediated gene transfer covered by the claims of U S Patent Nos 5 686 278 6 033 907 7 083 979 and 6 670 177 and their foreign counterpart patent claims is licensed to TAKARA BIO INC exclusively and worldwide Please see the BGH polyA CMV Sequence cPPT Element Lentiviral Expression Products Retroviral Packaging Syste
36. tegration of the bait sequence by colony PCR using Matchmaker Insert Check PCR Mix 1 m _ SMART cDNA Plate on SD Leu Use SMART technology to synthesize cDNA x x AbA Medium that is flanked by sequences that are homologous to the ends of the linearized pGADT7 Rec vector GADT7 gt f f p Rec uvo Create and screen your Y1H library in a single step recombihationin Cotransform your bait specific Y1HGold reporter Y1HGold Bait yeast strain with the SMART generated cDNA and pGADT7 Rec vector and plate on SD Leu AbA Figure 1 Use SMART technology and yeast biology to construct and screen your library Your library is simultaneously constructed Harvest the resulting colonies which contain putative and screened directly in yeast First SMART cDNA synthesis DNA binding proteins and analyze further e g technology is used to create a pool of cDNA that is flanked by with the Matchmaker Insert Check PCR Mix 2 sequences homologous to the ends of the linearized pGADT7 Rec and the Easy Yeast Plasmid Isolation Kit vector Next the newly created Y1HGold Bait reporter strain is transformed with the cDNA pool and pGADT7 Rec which undergo The Matchmaker Gold Yeast One Hybrid Library Screening homologous recombination within yeast The yeast cells are then System is the most convenient and advanced Y1H screening plated on SD Leu AbA to select for colonies that contain an i i l tool available allowing library screens to be accompl
37. teins identified but not for 2 of them One of the 2 proteins Hsp90 References also failed to show overexpression when analyzed by immunohisto r Er Ou pee ae obDfla et dl 00 TA g i i i Visitour website chemistry Figure 2 Panel A 2 Andersson O et al 2005 J Proteome Res 4 3 758 767 for more details clickchere Product Size Cat No Ab Microarray 500 Slides 2 arrays 631790 Ab Microarray Express Buffer Kit each 631795 Clontech Laboratories Inc www clontech com Clontechniques Spring 2009 14 New products Obtain Adenoviral Titers in Less than 4 Hours Rapidly determine adenoviral titers with our new Adeno X qPCR Titration Kit e Harvest titrate and infect in a single day e Measure titers from crude lysate or purified viral preps The Adeno X qPCR Titration Kit provides an extremely fast simple and accurate method for titrating adenoviral stocks from all Ad5 based adenoviral vectors The kit delivers results in just 4 hours a vast improvement over standard titration methods such as the plaque assay which require up to 10 days to complete Because qPCR titration is so fast target cells can be infected with accurately titrated virus on the same day the virus is harvested Obtain adenoviral lysate Purify viral DNA qPCR Flowchart of the procedures used for titrating adenoviral DNA with the Adeno X qPCR Titration Kit Table Comparison of Adeno X qPCR Titration to Other
38. tives for the proteins analyzed The latter sample was reanalyzed and the same results were observed Six different histologically confirmed MCL samples displayed the same protein expression profile demonstrating the reliability of the array in providing consistent accurate results The reproducibility of False Negatives the array data was also confirmed by the MCL7 sample that was Four proteins that did not show changes on the array were ana analyzed twice in 2 different experiments and yielded the same result lyzed by immunohistochemistry Figure 2 Panel B None of the 4 proteins revealed any changes when analyzed by this method va idation of Resu Its proving that the array does not yield false negatives The Ab Microarray 500 data from the mantle cell lymphoma i analysis Figure 1 was validated by Western blot 1 data not conclusion shown and immunohistochemistry Figure 2 Comparing relative expression levels with the Ab Microarray 500 revealed the existence of 3 novel proteins associated with mantle False Positives cell lymphoma The results demonstrate the capacity of the Ab Microarray 500 for identifying novel proteins as well as the Western blot analysis 1 data not shown and immunohisto y ty 8 P l importance of confirming antibody array data using an inde chemistry Figure 2 were used to confirm array data Western blotting i pendent method results were consistent with array results for 7 of the pro
39. tracentrifugation Easily Scalable Yes No Specialized Je oe Equipment Time Required 1 hr 4 hr to overnight Ease of Use Yield gt 90 gt 90 New products scalable for Supernatants of Any volume Any Titer The Lenti X Concentrator reagent is itself a 4X concentrate so it can be added to any volume of supernatant containing any amount of virus or any starting titer To illustrate we diluted a sample of supernatant to 250 ml then concentrated the virus and resuspended it in 2 5 ml recovering gt 95 of the original virus Figure 2 We also concentrated virus from serially diluted samples of lentiviral supernatant which were reduced to 1 100 of their original volumes using the Lenti X Concentrator protocol Figure 3 Regardless of the starting titer or volume virtually all of the virus is recovered in the Lenti X Concentrator pellets Whether you need to reduce the volume of your viral supernatant or increase its titer Lenti X Concentrator produces the results you need quickly and simply without the time consuming hassles of ultracentrifugation 250 ml _ gt 2 5 ml 10 O Titer IFU ml Q 104 Before After Figure 2 Concentrate virus from large volumes Lentiviral super natant was diluted into 250 ml and then concentrated down to 2 5 ml using Lenti X Concentrator Titrations were performed using HT1080 cells and flow cytometry 48 hr post transduction 8 1 Before
40. ven prep allows you to normalize the amount multiple virus preparations to be titrated simultaneously of the prep used in each experiment for consistent interassay results Fluorescence dRn 3 Fluorescence dRn 3 0 5 10 15 20 25 30 35 40 0 5 10 15 20 25 30 35 40 Cvcle no Cycle no Figure 2 Titrate your adenovirus from crude lysate or purified viral particles The Adeno X qPCR Titration kit was used to titrate capsid free viral DNA obtained from both crude lysate Panel A and purified viral particles Panel B In both cases the capsid free DNA was obtained with a virus purification kit provided with the Adeno X qPCR Titration Kit and serially diluted 10X prior to qPCR each dilution is represented by a different colored plot The titration procedure worked equally well regardless of the purity of the viral particles Product Size Cat No Adeno X qPCR Titration Kit 200 rxns 632252 NEW Visit our website for more details click here Notice to Purchaser a Please see the Advantage and TITANIUM PCR Products Hot Start Antibody Molecular Probes Inc and PCR licensing statements at www clontech com licensing Clontech Laboratories Inc www clontech com Clontechniques Spring 2009 123 New products Live Cell Reporters Now with Lentiviral Delivery e Optimized for high titers e Choose chemiluminescent or fluorescent reporters e Measure promoter activity on demand e Get more data points per exper
41. verse variety of applications as it is able to detect and quantify multiple miRNAs shRNAs or mRNA targets in a single RNA sample The complete dual function kit includes a fast and simple one step protocol for first strand cDNA synthesis as well as the reagents needed for the qPCR of your RNA target using SYBR Advantage technology From verifiable expression to accurate miRNA analysis Clontech has the highly effective state of the art tools you need for investi gating any miRNA network 4 19 Primer E miR 1 D miR 9 I miR 122a 103 f 2 N 2 Q x lt 5 f F 102 2 3S LL 101 10 0 1 9 122a 0 1 9 122a L STEG E pmR ZsGreen1 pmR mCherry Figure 2 miRNA expression from pmR vectors DNA sequences for the miR 1 miR 9 and miR 122 miRNAs were cloned into the pmR ZsGreen1 and pmR mCherry vectors and the recombinant plasmids 1 9 amp 122a respectively as well as the parental vectors 0 were each transfected into separate cultures of 293T cells After 48 hr cells were harvested and the RNA was isolated for Mir X miRNA qRT PCR analysis using specific primers and the U6 snRNA as a normalization standard Each primer was used with each RNA sample but detected only the corresponding miRNA cognate Product Size Cat No pmR ZsGreen1 Vector 20 ug 632541 NEW pmR mCherry Vector 20 ug 632542 NEW Mir X miRNA qRT PCR SYBR Kit 200 rxns 638314 NEW 600 rxns 638316 Includes
Download Pdf Manuals
Related Search