ThruPLEX®-FD Prep Kit Instruction Manual
Contents
1. N RUBICON GENOMICS ThruPLEX FD Prep Kit Instruction Manual Single Tube Library Preparation for Illumina NGS Platforms Contents Product DeScription sccccccccsscssssccssssscesscscsscssessccecessssscssescsecessssccscosessesesesscoscssessssesessossoseoss 2 Kit COntentS cia sods ahaa wna ovata ote dooce aca scavenge anand sd REE 2 Shipping And Storage asec srsusescreeeineeenatas sal arndeaiesd E ERREKEN REEERE 2 Getting Started ccccccccssccscsssssccscssccsccssssccesesscssssssssccecesscsscssesecseeescsscoscosesseessesscsscssessssesoseons 3 Input DNA Sample Requirement cscsecsssssssssssessecsecsssssseeseescenscussussecsecsecnsesssuesecsecsecussussusseeseessensenses 3 Index Sequenc s site eee an Ka l d rk AA Gea A AGN Ta da eS BAAN eA AABN Ka A ANE a Hak da la Bala Veke es 3 Required Materials and Equipment iireeeeeeeeeeeeeeexeeeere Hee HHH HHH HHH HHHH HHHH HHH HHH HHHH HAA 4 Optional Materials esses DD DD DD erer HHHH HHHH HHHH HRRHRHRH HE HH HHHH IINN 4 ThruPLEX FD Prep Kit Protocol hh hhh hereeeeeeeee nekeve eee ben HeHE eee ew H HENEK KK KH H HH HK KK KK 5 As Tetriplate Preparation k j 4y i1a c a lanla aa ala Gi aal ea a E a siyana Va ar al k eka ma aska ak araya kasi Akra civanan 5 B Library SYIt T gt i Z na dl Ra diya i KEK yaki veneke vek EE yan ser eve s veve e evel y y2. Life Technologies CAT NO P7589 EvaGreen Dye 20X in water Biotium CAT NO 31000 E Library Quantification Kit Tllumina KAPA Biosystems QAM 132 001 ThruPLEX FD Prep Kit Protocol Template Preparation Enzyme Library Synthesis Enzyme and Library Amplification Enzyme should be quick spun and transferred to ice immediately prior to use All remaining components should be thawed on ice briefly vortexed and quick spun prior to use All reagents and master mixes should be kept on ice A Template Preparation 1 Add 10 uL of each DNA sample to a PCR tube or well m Negative Control no DNA should be run in parallel use 10 uL of nuclease free water in place of DNA Positive control sheared DNA may also be run in parallel 2 Ina separate tube on ice prepare the Template Preparation Master Mix as described in the table below for the chosen number of reactions Mix thoroughly by pipette Keep on ice until used Template Preparation Master Mix Component Cap Color Volume Reaction Template Preparation Buffer Red 2 0 UL Template Preparation Enzyme Red 1 0 UL 3 Add 3 uL of the Template Preparation Master Mix to each 10 uL DNA sample 4 Mix by pipetting 5 times with pipette set to 8 uL 5 Centrifuge the tube s or plate briefly to ensure entire volume is collected at the bottom of each tube or well 6 Place the tube s or plate in a thermal cycler with a heated lid gt 100 C Perform
3. but not limited to use in diagnostics forensics therapeutics or in humans ThruPLEX FD Prep Kit may not be transferred to third parties resold modified for resale or used to manufacture commercial products without prior written approval of Rubicon Genomics Inc Protected by U S Patents 7 803 550 8 071 312 8 399 199 8 728 737 and corresponding foreign patents Additional patents are pending The index sequences correspond to Illumina Index sequences for multiplexing and are copyrighted to Illumina Inc Oligonucleotide sequences 2007 2012 Illumina Inc All rights reserved Agencourt and AMPure XP are registered trademarks of Beckman Coulter Inc Bioanalyzer is a registered trademark of Agilent Technologies Inc EvaGreen is a registered trademark of Biotium Inc Illumina is a registered trademark of Illumina Inc LabChip is a registered trademark of Caliper Life Sciences Inc MinElute and QIAquick are registered trademarks of Qiagen NanoDrop is a trademark of Thermo Fisher Scientific Inc Pippin Prep is a trademark of Sage Science Inc Quant iT PicoGreen Qubit and SYBR are registered trademarks of Life Technologies Corporation ThruPLEX is a registered trademark of Rubicon Genomics Inc TruSeq is a registered trademark of Illumina Inc MOD RUBICON GENOMICS 4743 Venture Drive Ann Arbor MI 48108 T 1 734 677 4845 F 1 734 477 9902
4. fixed material may require extra PCR cycles A Stage 5 Input DNA ng Aw kliiee ien Cycles 50 5 20 7 10 8 2 11 1 12 0 2 16 0 05 18 2 Program your thermal cycler for Library Amplification Reaction according to the table below using the recommended number of cycles for A Stage 5 Caution Ensure that the cycler does not have a denaturing step programmed until Stage 3 Library Amplification Reaction Stage Number of Cycles Temperature Time 1 1 72 C 3 min 2 1 85 C 2 min 3 1 98 C 2 min 98 C 20 sec 4 4 67 C 20 sec 72 C AO sec 98 C 20 sec A Ate 72 C 50 sec 6 1 4 C hold Acquire real time data at this step if using a real time thermal cycler QAM 132 001 6 3 Immediately prior to use prepare the Library Amplification Master Mix in a separate tube as described in the table below for the chosen number of reactions Keep on ice until used Library Amplification Master Mix Component Cap Color Volume Reaction Nuclease Free Water plus Optional Dye Clear 8 0 UL Library Amplification Buffer Green 48 5 uL Library Amplification Enzyme Green 1 5 uL If monitoring the library in real time the volume of fluorescent dye and calibration dye both diluted in nuclease free water as needed plus water should not exceed 8 uL Note that the total reaction volume is 75 uL EvaGreen Dye Biotium the pre
5. 45 min Repair Ligate Extend Cleave Amplify Kit Contents Table 1 ThruPLEX FD Prep Kit contents Name Cap Color 12 Reaction Kit 48 Reaction Kit CAT NO R40012 CAT NO R40048 Template Preparation Buffer Red 1 Tube 1 Tube Template Preparation Enzyme Red 1 Tube 1 Tube Library Synthesis Buffer Yellow 1 Tube 1 Tube Library Synthesis Enzyme Yellow 1 Tube 1 Tube Library Amplification Buffer Green 1 Tube 2 Tubes Library Amplification Enzyme Green 1 Tube 1 Tube Nuclease Free Water Clear 1 Tube 1 Tube Indexing Reagent 1 12 Violet 12 Tubes 12 Tubes User Manual The volumes of components provided in the kit are sufficient for the preparation of up to 12 reactions for R40012 and up to 48 reactions for R40048 Shipping and Storage ThruPLEX FD Prep Kit is shipped on dry ice The kit should be stored at 20 C upon arrival QAM 132 001 2 Getting Started Input DNA Sample Requirements Sample Recommended Nucleic acid Fragmented double stranded DNA Molecular weight lt 1000 bp Input volume 10 UL Input amount 50 pg 50 ng Starting Material Fragmented double stranded DNA gDNA or cDNA chromatin immunoprecipitates ChIP degraded DNA from sources such as biofluids or FFPE are suitable This kit is not for use with single stranded DNA ssDNA or RNA Optimal DNA fragment size ThruPLEX FD Prep Kit is a ligation based technology and adapters added during the process
6. aries from similar samples with equalized inputs equal volumes of each library can be pooled and then purified as described in Section F If the qPCR results show less than desirable yield the remaining library can be further amplified to attain a higher yield unless a plateau has been reached The additional amplification can only be performed on unpurified libraries To perform this additional amplification spin down a tube or plate containing the library transfer it to a thermal cycler and perform 2 3 PCR cycles as follows Number of Cycles Temperature Time 2 3 cydles 98 C 20 sec 72 C 50 sec 1 cycle 4 C hold Note ThruPLEX FD libraries quantified by this method can be pooled according to Section E and then purified according to Section F The pooled libraries should be quantified after purification prior to sequencing to achieve efficient clustering QAM 132 001 8 Alternative Quantification Methods Post purification Section F ThruPLEX FD libraries can be quantified by Agilent Bioanalyzer Qubit Life Technologies NanoDrop Thermo Fisher Scientific Inc and similar UV absorption or fluorescence based protocols Barcoded libraries can be pooled at a desired molar ratio prior to sequencing Section E E Pooling ThruPLEX FD Prep Kit Libraries Prepared with Different Indices Individual libraries quantified according to Section D can be pooled at desired molar ratios to allow multipl
7. en 5 C Library Amplification gt u x m2 33 51 302321 31r0 NON 3 Ra San d xet a year an y ar sid an 3 ADAR 6 D ThruPLEX FD Prep Kit Library Quantification ssessessscssssssseesecsecsscsssnssecsecsscnssusseeseeseesseneenees 7 E Pooling ThruPLEX FD Prep Kit Libraries Prepared with Different lndices 9 F ThruPLEX FD Prep Kit Library Purification or Size Selection cessesssssssssseeseeseessessseeseeseeseeneenees 9 G Sequencing ThruPLEX FD Prep Kit Libraries 0 sesesssssesesseesecscesssussecseescescesscussucaecsensesseneees 10 Troubleshooting Guide ccccccssssccscccsccscsscsscecessssccsccsessccesssscsssssesesseesssssssscosesscessesesssooess lI Technical Support csc5 ste aii Bi a ail EN ika e N Il QAM 132 001 Product Description ThruPLEX FD Prep Kit converts double stranded DNA dsDNA or cDNA samples into sequencing ready libraries for Illumina Next Generation Sequencing NGS platforms Highly efficient patented stem loop adaptor chemistry allows for use of smaller input amounts and eliminates intermediate purification steps thus reducing the time to results For more information visit www rubicongenomics com products thruplex ThruPLEX FD Workflow Amplification Template Library amp Preparation Synthesis Indexing Reagents Reagents Reagents Fragmented dsDNA cDNA Purify Illumina 50 pg 50 ng Quantify NGS 45 min 40 min 20
8. ex sequencing of the pooled library The pooled libraries should be prepared with different indices If using fewer than 12 indices follow Illumina Multiplexing Sample Preparation Guide Part 1005361 Rev D page 39 F ThruPLEX FD Prep Kit Library Purification or Size Selection 1 Gel Free Library Purification by AMPure XP Optimized for ThruPLEX FD Note AMPure XP sample purification is not necessary if size selection is performed Section F 2 AMPure XP is the preferred method of library purification to preserve sequence complexity Do not use QIAquick cleanup or other silica based filters for purification as this will result in an incomplete removal of primers Mixing the sample s and the AMPure XP reagent at a 1 1 ratio is critical 1 10 11 12 Bring all the samples and reagents to room temperature In the meantime prepare fresh 80 ethanol enough for steps 7 and 10 below Resuspend the AMPure XP reagent by light vortexing until no visible pellet is present at the bottom of the container In a 1 5 mL tube mix the sample library and the AMPure XP reagent at a 1 1 ratio Mix by pipette 10 times to achieve a homogeneous solution Incubate the solution at room temperature for 5 min Pulse spin the sample s place into a magnetic stand and wait for 2 min or until the beads are completely bound to the side of the tube s and the solution is clear While keeping the sample s in the magnetic stand use a pi
9. ferred dye for ThruPLEX FD Prep Kit chemistry should be added at 1x final concentration or SYBR Green I dye Life Technologies at 0 1x final concentration 4 Mix the Library Amplification Master Mix by briefly vortexing and add 58 uL to each tube or well 5 Add 2 uL of one Indexing Reagent 1 12 to each sample mix 4 times with a pipette set to 50 uL 6 Centrifuge the tube s or plate briefly to ensure entire volume is collected at the bottom of each tube or well 7 Transfer the tube s or plate to a thermal cycler with a heated lid gt 100 C perform Library Amplification Reaction according to the program in Step C 2 8 Store samples at 4 C overnight or up to seven days at 20 C QAM 132 001 D ThruPLEX FD Prep Kit Library Quantification ThruPLEX FD Quantification Workflow ThruPLEX FD Libraries Skip to save time Skip for individual sample purification AMPure XP Cleanup Quantify Pooled Libraries gt Rubicon Genomics Recommended ThruPLEX FD Quantification Workflow gt Alternative Quantification Workflow Recommended Quantification Method Non destructive Method 1 Quantify ThruPLEX FD libraries via real time qPCR by diluting 2 5 uL of the library using a 100 000 fold dilution Note No purification of the samples is necessary prior to qPCR due to the large dilution factor KAPA Library Quantification Kit for Illumina is recommended for library quantification If preparing libr
10. il the pellet is dry 16 Elute the DNA by resuspending the beads with 20 50 uL of 1x TE buffer pH 8 0 17 Pulse spin the tube s and place it into a magnetic stand and wait for 2 min or until the beads are completely bound to the side of the tube s and the solution is clear 18 With the sample s in the magnetic stand without disturbing the pellet transfer the supernatant with a pipette into a new tube 19 If not used immediately store the purified library at 20 C Pulse spin the sample s using a low speed benchtop centrifuge 2 Library Purification by Gel Size Selection Optional Note Gel size selection is not necessary if AMPure XP sample purification is performed Section F 1 ThruPLEX FD libraries can be size selected prior to sequencing using agarose gel electrophoresis as described in the Illumina Paired End Sample Preparation Guide Illumina Document 1005063 Illumina TruSeq DNA Sample Preparation Guide Illumina Catalog PE 940 2001 Part 15005180 or by using automated platforms such as LabChip Caliper Life Sciences Pippin Prep Sage Science or a similar technology When using agarose gel electrophoresis extraction of the DNA should be performed with QIAquick Gel Extraction Kit Qiagen Part 28704 or MinElute Gel Extraction Kit Qiagen Part 28604 following the manufacturer s instructions Note The adapters added during the ThruPLEX FD Prep Kit process result in an approxi
11. mately 120 base pair increase in the size of each library G Sequencing ThruPLEX FD Prep Kit Libraries The ThruPLEX FD Prep Kit generates libraries which are ready for cluster amplification and sequencing on the Illumina Genome Analyzer HiSeq or MiSeq platforms using standard Illumina clustering amp sequencing reagents and protocols for multiplexed libraries Follow Illumina s loading recommendations Note In order to set up a sample sheet for paired end sequencing choose paired end option add a sample entry choose I7 and finish by adding all the used indices A001 A012 Compare each sequence added to the sequences listed on page 3 of this manual Structure of ThruPLEX FD Libraries 5 AATGATACGGCGACCACCGAGATCTACACTCTT TCCCTACACGACGCTCT TCCGATCT Insert 3 TTACTATGCCGCTGGTGGCTCTAGATGTGAGAAAGGGAT GT GCTGCGAGAAGGCTAGA Insert Insert AGATCGGAAGAGCACACGTCTGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG 3 Insert TCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTGTAGTGCTAGAGCATACGGCAGAAGACGAAC 5 Index QAM 132 001 10 Troubleshooting Guide Problem Potential Cause Suggested Solutions Sample amplification curve looks like No Template Control NTC amplification curve or does not produce amplified product No input DNA was added Quantitate input before using the kit Incorrect library template was used e g RNA ssDNA Adhere
12. pette to aspirate off and discard the supernatant without disturbing the pellet Add 300 uL of freshly prepared 80 ethanol With the sample s in the magnetic stand turn each tube clockwise not end over end 90 degrees and wait until all the beads come to a halt Repeat this step three more times Note When using a plate strips turn the plate strips 180 degrees for a total of four times or skip step 8 and proceed to step 9 With the sample s in the magnetic stand use a pipette to aspirate off and discard the supernatant without disturbing the pellet Add 300 uL of freshly prepared 80 ethanol With the sample s in the magnetic stand turn each tube clockwise not end over end 90 degrees and wait until all the beads come to a halt Repeat this step three more times Note When using a plate strips turn the plate strips 180 degrees for a total of four times or skip step 11 and proceed to step 12 With the sample s in the magnetic stand use a pipette to aspirate off and discard the supernatant without disturbing the pellet QAM 132 001 9 13 Pulse spin the sample s place into a magnetic stand and wait for 2 min or until the beads are completely bound to the side of the tube s 14 While keeping the sample s in the magnetic stand use a pipette to aspirate off and discard any residual ethanol without disturbing the pellet 15 Leaving the cap open incubate the sample s in a heating block at 37 C for 2 3 min or unt
13. result in an approximately 120 base pair increase in the size of each DNA template fragment DNA fragments less than 1 kb will be more efficiently sequenced than fragments greater than 1 kb Input Volume If a sample is in a larger volume the DNA can be concentrated into 10 uL or less Alternatively the sample may be split into 10 uL aliquots processed in separate tubes and the corresponding products pooled prior to the purification step preceding sequencing Sections E amp F Recommended Input Amount for Obtaining Optimal Data For Whole Genome Sequencing WGS and Whole Exome Sequencing WES using human gDNA or plasma DNA 20 ng of input DNA is recommended to achieve a highly diverse library More damaged samples such as FFPE may require greater input amounts For sequencing samples with reduced complexity such as cDNA ChIP DNA bacterial DNA or targeted genomic regions lower input amounts picogram levels can be used Index Sequences Index Sequence Index Sequence 1 ATCACG 7 CAGATC 2 CGATGT 8 ACTTGA 3 TTAGGC 9 GATCAG 4 TGACCA 10 TAGCTT 5 ACAGTG 11 GGCTAC 6 GCCAAT 12 CTTGTA QAM 132 001 3 Required Materials and Equipment Thermal cycler with 75 uL reaction volume capability and heated lid PCR tubes or 96 well PCR plate and seal Aerosol barrier pipette tips Agencourt AMPure XP Beckman Coulter CAT NO A63880 Optional Materials li Quant iT PicoGreen dsDNA Assay Kit
14. the Template Preparation Reaction using the protocol in the table below Template Preparation Reaction Temperature Time 22 C 25 min 55 C 20 min 4 C Hold up to 2 hours 7 Important Centrifuge the tube s or plate for 1 min at room temperature B Library Synthesis 1 Immediately prior to use prepare the Library Synthesis Master Mix in a separate tube as described in the table below for the chosen number of reactions and mix thoroughly by pipette Keep on ice until used Library Synthesis Master Mix Component Cap Color Volume Reaction Library Synthesis Buffer Yellow 1 0 uL Library Synthesis Enyzme Yellow 1 0 uL 2 Add 2 uL of the Library Synthesis Master Mix to each sample QAM 132 001 5 3 Mix by pipetting 5 times with pipette set to 10 uL 4 Centrifuge the tube s or plate briefly to ensure entire volume is collected at the bottom of each tube or well 5 Incubate the tube s or plate in a thermal cycler with a heated lid gt 100 C Perform Library Synthesis Reaction using the protocol in the table below Library Synthesis Reaction Temperature Time 22 C AO min 4 C Hold up to 30 min 6 Centrifuge the tube s or plate before proceeding to Step C 1 C Library Amplification 1 Use the table below to determine the number of cycles required for A Stage 5 of the Library Amplification Reaction Note DNA extracted from formalin
15. to DNA Sample Requirements for input specifications p 3 NTC amplification curve appears early or produces a yield similar to sample reaction products NTC is contaminated with DNA Use a fresh control solution and check all reagents Work area is contaminated with DNA Clean area thoroughly and use PCR dedicated plastics and pipettes Kit has been contaminated with DNA Use a fresh kit Sample Bioanalyzer traces show multiple peaks after efficient cleanup e Peaks lt 120 bp Check thermal cycler reaction is not being cycled properly Check that the thermal cycler can accommodate 75 UL reactions If not switch to a cycler that can e Peaks lt 1000 bp Reaction was started with unevenly fragmented DNA of various fragment sizes e g plasma DNA If possible quantify and check the input DNA prior to using kit Sequencing is still recommended e Peaks lt 1000 bp and gt 1000 bp Library overamplified or Bioanalyzer chip is overloaded common for high sensitivity chips Perform fewer PCR cycles at Stage 5 C 1 For high sensitivity chips load lt 7ng UL Sequencing is still recommended Technical Support For technical support contact support rubicongenomics com or call 1 734 677 4845 9 AM 5 30 PM EST QAM 132 001 Product Use Limitations ThruPLEX FD Prep Kit is intended for Research Use Only It may not be used for any other purpose including
Download Pdf Manuals
Related Search