Home

The Bac-to-Bac

Contents

1. Item Quantity Cat no Bac to Bac Vector Kit 1 kit 10360 014 Bac to Bac HT Vector Kit 1 kit 10584 027 pFastBac Dual Vector Kit 1 kit 10712 024 Gateway pDEST 8 Vector 6 ug 11804 010 Gateway pDEST 10 Vector 6 ug 11806 015 Gateway pDEST 20 Vector 6 ug 11807 013 Bac to Bac C His TOPO Expression System 1 kit A11100 Bac to Bac C His TOPO Cloning Kit 1 kit A11098 Bac to Bac N His TOPO Expression System 1 kit A11101 Bac to Bac N His TOPO Cloning Kit 1 kit A11099 MAX Efficiency DH10Bac Competent E coli 5 x 100 ul 10361 012 One Shot TOP10 Chemically Competent E coli 20 x 50 pl C4040 03 One Shot MAX Efficiency DH10B T1 20 x 50 ul 12331 013 Chemically Competent E coli MAX Efficiency Stbl2 Competent Cells 1ml 10268 019 Cellfectin II Reagent 1ml 10362 100 Ampicillin Sodium Salt irradiated 200 mg 11593 027 Kanamycin Sulfate 100X liquid 100 ml 15160 054 Gentamicin Reagent Solution liquid 50 mg ml 10 ml 15750 060 Bluo gal 1g 15519 028 Neutral Red high purity 25 mg N 3246 Isopropylthio B galactoside IPTG 1g 15529 019 S O C Medium 10 x 10 ml 15544 034 AcTEV Protease 1 000 Units 12575 015 Platinum Tag DNA Polymerase 100 reactions 10966 018 Platinum Tag DNA Polymerase High Fidelity 100 reactions 11304 011 PCR SuperMix High Fidelity 100 reactions 10790 020 4 Agarose Gel 40 ml 18300 012 PureLink Quick Gel Extraction System 1 kit K2100 12 PureLink HiPure Plasmid Miniprep Kit 25 preps K2100
2. 1 4581 TTCATACCGT CCCACCATCG GGCGCGGATC CCGGTCCGAA GCGCGCGGAA Stu Sal Sst Spe Not NspV Xba 4631 TTCAAAGGCC TACGTCGACG AGCTCACTAG TCGCGGCCGC TTTCGAATCT Pst Hind Ill l 4681 AGAGCCTGCA GTCTCGACAA GCTTGTCGAG AAGTACTAGA GGATCATAAT SV40 polyadenylation signal 4731 CAGCCATACC ACATTTGTAG AGGTTTTACT TGCTTTAAAA AACCTCCCAC Continued on next page Cloning into pFastBac Dual continued Multiple Cloning Below is the multiple cloning site located downstream of the ACMNPV p10 Site Downstream promoter in pFastBac Dual Restriction sites are labeled to indicate the actual of the p10 cleavage site Potential stop codons are underlined The vector sequence of Promoter pFastBac Dual is available for downloading from our website www invitrogen com or by contacting Technical Support see page 66 For a map and a description of the features of pFastBac Dual refer to the Appendix pages 61 62 Start of Transcription p10 promoter m gt 4460 TATACGGACC TTTAATTCAA CCCAACACAA TATATTATAG TTAAATAAGA 4410 ATTATTATCA AATCATTTGT ATATTAATTA AAATACTATA CTGTAAATTA Bbs II Sma Xho 1 4360 CATTTTATTT ACAATCACTC GACGAAGACT TGATCACCCG GGATCTCGAG Nco Nhe Pvu Il Nsi Sph Kpn 4310 CCATGGTGCT AGCAGCTGAT GCATAGCATG CGGTACCGGG AGATGGGGGA HSV tk polyadenylation signal 4260 GGCTAACTGA AACACGGAAG GAGACAATAC CGGAAGGAAC CCGCGCTATG 17 Transformation and A
3. CTT TCG AAT CTA GAG CCT GCA GTC TCG AGG CAT GCG GTA CCA Leu Ser Asp Leu Glu Pro Ala Val Ser Arg His Ala Val Pro SV40 polyadenylation signal T AGC TTG TCG AGA AGT ACT AGA GGA TCA TAA TCA GCCATACCAC Ser Leu Ser Arg Ser Thr Arg Gly Ser Continued on next page 13 Cloning into pFastBac HT A B and C continued Multiple Cloning Site of pFastBac HT B 3901 3951 4001 4050 4092 4134 4176 4218 14 TM Below is the multiple cloning site for pFastBac HT B The initiation ATG is indicated in bold Restriction sites are labeled to indicate the actual cleavage site The boxed nucleotide indicates the variable region The vector sequence of pFastBac HT B is available for downloading from our website www invitrogen com or by contacting Technical Support see page 66 For a map and a description of the features of pFastBac HT refer to the Appendix pages 59 60 Start of Transcription Polyhedrin promoter I TAGATCATGG AGATAATTAA AATGATAACC ATCTCGCAAA TAAATAAGTA wild type ATG mutated to ATT FS TTTTACTGTT TTCGTAACAG TTTTGTAATA AAAAAACCTA TAAATATTCC 1 GGATTATTCA TACCGTCCCA CCATCGGGCG CGGATCTCGG TCCGAAACC 6xHis tag eee es Ce ll ATG TCG TAC TAC CAT CAC CAT CAC CAT CAC GAT TAC GAT ATC Met Ser Tyr Tyr His His His His His His Asp Tyr Asp Ile TEV recognition site Ehel Ncol BamHI I CCA ACG ACC GAA AAC CTG TAT TTT CAG GGC GCC ATG GGA TCC Pro Thr Thr Glu Asn Leu
4. The Bac to Bac Baculovirus Expression System is shipped in three boxes as described below Upon receipt store each box as detailed below All reagents are guaranteed for six months if stored properly Box Item Shipping Storage pFastBac Vectors Blue ice 4 C MAX Efficiency DH10Bac Competent E coli Dry ice 80 C Cellfectin II Reagent Blue ice 4 C Cat nos 10360 014 10584 027 and 10712 024 are shipped on blue ice Upon receipt store the vectors at 4 C Continued on next page Kit Contents and Storage continued pFastBac Each catalog number includes a specific pFastBac vector s and a corresponding Vectors expression control and are supplied as detailed below Store at 4 C Product Cat no pFastBac Vector Expression Control Bac to Bac Baculovirus 10359 016 pFastBac 1 pFastBac Gus Expression System Supplied 20 ul at 0 5 ug ul Supplied 20 ul at 0 2 ng ul in TE pH 8 0 10 ug total in TE pH 8 0 4 ng total Bac to Bac Vector Kit 10360 014 pFastBac 1 pFastBac Gus Supplied 20 ul at 0 5 ug ul Supplied 20 ul at 02 ng pl in TE pH 8 0 10 ug total in TE pH 8 0 4 ng total Bac to Bac HT Vector Kit 10584 027 pFastBac HT A pFastBac HT CAT pFastBac HT B Supplied 15 ul at 1 ng ul in pFastBac HT C TE pH 8 0 15 ng total Supplied 20 ul each at 0 5 ug ul in TE pH 8 0 10 ug total of each vector pFastBac Dual 10712 024 pFastBac Dual pFastBac D
5. Note It is possible to harvest virus at later times after infection e g 72 hours Optimal harvest times can vary and should be determined for each baculoviral construct Remember that culture viability will decrease over time as cells lyse 6 Transfer the supernatant to fresh 15 ml snap cap tubes This is the P2 viral stock Store at 4 C protected from light For long term storage you may store an aliquot of the P2 stock at 80 C protected from light See page 33 for storage guidelines 7 Proceed to the next section to determine the titer of your P2 viral stock Scaling Up the Once you have generated a high titer P2 baculoviral stock you may scale up the Amplification amplification procedure to any volume of your choice To produce this high titer Procedure P3 stock scale up the amount of cells and volume of virus used appropriately and follow the guidelines and procedure outlined in this section Generating High If you have stored your viral master stock at 80 C we recommend amplifying Titer Stocks From this stock to generate another high titer stock for use in expression experiments Frozen Master Viral titers generally decrease over time when virus is stored at 80 C Follow the Stock guidelines and amplification procedure detailed in this section 35 Performing a Viral Plaque Assay Introduction Experimental Outline Factors Affecting Viral Titer 36 TM We recommend using the BaculoTiter
6. 3 Following the 1 hour incubation observe the cell monolayers using an inverted microscope Sf9 cells should be attached and at 50 confluence 4 Prepare an 8 log serial dilution 107 to 10 of the clarified baculoviral stock in Sf 900 II SFM or Grace s Insect Cell Culture Medium Supplemented without FBS as appropriate To do this sequentially dilute 0 5 ml of the baculoviral stock or previous dilution in 4 5 ml of medium in 12 ml disposable tubes You should finish with 8 tubes of diluted viral stock i e 107 10 10 10 10 105 107 10 You will use the dilutions 10 to 105 in your assay 5 Move the 6 well plates containing Sf9 cells and the tubes of diluted virus to the sterile hood Label the plates in columns of 2 1 sample well plus 1 duplicate as follows no virus negative control 10 10 105 1077 10 6 Remove the medium from each well discard and immediately replace with 1 ml of the appropriate virus dilution As a negative control add the appropriate medium without virus 7 Incubate cells with virus for 1 hour at room temperature 8 Following the 1 hour incubation move the cells and the bottle of plaquing medium from the 40 C water bath Step 4 previous page to a sterile hood 9 Sequentially starting from the highest dilution 105 to the lowest dilution 105 remove the medium containing virus from the wells and replace with 2 ml of plaquing medium Work quickly to avoid dessication of th
7. If your baculoviral stock has been stored for 6 months to 1 year we recommend titering or re titering your baculoviral stock prior to use in an expression experiment e Number of freeze thaw cycles If you are storing your viral stock at 80 C viral titers can decrease as much as 10 with each freeze thaw cycle e Improper storage of your baculoviral stock For routine use baculoviral stocks should be aliquotted and stored at 4 C protected from light Continued on next page Performing a Viral Plaque Assay continued Materials Needed Note Your clarified baculoviral stock store at 4 C until use Sf9 or Sf21 cells cultured in the appropriate medium 30 ml of log phase cells at 5 x 10 cells ml for each baculoviral stock to be titered Sf 900 II SFM Sf 900 III SFM or other appropriate complete growth medium see Note below Sf 900 Medium 1 3X 100 ml or other appropriate plaquing medium see Note below 4 Agarose Gel specifically formulated for optimal insect cell growth see page vii Sterile cell culture grade distilled water 100 ml sterile glass bottle 6 well tissue culture plates 2 plates for each viral stock to be titered Sterile hood Waters baths at 40 C and 70 C Microwave oven optional 27 C humidified incubator Neutral Red high purity see page vii See page viii for ordering information If you are culturing your Sf9 or Sf21 cells in serum supplemented media i e complet
8. amp Stacy 1985 Multiple cloning site Pp10 Allows restriction enzyme mediated cloning of your gene of interest p10 promoter Pp10 Allows efficient high level expression of your recombinant protein in insect cells O Reilly et al 1992 Map of pFastBac Gus Description pFastBac Gus is a 6661 bp control vector containing the Arabidopsis thaliana gene for B glucuronidase Gus Kertbundit et al 1991 and was generated by restriction cloning of the Gus gene into pFastBac 1 The molecular weight of B glucuronidase is 68 5 kDa pFastBac Gus The figure below summarizes the features of the pFastBac Gus vector The Map vector sequence of pFastBac Gus is available from our website www invitrogen com or by contacting Technical Support see page 66 Comments for pFastBac 1 Gus 6661 nucleotides f1 origin bases 2 457 Ampicillin resistance gene bases 589 1449 pUC origin bases 1594 2267 Tn7R bases 2511 2735 Gentamicin resistance gene bases 2802 3335 complementary strand Polyhedrin promoter Ppp bases 3904 4032 GUS ORF bases 4081 5892 SV40 polyadenylation signal bases 6047 6287 Tn7L bases 6315 6480 63 Map of pFastBac HT CAT TM Description pFastBac HT CAT is a 5500 bp control vector containing the gene for chloramphenicol acetyltransferase CAT and was generated by restriction cloning of the CAT gene into pFastBac HT The CAT gene is express
9. construct into MAX Efficiency DH10Bac competent E coli to generate a recombinant bacmid 3 Transfect the recombinant bacmid DNA into the insect cell line of choice to generate a recombinant baculovirus 4 Amplify and titer the baculoviral stock and use this stock to infect insect cells to express your recombinant protein The Bac to Bac Baculovirus Expression System is designed to help you create a recombinant baculovirus for high level expression of your gene of interest in insect cells Although the system has been designed to help you easily generate a baculovirus and express your recombinant protein of interest use of the system is geared towards those users who are familiar with baculovirus biology and insect cell culture We highly recommend that users possess a working knowledge of viral and tissue culture techniques For more information about baculovirus biology refer to published reference sources King amp Possee 1992 Luckow 1991 O Reilly et al 1992 For more information about insect cell culture refer to the Guide to Baculovirus Expression Vector Systems BEVS and Insect Cell Culture Techniques for downloading on our website at www invitrogen com or by contacting Technical Support see page 66 The Bac to Bac Baculovirus Expression System Components of the Bac to Bac Baculovirus Expression System The Bac to Bac Baculovirus Expression System facilitates rapid and efficient generation of reco
10. you do not have to remove the medium from cells and wash cells prior to adding the DNA lipid complex to cells The DNA lipid complex formation time is shorter 15 30 minutes when using Cellfectin II as compared to Cellfectin reagent Do not add antibiotics during transfection as this causes cell death For Sf9 or Sf21 insect cells cultured in Supplemented Grace s Insect Medium containing 10 FBS use the following protocol to prepare your cells for transfection in a 6 well format All amounts and volumes are given on a per well basis If you wish to transfect cells in other tissue culture formats you will need to determine the optimal conditions to use 1 Verify that the Sf9 or Sf21 cells are in the log phase 1 5 2 5 x 10 cells ml with greater than 95 viability If the cell density is in range of 1 5 x 10 2 5 x 10 cells ml and the culture is without antibiotics proceed to step 2a If the cell density is not in this range or the cell culture contains antibiotics follow steps 2b 2c a Add 2 ml of Grace s Insect Medium Unsupplemented without antibiotics and serum in each well Seed 8 x 10 Sf9 or Sf21 cells from Step 1 per well Do not change medium or wash the cells The medium carried over will enhance the transfection efficiency Allow cells to attach for 15 minutes at room temperature in the hood Proceed to step 3 b Prepare 10ml plating medium by mixing 1 5 ml Supplemented Grace s Insect Medium containing 10 FB
11. 02 100 preps K2100 03 PureLink HiPure Plasmid Maxiprep Kit 10 preps K2100 06 25 preps K2100 07 Continued on next page vii Accessory Products continued TM Insect Cell Culture A variety of insect cell lines and GIBCO cell culture products are available from Products Invitrogen to facilitate baculovirus mediated expression of your recombinant protein in insect cells For more information about the insect cell lines and GIBCO cell culture products refer to our website www invitrogen com or contact Technical Support see page 66 Note Reagents are also available in other sizes Item Quantity Cat no Sf9 Cells SFM Adapted 1 5 x 107 cells 11496 015 Sf21 Cells SFM Adapted 1 5 x 107 cells 11497 013 High Five Cells 3 x 10 cells B855 02 Mimic Sf9 Insect Cells 1 x 10 cells 12552 014 Sf 900 II SFM 500 ml 10902 096 S 900 III SFM 500 ml 12658 019 Sf 900 Medium 1 3X 100 ml 10967 032 Express Five SFM 1000 ml 10486 025 Grace s Insect Cell Culture Medium 500 ml 11595 030 Unsupplemented Grace s Insect Cell Culture Medium 500 ml 11605 094 Supplemented Grace s Insect Cell Culture Medium 2X 100 ml 11667 037 Penicillin Streptomycin 100 ml 15070 063 PLURONIC F 68 10 100X 100 ml 24040 032 PLURONIC is a registered trademark of BASF Corporation Purifying If you use the pFastBac HT A B or C vector to express your gene of interest as a
12. HT A B and C vectors are available from our website www invitrogen com or by contacting Technical Support see page 66 ATG 6xHis TEV Comments for pFastBac HT A 4856 nucleotides f1 origin bases 2 457 Ampicillin resistance gene bases 589 1449 pUC origin bases 1594 2267 Tn7R bases 2511 2735 Gentamicin resistance gene bases 2802 3335 complementary strand Polyhedrin promoter Ppp bases 3904 4032 Initiation ATG bases 4050 4052 6xHis tag bases 4062 4079 TEV recognition site bases 4101 4121 Multiple cloning site bases 4119 4222 SV40 polyadenylation signal bases 4240 4480 Tn7L bases 4509 4674 Frameshift occurs at the BamH site in each vector Continued on next page 39 Map and Features of pFastBac HT continued Features of the Vector 60 The pFastBac HT A 4856 bp B 4857 bp and C 4858 bp vectors contain the following elements All features have been functionally tested Feature Benefit Polyhedrin promoter Pri Allows efficient high level expression of your recombinant protein in insect cells O Reilly et al 1992 6xHis tag Allows purification of your recombinant protein using a metal chelating resin such as ProBond or Ni NTA see page viii TEV recognition site Permits removal of the N terminal tag from your recombinant protein using ACTEV Protease Carrington amp Dougherty 1988 Dougherty et al 1988 Multiple cloning site Allows
13. Hall New York NY Luckow V A 1991 in Recombinant DNA Technology and Applications Prokop A Bajpai R K and Ho C eds McGraw Hill New York Luckow V A Lee C S Barry G F and Olins P O 1993 Efficient Generation of Infectious Recombinant Baculoviruses by Site Specific Transposon Mediated Insertion of Foreign Genes into a Baculovirus Genome Propagated in Escherichia coli J Virol 67 4566 4579 Luckow V A and Summers M D 1988 Signals Important for High Level Expression of Foreign Genes in Autographa californica Nuclear Polyhedrosis Virus Expression Vectors Virology 167 56 71 Neumann J R Morency C A and Russian K O 1987 A Novel Rapid Assay for Chloramphenicol Acetyltransferase Gene Expression Biolechniques 5 444 447 Continued on next page 69 References continued O Reilly D R Miller L K and Luckow V A 1992 Baculovirus Expression Vectors A Laboratory Manual W H Freeman and Company New York N Y Polayes D Harris R Anderson D and Ciccarone V 1996 New Baculovirus Expression Vectors for the Purification of Recombinant Proteins from Insect Cells Focus 18 10 13 Sambrook J Fritsch E F and Maniatis T 1989 Molecular Cloning A Laboratory Manual Second Ed Cold Spring Harbor Laboratory Press Plainview New York Westwood J A Jones I M and Bishop D H L 1993 Analyses of Alternative Poly A Signals for Use in Baculovirus Expression
14. M13 Forward or Reverse primers primer and a primer specific for your gene you will need to determine the amplification conditions to use If you are using another polymerase follow the manufacturer s recommendations for the polymerase you are using Note Amplification conditions may need to be optimized if your insert is gt 4 kb 1 For each sample set up the following 50 pl PCR reaction in a 0 5 ml microcentrifuge tube Recombinant bacmid DNA 100 ng 1u 10X PCR Buffer appropriate for enzyme 5 ul 10 mM dNTP Mix 1 ul 50 mM MgCl 1 5 ul PCR Primers 1 25 ul each 10 uM stock 2 5 pl Sterile Water 38 5 ul Platinum Tag polymerase 5 units ul 0 5 ul Total Volume 50 pl 2 Amplify using the following cycling parameters Step Time Temperature Cycles Initial Denaturation 3 minutes 93 C 1X Denaturation 45 seconds 94 C Annealing 45 seconds 55 C 25 35X Extension 5 minutes 72 C Final Extension 7 minutes 72 C 1X 3 Remove 5 10 pl from the reaction and analyze by agarose gel electrophoresis Continued on next page 27 Analyzing Recombinant Bacmid DNA by PCR continued What You Should If transposition has occurred and you have used the pUC M13 Forward and See 28 Reverse primers for amplification you should see a PCR product of the following size on the agarose gel Sample Size of PCR Product Bacmid alone 300 bp Bacmid transpo
15. Polayes et al expression 1996 e N terminal 6xHis tag for purification of recombinant fusion proteins using metal chelating resin and a TEV protease cleavage site for removal of the 6xHis tag following protein purification e Vector supplied in 3 reading frames for simplified cloning pFastBac Dual e Two strong baculovirus promoters Pu and p10 to Harris amp allow simultaneous expression of two proteins Polayes 1997 e Two large multiple cloning sites for simplified cloning Bac to Bac TOPO Expression System The Bac to Bac TOPO Expression System provides a rapid and highly effective method to generate recombinant baculoviruses by combining the ease of blunt end TOPO cloning with the efficiency of site specific transposition technology of the Bac to Bac System The Bac to Bac TOPO Expression System is available separately from Invitrogen with a choice of pFastBac CT TOPO or pFastBac NT TOPO donor plasmids which are also available separately as part of Bac to Bac C His TOPO or Bac to Bac N His TOPO Cloning Kits see page vii for ordering information Continued on next page Overview continued Purpose of This Manual Important This manual provides an overview of the Bac to Bac Baculovirus Expression System and provides instructions and guidelines to 1 Clone your gene of interest into the pFastBac donor plasmid of choice 2 Transform the pFastBac
16. Recombinant fusion with the 6xHis tag you may use Invitrogen s ProBond or Ni NTA resins to Fusion Proteins purify your recombinant fusion protein See the table below for ordering information Item Quantity Cat no ProBond Nickel chelating Resin 50 ml R801 01 150 ml R801 15 ProBond Purification System 6 purifications K850 01 Ni NTA Agarose 10 ml R901 01 25 ml R901 15 100 ml R901 10 Ni NTA Purification System 6 purifications K950 01 viii Overview Introduction Advantages of the Bac to Bac Baculovirus Expression System Introduction The Bac to Bac Baculovirus Expression System provides a rapid and efficient method to generate recombinant baculoviruses Ciccarone et al 1997 This method was developed by researchers at Monsanto and is based on site specific transposition of an expression cassette into a baculovirus shuttle vector bacmid propagated in E coli Luckow et al 1993 The major components of the Bac to Bac Baculovirus Expression System include TM A choice of pFastBac donor plasmids that allow generation of an expression construct containing the gene of interest where expression of the gene of interest is controlled by a baculovirus specific promoter An E coli host strain DH10Bac that contains a baculovirus shuttle vector bacmid and a helper plasmid and allows generation of a recombinant bacmid following transposition of the pFastBac expression c
17. The figure below illustrates the general steps required to express your gene of interest using the Bac to Bac Baculovirus Expression System pFastBac donor plasmid v Clone gene of interest pFastBac Recombinant Transform into MAX Efficiency DH10Bac Cells containing bacmid and helper E coli Colonies with Recombinant Bacmid Y Restreak Verified E coli Colonies with Recombinant Bacmid Grow overnight culture and isolate recombinant bacmid DNA Recombinant Bacmid DNA using Cellfectin9 Reagent P1 Recombinant Baculovirus Stock 109 pfu ml Infect insect cells to amplify virus Transfect insect cells P2 Recombinant Baculovirus Stock gt 10 pfu ml insect cells Protein Expression Titer and infect Culturing Insect Cells General Guidelines Introduction Using Serum Free Medium Insect Cell Culture Reference Guide We recommend using Spodoptera frugiperda Sf9 or Sf21 insect cells as the host for your baculovirus transfer vector Before you start your transfection and expression experiments be sure to have cultures of Sf9 or Sf21 cells growing and have frozen master stocks available Sf9 and Sf21 cells and cell culture reagents are available separately from Invitrogen see page viii for ordering information Note High Five and Mimic Sf9 insect cells are suitable for use for expression only Insect cell
18. promoter Pp10 bases 4338 4459 complementary strand Polyhedrin promoter Ppp bases 4478 4606 Multiple cloning site bases 4606 4704 SV40 polyadenylation signal bases 4722 4962 Tn7L bases 4991 5156 Continued on next page 61 Map and Features of pFastBac Dual continued Features of the Vector 62 pFastBac Dual 5238 bp contains the following elements All features have been functionally tested Feature Benefit Polyhedrin promoter Pru Allows efficient high level expression of your recombinant protein in insect cells O Reilly et al 1992 Multiple cloning site Allows restriction enzyme mediated cloning of your gene of interest SV40 polyadenylation signal Permits efficient transcription termination and polyadenylation of mRNA Westwood et al 1993 Tn7L and Tn7R Mini Tn7 elements that permit site specific transposition of the gene of interest into the baculovirus genome i e bmon14272 bacmid Luckow et al 1993 f1origin Allows rescue of single stranded DNA Ampicillin resistance gene Allows selection of the plasmid in E coli pUC origin Permits high copy replication and maintenance in E coli Gentamicin resistance gene Permits selection of the recombinant bacmid in DH10Bac E coli Herpes Simplex Virus HSV thymidine kinase tk polyadenylation signal Allows efficient transcription termination and polyadenylation of mRNA Cole
19. remove excess stain with a pipet or blotter and count the plaques Plaques will appear as clear spots in a nearly clear gel against a red background Count the number of plaques present in each dilution then use the following formula to calculate the titer plaque forming units pfu ml of your viral stock Note that the optimal range to count is 3 to 20 plaques per well of a 6 well plate 1 ml of inoculum w ell titer pfu ml number of plaques x dilution factor x In this example we add 1 ml of inoculum and observe 20 plaques in the well containing the 10 viral dilution Using the formula above the titer of this viral stock is 1 1ml of inoculum well titer pfu ml 20 plaques x 10 x titer pfu ml 2 x 10 pfu ml When titering pFastBac baculoviral stocks we generally obtain titers ranging from e 1x 10 to 1x10 pfu ml for P1 viral stocks e 1x10 to 1 x 105 pfu ml for P2 viral stocks Note If the titer of your baculoviral stock is less than 1 x 10 pfu ml or 1 x 10 pfu ml for a P1 or P2 viral stock respectively we recommend producing a new baculoviral stock See page 36 and the Troubleshooting section page 50 for more tips and guidelines to optimize your viral yield Continued on next page 41 Performing a Viral Plaque Assay continued Plaque You may generate a viral stock from a single viral clone by plaque purifying Purification your baculovirus if desired Use
20. resistance gene bases 2802 3335 complementary strand Polyhedrin promoter Ppp bases 3904 4032 Multiple cloning site bases 4037 4142 SV40 polyadenylation signal bases 4160 4400 Tn7L bases 4429 4594 Continued on next page 34 Map and Features of pFastBac 1 continued Features of the Vector 58 pFastBac 1 4775 bp contains the following elements All features have been functionally tested Feature Benefit Polyhedrin promoter Pru Allows efficient high level expression of your recombinant protein in insect cells O Reilly et al 1992 Multiple cloning site Allows restriction enzyme mediated cloning of your gene of interest SV40 polyadenylation signal Permits efficient transcription termination and polyadenylation of mRNA Westwood et al 1993 Tn7L and Tn7R Mini Tn7 elements that permit site specific transposition of the gene of interest into the baculovirus genome i e bmon14272 bacmid Luckow et al 1993 f1origin Allows rescue of single stranded DNA Ampicillin resistance gene Allows selection of the plasmid in E coli pUC origin Permits high copy replication and maintenance in E coli Gentamicin resistance gene Permits selection of the recombinant bacmid in DH10Bac E coli Map and Features of pFastBac HT pFastBac HT A The map below shows the elements of pFastBac HT A The vector sequences of Map the pFastBac
21. restriction enzyme mediated cloning of your gene of interest SV40 polyadenylation signal Permits efficient transcription termination and polyadenylation of mRNA Westwood et al 1993 Tn7L and Tn7R Mini Tn7 elements that permit site specific transposition of the gene of interest into the baculovirus genome i e bmon14272 bacmid Luckow et al 1993 f1origin Allows rescue of single stranded DNA Ampicillin resistance gene Allows selection of the plasmid in E coli pUC origin Permits high copy replication and maintenance in E coli Gentamicin resistance gene Permits selection of the recombinant bacmid in DH10Bac E coli Map and Features of pFastBac Dual pFastBac Dual The map below shows the elements of pFastBac Dual The vector sequence of Map pFastBac Dual is available from our website www invitrogen com or by contacting Technical Support see page 66 c c 5000 LO O rw LOH QOL GG o0sS amp co0cto0 0800023m0029292032 Xx oz zzxomi madmuudooocozzxmar o D E et 3 o 2 Comments for pFastBac Dual 5238 nucleotides UC ori f1 origin bases 102 557 Ampicillin resistance gene bases 689 1549 pUC origin bases 1694 2367 Tn7R bases 2611 2835 Gentamicin resistance gene bases 2902 3435 complementary strand HSV tk polyadenylation signal bases 3992 4274 complementary strand Multiple cloning site bases 4274 4337 complementary strand p10
22. too low Wait at least 48 hours before picking colonies Incubate plates at 37 C All colonies are blue pFastBac DNA used for transformation was of poor quality e Use purified plasmid DNA for transformation e Check the quality of your plasmid DNA make sure that the DNA is not degraded Gentamicin omitted from plates Prepare fresh selective plates containing 50 ug ml kanamycin 7 ug ml gentamicin 10 ug ml tetracycline 100 ug ml Bluo gal and 40 ug ml IPTG Continued on next page Troubleshooting continued Generating Recombinant Bacmid DNA continued Problem Reason Solution Few colonies obtained Used LB medium for recovery expression period Use S O C Medium for the 4 hours growth time Recovery expression time too short Increase the recovery time to gt 4 hours at 37 C or 6 hours at 30 C differentiation Poor blue white colony Agar not at correct pH Adjust pH of LB agar to 7 0 Intensity of the blue color too weak e Use Bluo gal not X gal e Increase the concentration of Bluo gal to 300 pg ml e Use dark and light backgrounds to view plates Too many or too few colonies on plate Adjust the serial dilutions of cells to obtain an optimal number of colonies Incubation period too short or temperature too low e Do not pick colonies until 48 hours after plating e Incubate plates at 37 C IPTG con
23. vector To ensure proper expression of your recombinant protein your insert must contain e An ATG start codon for initiation of translation e A stop codon for termination of the gene Note Stop codons are included in the multiple cloning site in all three reading frames The production of recombinant proteins requires that your insert contain a translation initiation ATG Generally transfer vectors that contain intact polyhedrin Py leader sequences e g pFastBac vectors may yield higher levels of expression than vectors that contain interrupted leader sequences Protein translation can initiate at the mutated ATG ATT upstream of the multiple cloning site however initiation from this site is inefficient and generally does not interfere with expression and detection of recombinant protein Below is the multiple cloning site for pFastBac 1 Restriction sites are labeled to indicate the actual cleavage site Potential stop codons are underlined The vector sequence of pFastBac 1 is available for downloading from our website www invitrogen com or by contacting Technical Support see page 66 For a map and a description of the features of pFastBac 1 refer to the Appendix pages 57 58 Start of Transcription Polyhedrin promoter I TAGATCATGG 3901 AGATAATTAA AATGATAACC ATCTCGCAAA TAAATAAGTA wild type ATG mutated to ATT 3951 TTTTACTGTT TTCGTAACAG TTTTGTAATA AAAAAACCTA TAAATATTCC Bam H1 Rsr ll BssH Il
24. 4001 GGATTATTCA TACCGTCCCA CCATCGGGCG TE eac EcoR I Stu Sal Sst Spe Not Nsp V 4051 GCGGARTTCA A GGOCTACO TOGACOAGOT CACTAGTGGC Gecceemmrc Xba Pst Xho Sph Kpn Hind III 4101 GAATCTAGAG CCTGCAGTCT AT E T TTGTCGAGAA SV40 polyadenylation signal 4151 GTACTAGAGG ATCATAATCA GCCATACCAC ATTTGTAGAG GTTTTACTTG 11 Cloning into pFastBac HT A B and C Introduction Cloning Considerations Note 12 TM The pFastBac HT vector is supplied with the multiple cloning site in three reading frames A B and C to facilitate cloning your gene of interest in frame with the N terminal 6xHis tag See the recommendations below and the diagrams on pages 13 15 to help you design a cloning strategy TM The pFastBac HT vectors are fusion vectors To ensure proper expression of your recombinant protein you must e Clone your gene in frame with the initiation ATG at base pairs 4050 4052 This will create a fusion with the N terminal 6xHis tag and a cleavage site for the AcTEV Protease e Include a stop codon with your insert Generally transfer vectors that contain intact polyhedrin Px leader sequences e g pFastBac vectors may yield higher levels of expression than vectors that contain interrupted leader sequences Protein translation can initiate at the mutated ATG ATT upstream of the multiple cloning site however initiation from this site is inefficient and generally does not interfere with exp
25. Assay kit available separately from Invitrogen to determine the titer of your baculoviral stock The BaculoTiter Assay kit provides accurate results for your baculovirus titer in two days as compared to 10 day dilution assays For more information refer to our website at www invitrogen com or contact Technical Support page 66 Alternatively you may follow the guidelines and instructions provided below to e Determine the titer of your baculoviral stock e Plaque purify the virus optional To determine the titer of a baculoviral stock you will 1 Plate Sf9 or Sf21 cells in 6 well plates 2 Prepare 10 fold serial dilutions of your baculoviral stock 3 Add the different dilutions of baculovirus to Sf9 or Sf21 cells and infect cells for 1 hour Remove the virus and overlay the cell monolayer with Plaquing Medium Incubate the cells for 7 10 days stain if desired and count the number of plaques in each dilution A number of factors can influence viral titers including e The size of your gene of interest Titers will generally decrease as the size of the insert increases e The transfection efficiency For the highest transfection efficiency we recommend transfecting Sf9 or Sf21 cells using Cellfectin II Reagent Prepare DNA lipid complexes in Grace s Insect Medium Unsupplemented see pages 29 31 for details e The age of your baculoviral stock Viral titers may decrease with long term storage at 4 C or 80 C
26. Bac Gus or pFastBac Dual Gus CAT control constructs in your expression experiment you may assay for B glucuronidase expression using the following methods Other methods are suitable e Identify blue plaques on agarose plates containing the chromogenic indicator X glucuronide e To assess glucuronidase expression in a rapid but qualitative manner mix a small amount of media from the infected cells with X glucuronide and observe development of blue color Briefly mix 5 ul of a 20 mg ml X glucuronide solution in DMSO or dimethylformamide with 50 ul of cell free medium Monitor for development of blue color within 2 hours If you include the baculoviral control created using the pFastBac HT CAT or pFastBac Dual Gus CAT baculoviral construct in your expression experiment you may assay for CAT expression using your method of choice There are commercial kits available for assaying CAT expression as well as a rapid radioactive assay Neumann et al 1987 You may use any method of choice to purify your recombinant protein of interest Refer to published references Deutscher 1990 Janson amp Ryden 1989 for general guidelines on protein purification methods Note If you have cloned your gene of interest in frame with the 6xHis tag in pFastBac HT you may purify your recombinant protein using a metal chelating resin such as ProBond or Ni NTA available from Invitrogen see page viii for ordering information Refer to the m
27. Invitrogen Bac to Bac Baculovirus Expression System An efficient site specific transposition system to generate baculovirus for high level expression of recombinant proteins Catalog nos 10359 016 10360 014 10584 027 10712 024 Version E 19 January 2009 10359 Table of Contents Kit Contents arid Storage cce eee tee ee ee bete tee ibis e athe v ACCESSORY Products icio aasar ESETE A E E E E E rt ertet vii Introduction p 1 OO ACs YALA PPE EE er tna e et HU Rd UR UR Ge TRES RE RE 1 The Bac to Bac Baculovirus Expression Dyslerti eadeni ieget eR Yu PERSE RUE PRETENDE eds 3 Experimental Outline 5a sire pete o e e eee c d Ne o eR a ed a intere ertet rs 7 Cultu rind Insect Gellsu iiia caci te pU HERE ca a OU IU PIE IUS SECO Ee c nO Ru DA eNA DU AU FD RE EN Y CE TRAE 8 General Guidelines atiende ca atte eee iene end en uisaute ne debel dii e tes 8 Generating the Recombinant pFastBac Vector 10 General Information so seme pa ronde aeenpie inq etiem eei hrieencn tet tese delen iride d petes 10 Clonineinto pFastBac liste aon ute etre Rte emerit Resets a a ele es e Cedere 11 Cloning into pFastBac HT A B and C oit pate teme tee Dub dti os omoi idan agit 12 Clomihne into paste Dusddlooso dense oo niini anin ula Eee oder e pel D Ea eei ede RIA Foe ad 16 Transformation and Analysis ue pe net eei RH RR Rn Rs e hee ede dos e RH te eet teen 18 Generating the Recombinant Bacmmid ccccccccssesesseeeeeeeeeeeeeeeeeeeeeeeeeeee
28. Manager Agriculture and Life Sciences Technology Licensing Office The Texas A amp M University System 310 Wisenbaker College Station TX 77843 3369 Phone 409 847 8682 Fax 409 845 1402 You may not distribute the System or the vectors or host strains contained in it to others You may not transfer modified altered or original material from the System to a third party without written notification to and written approval from Invitrogen You may not assign sub license rent lease or otherwise transfer any of the rights or obligations set forth herein except as expressly permitted by Invitrogen References Anderson D Harris R Polayes D Ciccarone V Donahue R Gerard G and Jessee J 1996 Rapid Generation of Recombinant Baculoviruses and Expression of Foreign Genes Using the Bac To Bac Baculovirus Expression System Focus 17 53 58 Ausubel F M Brent R Kingston R E Moore D D Seidman J G Smith J A and Struhl K 1994 Current Protocols in Molecular Biology Greene Publishing Associates and Wiley Interscience New York Barry G F 1988 A Broad Host Range Shuttle System for Gene Insertion into the Chromosomes of Gram negative Bacteria Gene 71 75 84 Carrington J C and Dougherty W G 1988 A Viral Cleavage Site Cassette Identification of Amino Acid Sequences Required for Tobacco Etch Virus Polyprotein Processing Proc Natl Acad Sci USA 85 3391 3395 Ciccarone V C P
29. S without antibiotics and 8 5 ml Grace s Insect Medium Unsupplemented without FBS and antibiotics c Plate 8 x 10 Sf9 or Sf21 cells from Step 1 per well Allow cells to attach for 15 minutes at room temperature in the hood Remove the medium Add 2 5 ml plating medium from step 2b per well Proceed to step 3 For each transfection sample prepare complexes as follows a Mix Cellfectin II before use and dilute 8 ul in 100 ul Grace s Medium Unsupplemented without antibiotics and serum Vortex briefly to mix Note You may leave this mixture at room temperature for up to 30 minutes b Dilute 1 ul baculovirus DNA in 100 ul Grace s Medium Unsupplemented without antibiotics and serum Mix gently c Combine the diluted DNA with diluted Cellfectin II total volume 210 ul Mix gently and incubate for 15 30 minutes at room temperature Add 210 ul DNA lipid mixture or transfection mixture Step 3c dropwise onto the cells from Step 2 Incubate cells at 27 C for 3 5 hours Remove the transfection mixture and replace with 2 ml of complete growth medium e g Grace s Insect Medium Supplemented and 10 FBS Using antibiotics is optional Incubate cells at 27 C for 72 hours or until you see signs of viral infection 3l Isolating P1 Viral Stock Introduction Characteristics of Infected Cells Budded virus should be released into the medium 72 hours after transfection However if your transfection efficiency was n
30. TAAATAAGTA wild type ATG mutated to ATT TTTTACTGTT TTCGTAACAG TTTTGTAATA AAAAAACCTA TAAATATTCC l GGATTATTCA TACCGTCCCA CCATCGGGCG CGGATCTCGG TCCGAAACC 6xHis tag I l ATG TCG TAC TAC CAT CAC CAT CAC CAT CAC GAT TAC GAT ATC Met Ser Tyr Tyr His His His His His His Asp Tyr Asp Ile TEV recognition site Ehe Nco Bam H Eoo he ee cate a AA CCA ACG ACC GAA AAC CTG TAT TTT CAG GGC GCC ATG GGG ATC Pro Thr Thr Glu Asn Leu Tyr Phe n uri Ala Met Gly Ile TEV cleavage site EcoR Stu Sal Sst Spel Not CGG AAT TCA AAG GCC TAC GTC GAC GAG CTC ACT AGT CGC GGC Arg Asn Ser Lys Ala Tyr Val Asp Glu Leu Thr Ser Arg Gly Nsp V Xba Pst Xhol Sph l KpnI Hind Ill Id CGC TTT CGA ATC TAG AGCCTGCAGT CTCGAGGCAT GCGGTACCAA Arg Phe Arg Ile SV40 polyadenylation signal I GCTTGTCGAG AAGTACTAGA GGATCATAAT CAGCCATACC 15 Cloning into pFastBac Dual Introduction Cloning Considerations Note Multiple Cloning Site Downstream of the PH Promoter 16 The pFastBac Dual vector contains two multiple cloning sites to allow expression of two heterologous genes one controlled by the polyhedrin Pu promoter and one by the p10 promoter To help you design a strategy to clone your genes of interest into pFastBac Dual see the recommendations and the diagram below TM The pFastBac Dual vector is a non fusion vector To ensure proper expression of your recombinant proteins both of y
31. Tyr Phe Gingcly Ala Met Gly Ser TEV cleavage site EcoR Stu Sal Sstl Spel Not GGA ATT CAA AGG CCT ACG TCG ACG AGC TCA CTA GTC GCG GCC Gly Ile Glu Arg Pro Thr Ser Thr Ser Ser Leu Val Ala Ala NspV Xba Pst Xhol Sph Kpn GCT TTC GAA TCT AGA GCC TGC AGT CTC GAG GCA TGC GGT ACC Ala Phe Glu Ser Arg Ala Cys Ser Leu Glu Ala Cys Gly Thr Hind II AAG CTT GTC GAG AAG TAC TAG AG GATCATAATC AGCCATACCA Lys Leu Val Glu Lys Tyr SV40 polyadenylation signal Continued on next page Cloning into pFastBac HT A B and C continued Multiple Cloning Site of pFastBac HT C 3901 3951 4001 4050 4092 4134 4176 4221 TM Below is the multiple cloning site for pFastBac HT C The initiation ATG is indicated in bold Restriction sites are labeled to indicate the actual cleavage site The boxed nucleotide indicates the variable region The vector sequence of pFastBac HT C is available for downloading from our website www invitrogen com or by contacting Technical Support see page 66 For a map and a description of the features of pFastBac HT refer to the Appendix pages 61 62 Note In pFastBac HT C there is a stop codon within the Xba I site that is in frame with the N terminal tag Make sure that the 5 end of your gene is cloned upstream of the Xba I site Start of Transcription Polyhedrin promoter I TAGATCATGG AGATAATTAA AATGATAACC ATCTCGCAAA
32. Vectors Virology 195 90 93 01998 2009 Invitrogen Corporation All rights reserved For research use only Not intended for any animal or human therapeutic or diagnostic use 70 invitrogen Corporate Headquarters Invitrogen Corporation 5791 Van Allen Way Carlsbad CA 92008 T 1 760 603 7200 F 1 760 602 6500 E tech_support invitrogen com For country specific contact information visit our web site at www invitrogen com
33. a protocol of your choice or the procedure below Materials Needed e Plate containing well spaced viral plaques from Plaque Assay Procedure Step 11 page 39 do not stain plates with Neutral Red e Log phase Sf9 or Sf21 cells at greater than 95 viability e Sterile Pasteur pipette and bulb Procedure 1 Follow Steps 13 in the Plaque Assay Procedure page 39 to seed Sf9 or Sf21 cells 2 Using a sterile Pasteur pipette and bulb carefully pick a clear plaque and transfer the agarose plug containing virus to a 1 5 ml microcentrifuge tube containing 500 ul of complete growth medium Mix well by vortexing 3 Add 100 ul of the agarose plug solution to each well Incubate the cells in a 27 C humidified incubator for 72 hours 5 Collect the medium containing virus from each well 2 ml and transfer to sterile 15 ml snap cap tubes Centrifuge the tubes at 500 x g for 5 minutes to remove cells and large debris 6 Transfer the clarified supernatant to fresh 15 ml snap cap tubes This is your plaque purified viral stock 7 Proceed to Amplifying Your Baculoviral Stock page 34 42 Expressing Your Recombinant Protein Introduction Positive Control Guidelines for Expression TM Once you have generated a pFastBac baculoviral stock with a suitable titer e 1 x 10 pfu ml you are ready to use the baculoviral stock to infect insect cells and assay for expression of your recombinant protein Guidelines for infe
34. anual included with each product for guidelines to purify your fusion protein These manuals are available for downloading from our website www invitrogen com or by contacting Technical Support see page 66 TM pFastBac HT vector contains a Tobacco Etch Virus TEV recognition site that allows the removal of the 6xHis tag from your recombinant fusion protein using the AcTEV Protease available separately from Invitrogen see page vii Instructions for digestion are included with the product For more information contact Technical Support see page 66 Note Depending on which restriction enzymes are used for cloning additional amino acids may be present at the N terminus of your protein refer to the diagrams on pages 13 15 for more help 45 Troubleshooting Cloning into the The table below lists some potential problems that you may encounter when pFastBac generating your pFastBac construct Possible solutions that may help you Vectors troubleshoot your cloning are provided Problem Reason Solution Recombinant pFastBac Incomplete digestion of e Use additional restriction enzyme construct lacks insert pFastBac plasmid or insert for digestion DNS e Purify insert DNA Incomplete or excessive Optimize dephosphorylation phosphatase treatment of conditions according to the pFastBac plasmid manufacturer s recommendations for the phosphatase you are using Poor recovery of pFastBac Use PureLin
35. ature of your gene of interest You may perform the following to determine the optimal conditions to use to express your recombinant protein of interest e Cell line Infect Sf9 Sf21 High Five or Mimic Sf9 cells at a constant MOI Assay for recombinant protein expression at different times post infection e g 24 48 72 96 hours post infection Choose the cell line that provides the optimal level of recombinant protein expression e MOI Infect a population of cells at varying MOIS e g 1 2 5 10 20 and assay for protein expression Use the MOI that provides the optimal level of recombinant protein expression e Time course Infect cells at a constant MOI and assay for recombinant protein expression at different times post infection e 2 24 48 72 96 hours post infection Choose the time point at which optimal recombinant protein expression is obtained Use the following procedure for harvesting recombinant baculovirus infected insect cells to analyze expression of your recombinant protein of interest This procedure is adapted from Luckow and Summers and is designed to allow expression analysis in a 24 well format from cells harvested 24 to 96 hours post infection Other protocols are also suitable 1 Seed 6 x 10 Sf or Sf21 cells per well in a 24 well plate Let cells attach for at least 30 minutes 2 Remove the media and rinse the cells once with fresh growth media Replace with 300 ul of fresh media 3 Add
36. centration not optimal Optimize the IPTG concentration A range of 20 60 ug ml IPTG generally gives optimal color development Isolating Bacmid DNA The table below lists some potential problems and possible solutions to help you troubleshoot recombinant bacmid DNA isolation Problem Reason Solution Bacmid DNA is DNA stored improperly e Store purified bacmid DNA in degraded aliquots at 20 C e Do not freeze thaw repeatedly High molecular weight bacmid DNA handled improperly When isolating bacmid DNA do not vortex the DNA solution e Do not resuspend DNA pellets mechanically allow the solution to sit in the tube with occasional gentle tapping of the bottom of the tube Continued on next page 49 Troubleshooting continued Isolating Bacmid DNA continued Problem Reason Solution Poor yield Used incorrect antibiotic concentrations Grow transformed DH10Bac cells in LB medium containing 50 ug ml kanamycin 7 ug ml gentamicin and 10 pg ml tetracycline Bacmid DNA contains a mixture of recombinant bacmid and empty bacmid Picked a colony that was gray or dark in the center Analyze more white DH10Bac transformants and choose one that contains recombinant bacmid DNA only Transfecting Insect Cells 50 The table below lists some potential problems and possible solutions that may help you troubleshoot insect cell t
37. ch dilution on an LB agar plate containing 50 ug ml kanamycin 7 ug ml gentamicin 10 ug ml tetracycline 100 ug ml Bluo gal and 40 ug ml IPTG For the pUC19 transformation Dilute the cells 1 100 with S O C Medium Plate 100 ul of the dilution on an LB agar plate containing 100 ug ml ampicillin 10 Incubate plates for 48 hours at 37 C Pick white colonies for analysis see the next page for recommendations Note We do not recommend picking colonies earlier than 48 hours as it may be difficult to distinguish between white and blue colonies Insertions of the mini Tn7 into the mini attTn7 attachment site on the bacmid disrupt the expression of the LacZa peptide so colonies containing the recombinant bacmid are white in a background of blue colonies that harbor the unaltered bacmid Select white colonies for analysis True white colonies tend to be large therefore to avoid selecting false positives choose the largest most isolated white colonies Avoid picking colonies that appear gray or are darker in the center as they can contain a mixture of cells with empty bacmid and recombinant bacmid Continued on next page Transforming DH10Bac E coli continued Verifying the Phenotype Pick 10 white colonies and restreak them on fresh LB agar plates containing 50 ug ml kanamycin 7 ug ml gentamicin 10 ug ml tetracycline 100 ug ml Bluo gal and 40 ug ml IPTG Incubate the plates overnight at 37 C From a single colony confi
38. collect the medium containing virus from each well 2 ml and transfer to sterile 15 ml snap cap tubes Centrifuge the tubes at 500 x g for 5 minutes to remove cells and large debris 2 Transfer the clarified supernatant to fresh 15 ml snap cap tubes This is the P1 viral stock Store at 4 C protected from light See the next page for additional storage information Note If you wish to concentrate your viral stock to obtain a higher titer you may filter your viral supernatant through a 0 2 um low protein binding filter after the low speed centrifugation step if desired Continued on next page Isolating P1 Viral Stock continued Storing Viral Stocks The Next Step Note Store viral stocks as follows Store viral stock at 4 C protected from light If medium is serum free e g Sf 900 II SFM Sf 900 III SFM add fetal bovine serum to a final concentration of 2 Serum proteins act as substrates for proteases For long term storage store an aliquot of the viral stock at 80 C for later reamplification Do not store routinely used viral stocks at temperatures below 4 C Repeated freeze thaw cycles can result in a 10 to 100 fold decrease in virus titer Once you have obtained your clarified P1 baculoviral stock you may Amplify the viral stock see the next section for details This procedure is recommended to obtain the highest viral titers and optimal results in your expression studies Determin
39. ction and expression are provided below If you have generated a high titer viral stock from the pFastBac control baculo viral construct i e pFastBac Gus pFastBac HT CAT pFastBac Dual Gus CAT you may want to include this recombinant baculovirus in your experiments for use as an expression control Once you have infected cells with the FastBac control virus the gene encoding B glucuronidase Gus and or chloramphenicol acetyltransferase CAT will be constitutively expressed and can be easily assayed see page 45 General guidelines are provided below to infect insect cells with the recombinant baculovirus to express your protein of interest e Cell line Depending on your application and gene of interest you may use any insect cell line including Sf9 Sf21 High Five or Mimic Sf9 for expression Cells may be grown in adherent or suspension culture in the culture vessel of choice Note If you are expressing a secreted protein you may improve expression by using High Five cells e Culture Conditions We generally culture cells in serum free conditions using Sf 900 II SFM Sf 900 III SFM or Express Five SFM as appropriate see page viii Depending on your application and the protein of interest note that it may be necessary to supplement the culture post infection with 0 176 to 0 5 FBS or BSA to protect the recombinant protein from proteolysis Protein based protease inhibitors are generally less expensive and
40. d ampicillin resistant transformants we recommend the following 1 Pick 10 transformants and culture them overnight in LB or S O B containing 100 ug ml ampicillin 2 Isolate the plasmid DNA using your method of choice We recommend using the PureLink HiPure Plasmid DNA Miniprep Kit to purify high quality plasmid DNA from your E coli transformants see page vii for ordering information 3 Analyze the plasmids by restriction analysis to confirm the presence and correct orientation of the insert Use a restriction enzyme or a combination of enzymes that cut once in the vector and once in the insert Transformation and Analysis continued Analyzing Transformants by PCR Sequencing Long Term Storage You may also analyze positive transformants using PCR Use the appropriate PCR primers and amplification conditions for your insert If you are using this technique for the first time you may want to perform restriction analysis in parallel Artifacts may be obtained because of mispriming or contaminating template The protocol below is provided for your convenience Other protocols are suitable Materials Needed PCR SuperMix High Fidelity see page vii for ordering information Appropriate forward and reverse PCR primers 20 uM each Procedure 1 For each sample aliquot 48 ul of PCR SuperMix High Fidelity into a 0 5 ml microcentrifuge tube Add 1 ul each of the forward and reverse PCR primer 2 Pick 10 colonies a
41. discard the supernatant Add another 1 ml fresh 70 ethanol to the pellet in the microcentrifuge tube and centrifuge at 715 000 x g at 4 C for another 10 minutes second wash Carefully remove and discard the supernatant Air dry the pellet at room temperature until the appearance of the pellet changes from white opaque to translucent and crystalline Resuspend the DNA pellet in 200 500 ul TE Buffer pH 8 0 by vortexing Measure the concentration of the purified bacmid DNA The concentration should be in range of 150 300 ng ml Store the tube at 4 C We do not recommend storing the purified bacmid DNA by freezing at 20 C as it decreases the transfection efficiency You can store the purified bacmid DNA for up to 2 weeks at 4 C in TE Buffer pH 8 0 TM You can prepare glycerol stocks of DH10Bac E coli containing the bacmid DNA from mid logarithmic phase culture grown from white colonies picked during the blue white screening and store at 80 C for future bacmid DNA isolation Map and Features of pFastBac 1 TM pFastBac 1 Map The map below shows the elements of pFastBac 1 The vector sequence of pFastBac 1 is available from our website www invitrogen com or by contacting Technical Support see page 66 pFastBac 1 4775 bp Comments for pFastBac 1 4775 nucleotides f1 origin bases 2 457 Ampicillin resistance gene bases 589 1449 pUC origin bases 1594 2267 Tn7R bases 2511 2735 Gentamicin
42. e TNM FH you should have the following reagents on hand Grace s Insect Cell Culture Medium Supplemented Grace s Insect Cell Culture Medium 2X Fetal Bovine Serum FBS Qualified Heat Inactivated See page viii for ordering information Continued on next page 37 Performing a Viral Plaque Assay continued Preparing the Plaquing Medium 38 Plaquing medium consists of a mixture of culture medium and agarose and will be used to immobilize the infected cells for the plaque assay Prepare plaquing medium immediately before use following the procedure below If you are culturing the Sf9 cells in Sf 900 II SFM prepare Sf 900 Plaquing Medium If you are culturing cells in TNM FH prepare Grace s Plaquing Medium Note Other Plaquing Media are suitable 1 Melt the 4 Agarose Gel by placing the bottle in a 70 C water bath for 20 to 30 minutes or heating the agarose in a microwave oven While the 4 agarose gel is melting place the following in the 40 C water bath e Empty sterile 100 ml bottle e Sf 900 Medium 1 3X or Grace s Insect Cell Culture Medium 2X as appropriate Once the 4 agarose gel has liquefied move the agarose gel medium and empty 100 ml bottle to a sterile hood Working quickly prepare the plaquing medium as follows Sf 900 Plaquing Medium Combine 30 ml of Sf 900 Medium 1 3X and 10 ml of the melted 4 Agarose Gel in the empty 100 ml bottle and mix gently Grace s Plaquing Medi
43. e cell monolayer 10 Allow agarose overlay to harden for 1 hour at room temperature before moving the plates 11 Incubate the cells in a 27 C humidied incubator for 7 10 days until plaques are visible and ready to count If you wish to stain plaques to facilitate counting see the next page To calculate the titer see page 41 Continued on next page 39 Performing a Viral Plaque Assay continued Note Materials Needed Neutral Red Staining Procedure 40 To improve the visualization of plaques stain the plates using Neutral Red Crystalline Blue and other plaque staining dyes containing organic solvents are not recommended because they kill the host cells To stain plaques you may do one of the following Prepare an agarose solution containing neutral red and overlay this solution on the plates 4 days post infection Count plaques 7 10 days post infection or Prepare a neutral red solution and add to plates for 1 2 hours just prior to counting plaques 7 10 days post infection Important If you plan to plaque purify your baculovirus you should not stain plaques as neutral red is a known mutagen that can alter your recombinant virus Neutral Red high purity see page vii for ordering information Cell culture grade distilled water Sf 900 II SFM or other appropriate complete growth medium if preparing the agarose solution see page vii for ordering information 4 Agarose Gel if preparing the agar
44. e features of the pFastBac Dual Gus CAT Gus CAT Map vector The vector sequence of pFastBac Dual Gus CAT is available from our website www invitrogen com or by contacting Technical Support see page 66 L E G aq pFastBac Dual Gus CAT wouuag Comments for pFastBac Dual 5238 nucleotides PUC ori Polyhedrin promoter Ppp bases 16 144 CAT ORF bases 181 840 SV40 polyadenylation signal bases 964 1204 Tn7L bases 4991 5156 f1 origin bases 1582 2037 Ampicillin resistance gene bases 2169 3029 pUC origin bases 3174 3847 Tn7R bases 4091 4315 Gentamicin resistance gene bases 4382 4915 complementary strand HSV tk polyadenylation signal bases 5472 5754 complementary strand GUS ORF bases 5878 7689 complementary strand p10 promoter Pp40 bases 7719 7840 complementary strand 65 Technical Support World Wide Web Visit the Invitrogen website at www invitrogen com for e Technical resources including manuals vector maps and sequences application notes MSDSs FAQs formulations citations handbooks etc e Complete technical support contact information e Access to the Invitrogen Online Catalog e Additional product information and special offers Contact Us For more information or technical assistance call write fax or email Additional international offices are listed on our Web page www invitrogen com Corporate Headquarters Japanese Headquarters European Headquarters Invitro
45. e the titer of your viral stock see Performing a Viral Plaque Assay page 36 Plaque purify your recombinant baculovirus if desired see Performing a Viral Plaque Assay page 36 Use the P1 viral stock to infect Sf9 or Sf21 cells for preliminary expression experiments see below If you wish to perform small scale or preliminary expression experiments it is possible to proceed directly to expression studies by using the P1 viral stock to infect your Sf9 or Sf21 cells Note that the amount of viral stock is limited and expression conditions may not be reproducible i e MOI is unknown if titer is not determined 33 Amplifying Your Baculoviral Stock Introduction Materials Needed Important Multiplicity of Infection MOI Example 34 The P1 viral stock is a small scale low titer stock You may use this stock to infect cells to generate a high titer P2 stock The titer of the initial viral stock obtained from transfecting Sf9 or Sf21 cells generally ranges from 1 x 10 to 1 x 107 plaque forming units pfu ml Amplification allows production of a P2 viral stock with a titer ranging from 1 x 107 to 1 x 10 pfu ml and is generally recommended Guidelines and protocols are provided in this section to amplify the recombinant baculovirus to prepare a P2 viral stock You should have the following materials on hand before beginning e Sf9 or Sf21 cells cultured in the appropriate growth medium e P1 baculovira
46. e transposition reaction you will isolate the high molecular weight recombinant bacmid DNA and transfect the bacmid DNA into insect cells to generate a recombinant baculovirus that can be used for preliminary expression experiments After the baculoviral stock is amplified and titered this high titer stock can be used to infect insect cells for large scale expression of the recombinant protein of interest For a schematic representation of the Bac to Bac Baculovirus Expression System see the diagram on page 6 Continued on next page The Bac to Bac Baculovirus Expression System continued Baculovirus Shuttle Vector Helper Plasmid The baculovirus shuttle vector bacmid DbMON14272 136 kb present in DH10Bac E coli contains e Alow copy number mini F replicon e Kanamycin resistance marker e Asegment of DNA encoding the LacZa peptide from a pUC based cloning vector into which the attachment site for the bacterial transposon Tn7 mini att Tn7 has been inserted Insertion of the mini attTn7 does not disrupt the reading frame of the LacZa peptide The bacmid propagates in E coli DH10Bac as a large plasmid that confers resistance to kanamycin and can complement a lacZ deletion present on the chromosome to form colonies that are blue Lac in the presence of a chromogenic substrate such as Bluo gal or X gal and the inducer IPTG Recombinant bacmids composite bacmids are generated by transposing a mini Tn7 elemen
47. ed as a fusion to the N terminal 6xHis tag The molecular weight of the fusion protein is 28 kDa pFast Bac HT CAT The figure below summarizes the features of the pFastBac HT CAT vector The Map vector sequence of pFastBac HT CAT is available from our website www invitrogen com or by contacting Technical Support see page 66 nd Ill ATG 6xHis TEV CAT I Ba an 3 X H Comments for pFastBac HT CAT 5500 nucleotides f1 origin bases 2 457 Ampicillin resistance gene bases 589 1449 pUC origin bases 1594 2267 Tn7R bases 2511 2735 Gentamicin resistance gene bases 2802 3335 complementary strand Polyhedrin promoter Ppp bases 3904 4032 Initiation ATG bases 4050 4052 6xHis tag bases 4062 4079 TEV recognition site bases 4101 4121 CAT ORF bases 4131 4790 SV40 polyadenylation signal bases 4884 5124 Tn7L bases 5153 5318 64 Map of pFastBac Dual Gus CAT TM Description pFastBac Dual Gus CAT is a 7843 bp control vector containing the Arabidopsis thaliana gene for B glucuronidase Gus Kertbundit et al 1991 and the chloramphenicol acetyltransferase CAT gene The vector was generated by restriction cloning of the Gus and CAT genes into pFastBac Dual Expression of CAT and Gus are controlled by the polyhedrin Px and p10 promoters respectively The molecular weight of B glucuronidase and CAT are 68 5 kDa and 26 kDa respectively pFastBac Dual The figure below summarizes th
48. eeeeseeeeeeeeeeeeeeees 20 Transtorming DHI0Bac E colision enean pan a aaa nera E hE addidit dimid ibit 20 Isolating Recombinant Bacmid DNA nennen nennen nennen 24 Analyzing Recombinant Bacmid DNA by PCR ssssssssssessseeeeeeeeenerene nennen tenete 26 Producing Recombinant Baculovirus ee eeeeeeeeeeee eene nennen nennen nnn 29 Transtecting Insect Cells e E SERERE RH s 29 Isolating P1 Viral Stock eee meer eere e epe re e i rege ue Seen eve ses 32 Amplifying Your Baculoviral Stock ccccccccscssssscsceseseteeseseseensenesesesesneenesescscscececseesesesesesesesuanansnesssesnaananenessaeees 34 Performing a Viral Plaque Assay cscsccccsssssessscsceseeeteeseseseesesesesesesesnsneneseseseseececeesesesesesesesuansnesssesesnananenesesssesees 36 Expressing Your Recombinant Prot inen ienis eienenn ea kaa aerae Aiae ee ER aaa EE ARAE 43 HCIUIUE 46 Ld 52 cu M P M 52 Bacmid DNA Isolation Using PureLink HiPure Maxiprep Kit sse enne 54 Map atid Eeat tres of prastBac Doutoaodgpbeasretabduse ct REA Het deti o Elo del ul of ee a PR oet 57 Map and Featuresor pF stBac ELT assesses adiac vn P RO cited in RA UH OA VER urb IG on UN e 59 Map and Features of pFastBac Daleet oh aia dae nd era COTRA QORT AU RE Decl ehi S Sa QU Aias ie 61 Mic ph pEastbae GUsm ns tou sound en n dba desi
49. eeze thaw Important cycles as it decreases the transfection efficiency To store your purified bacmid DNA at 20 C aliquot into separate tubes in TE Buffer pH 8 0 to avoid more than one freeze thaw cycle and do not store in a frost free freezer You may also store the purified bacmid DNA for up to 2 weeks at 4 C in TE Buffer pH 8 0 TM You may prepare glycerol stocks of DH10Bac E coli containing the bacmid DNA from mid logarithmic phase culture grown from white colonies picked during the blue white screening and store at 80 C for future bacmid DNA isolation TM You may also use the procedure for PureLink HiPure Plasmid Maxiprep Kit Note provided in the Appendix page 54 for increased recombinant bacmid yield TM The PureLink HiPure Plasmid Prep Kits available separately from Invitrogen allow the purification of all types and sizes of plasmid DNA including BAC bacmids and ssM13 DNAs and are ideally suited for bacmid purification see page vii for ordering information 25 Analyzing Recombinant Bacmid DNA by PCR Introduction Recombinant bacmid DNA is greater than 135 kb in size Since restriction analysis is difficult to perform with DNA of this size we recommend using PCR analysis to verify the presence of your gene of interest in the recombinant bacmid Use the pUC M13 Forward and Reverse primers sequences given below that hybridize to sites flanking the mini attTn7 site within the lacZa complementat
50. endations For the antibiotics below prepare and store the stock solutions as directed Antibiotic Stock Solution Concentration Storage Ampicillin 50 mg ml in water filter sterilize 20 C protected from light Kanamycin 10 mg ml in water filter sterilize 20 C protected from light Tetracycline 10 mg ml in 10076 ethanol filter 20 C protected from light sterilize Gentamicin 7 mg ml in water filter sterilize 20 C protected from light Follow the procedure below to prepare a 200 mg ml stock solution of IPTG 1 Boe SS Dissolve 2 g of IPTG in 8 ml of sterile water Adjust the volume of the solution to 10 ml with sterile water Filter sterilize through a 0 22 micron filter Dispense the stock solution into 1 ml aliquots Store at 20 C Follow the guidelines below to prepare a 20 mg ml stock solution of Bluo gal Dissolve the Bluo gal in dimethylformamide or dimethyl sulfoxide DMSO to make a 20 mg ml stock solution Use a glass or polypropylene tube Important Exercise caution when working with dimethylformamide Dispense solutions in a vented chemical hood only Do not filter the stock solution Store at 20 C protected from light Continued on next page Recipes continued LB Luria Bertani Medium LB Luria Bertani Plates Composition 1 0 Tryptone casein peptone 0 5 Yeast Extract 1 0 NaCl pH 7 0 1 For 1 liter dissolve 10 g tryptone 5 g
51. ential problems that you may encounter when Recombinant generating the recombinant bacmid following transformation into DH10Bac Bacmid DNA E coli Possible solutions that may help you troubleshoot the transposition reaction are provided Problem Reason Solution 48 No blue non recombi nant colonies obtained i e all colonies are white Note Although you will pick white colonies you should expect to see some blue colonies Blue colonies contain non recombinant bacmids Insufficient time for color development Wait at least 48 hours before identifying colony phenotypes Used X gal instead of Bluo gal in agar plates Use Bluo gal in selective plates to increase the contrast between blue and white colonies Insufficient growth after transposition Grow transformed cells in S O C Medium for a minimum of 4 hours before plating Bluo gal and IPTG omitted from plates Prepare fresh selective plates containing 50 ug ml kanamycin 7 ug ml gentamicin 10 ug ml tetracycline 100 ug ml Bluo gal and 40 ug ml IPTG Too many colonies on the plate e Serially dilute the transformation mixture and plate to give well separated colonies e Adjust the serial dilutions of cells 10 to 10 to obtain well spaced colonies Plates too old or stored in light e Donot use plates that are more than 4 weeks old e Store plates protected from light Incubation period too short or temperature
52. f 900 III SFM after transfection Continued on next page 29 Transfecting Insect Cells continued Positive Control Materials Needed Transfection Conditions 30 If you have generated a recombinant bacmid from one of the pFastBac control plasmids i e pFastBac Gus pFastBac HT CAT or pFastBac Dual Gus CAT we recommend including this positive control in your transfection and expression experiments to help you evaluate your results In these bacmids the gene encoding B glucuronidase Gus and or chloramphenicol acetyltransferase CAT will be expressed under the control of the polyhedrin Px or p10 promoter After transfection expression of glucuronidase or CAT may be assayed as appropriate e Purified recombinant bacmid DNA from your pFastBac construct 500 ng ul in TE Buffer pH 8 0 e Purified recombinant bacmid DNA from the appropriate pFastBac control construct if desired 500 ng yl in TE Buffer pH 8 0 e Sf9 or Sf21 cells cultured in the appropriate medium e Cellfectin II Reagent store at 4 C until use e Grace s Insect Cell Medium Unsupplemented see page viii media should not contain supplements FBS or antibiotics e 6 well tissue culture plates and other tissue culture supplies e 1 5 ml sterile microcentrifuge tubes e Complete growth medium for culturing insect cells e g Sf 900 IT SFM Sf 900 III SFM TNM FH Grace s Supplemented Insect Cell Culture Medium or other
53. fy recombinant bacmid DNA from the transformed E coli see page vii for ordering information Bacmid DNA purified by this method is suitable for use in PCR analysis or insect cell transfections TM TM Note We do not recommend the PureLink HiPure Precipitator Module or the PureLink HiPure Plasmid Filter Mini Midi Maxiprep Kits for isolating bacmid DNA TM For more information on PureLink HiPure purification products visit our website at www invitrogen com or contact Technical Support see page 66 Growing bacmid DNA stock from E coli transformants in LB medium requires three days Day 1 e Pick a single white bacterial colony from among the transformants see page 18 and inoculate 4 ml of LB medium containing 50 ug ml kanamycin 7 ug ml gentamicin and 10 ug ml tetracycline Alternatively you can thaw glycerol stocks of DH10Bac cells harboring your verified recombinant bacmid and use 100 ul to inoculation e Incubate the culture at 37 C in a shaking water bath at 250 rpm overnight Day 2 e Transfer the entire 4 ml of overnight culture into 50 ml of fresh LB medium with antibiotics as above and incubate at 37 C in a shaking water bath at 250 rpm overnight Day 3 e Transfer the entire 50 ml of overnight culture into 500 ml of fresh LB medium with antibiotics as above and incubate at 37 C in a shaking water bath at 250 rpm overnight TM On Day 4 proceed with the PureLink HiPure bacmid DNA isolatio
54. gen Corporation Invitrogen Japan Invitrogen Ltd 5791 Van Allen Way LOOP X Bldg 6F Inchinnan Business Park Carlsbad CA 92008 USA 3 9 15 Kaigan 3 Fountain Drive Tel 1 760 603 7200 Minato ku Tokyo 108 0022 Paisley PA4 9RF UK Tel Toll Free 1 800 955 6288 Tel 81 3 5730 6509 Tel 44 0 141 814 6100 Fax 1 760 602 6500 Fax 81 3 5730 6519 Tech Fax 44 0 141 814 6117 E mail tech_support invitrogen com E mail jpinfo invitrogen com E mail eurotech invitrogen com MSDS Certificate of Analysis Limited Warranty 66 MSDSs Material Safety Data Sheets are available at www invitrogen com msds The Certificate of Analysis CofA provides detailed quality control information for each product and is searchable by product lot number which is printed on each box CofAs are available on our website at www invitrogen com support Invitrogen is committed to providing our customers with high quality goods and services Our goal is to ensure that every customer is 100 satisfied with our products and our service If you should have any questions or concerns about an Invitrogen product or service contact our Technical Support Representatives Invitrogen warrants that all of its products will perform according to specifications stated on the certificate of analysis The company will replace free of charge any product that does not meet those specifications This warranty limits Invitrogen Corporation s liability only to the cos
55. he procedure provided in the Appendix page 54 We recommend using a cationic lipid such as Cellfectin II Reagent for transfection Cellfectin II Reagent is supplied with the Bac to Bac Baculovirus Expression System and is available separately from Invitrogen see page vii for ordering information Cellfectin II Reagent is a proprietary cationic lipid formulation that offers the highest transfection efficiencies and protein expression levels on the widest variety of adherent and suspension insect cell lines including Sf9 and Sf21 cells We recommend using Sf9 or Sf21 cells for transfection and identification of recombinant plaques High Five and Mimic Sf9 cells are not recommended because they generally transfect less efficiently However once you have generated your baculovirus stock you may use High Five or Mimic Sf9 cells for expression studies For the highest transfection efficiency we recommend performing the transfection in Grace s Insect Cell Culture Medium Unsupplemented see page viii Note that the Grace s Insect Cell Culture Medium should not contain supplements or fetal bovine serum FBS as the supplements and the proteins in the FBS will interfere with the Cellfectin II Reagent inhibiting the transfection Note If you are culturing Sf9 or Sf21 cells in Sf 900 II SFM or Sf 900 III SFM you can perform the transfection in unsupplemented Grace s Medium then easily switch back to Sf 900 II SFM or S
56. ill use blue white selection to identify colonies containing the recombinant bacmid MAX Efficiency DH10Bac chemically competent cells are supplied with the Bac to Bac Baculovirus Expression System but are also available separately from Invitrogen see page vii Guidelines and instructions to transform TM DH10Bac cells are provided in this section Each pFastBac plasmid is supplied with a corresponding control plasmid for use as a positive transfection and expression control see table below Depending on the pFastBac vector you are using we recommend including the corresponding control plasmid in your DH10Bac transformation experiment see table below For maps and a description of the features of each control plasmid see the Appendix pages 63 65 pFastBac Vector Control Plasmid pFastBac 1 pFastBac Gus pFastBac HT pFastBac HT CAT pFastBac Dual pFastBac Dual Gus CAT Continued on next page Transforming DH10Bac E coli continued Materials Needed A by D L1 5 v EDS AL o Preparing for Transformation Have the following materials on hand before beginning e Your purified pFastBac construct 200 pg ul in TE pH 8 e Positive expression control i e pFastBac Gus pFastBac HT CAT or pFastBac Dual Gus CAT use as a control for transposition e MAX Efficiency DH10Bac chemically competent cells supplied with the Bac to Bac Baculovirus Expression System
57. ion continued Limited Use Label License No 22 Vectors amp Clones Encoding Histidine Hexamer Limited Use Label License No 326 Cellfectin II Transfection Reagent Limited Use Label License No 69 Baculovirus Vectors and Reagents 68 This product is licensed under U S Patent Nos 5 284 933 and 5 310 663 and foreign equivalents from Hoffmann LaRoche Inc Nutley NJ and or Hoffmann LaRoche Ltd Basel Switzerland and is provided only for use in research Information about licenses for commercial use is available from QIAGEN GmbH Max Volmer Str 4 D 40724 Hilden Germany This product is subject to U S Patents 4 897 355 and 5 550 289 This product is licensed for use in in vitro transfection or in vitro delivery of proteins peptides or other macromolecules only For a license to use the product in any other field of use including in vivo uses contact Roche Palo Alto LLC 3431 Hillview Avenue Palo Alto CA 94304 1397 This recombinant baculovirus expression system is the subject of one ore more of US patents 4 745 051 4 879 236 5 155 037 and 5 278 050 and corresponding foreign applications licensed to Invitrogen Corporation and sold for research purposes only Utilization of this product or system for the expression of gene products for commercial product development manufacturing or sale requires a license under the rights of The Texas A amp M University System Please contact Technology Licensing
58. ion and ligation to clone your gene s into one of the pFastBac vectors For recommendations and guidelines to help you design your cloning strategy refer to the appropriate section on pages 11 17 depending on the pFastBac vector you are using For help with restriction enzyme digestion ligation DNA sequencing and other general molecular biology techniques refer to Molecular Cloning A Laboratory Manual Sambrook et al 1989 or Current Protocols in Molecular Biology Ausubel et al 1994 The pFastBac vectors and their corresponding expression control plasmids contain the ampicillin resistance gene to allow for selection in E coli using ampicillin To propagate and maintain the pFastBac vectors and the pFastBac control plasmids use the following procedure 1 Use the stock solution of vector provided to transform a recA end E coli strain such as TOP10 DH10B or DH5a see page 18 for more information Select transformants on LB agar plates containing 100 ug ml ampicillin Prepare a glycerol stock from each transformant containing plasmid for long term storage see page 19 Cloning into pFastBac 1 Introduction Cloning Considerations Note Multiple Cloning Site of pFastBac 1 To help you design a strategy to clone your gene of interest into pFastBac 1 see the recommendations and diagram below The pFastBac 1 vector is a non fusion vector i e no fusion tags are present in the
59. ion region to facilitate PCR analysis see figure below Guidelines and instructions are provided in this section to perform PCR using the pUC M13 Forward and Reverse primers Transposed pFastBac Gene of interest sequence Bacmid DNA mini atfTn7 pUC M13 pUC M13 Forward Reverse PCR Analysis with To verify the presence of your gene of interest in the recombinant bacmid using pUC M13 Primers DNA Polymerase 26 PCR you may e Use the pUC M13 Forward and Reverse primers see sequences below e Use a combination of the pUC M13 Forward or Reverse primer and a primer that hybridizes within your insert Invitrogen does not supply the pUC M13 Forward and Reverse primers you must have these primers custom synthesized Primer Sequence pUC M13 Forward 5 CCCAGTCACGACGTTGTAAAACG 3 pUC M13 Reverse 5 AGCGGATAACAATTTCACACAGG 23 You may use any DNA polymerase of your choice for PCR including Platinum Taq DNA Polymerase If the expected PCR product is gt 4 kb we recommend using a polymerase mixture such as Platinum Tag DNA Polymerase High Fidelity for best results see page vii for ordering information Continued on next page Analyzing Recombinant Bacmid DNA by PCR continued Producing the PCR Product Use the procedure below to amplify your recombinant bacmid DNA using the pUC M13 Forward and Reverse primers and Platinum Taq polymerase If you are using a combination of the pUC
60. k Quick Gel Extraction plasmid or insert DNA from System to purify high quality plasmid agarose gel DNA from your agarose gel see page vii Incomplete ligation reactions e Follow ligation conditions according to the manufacturer s recommendations for the ligase you are using e Optimize ligation reaction by varying vector insert molar ratios e g 1 3 1 1 3 1 Insert contains unstable DNA Grow transformed cells at lower sequences such as LTR sequences temperatures 30 C and dvenedacpea e Use MAX Efficiency StbI2 Competent Cells available from Invitrogen see page vii for transformation Stbl2 E coli are specifically designed for cloning unstable inserts No or few colonies Low transformation efficiency of If stored incorrectly prepare or obtained after competent E coli obtain new competent cells ERDPCOURAUUR e Use Invitrogen s One Shot TOP10 or One Shot MAX Efficiency DH10B T1 Chemically Competent E coli for transformation see page vii Impurities in DNA Purify insert DNA Make sure to remove excess phenol proteins detergents and ethanol from the DNA solution Continued on next page 46 Troubleshooting continued Cloning into the pFastBac Vectors continued Problem Reason Solution No or few colonies obtained after transformation continued Too much DNA transformed e For chemically competent cells add 1 to 10 ng of DNA i
61. l one 15 ml round bottom polypropylene tube for each transformation Continued on next page 21 Transforming DH10Bac E coli continued Transformation Procedure Important 22 Follow the procedure below to transform MAX Efficiency DH10Bac chemically competent cells with your pFastBac construct We recommend including positive controls for transposition i e pFastBac expression plasmid and transformation i e pUC19 in your experiment to help you evaluate your results 1 Thaw on ice one vial of MAX Efficiency DH10Bac competent cells for each transformation 2 For each transformation gently mix and transfer 100 ul of the DH10Bac cells into a pre chilled 15 ml round bottom polypropylene tube 3 Add the appropriate amount of plasmid DNA to the cells and mix gently Do not pipet up and down to mix e Your pFastBac construct 1 ng 5 ul e pFastBac control plasmid 1 ng e pUC19 control 50 pg 5 ul Incubate cells on ice for 30 minutes Heat shock the cells for 45 seconds at 42 C without shaking Immediately transfer the tubes to ice and chill for 2 minutes Add 900 ul of room temperature S O C Medium OM DS Oros For pFastBac transformations Shake tubes at 37 C at 225 rpm for 4 hours For pUC19 transformation Shake tube at 37 C at 225 rpm for 1 hour 9 For each pFastBac transformation Prepare 10 fold serial dilutions of the cells 10 107 10 with S O C Medium Plate 100 ul of ea
62. l stock e Any appropriate tissue culture vessel see Important Note below e Tissue culture reagents e 27 C humidified incubator To amplify your P1 viral stock you may infect Sf9 or Sf21 cells growing in suspension or monolayer culture Depending on your needs you may amplify your P1 viral stock at any scale but remember that you may be limited by the amount of P1 viral stock available We generally amplify our P1 viral stock ina 10 ml suspension culture at 2 x 10 cells ml or in 6 well tissue culture plates at 2 x 106 cells well Calculate the number of Sf9 or Sf21 cells that you will need for infection and expand cells accordingly Make sure that the cells are healthy of low passage 5 20 and have gt 95 viability before proceeding to infection To amplify your viral stock infect cells at a multiplicity of infection MOI ranging from 0 05 to 0 1 MOI is defined as the number of virus particles per cell Use the following formula to calculate how much viral stock to add to obtain a specific MOI MOI pfu cell x number of cells Inoculum required ml titer of viral stock pfu ml Note If you have not determined the titer of your P1 viral stock you may assume that the titer ranges from 1 x 10 to 1 x 107 pfu ml We wish to infect a 10 ml culture at 2 x 10 cells ml using an MOI 0 1 We assume that the titer of our P1 viral stock is 5 x 105 pfu ml 0 1 pfu cell 2x 107 cells 5x10 pfu ml Inoculum re
63. mbinant baculoviruses Ciccarone et al 1997 Based on a method developed by Luckow et al 1993 the Bac to Bac Baculovirus Expression System takes advantage of the site specific transposition properties of the Tn7 transposon to simplify and enhance the process of generating recombinant bacmid DNA The first major component of the System is a pFastBac vector into which the gene s of interest will be cloned Depending on the pFastBac vector selected expression of the gene s of interest is controlled by the Autographa californica multiple nuclear polyhedrosis virus ACMNPV polyhedrin Px or p10 promoter for high level expression in insect cells This expression cassette is flanked by the left and right arms of Tn7 and also contains a gentamicin resistance gene and an SV40 polyadenylation signal to form a mini Tn7 The second major component of the System is the DH10Bac E coli strain that is used as the host for your pFastBac vector DH10Bac cells contain a baculovirus shuttle vector bacmid with a mini attTn7 target site and a helper plasmid see the next page for details Once the pFastBac expression plasmid is transformed into DH10Bac cells transposition occurs between the mini Tn7 element on the pFastBac vector and the mini attTn7 target site on the bacmid to generate a recombinant bacmid This transposition reaction Occurs in the presence of transposition proteins supplied by the helper plasmid Once you have performed th
64. mid Perform plaque purification to isolate recombinant baculovirus Expressing Your Protein The table below lists some potential problems and possible solutions that may help you troubleshoot your expression experiments Problem Reason Solution Low protein yield Viral stock contains a mixture of recombinant and non recombinant baculovirus Perform plaque purification to isolate recombinant baculovirus Baculovirus not recombinant Verify transposition by PCR analysis of bacmid DNA using the pUC M13 Forward and Reverse primers Re transfect insect cells with new recombinant bacmid DNA Used too low or too high viral titer Optimize infection conditions by varying the MOI Time of cell harvest not optimal Perform a time course of expression to determine the optimal time to obtain maximal protein expression Cell growth conditions and medium not optimal Optimize culture conditions based on the size of your culture vessel and expression conditions Culture cells in Sf 900 II SFM or Sf 900 III SFM for optimal cell growth and protein expression Cell line not optimal Try other insect cell lines 51 Recipes Antibiotic Stock Solutions IPTG Bluo gal 52 Appendix Antibiotics can be ordered in either dry powdered form or as a stabilized sterile premixed solution Store these solutions according to the manufacturer s recomm
65. more effective than many synthetic protease inhibitors e Infection Conditions We recommend infecting cultures while cells are in the mid logarithmic phase of growth at a density of 1 x 10 to 2 x 10 cells ml Make sure that the culture is not rate limited by nutritional i e amino acid or carbohydrate utilization or environmental factors i e pH dissolved O or temperature during infection e MOI Optimal MOI will vary between cell lines and the relative infection kinetics of the virus isolate or clone used A dose response should be established for each virus medium reactor and cell line employed to determine the optimal infection parameters to use for protein expression As a starting point infect cells using an MOI of 1 to 5 e Time course We recommend performing a time course to determine the expression kinetics for your recombinant protein as many proteins may be degraded by cellular proteases released in cell culture Note Maximum expression of secreted proteins is generally observed between 30 and 72 hours and non secreted proteins between 48 and 96 hours post infection Continued on next page 43 Expressing Your Recombinant Protein continued Optimizing Expression Harvesting Baculovirus Infected Insect Cells Detecting Recombinant Protein 44 A number of factors can influence determination of optimal expression conditions including the cell line MOI your application of interest and the n
66. n procedure as described on the next page Continued on next page Bacmid DNA Isolation Using PureLink HiPure Maxiprep Kit continued Before Starting Equilibrating the Column Preparing the Cell Lysate Binding and Washing the DNA Before beginning verify that RNase A has been added to the Resuspension Buffer R3 and that no precipitate has formed in the Lysis Buffer L7 Place the PureLink HiPure Maxi column on the PureLink Nucleic Acid Purification Rack see the manual supplied with the rack for more details Apply 30 ml Equilibration Buffer EQ1 to the column Allow the solution in the column to drain by gravity flow Proceed to Preparing the Cell Lysate next page while the column is equilibrating Harvest 250 500 ml of the overnight culture by centrifuging at 4 000 x g for 10 minutes in a bucket Remove all medium Add 20 ml Resuspension Buffer R3 with RNase A to the pellet and resuspend the cells until homogeneous Transfer cell suspension to a 50 ml centrifuge tube Add 20 ml Lysis Buffer L7 Mix gently by inverting the capped tube five times Do not vortex Incubate at room temperature for 5 minutes Note Do not allow lysis to proceed for more than 5 minutes Add 20 ml Precipitation Buffer N3 and mix immediately by inverting the capped tube until the mixture is homogeneous Do not vortex Centrifuge the mixture at 212 000 x g at room temperature for 10 minutes Note If the pellet d
67. na volume of 5 ul or less per 100 ul of cells For electrocompetent cells add 10 to 50 ng of DNA in a volume of 1 pl or less per 20 ul of cells e If you have purchased competent cells follow the manufacturer s instructions Incomplete ligation reaction e Optimize the ligation reaction e Include a ligation control i e digested pFastBac vector ligase no insert Check the ligation reaction on a gel Note Ligated products and linear DNA transform 10X and 100 100X less efficiently respectively than super coiled DNA Hanahan 1983 Ligation reaction mix inhibits transformation of competent cells Reduce the amount of ligation reaction transformed Dilute ligation reaction 5X with TE Buffer prior to transformation Problem with antibiotic e Confirm use of the correct antibiotic confirm antibiotic concentration e Check that the antibiotic is not degraded i e change in color of solution or the appearance of precipitate Use fresh antibiotic Competent cells stored improperly Store competent cells at 80 C Competent cells handled improperly Thaw cells on ice use immediately after thawing do not vortex Cells not heat shocked or incubated properly during transformation Follow the recommended transformation procedure for the cells you are using Continued on next page 47 Troubleshooting continued Generating The table below lists some pot
68. nalysis Introduction E coli Host Transformation Method Analyzing Transformants 18 Once you have completed your ligation reactions you are ready to transform your pFastBac construct into E coli Many E coli host strains and transformation procedures are suitable General recommendations to transform E coli and analyze transformants are provided in this section Once you have cloned your insert into one of the pFastBac vectors you will transform the ligation reaction into E coli and select for ampicillin resistant transformants You may use any recA endA E coli strain including TOP10 DH10P or DH5a for transformation Do not transform the ligation reaction into DH10Bac cells Note Chemically competent TOP10 DH10B and DH5a E coli are available from Invitrogen in a convenient One Shot format see table below Item Quantity Cat no One Shot TOP10 Chemically Competent E coli 20 x 50 ul C4040 03 One Shot MAX Efficiency DH10B T1 20 x 50 ul 12331 013 Chemically Competent E coli One Shot MAX Efficiency DH5a T1 20 x 50 ul 12297 016 Chemically Competent E coli You may use any method of choice to transform E coli Chemical transformation is the most convenient method while electroporation is the most efficient and method of choice for large plasmids To select for transformants use LB agar plates containing 100 ug ml ampicillin Once you have obtaine
69. nd centrifuge at 215 000 x g for 5 minutes at room temperature to remove any remaining cellular debris 1 Load the supernatant from Step 5 see above onto the equilibrated column Allow the solution in the column to drain by gravity flow 2 Wash the column twice with 2 5 ml Wash Buffer W8 Allow the solution in the column to drain by gravity flow after each wash Discard the flow through Continued on next page Isolating Recombinant Bacmid DNA continued Eluting and 1 Place a sterile centrifuge tube elution tube under the column Precipitating DNA gt Add 09 ml Elution Buffer E4 to the column to elute DNA Allow the solution to drain by gravity flow Do not force out any remaining solution The elution tube contains the purified DNA Discard the column Add 0 63 ml isopropanol to the elution tube Mix and place on ice for 10 minutes 5 Centrifuge the mixture at gt 15 000 x g at 4 C for 20 minutes Carefully remove and discard the supernatant Resuspend the DNA pellet in 1 ml 70 ethanol 7 Centrifuge at 215 000 x g at 4 C for 5 minutes Carefully remove and discard the supernatant Air dry the pellet for 10 minutes Resuspend the DNA pellet in 40 ul TE Buffer TE Allow pellet to dissolve for at least 10 minutes on ice To avoid shearing the DNA pipette only 1 2 times to resuspend 10 Store the bacmid DNA at 4 C see Important below You may store your bacmid DNA at 20 C if you avoid frequent fr
70. nd resuspend them individually in 50 ul of the PCR SuperMix containing primers remember to make a patch plate to preserve the colonies for further analysis Incubate reaction for 10 minutes at 94 C to lyse cells and inactivate nucleases Amplify for 20 to 30 cycles For the final extension incubate at 72 C for 10 minutes Store at 4 C yO gm Visualize by agarose gel electrophoresis You may sequence your construct to confirm that your gene of interest is in the correct orientation for expression If you have cloned your gene into one of the pFastBac HT vectors verify that your gene is cloned in frame with the N terminal tag Once you have identified the correct clone be sure to purify the colony and make a glycerol stock for long term storage We recommend that you store a stock of plasmid DNA at 20 C 1 Streak the original colony out for single colony on LB plates containing 100 ug ml ampicillin 2 Isolate a single colony and inoculate into 1 2 ml of LB containing 100 ug ml ampicillin 3 Grow until culture reaches stationary phase Mix 0 85 ml of culture with 0 15 ml of sterile glycerol and transfer to a cryovial 5 Store at 80 C 19 Generating the Recombinant Bacmid Transforming DH10Bac E coli Introduction Positive Control 20 Once you have generated your pFastBac construct you are ready to transform purified plasmid DNA into DH10Bac E coli for transposition into the bacmid You w
71. nge of 6 1 to 6 4 works well for most culture systems Sf 900 II SFM will maintain a pH in this range under conditions of normal air and open capped culture systems e Osmolality The optimal osmolality of medium for use with lepidopteran cell lines is 345 to 380 mOsm kg e Aeration Insect cells require passive oxygen diffusion for optimal growth and recombinant protein expression Active or controlled oxygenated systems require dissolved oxygen at 10 to 50 of air saturation e Shear Forces Suspension culture generates mechanical shear forces Growing insect cells in serum containing media 10 to 20 FBS generally provides adequate protection from cellular shear forces If you are growing insect cells in serum free conditions supplementation with a shear force protectant such as PLURONIC F 68 may be required Note Growing cells in Sf 900 II SFM does not require addition of shear force protectants Cells for You will need log phase cells with gt 95 viability to perform a successful Transfection transfection Refer to page 30 to determine how many cells you will need for transfection Generating the Recombinant pFastBac Vector General Information Introduction General Molecular Biology Techniques Propagation and Maintenance of Plasmids 10 To generate a recombinant plasmid containing your gene s of interest for use in the Bac to Bac Baculovirus Expression System you will use restriction enzyme digest
72. oes not adhere to the bottom of the tube incubate the tube at room temperature for 5 minutes to allow the separation of the lysate and gelatinous pellet Pipette the clear lysate into another tube and centrifuge at 215 000 x g for 5 minutes at room temperature to remove any remaining cellular debris Load the supernatant from Step 5 see above onto the equilibrated column Allow the solution in the column to drain by gravity flow Wash the column with 60 ml Wash Buffer W8 Allow the solution in the column to drain by gravity flow after each wash Discard the flow through Continued on next page 55 Bacmid DNA Isolation Using PureLink HiPure Maxiprep Kit continued Eluting and Precipitating the DNA Important 56 10 11 Place a sterile 30 ml centrifuge tube elution tube under the column Add 15 ml Elution Buffer E4 to the column to elute DNA Allow the solution to drain by gravity flow Do not force out any remaining solution The elution tube contains the purified DNA Discard the column Add 10 5 ml isopropanol to the elution tube Mix well Centrifuge the mixture at 215 000 x g at 4 C for 30 minutes Carefully remove and discard the supernatant Add 1 ml 70 ethanol to the pellet in the 30 ml elution tube displace the pellet from the side of the tube and transfer all the pellet fragments into a 1 5 ml microcentrifuge tube Centrifuge at 215 000 x g at 4 C for 10 minutes Carefully remove and
73. olayes D and Luckow V A 1997 Generation of Recombinant Baculovirus DNA in E coli Using Baculovirus Shuttle Vector Methods in Molecular Medicine Reischt U Ed 13 Humana Press Inc Totowa NJ Cole C N and Stacy T P 1985 Identification of Sequences in the Herpes Simplex Virus Thymidine Kinase Gene Required for Efficient Processing and Polyadenylation Mol Cell Biol 5 2104 2113 Deutscher M P ed 1990 Guide to Protein Purification Vol 182 Methods in Enzymology Edited by Abelson J N and Simon M I Academic Press San Diego CA Dougherty W G Carrington J C Cary S M and Parks T D 1988 Biochemical and Mutational Analysis of a Plant Virus Polyprotein Cleavage Site EMBO J 7 1281 1287 Hanahan D 1983 Studies on Transformation of Escherichia coli with Plasmids J Mol Biol 166 557 580 Harris R and Polayes D 1997 A New Baculovirus Expression Vector for the Simultaneous Expression of Two Heterologous Proteins in the Same Insect Cell Focus 19 6 8 Janson J C and Ryden L 1989 in Protein Purification Principles High Resolution Methods and Applications VCH Publishers New York Kertbundit S Greve H d Deboeck F Montagu M V and Hernalsteens J P 1991 In vivo Random b glucuronidase Gene Fusions in Arabidopsis thaliana Proc Natl Acad Sci USA 88 5212 5216 King L A and Possee R D 1992 The Baculovirus Expression System A Laboratory Guide Chapman and
74. onstruct A control expression plasmid containing the Gus and or CAT gene that allows production of a recombinant baculovirus which when used to infect insect cells expresses glucuronidase and or chloramphenicol acetyl transferase Using the Bac to Bac Baculovirus Expression System to generate a recombinant baculovirus provides the following advantages over the traditional method using homologous recombination Requires less than 2 weeks to identify and purify a recombinant baculovirus as compared to the 4 6 weeks required to generate a recombinant baculovirus using homologous recombination Reduces the need for multiple rounds of plaque purification as the recombinant virus DNA isolated from selected colonies is not mixed with parental non recombinant virus Permits rapid and simultaneous isolation of multiple recombinant baculoviruses and is suited for the expression of protein variants for structure function studies Continued on next page Overview continued Choosing a A number of pFastBac vectors are available for use with the Bac to Bac pFastBac Vector Baculovirus Expression System see table below Choose the vector that best suits your needs Vector Features Reference pFastBac 1 e Strong AcMNPV polyhedrin Pu promoter for high Anderson et al level protein expression 1996 e Large multiple cloning site for simplified cloning pFastBac HT e Strong polyhedrin Px promoter for high level protein
75. ose solution see page vii for ordering information 40 C water bath if preparing the agarose solution Preparing a Neutral Red Agarose Overlay for use on Day 4 1 Prepare a 1 mg ml Neutral Red solution in Sf 900 II SFM or other appropriate complete growth medium Filter sterilize Combine the reagents below in a 50 ml tube and place in a 40 C water bath 1 mg ml Neutral Red solution 15ml Sf 900 II SFM 16 5 ml Microwave 4 Agarose Gel until melted then place in a 40 C water bath for 5 minutes Move the 50 ml tube of Neutral Red solution and the 4 agarose gel to a sterile hood Add 6 ml of 4 agarose gel to the Neutral Red solution Add 1 ml of the Neutral Red overlay to each well containing plaquing overlay Once the agarose has hardened return plates to a 27 C humidified incubator until plaques are ready to count Plaques will appear as clear spots on a red monolayer Procedure continued on next page Continued on next page Performing a Viral Plaque Assay continued Neutral Red Staining Procedure continued Calculating the Titer Example What You Should See Procedure continued from previous page Preparing a Neutral Red Stain for use on Day 7 10 prior to counting plaques 6 Preparea 1 mg ml Neutral Red solution in cell culture grade distilled water 7 Add0 5 ml of Neutral Red solution to each well containing plaquing overlay Incubate for 1 to 2 hours at room temperature 8 Gently
76. ot optimal cells may not show all of the signs of viral infection until 4 or 5 days post transfection Beginning at 72 hours after transfection you should visually inspect the cells daily for signs of infection see below Once the cells appear infected i e demonstrate chacteristics typical of late to very late infection harvest the virus from the cell culture medium using the procedure below Virally infected insect cells typically display the following characteristics as observed from visual inspection using an inverted phase microscope at 250 400X magnification The time points provided below assume that the transfection was successful i e transfection efficiency was high Signs of Infection Phenotype Description Early first 24 hours Increased cell diameter A 25 50 increase in cell diameter may be seen Increased size of cell nuclei Nuclei may appear to fill the cells Late 24 72 hours Cessation of cell growth Cells appear to stop growing when compared to a cell only control Granular appearance Signs of viral budding vesicular appearance to cells Detachment Cells release from the plate or flask Very Late 272 hours Cell lysis Cells appear lysed and show signs of clearing in the monolayer Preparing the P1 Viral Stock 32 1 Once the transfected cells from Step 6 previous page demonstrate signs of late stage infection e g 72 hours post transfection
77. our inserts must contain e An ATG start codon for initiation of translation e A stop codon for termination of the gene if you don t use one of the stop codons provided in the multiple cloning site The production of recombinant proteins requires that your insert contain a translation initiation ATG Generally transfer vectors that contain intact polyhedrin leader sequences e g pFastBac vectors may yield higher levels of expression than vectors that contain interrupted leader sequences For inserts cloned downstream of the polyhedrin promoter note that protein translation can initiate at the mutated ATG ATT however initiation from this site is inefficient and generally does not interfere with expression and detection of recombinant protein Below is the multiple cloning site located downstream of the Pu promoter in pFastBac Dual Restriction sites are labeled to indicate the actual cleavage site Potential stop codons are underlined The vector sequence of pFastBac Dual is available for downloading from our website www invitrogen com or by contacting Technical Support see page 66 For a map and a description of the features of pFastBac Dual refer to the Appendix pages 61 62 Start of Transcription Polyhedrin promoter I 4481 ATGGAGATAA TTAAAATGAT AACCATCTCG CAAATAAATA AGTATTTTAC wild type ATG mutated to ATT E 4531 TGTTTTCGTA ACAGTTTTGT AATAAAAAAA CCTATAAATA TTCCGGATTA BamH Rsr ll BssH Il EcoR I
78. pBR322 derived plasmid pMON7124 bom tra mob As a condition of sale this product must be in accordance with all applicable local legislation and guidelines including EC Directive 90 219 EEC on the contained use of genetically modified organisms The purchase of this product conveys to the buyer the non transferable right to use the purchased amount of the product and components of the product in research conducted by the buyer whether the buyer is an academic or for profit entity The buyer cannot sell or otherwise transfer a this product b its components or c materials made using this product or its components to a third party or otherwise use this product or its components or materials made using this product or its components for Commercial Purposes The buyer may transfer information or materials made through the use of this product to a scientific collaborator provided that such transfer is not for any Commercial Purpose and that such collaborator agrees in writing a not to transfer such materials to any third party and b to use such transferred materials and or information solely for research and not for Commercial Purposes Commercial Purposes means any activity by a party for consideration and may include but is not limited to 1 use of the product or its components in manufacturing 2 use of the product or its components to provide a service information or data 3 use of the product or its components for therape
79. quired ml Inoculum required ml 0 4 ml Continued on next page Amplifying Your Baculoviral Stock continued Important For successful amplification of your baculovirus you should pay attention to considerations several key points e UseSf9 or Sf21 cells that are in excellent health low passage 5 20 log phase growth and have gt 95 viability e Use sterile P1 baculoviral stock that is free of contaminants e Use a low MOI between 0 05 0 1 as higher MOI will reduce baculovirus quality e Harvest the virus when 70 80 of cells are dead e You cannot amplify the baculovirus indefinitely as they acquire deleterious mutations with each passage Usually P3 is highest usable passage Amplification Follow the guidelines below to amplify your P1 viral stock in a 6 well plate Procedure 1 On the day of infection prepare your Sf9 or Sf21 cell suspension and plate cells at 2 x 10 cells well Incubate cells at room temperature for 1 hour to allow attachment After 1 hour inspect cells under an inverted microscope to verify attachment Add the appropriate amount of P1 viral stock to each well Incubate the cells for 48 hours in a 27 C humidified incubator Qno vox sp 48 hours post infection collect 2 ml of medium containing virus from each well and transfer to sterile 15 ml snap cap tubes Centrifuge the tubes at 500 x g for 5 minutes to remove cells and large debris and to obtain clarified baculoviral stock
80. r Odi cdd d aam eb rien De hup aat 63 Map oF BESSEDae HECAT oo oU etl tied ors La Von eua bes ele Aa Enina ara Ut E nE E Terry 64 Map of prasthac Dual GusZ CAT s arto AU DAE T IUE e bla An ride ete gere de 65 Technical Support i onse n qa edi re a idet eh tnr diiit ie RR RR RT RO des 66 Purchaser Notification s oes ie ee ede e OH ERE RUE soled a Saan tre i m a de iU bI ess 67 R fer nceso usioraneopatiia iret uda tcc adt Quit etd dai sitit tutti 69 Kit Contents and Storage Types of Products This manual is supplied with the products listed below For a list of the reagents supplied with each catalog number see below and the next page Kit Components Shipping Storage Vector Kits Product Quantity Cat no Bac to Bac Baculovirus Expression System 1 kit 10359 016 Bac to Bac Vector Kit 1 kit 10360 014 Bac to Bac HT Vector Kit 1 kit 10584 027 pFastBac Dual Vector Kit 1 kit 10712 024 Each catalog number contains the components listed below Important Note that catalog numbers 10360 014 10584 027 and 10712 024 contain pFastBac vectors only See the next page for a detailed description about the specific pFastBac vector and other reagents supplied with each catalog number Component Cat no Cat no Cat no Cat no 10359 016 10360 014 10584 027 10712 024 pFastBac Vectors v v Y v MAX Efficiency DH10Bac Y Competent E coli Cellfectin II Reagent Y
81. ransfection Problem Reason Solution Low yield of virus Low transfection efficiency e Use Invitrogen s Cellfectin II Reagent for transfection e Perform transfection in Grace s Medium Unsupplemented make sure that no supplements FBS or antibiotics are present during transfection e Harvest viral supernatant when signs of infection are visible i e gt 96 hours post transfection Cells plated too sparsely Plate insect cells at the recommended cell density Used too much or too little Cellfectin II or other lipid reagent Optimize the amount of Cellfectin II or other lipid reagent used Time of incubation with DNA lipid complexes too short Optimize the incubation time e g 3 to 8 hours or too long Recombinant bacmid DNA is e Check the quality of your degraded recombinant DNA by agarose gel electrophoresis prior to transfection e Prepare bacmid DNA using Invitrogen s PureLink HiPure Plasmid DNA Miniprep or Maxiprep Kit see page vii for ordering information or use the procedure provided on page 54 Continued on next page Troubleshooting continued Transfecting Insect Cells continued Problem Reason Solution Low yield of virus continued Bacmid DNA is not pure i e contains recombinant bacmid and empty bacmid Screen other DH10Bac transformants and choose one that contains only recombinant bac
82. ression and detection of recombinant protein Continued on next page Cloning into pFastBac HT A B and C continued Multiple Cloning Site of pFastBac HT A 3901 3951 4001 4050 4092 4134 4176 4218 TM Below is the multiple cloning site for pFastBac HT A The initiation ATG is indicated in bold Restriction sites are labeled to indicate the actual cleavage site The vector sequence of pFastBac HT A is available for downloading from our website www invitrogen com or by contacting Technical Support see page 66 For a map and a description of the features of pFastBac HT refer to the Appendix pages 59 60 Start of Transcription Polyhedrin promoter T TAGATCATGG AGATAATTAA AATGATAACC ATCTCGCAAA TAAATAAGTA wild type ATG mutated to ATT n TTTTACTGTT TTCGTAACAG TTTTGTAATA AAAAAACCTA TAAATATTCC j GGATTATTCA TACCGTCCCA CCATCGGGCG CGGATCTCGG TCCGAAACC 6xHis tag Bea aa e a a a a aal ATG TCG TAC TAC CAT CAC CAT CAC CAT CAC GAT TAC GAT ATC Met Ser Tyr Tyr His His His His His His Asp Tyr Asp Ile TEV recognition site Ehe Ncol BamHI E 0H dg CCA ACG ACC GAA AAC CTG TAT TTT CAG GGC GCC ATG GAT CCG Pro Thr Thr Glu Asn Leu Tyr Phe E Ala Met Asp Pro TEV cleavage site EcoR Stu Sal Sst Spe Not GAA TTC AAA GGC CTA CGT CGA CGA GCT CAA CTA GTG CGG CCG Glu Phe Lys Gly Leu Arg Arg Arg Ala Glu Leu Val Arg Pro Nsp V Xba Pst Xhol Sph Kpn Hind III
83. rmed to have a white phenotype on restreaked plates containing Bluo gal and IPTG inoculate a liquid culture containing 50 ug ml kanamycin 7 ug ml gentamicin and 10 ug ml tetracycline Isolate recombinant bacmid DNA using the procedure provided on the next page for analysis You may also use the procedure for the PureLink HiPure Plasmid Maxiprep Kit provided in the Appendix page 54 for increased recombinant bacmid yield Analyze the recombinant bacmid DNA to verify successful transposition to the bacmid We recommend using PCR to analyze your bacmid DNA see Analyzing Recombinant Bacmid DNA by PCR page 26 for details Note It is possible to verify successful transposition to the bacmid by using agarose gel electrophoresis to look for the presence of high molecular weight DNA This method is less reliable than performing PCR analysis as high molecular weight DNA can be difficult to visualize 23 Isolating Recombinant Bacmid DNA Introduction Before Starting Equilibrating the Column Preparing the Cell Lysate Binding and Washing the DNA 24 The PureLink HiPure Plasmid DNA Miniprep Kit allows you to purify high quality Bacmid DNA from DH10Bac E coli see page vii for ordering information The isolated bacmid DNA is suitable for use in insect cell transfections Note We do not recommend the PureLink HiPure Precipitator Module or the PureLink HiPure Plasmid Filter Mini Midi Maxiprep Kits for isola
84. s may be cultured under serum free conditions We recommend using Sf 900 II SFM or Sf 900 III SFM available from Invitrogen see page viii for ordering information Both Sf 900 II SFM and Sf 900 III SFM are protein free media optimized for the growth and maintenance of Sf9 and Sf21 cells and for large scale production of recombinant proteins expressed using the Bac to Bac System For more information see our website www invitrogen com or call Technical Support see page 66 For guidelines and detailed information on insect cell culture refer to the Guide to Baculovirus Expression Vector Systems BEVS and Insect Cell Culture Techniques This guide is available on our website at www invitrogen com or by contacting Technical Support see page 66 and contains information on e Maintaining and passaging insect cells in adherent and suspension culture e Freezing cells e Using serum free medium includes protocols to adapt cells to serum free medium e Scaling up cell culture Continued on next page General Guidelines continued General Insect cells are very sensitive to environmental factors In addition to chemical Guidelines and nutritional culture factors physical factors can also affect insect cell growth and optimization is required to maximize cell growth Consider the following when culturing insect cells e Temperature The optimal range to grow and infect cultured insect cells is 27 C to 28 C e pH A ra
85. sed with pFastBac 1 2300 bp size of your insert Bacmid transposed with pFastBac Gus 4200 bp Bacmid transposed with pFastBac HT 2430 bp size of your insert Bacmid transposed with pFastBac HT CAT 3075 bp Bacmid transposed with pFastBac Dual 2560 bp size of your insert Bacmid transposed with pFastBac Dual Gus CAT 5340 bp If you have used a combination of the pUC M13 Forward or Reverse primer and a gene specific primer for amplification you will need to determine the expected size of your PCR product Refer to the diagram on page 26 to help you calculate the expected size of your PCR product Producing Recombinant Baculovirus Transfecting Insect Cells Introduction Plasmid Preparation Transfection Method Cellfectin II Reagent Insect Cell Lines Media for Transfection Once you have confirmed that your recombinant bacmid contains the gene of interest you are ready to transfect insect cells to produce recombinant baculovirus Guidelines and instructions to transfect insect cells are provided in this section You may use any method to prepare purified recombinant bacmid DNA for transfection Bacmid DNA must be clean and free from phenol and sodium chloride as contaminants may kill the cells and salt will interfere with lipid complexing decreasing transfection efficiency We recommend isolating bacmid DNA using the PureLink HiPure Plasmid Miniprep Kit see page vii for ordering information or t
86. suitable medium Calculate the number of Sf9 or Sf21 cells that you will need for your transfection experiment and expand cells accordingly Make sure your cells are healthy with greater than 95 viability and are growing in the logarithmic phase with a density of 1 5 x 1062 5 x 10 cells ml before proceeding to transfection We generally produce baculoviral stocks in Sf9 or Sf21 cells using the following transfection conditions Note that these conditions should be used as a starting point for your transfection To obtain the highest transfection efficiency and low non specific effects you may optimize transfection conditions by varying DNA and Cellfectin II Reagent concentrations and cell density Condition Amount Tissue culture plate size 6 well 35 mm plate one well bacmid Number of Sf9 or Sf21 cells to transfect 8 x 10 cells Amount of bacmid DNA 1 ug can vary from 1 to 2 ug Amount of Cellfectin II Reagent 8 ul can vary from 1 5 to 9 ul Note This procedure is for insect cells in a 6 well format All amounts and volumes are given on a per well basis Continued on next page Transfecting Insect Cells continued Important Guidelines for Transfection Transfection Procedure Use Grace s Insect Cell Culture Medium Unsupplemented to seed all cells in plate for Sf9 and Sf21 cells grown in Grace s Insect Cell Culture Medium Supplemented with 10 FBS With Cellfectin II
87. t from a pFastBac donor plasmid to the mini attTn7 attachment site on the bacmid The Tn7 transposition functions are provided by a helper plasmid see below DH10Bac E coli also contain the helper plasmid pMON7124 13 2 kb which encodes the transposase and confers resistance to tetracycline The helper plasmid provides the Tn7 transposition function in trans Barry 1988 Continued on next page The Bac to Bac Baculovirus Expression System continued Diagram of the Bac to Bac System System pFastBac donor plasmid Clone Gene of Interest Gene of Interest 22 Tn7L Tn7R X 2 Transformation Ime Recombinant Donor Plasmid f V4 Ve lacZ mini attTn7 Competent DH10Bac E coli Cells Transposition y Antibiotic Selection The figure below depicts the generation of recombinant baculovirus and the expression of your gene of interest using the Bac to Bac Baculovirus Expression Foreign Gene O Pe E coli LacZ Containing Recombinant Bacmid Mini prep of High Molecular Weight DNA uc Determine Viral Titer by Plaque Assay Infection of Insect Cells OOoOoO0OoOOOOOO Y Recombinant Gene Expression or Viral Amplification Recombinant Baculovirus Particles MUT OoOoOoooooooo Insect Cells with Transfection of Cellfectin Il Reagent Recombinant Bacmid DNA Experimental Outline Flow Chart
88. t of the product No warranty is granted for products beyond their listed expiration date No warranty is applicable unless all product components are stored in accordance with instructions Invitrogen reserves the right to select the method s used to analyze a product unless Invitrogen agrees to a specified method in writing prior to acceptance of the order Invitrogen makes every effort to ensure the accuracy of its publications but realizes that the occasional typographical or other error is inevitable Therefore Invitrogen makes no warranty of any kind regarding the contents of any publications or documentation If you discover an error in any of our publications please report it to our Technical Support Representatives Invitrogen assumes no responsibility or liability for any special incidental indirect or consequential loss or damage whatsoever The above limited warranty is sole and exclusive No other warranty is made whether expressed or implied including any warranty of merchantability or fitness for a particular purpose Purchaser Notification Introduction Information for European Customers Limited Use Label License No 5 Invitrogen Technology Limited Use Label License No 21 Bac to Bac and Bac to Bac HT Use of the Bac to Bac Baculovirus Expression System and the Bac to Bac vectors is covered under the licenses detailed below TM The DH10Bac strain is genetically modified and carries the
89. the pFastBac baculoviral stock to each well at the desired MOI Include the appropriate controls e 2 mock infected uninfected cells pFastBac positive control baculovirus previously characterized recombinant baculoviruses Incubate cells in a 27 C humidified incubator Harvest cells or media if the recombinant protein is secreted at the appropriate time i e 24 48 72 96 hours post infection If harvesting cells remove the media and rinse the cells once with serum free medium 6 Lyse the cells with 400 ul of 1X SDS PAGE Buffer 62 5 mM Tris HCl pH 6 8 2 SDS 7 Freeze samples at 20 C or boil samples for at least 3 minutes and separate proteins by SDS PAGE You may use any method of choice to detect your recombinant protein of interest including functional analysis or western blot If you perform western blot analysis you will need to have an antibody to your protein of interest Continued on next page Expressing Your Recombinant Protein continued Note Assay for p glucuronidase Assay for CAT Protein Purifying Recombinant Protein Removing the N Terminal Fusion Tag Using TEV Protease If you have cloned your gene of interest in frame with the 6xHis tag in pFastBac HT the presence of the N terminal 6xHis tag and the recognition site for the ACTEV Protease will increase the size of your protein by at least 3 kDa TM If you include the baculoviral control created using the pFast
90. ting bacmid DNA e Inoculate a single white bacterial colony into 2 ml LB medium with 50 ug ml kanamycin 7 ug ml gentamicin and 10 ug ml tetracycline Incubate the culture at 37 C in a shaking water bath at 250 rpm overnight e Verify that RNase A is added to the Resuspension Buffer R3 and that the Lysis Buffer L7 contains no precipitates Place the PureLink HiPure Mini column on the PureLink Nucleic Acid Purification Rack see the manual supplied with the rack for more details Apply 2 ml Equilibration Buffer EQ1 to the column Allow the solution in the column to drain by gravity flow 1 Harvest 1 5 ml bacterial cells by centrifuging at 9 000 x g for 15 minutes Remove all medium 2 Add 0 4 ml Resuspension Buffer R3 containing RNase A to the pellet and resuspend the cells until homogeneous Transfer cell suspension to a centrifuge tube 3 Add 0 4 ml Lysis Buffer L7 Mix gently by inverting the capped tube five times Do not vortex Incubate at room temperature for 5 minutes 4 Add 0 4 ml Precipitation Buffer N3 and mix immediately by inverting the capped tube until the mixture is homogeneous Do not vortex 5 Centrifuge the mixture at 215 000 x g at room temperature for 10 minutes Note If the pellet does not adhere to the bottom of the tube incubate the tube at room temperature for 5 minutes to allow the separation of the lysate and gelatinous pellet Pipette the clear lysate into a sterile tube a
91. ual Gus CAT Supplied 20 ul at 0 5 ug pl in TE pH 8 0 10 ug total Supplied 20 ul at 0 2 ng pl in TE pH 8 0 4 ng total TE buffer pH 8 0 10 mM Tris HCl 1 mM EDTA pH 8 0 MAX Efficiency MAX Efficiency DH10Bac Chemically Competent E coli are supplied with the DH10Bac Bac to Bac Baculovirus Expression System only and include the following items Competent E coli Transformation efficiency is 1 x 10 cfu ng DNA Store at 80 C Reagents Item Composition Amount MAX Efficiency Chemically 5 x 100 ul Competent DH10Bac pUC19 Control DNA 10 pg ul in 5 mM Tris HCl 100 pl 0 5 mM EDTA pH 8 Genotype of F mcrA A mrr hsdRMS mcrBC 80lacZAM15 AlacX74 recA1 endA1 araD139 A ara DH10Bac leu 7697 galU galK 2 rpsL nupG bMON14272 pMON7124 Cellfectin Il Cellfectin II Reagent is supplied with the Bac to Bac Baculovirus Expression Transfection System only Reagent Amount supplied 1 ml vi Composition 1 mg ml transfection reagent in membrane filtered water Storage conditions 4 C Accessory Products Additional Products All of the reagents supplied in the Bac to Bac Baculovirus Expression System as well as other products suitable for use with the Bac to Bac System are available separately from Invitrogen Ordering information for these reagents is provided below
92. um Add 20 ml of heat inactivated FBS to the 100 ml bottle of Grace s Insect Medium 2X and mix Combine 25 ml of the Grace s Insect Medium 2X containing serum with 12 5 ml of cell culture grade sterile distilled water and 12 5 ml of the melted 4 Agarose Gel in the empty 100 ml bottle and mix gently 4 Return the bottle of plaquing medium to the 40 C water bath until use Continued on next page Performing a Viral Plaque Assay continued Plaque Assay Procedure Use the procedure below to perform a plaque assay in 6 well plate format to determine the titer of your pFastBac baculoviral stock If you have generated a baculoviral stock of the pFastBac expression control pFastBac Gus we recommend titering this stock as well Remember to include a negative control no virus in your experiment Note The amounts provided in this procedure are suitable to titer one baculoviral stock two 6 well plates per viral stock If you wish to titer more than one baculoviral stock scale up the reagent quantities accordingly 1 On the day of infection harvest Sf9 or Sf21 cells and prepare a 30 ml cell suspension at 5 x 10 cells ml in Sf 900 II SFM or other complete growth medium Aliquot 2 ml of cell suspension into each well of two 6 well plates If you are including a negative control you will need another 6 well plate 2 Allow the cells to settle to the bottom of the plate and incubate covered at room temperature for 1 hour
93. use 1 tube of competent cells for every transformation e pUCI supplied with the MAX Efficiency DH10Bac E coli use as a control for transformation if desired e LB agar plates containing kanamycin gentamicin tetracycline Bluo gal and IPTG 3 plates for each transformation use freshly prepared plates see recommendation below e LB agar plate containing 100 ug ml ampicillin for plating pUC19 transformation control e S O C Medium see page vii e 15 mlround bottom polypropylene tubes e 42 C water bath e 37 C shaking and non shaking incubator You will need to prepare LB agar plates containing 50 pg ml kanamycin 7 ug ml gentamicin 10 ug ml tetracycline 100 ug ml Bluo gal and 40 ug ml IPTG to select for DH10Bac transformants See page vii to order antibiotics Bluo gal and IPTG and page 53 for instructions to prepare plates If you are preparing LB plates using a pre mixed formulation we recommend using Luria Broth Base instead of Lennox L LB Using Lennox L plates will reduce the color intensity and may reduce the number of colonies obtained Note Use Bluo gal instead of X gal for blue white selection Bluo gal generally produces a darker blue color than X gal For each transformation you will need one vial of competent cells and three selective plates e Equilibrate a water bath to 42 C e Warm selective plates at 37 C for 30 minutes e Warm the S O C Medium to room temperature e Pre chil
94. utic diagnostic or prophylactic purposes or 4 resale of the product or its components whether or not such product or its components are resold for use in research Invitrogen Corporation will not assert a claim against the buyer of infringement of patents owned or controlled by Invitrogen Corporation which cover this product based upon the manufacture use or sale of a therapeutic clinical diagnostic vaccine or prophylactic product developed in research by the buyer in which this product or its components was employed provided that neither this product nor any of its components was used in the manufacture of such product If the purchaser is not willing to accept the limitations of this limited use statement Invitrogen is willing to accept return of the product with a full refund For information on purchasing a license to this product for purposes other than research contact Licensing Department Invitrogen Corporation 5791 Van Allen Way Carlsbad California 92008 Phone 760 603 7200 Fax 760 602 6500 Email outlicensing invitrogen com This product is the subject of U S Patent No 5 348 886 This product is sold under patent license from Monsanto for research purposes only and no license for commercial use is included Requests for licenses for commercial manufacture or use should be directed to Director Monsanto Corporate Research 800 N Lindbergh St Louis Missouri 63167 Continued on next page 67 Purchaser Notificat
95. yeast extract and 10 g NaCl in 950 ml deionized water 2 Adjust the pH of the solution to 7 0 with NaOH and bring the volume up to 1 liter 3 Autoclave on liquid cycle for 20 minutes Allow solution to cool to 55 C and add antibiotic if needed 4 Store at room temperature or at 4 C Follow the procedure below to prepare LB agar plates 1 2 3 4 Prepare LB medium as above but add 15 g liter agar before autoclaving Autoclave on liquid cycle for 20 minutes After autoclaving cool to 55 C add antibiotic s and pour into 10 cm plates Let harden then invert and store at 4 C in the dark Plates containing antibiotics are stable for up to 4 weeks TM LB agar selective plates for DH10Bac transformation 1 2 Follow Steps 1 2 in the procedure above After autoclaving cool to 55 C and add the following e 50 ug ml kanamycin e 7 ug ml gentamicin e 10 ug ml tetracycline e 100 pg ml Bluo gal e 40 ug ml IPTG Let harden then invert and store at 4 C in the dark Tetracycline and Bluo gal are light sensitive so make sure that plates are stored protected from light 53 Bacmid DNA Isolation Using PureLink HiPure Maxiprep Kit Introduction Growing Bacmid DNA Stock 54 After you have transformed your pFastBac construct containing your gene of interest into the appropriate competent E coli and performed the transposition reaction use the PureLink HiPure Plasmid Maxiprep Kit to puri

Download Pdf Manuals

Related Search

Related Contents

Mode d`emploi  Philips 55PFG6519 55" Full HD 3D compatibility Smart TV Wi-Fi White    xdb-manual-search-photography 2  User Guide for Intrastat Offline application - Version 1 -  Digitus Slimbag Muscle Beach  TELECAMERA DAY & NIGHT CON ZOOM 22X (cod  Manual del usuario del monitor INTELIGENTE Todo en uno  Manual do proprietário  Ratón láser Nano para laptop Guía del usuario  

Copyright © All rights reserved. Failed to retrieve file