Home

TruSeq Stranded Total RNA Sample Preparation Guide 15031048 E

1. When indexing libraries with the RAP arrange samples that will be pooled together in the same orientation as the indices in the RAP 3 6 Part 15031048 Rev E ly NOTE When indexing libraries with the RAP Review Handling Adapter Plate in the TruSeq Sample Preparation Pooling Guide part 15042173 See Additional Resources on page 10 for information on how to download the guide from the Illumina website Illumina recommends that the RAP does not undergo more than four freeze thaw cycles To maximize the use of the RAP process more than 24 samples at a time These samples can then be pooled in any supported configuration Stop Ligation Buffer NOTE k Do not remove the Ligation Mix tube from 15 C to 25 C storage until instructed to do so in the procedures sJo1depy oe1e6r Ligation Control Igy NOTE The use of the Ligation Control is optional and it can be replaced with the same volume of Resuspension Buffer Remove the Resuspension Buffer from 2 C to 8 C storage and bring it to room temperature Remove the AMPure XP Beads from storage and let stand for at least 30 minutes to bring them to room temperature Review Best Practices for Handling Magnetic Beads See Additional Resources on page 10 for information on how to access TruSeq Stranded Total RNA Sample Preparation Best Practices on the Illumina website Pre heat the thermal cycler to 30 C Choose the thermal cycler pre heat lid option and set to 100 C Appl
2. FFPE 20 23 58 60 116 119 first strand cDNA 2 fragmentation time 116 FSA 25 63 G GRM 18 56 H help technical 127 m Sample HS 4 HSP 4 IEM 11 IMP 66 in line control DNA 8 Incubate 1 ALP 34 72 Incubate 1 BRP 21 59 Incubate 1 DFP 24 62 Incubate 2 ALP 39 77 Incubate 2 DFP 26 65 Incubate 3 DFP 30 68 index adapter 2 indexed adapter 111 112 L LIG 35 73 Low Sample LS 4 125 Index 126 IM Make BRP 20 58 Make DCT 49 89 Make PCR 44 83 Make PDP vii 50 89 Make RRP 21 59 micro plate shaker 4 microheating system 4 MIDI 4 mRNA Denaturation 21 59 p PCR 3 35 73 PDP 48 88 PMM 42 81 pooled sample volumes 50 90 pos guidelines 11 PC 42 81 Q quality control 46 86 quantify libraries 46 86 R RAP 35 73 RBB 18 56 RCP 19 57 Reagent Reservoirs 19 25 28 32 36 43 57 63 66 70 74 82 Ribo Zero 2 17 18 21 55 56 58 96 100 105 RNA Adapter Indices 35 73 RNAClean XP Beads 19 57 RRB 19 56 RRM 18 56 RRM G 18 56 RRM P 18 56 RRP 19 57 RSB 18 28 32 35 42 56 66 70 73 81 S SAV 8 9 second strand cDNA 2 SMM 28 66 SIL 35 73 strip tubes and caps 19 25 28 32 36 42 57 63 66 70 74 82 SuperScript II 25 63 T technical assistance 127 thermal cycler 4 total RNA 2 Training 10 Tris HCl 48 88 TSP1 42 49 81 88 U ultra pure water 19 57 W workflow diagram 16 54 Part 15031048 Rev E Technic
3. NOTE E Leave the CAP plate on the magnetic stand while performing the following 80 EtOH wash steps 27 29 With the CAP plate on the magnetic stand add 200 ul freshly prepared 8076 EtOH to each well Take care not to disturb the beads Incubate the CAP plate at room temperature for 30 seconds and then remove and discard all of the supernatant from each well Take care not to disturb the beads Repeat steps 27 and 28 one time for a total of two 80 EtOH washes With the CAP plate on the magnetic stand let the samples air dry at room temperature for 15 minutes Remove the CAP plate from the magnetic stand Add 22 5 ul Resuspension Buffer to each well of the CAP plate Mix thoroughly as follows a Seal the CAP plate with a Microseal B adhesive seal b Shake the CAP plate on a microplate shaker at 1800 rpm for 2 minutes TruSeq Stranded Total RNA Sample Preparation Guide Fi Q sJo1depy e1e6r High Sample HS Protocol 80 33 34 35 36 37 Incubate the CAP plate at room temperature for 2 minutes Centrifuge the CAP plate to 280 x g for 1 minute Remove the adhesive seal from the CAP plate Place the CAP plate on the magnetic stand at room temperature for 5 minutes or until the liquid is clear Transfer 20 ul supernatant from each well of the CAP plate to the corresponding well of the new HSP plate labeled with the PCR barcode Take care not to disturb the beads SAFESTOPPING POINT If you do not plan to proc
4. 15 C to 25 C Ribo Zero Globin part 15035751 Slot Reagent Part Description Storage Temperature 1 2 15031737 rRNA Binding Buffer 15 C to 25 C 3 4 15037137 Globin Removal Mix 15 C to 25 C 5 6 15026780 Elution Buffer 2 C to 8 C 7 8 15029211 Elute Prime Fragment High Mix 15 C to 25 C Part 15031048 Rev E Consumables and Equipment Check to make sure that you have all of the necessary user supplied consumables and equipment before starting the TruSeq Stranded Total RNA Sample Preparation protocol The requirement for some supplies is dependent upon the protocol performed LS or HS and these items are specified in separate tables Table 11 User Supplied Consumables Consumable Supplier 1 5 ml RNase DNase free Life Technologies non sticky tubes part AM12450 10 ul barrier pipette tips General lab supplier 10 ul multichannel pipettes General lab supplier 10 ul single channel pipettes General lab supplier 1000 ul barrier pipette tips General lab supplier 1000 ul multichannel pipettes General lab supplier 1000 ul single channel pipettes General lab supplier 200 ul barrier pipette tips General lab supplier 200 ul multichannel pipettes General lab supplier 200 ul single channel pipettes General lab supplier 96 well storage plates round well Fisher Scientific 0 8 ml MIDI plate 96 well 2 ml deep well plates Optional to aliquot reagents Agencourt AMPure XP 60 ml kit TruSeq
5. depending on the adapter type used If using the RNA Adapter tubes add 50 ul of the mixed AMPure XP Beads to each well of the new MIDI plate labeled with the CPP barcode If using the RAP add 47 5 ul of the mixed AMPure XP Beads to each well of the new MIDI plate labeled with the CPP barcode 4 Transfer the entire contents from each well of the PCR plate to the corresponding well of the CPP plate containing 50 ul of mixed AMPure XP Beads Mix thoroughly as follows a Seal the CPP plate with a Microseal B adhesive seal b Shake the CPP plate on a microplate shaker at 1800 rpm for 2 minutes 5 Incubate the CPP plate at room temperature for 15 minutes 6 Centrifuge the CPP plate to 280 x g for 1 minute 7 Remove the adhesive seal from the CPP plate 8 Place the CPP plate on the magnetic stand at room temperature for 5 minutes or until the liquid is clear 9 Remove and discard 95 ul supernatant from each well of the CPP plate E NOTE Leave the CPP plate on the magnetic stand while performing the following 80 EtOH wash steps 10 12 10 With the CPP plate on the magnetic stand add 200 yl freshly prepared 80 EtOH to each well without disturbing the beads 11 Incubate the CPP plate at room temperature for 30 seconds and then remove and discard all of the supernatant from each well 12 Repeat steps 10 and 11 one time for a total of two 80 EtOH washes 84 Part 15031048 Rev E 13 14 15 16 17 18 19 With the CPP
6. terms and conditions and in accordance with this Product s Documentation and Specifications infringes the valid and enforceable intellectual property rights of a third party and ii pay all settlements entered into and all final judgments and costs including reasonable attorneys fees awarded against Purchaser in connection with such infringement claim If this Product or any part thereof becomes or in Illumina s opinion may become the subject of an infringement claim Illumina shall have the right at its option to A procure for Purchaser the right to continue using this Product B modify or replace this Product with a substantially equivalent non infringing substitute or C require the return of this Product and terminate the rights license and any other permissions provided to Purchaser with respect this Product and refund to Purchaser the depreciated value as shown in Purchaser s official records of the returned Product at the time of such return provided that no refund will be given for used up or expired Consumables This Section states the entire liability of Illumina for any infringement of third party intellectual property rights Exclusions to Illumina Indemnification Obligations Illumina has no obligation to defend indemnify or hold harmless Purchaser for any Illumina Infringement Claim to the extent such infringement arises from i the use of this Product in any manner or for any purpose outside the scope of research use p
7. C to 8 C 15029211 Elute Prime Fragment High Mix 15 C to 25 C TruSeq Stranded Total RNA Sample Preparation Guide 1 01 S1U91UO2 YM Supporting Information Ribo Zero Globin part 15035750 Slot Reagent Part Description Storage Temperature 1 RBB 15031737 rRNA Binding Buffer 15 C to 25 C 2 15 C to 25 C 3 PC to FC 4 Elute Prime Fragment High Mix 15 C to 25 C 48 Samples cDNA Synthesis PCR Box Store at 15 C to 25 C This box is shipped on dry ice As soon as you receive it store the following components at 15 C to 25 C Figure 16 TruSeq Stranded Total RNA LT Sample Prep Kit 48 Samples cDNA Synthesis PCR Box part 15032611 Slot Reagent Part Description 2 15031748 PCR Primer Cocktail 3 15031094 First Strand Synthesis Act D Mix 4 15031098 Second Strand Marking Master Mix TruSeq Stranded Total RNA HT Sample Prep Kit The TruSeq Stranded Total RNA HT Sample Prep Kit contains five boxes a core reagent box a cDNA Synthesis PCR box an Adapter Plate box and a Box 1 and Box 2 1 02 Part 15031048 Rev E 96 Samples Core Box Store at 15 C to 25 C This box is shipped on dry ice As soon as you receive it store the following components at 15 C to 25 C Figure 17 TruSeq Stranded Total RNA HT Sample Prep Kit 96 Samples Core Box part 15032620 O o e UU UU Pa 000000 Slot Reagent Part Description 12 15026770 Resuspensio
8. Plate for pooling only 96 well MIDI plates 96 well 0 3 ml PCR plate for pooling only if pooling 40 samples Microseal B Adhesive Seals Tris HCl 10 mM pH8 5 with 0 196 Tween 20 48 Quantity 1 label per plate 2 second plate for pooling only if pooling gt 40 samples 1 p Enough to normalize the concentration of each sample library to 10 nM Storage 15 C to 30 C ISAC to HOKE 15 C to 30 C TIS re SUE 15 C to 30 C Supplied By Illumina User User User User Part 15031048 Rev E Preparation Remove the TSP1 plate from 15 C to 25 C storage if it was stored at the conclusion of Clean Up PCR on page 44 Let it thaw at room temperature Centrifuge the thawed TSP1 plate to 280 x g for 1 minute Remove the adhesive seal from the thawed TSP1 plate Apply a DCT barcode label to a new 96 well MIDI plate For pooling only Apply a PDP barcode label to a new 96 well 0 3 ml PCR plate if pooling x 40 samples or a 96 well MIDI plate if pooling gt 40 samples Make DCT 1 Transfer 10 ul of sample library from each well of the TSP1 plate to the corresponding well of the new MIDI plate labeled with the DCT barcode 2 Normalize the concentration of sample library in each well of the DCT plate to 10 nM using Tris HCl 10 mM pH 8 5 with 0 176 Tween 20 1 NOTE Depending on the yield quantification data of each sample library the final volume in the DCT plate can vary f
9. RRP Added steps to transfer supernatant from RIP to SIP plate and incubate Initial Release Part 15031048 Rev E Table of Contents Revision History uusuuueusessssssss nnne Table of Contents o oooccccccccccccccccccccccccccccccncnnnncnccco List of Tables eee a a ea e e araea ni Chapter 1 Overview ooooooccccc ccoo coc n nn cccnccccccccccccnn Introduction 2 2 2 2 2 eee eee cece cece cece ecceececeeeeseeeeees Protocol Features _ 2 2 eee eee cee eee cc cece ceeceeeceeees RNA Input Recommendations In Line Control DNA sess rIsII Chapter 2 Low Sample LS Protocol INTOGUCTION Em Sample Prep Workflow 22222 2 22222 e eee eeeeeeeeeeee Ribo Zero Deplete and Fragment RNA Synthesize First Strand cDNA o 222222 222222 eee Synthesize Second Strand cDNA 22222222 22 22222 Adenylate 3 Ends occ cnn eee eee Ligate Adapters 2 22 2 eee cece e cece ee sees Enrich DNA Fragments 2 2 eee cece cece cece eee Validate Library o 222 2222 eee Chapter 3 High Sample HS Protocol Introduction sssuuuuuseuseeeeeeeeeee ee Renee Sample Prep Workflow ssec Ribo Zero Deplete and Fragment RNA Synthesize First Strand cDNA eeeeee eee Synthes
10. RSB rRNA Binding Buffer RBB rRNA Removal Beads RRB Quantity 1 tube per 48 reactions 1 tube per 48 reactions 1 tube per 48 reactions 1 tube 1 tube per 48 reactions 1 tube per 48 reactions Storage 15 C to 25 C AE URAC 15 C to 25 C 15 C to 25 C 15 C to 25 C 2 C to 8 C Supplied By Illumina Illumina Illumina Illumina Illumina Illumina Part 15031048 Rev E U Item Quantity Storage Supplied By O O Barcode labels for 1 label per plate 15 C to 30 C Ilumina I BRP Bind rRNA Plate N e DFP Depleted RNA Fragmentation Plate O e RCP RNA Clean Up Plate U RRP rRNA Removal Plate D oO 96 well HSP Plates 2 IC tt SOC User o e 96 well MIDI Plates 2 15 C to 30 C User O Freshly Prepared 70 Ethanol 200 ul per sample ISAC tio SOC User EtOH o Microseal B Adhesive Seals 5 15 C to 30 C User TI lt RNAClean XP Beads 99 ul per sample AC MOE User a RNase DNase free Eight Tube 6 15 C to 30 C User 3 Strips and Caps D if using multichannel pipettes pm RNase DNase free Reagent 6 15 to 30 C User JJ Reservoirs Z if using multichannel pipettes D Ultra Pure Water Enough to dilute 15 C to 30 C User each total RNA sample to a final volume of 10 ul Preparation Remove the following from 15 C to 25 C storage and thaw them at room temperature Elute Prime Fragment High Mix One of the following depending on the kit you are usi
11. Stranded Total RNA Sample Preparation Guide part AB 0859 Thomson Instrument Company part 951652 Beckman Coulter Genomics part A63881 107 jueuudinb4 pue se qeuunsuo Supporting Information 108 Consumable Agencourt RNAClean XP 40 ml kit Agilent RNA 6000 Nano Kit or Agilent RNA 6000 Pico Kit Optional for alternative fragmentation only Ethanol 200 proof absolute for molecular biology 500 ml Microseal B adhesive seals MicroTube 6x16mm AFA fiber with crimp cap Optional for alternative fragmentation only MinElute Gel Extraction Kit Optional if starting with previously isolated mRNA Nuclease free ultra pure water RNaseZap to decontaminate surfaces RNase DNase free eight tube strips and caps RNase DNase free multichannel reagent reservoirs disposable SuperScript II Reverse Transcriptase Tris HCl 10 mM pH8 5 Tween 20 Supplier Beckman Coulter Genomics part A63987 Agilent Technologies part 5067 1511 or part 5067 1513 Sigma Aldrich part E7023 Bio Rad part MSB 1001 Covaris part 4 520052 QIAGEN part 4 28604 General lab supplier General lab supplier General lab supplier VWR part 89094 658 Invitrogen part 18064 014 General lab supplier Sigma part P7949 Table 12 User Supplied Consumables Additional Items for LS Processing Consumable 96 well 0 3 ml PCR plates Supplier General lab supplier Part
12. TAAGAT TACT TGATCCACTGATTCAACGTACCGTAACGAAC ACGAAAAGAATGATAACAGTAACACACT TCTGTTAACCTTAAGAT TACTTGATCCACTGATTCAACGTACCGTAAAGATTACTTGATCCACTGAT TCAACGTACCGTAACGAACGTATCAAT TGAGAC TAAATATTAACGTACCAT TAAGAGCTACCGT AATGATAACAG TAACACACT TCTGTTAACCTTAAGATTACTTGATCCACTGAT TCAACGTACCGTAACGAACG TATCAAT TGAGACTAAATATTAACGTA a AAGATTACTTGATCCACTGATTCAACGTA AAT TGAGACTAAATAT TAACGTTGTTAACCTTAAGATTACTTGATCCACTGAT TCAACG TACCGTAACGAACG TATCAATTGAGACTAAATATTAACGTACCAT TAAGAGCT TCTGT TAACCT TAAGAT TACTTGATCCACTGAT TCAACGTACCGTAAC CGTATGAAT GAGACTAAATAT TAACGTACLIAACG TARGA TACT GATCCAGTGAT T CAACGTACOQTAACGAAOGTO TTCTGT TAAGC TIAAG TTAC T IGT CCACTGAT TOMOGTACOSTACGAACO TATGAAT GAGACTAACGACGANS GAGACTAAATAT TAACGTACCAT TAAGAGCTACAACCTTAAGA BEC SE SEES DO ne TCAAT TGAGACTAAATAT TAACG TACCAT TAAGAGCTACCGTGCAACGACGAAAAGAAT GA EE AATGATAACAGTAACACACT TCTGTTAACCTTAAGAT TACT TGATCCACTGAT TCAACGTACCG TAACGAACG TA AT ACA APTA LTRAC QUA CAT DAC TACCOTOTIOTO TAAGO AGAT TAG SATUS AACG GTACCAT ITAAGAGCTACCGTGCAACT TAACCT TAAGAT TAC T TGAT CCACTGATTCAACGTACCGTAACGAACGTATCAAT T GAGAC TAAA AT TA CA AC TTAACATIACTIGATCC ES ee ana AACCTTAAGATTACTTGATCCACTGATTCAACGTACTTCTGTTAACCTTAAGAT TACTTGATCCAC GAAAAGAATGATAA ACGAAAAGAATGATAACAG TAACACACTTCTGT TAACCT TAAGAT TACTTGATCCACTGAT TCAACGTACCGTAAAGAT TAC T T GAT C ITTAAGAGCTACCGT AATGATAACAGTAACACACTTCTGT TAACCTTAAGAT TACTTGATCCACTGAT TCAACGTACCGTAACGAACG TATCAAT TGAGACTA uM M LU IARE ESSO EUR CIT GAATGATAACA AATGATAACAGTAA
13. The base in parentheses indicates the base for the seventh cycle and is not considered as part of the index sequence Record the index in the sample sheet as only six bases For indices 13 and above the seventh base in parentheses might not be A which is seen in the seventh cyde of the index read For more information on the number of cycles used to sequence the index read reference your instrument user guide TruSeq Stranded Total RNA Sample Preparation Guide 1 1 1 seouenbes Je1depy pexepu Supporting Information Table 16 TruSeq Stranded Total RNA LT Sample Prep Kit Set A Indexed Adapter Sequences Adapter AR002 ARO004 ARO005 AR006 AR007 AR012 Sequence CGATGT A Adapter AR013 TGACCA A ARO14 GCCAAT A ARO16 CTIGTA A li AROI9 Sequence AGICAA C AGTTCC G ATGTCA G CECICE S GTCCGC A GIGAAA C Table 17 TruSeq Stranded Total RNA LT Sample Prep Kit Set B Indexed Adapter Sequences Adapter ARO001 ARO003 AR008 AR009 ARO10 ARO11 Sequence ATCACG A Adapter TTAGGC A H AR021 LONE M wem O s Sequence GTGGCC T GTTICG G CGTACG T GAGTGG A ACTGAT A ATTCCT T TruSeq Stranded Total RNA HT Sample Prep Kit Indexed Adapter Sequences The RAP in the TruSeq Stranded Total RNA HT Sample Prep Kit contains the following indexed adapter sequences 112 Part 15031048 Rev E y NOTE 7 The Index recorded in the sample sheet is the full 8 bas
14. User Remove the following from 15 C to 25 C storage and thaw them at room temperature A Tailing Control Igy NOTE The use of the A Tailing Control is optional and it can be replaced with the same volume of Resuspension Buffer A Tailing Mix 32 Part 15031048 Rev E Add ATL 1 2 Remove the Resuspension Buffer from 2 C to 8 C storage and bring it to room temperature Remove the ALP plate from 15 C to 25 C storage if it was stored at the conclusion of Clean Up DFP on page 30 Let it thaw at room temperature Centrifuge the thawed ALP plate to 280 x g for 1 minute Remove the adhesive seal from the ALP plate Pre program the thermal cycler with the following program and save as ATAIL70 Choose the pre heat lid option and set to 100 C 37 C for 30 minutes 70 C for 5 minutes Hold at 4 C Do one of the following If using the in line control reagent Centrifuge the thawed A Tailing Control tube to 600 x g for 5 seconds Dilute the A Tailing Control to 1 100 in Resuspension Buffer For example 1 ul A Tailing Control 99 ul Resuspension Buffer before use Discard the diluted A Tailing Control after use Add 2 5 ul of diluted A Tailing Control to each well of the ALP plate If not using the in line control reagent add 2 5 ul of Resuspension Buffer to each well of the ALP plate Add 12 5 ul of thawed A Tailing Mix to each well of the ALP plate Gently pipette the entire volume up and down 10 times to mix thorou
15. analysis on your sample library and quantification of the DNA library templates Quantify Libraries To achieve the highest quality data on Illumina sequencing platforms it is important to create optimum cluster densities across every lane of the flow cell Optimizing cluster densities requires accurate quantitation of DNA library templates Quantify your libraries using qPCR according to the Illumina Sequencing Library qPCR Quantification Guide part 11322363 Quality Control 46 1 Load 1 ul of the resuspended construct on an Agilent Technologies 2100 Bioanalyzer using a DNA specific chip such as the Agilent DNA 1000 2 Check the size and purity of the sample The final product should be a band at approximately 260 bp Figure 5 Example of TruSeq Stranded Total RNA Sample Preparation Library Size Distribution Part 15031048 Rev E Figure 6 TruSeq Stranded Total RNA Sample Preparation 260 bp PCR Product g E 3 g E 8 TruSeq Stranded Total RNA Sample Preparation Guide A7 Mesq e1epi eA Low Sample LS Protocol Normalize and Pool Libraries This process describes how to prepare DNA templates for cluster generation Indexed DNA libraries are normalized to 10 nM in the DCT plate and then pooled in equal volumes in the PDP plate DNA libraries not intended for pooling are normalized to 10 nM in the DCT plate Consumables Item Barcode labels for DCT Diluted Cluster Template PDP Pooled DCT
16. each well of the DFP plate Mix thoroughly as follows a Seal the DFP plate with a Microseal B adhesive seal b Shake the DFP plate on a microplate shaker continuously at 1600 rpm for 20 seconds Return the First Strand Synthesis Mix Act D tube to 15 C to 25 C storage immediately after use Part 15031048 Rev E Incubate 2 DFP 1 Place the sealed DFP plate on the pre programmed thermal cycler Close the lid and select Synthesize 1st Strand a b c d e Choose the pre heat lid option and set to 100 C 25 C for 10 minutes 42 C for 15 minutes 70 C for 15 minutes Hold at 4 C 2 When the thermal cycler reaches 4 C remove the DFP plate from the thermal cycler and proceed immediately to Synthesize Second Strand cDNA on page 66 TruSeq Stranded Total RNA Sample Preparation Guide 6 5 VNQ pueJig 18114 ZIS y U S High Sample HS Protocol Synthesize Second Strand cDNA 66 This process removes the RNA template and synthesizes a replacement strand incorporating dUTP in place of dTTP to generate ds cDNA The incorporation of dUTP quenches the second strand during amplification because the polymerase does not incorporate past this nucleotide AMPure XP beads are used to separate the ds cDNA from the second strand reaction mix At the end of this process you have blunt ended cDNA Consumables Item Optional End Repair Control CTE Resuspension Buffer RSB Second Strand Marking Master Mix S
17. it reaches 4 C and centrifuge briefly 3 Proceed immediately to Synthesize First Strand cDNA on page 25 2 A Part 15031048 Rev E Synthesize First Strand cDNA This process reverse transcribes the cleaved RNA fragments that were primed with random hexamers into first strand cDNA using reverse transcriptase and random primers The addition of Actinomycin D to the First Stand Synthesis Act D mix FSA prevents spurious DNA dependent synthesis while allowing RNA dependent synthesis improving strand specificity Consumables Item First Strand Synthesis Act D Mix FSA Microseal B Adhesive Seal RNase DNase free Eight Tube Strips and Caps if using multichannel pipettes RNase DNase free Reagent Reservoirs if using multichannel pipettes SuperScript II Reverse Transcriptase Quantity 1 tube per 48 reactions 1 1 1 tube Storage 15 C to 25 C JI C O SAS 15 C to 30 C IBC e SOC 15 C to 25 C Supplied By Illumina User User User User WARNING y First Strand Synthesis Act D Mix contains Actinomycin D a toxin Personal injury can occur through inhalation ingestion skin contact and eye contact Dispose of containers and any unused contents in accordance with the governmental safety standards for your region Refer to the product material safety data sheet MSDS for detailed environmental health and safety information MSDSs are available for this kit on the Illumin
18. of rRNA Binding Buffer to each well of the BRP plate Add 5 ul of one of the following reagents to each well of the BRP plate depending on the kit you are using Globin Removal Mix rRNA Removal Mix rRNA Removal Mix Gold rRNA Removal Mix Plant Part 15031048 Rev E Mix the contents of the BRP plate thoroughly as follows a Seal the BRP plate with a Microseal B adhesive seal b Shake the BRP plate on a microplate shaker continuously at 1600 rpm for 20 seconds Centrifuge the BRP plate to 280 x g for 1 minute Return the following to 15 C to 25 C storage rRNA Binding Buffer One of the following depending on the kit you are using Globin Removal Mix rRNA Removal Mix rRNA Removal Mix Gold rRNA Removal Mix Plant Incubate 1 BRP 1 Make RRP 1 3 Place the sealed BRP plate on the pre programmed thermal cycler Close the lid then select and run the RNA Denaturation program a Choose the pre heat lid option and set to 100 C b 68 C for 5 minutes After the 5 minute incubation place the BRP plate on the bench and incubate at room temperature for 1 minute Vortex the room temperature rRNA Removal Bead tube vigorously to resuspend the beads Add 35 ul of rRNA Removal Beads to each well of the new 96 well MIDI plate labeled with the RRP barcode NOTE It is important not to skip this step by adding beads to the sample in the BRP plate Adding the sample from the BRP plate to beads in the RRP
19. of the flow cell Optimizing cluster densities requires accurate quantitation of DNA library templates Quantify your libraries using qPCR according to the Illumina Sequencing Library qPCR Quantification Guide part 11322363 Quality Control 86 1 Load 1 ul of the resuspended construct on an Agilent Technologies 2100 Bioanalyzer using a DNA specific chip such as the Agilent DNA 1000 2 Check the size and purity of the sample The final product should be a band at approximately 260 bp Figure 10 Example of TruSeq Stranded Total RNA Sample Preparation Library Size Distribution Part 15031048 Rev E Figure 11 TruSeq Stranded Total RNA Sample Preparation 260 bp PCR Product g E 3 g E 8 TruSeq Stranded Total RNA Sample Preparation Guide 87 Mesq e1epi eA High Sample HS Protocol Normalize and Pool Libraries 88 This process describes how to prepare DNA templates for cluster generation Indexed DNA libraries are normalized to 10 nM in the DCT plate and then pooled in equal volumes in the PDP plate DNA libraries not intended for pooling are normalized to 10 nM in the DCT plate Consumables Item Barcode labels for DCT Diluted Cluster Template PDP Pooled DCT Plate for pooling only 96 well HSP Plate for pooling only 96 well MIDI Plate Microseal B Adhesive Seals Tris HCl 10 mM pHS8 5 with 0 1 Tween 20 Preparation Quantity 1 label per plate 1 5 Enough t
20. plate on the magnetic stand let the samples air dry at room temperature for 15 minutes and then remove the plate from the magnetic stand Add 32 5 ul Resuspension Buffer to each well of the CPP plate Mix thoroughly as follows a Seal the CPP plate with a Microseal B adhesive seal b Shake the CPP plate on a microplate shaker at 1800 rpm for 2 minutes Incubate the CPP plate at room temperature for 2 minutes Centrifuge the CPP plate to 280 x g for 1 minute Remove the adhesive seal from the CPP plate Place the CPP plate on the magnetic stand at room temperature for 5 minutes or until the liquid is clear Transfer 30 ul supernatant from each well of the CPP plate to the corresponding well of the new HSP plate labeled with the TSP1 barcode SAFESTOPPING POINT If you do not plan to proceed immediately to Validate Library on page 86 you can safely stop the protocol here If you are stopping seal the TSP1 plate with a Microseal B adhesive seal and store at 15 C to 25 C for up to 7 days TruSeq Stranded Total RNA Sample Preparation Guide 8 5 s juauBe14 vNG u9uu3 High Sample HS Protocol Validate Library Illumina recommends performing the following procedures for quality control analysis on your sample library and quantification of the DNA library templates Quantify Libraries To achieve the highest quality data on Illumina sequencing platforms it is important to create optimum cluster densities across every lane
21. seal from the ALP plate 2 Vortex the AMPure XP Beads for at least 1 minute or until they are well dispersed TruSeq Stranded Total RNA Sample Preparation Guide 4 T sJo1depy oe1e6r High Sample HS Protocol 78 N Oo OF q 10 11 12 13 14 15 16 17 Add 42 ul of mixed AMPure XP Beads to each well of the ALP plate Mix thoroughly as follows a Seal the ALP plate with a Microseal B adhesive seal b Shake the ALP plate on a microplate shaker at 1800 rpm for 2 minutes Incubate the ALP plate at room temperature for 15 minutes Centrifuge the ALP plate to 280 x g for 1 minute Remove the adhesive seal from the ALP plate Place the ALP plate on the magnetic stand at room temperature for 5 minutes or until the liquid is clear Remove and discard 79 5 ul supernatant from each well of the ALP plate Take care not to disturb the beads NOTE E Leave the ALP plate on the magnetic stand while performing the following 8076 EtOH wash steps 9 11 With the ALP plate on the magnetic stand add 200 ul freshly prepared 80 EtOH to each well without disturbing the beads Incubate the ALP plate at room temperature for 30 seconds and then remove and discard all of the supernatant from each well Take care not to disturb the beads Repeat steps 9 and 10 one time for a total of two 80 EtOH washes With the ALP plate on the magnetic stand let the samples air dry at room temperature for 15 minutes Remove the ALP plate f
22. sure that you have obtained all of the requisite equipment and consumables for the HS protocol TruSeq Stranded Total RNA Sample Preparation Guide 5 3 uononpoJiu High Sample HS Protocol Sample Prep Workflow The following illustrates the processes of the TruSeq Stranded Total RNA Sample Preparation HS protocol to prepare templates using 24 indexed adapter tubes or a RAP Figure 7 TruSeq Stranded Total RNA Sample Preparation HS Workflow Prepare for Pooling 0 1 1 ug Total RNA RiboZero Deplete and Fragment RNA Plates BRP DFP RCP RRP 1 Adenylate 3 Ends Consumablos ATL CTA Optional RSB Plate ALP 54 Ligate Adapters Consumables AMPure XP Beads CTL Optional EtOH uG RNA Adapters or RAP RSB s Pilates CAP PCR 1 PCR Amplification AMPure x P Beads 497 RBS 1 Validate Library 4 Normalize and Pool Libraries Consumables Tris HCI 10 mM w Tween 20 Plates DCT PDP indexing only Part 15031048 Rev E Hibo Zero Deplete and Fragment HNA This process depletes rRNA from total RNA After the rRNA is depleted the remaining RNA is purified fragmented and primed for cDNA synthesis It is important to follow this purification procedure exactly to be sure of reproducibility Reference the following diagram while performing the procedures Figure 8 TruSeq Stranded Total RNA Sample Preparation Purification Workflow Dilute Total RNA Add RBB and GRM RRM RRM G RRM P
23. there are no beads remaining The last 0 3 ml PCR plate will be the RCP plate used during Clean Up RCP 10 Return the rRNA Removal Beads to 2 C to 8 C storage 2 d Part 15031048 Rev E Clean Up RCP 1 j 10 11 12 13 Vortex the RNAClean XP beads until they are well dispersed then add 99 ul of well mixed RNAClean XP beads to each well of the RCP plate containing ribosomal depleted RNA Gently pipette the entire volume up and down 10 times to mix thoroughly NOTE If starting with degraded total RNA add 193 ul of well mixed RNAClean XP beads to each well of the RCP plate containing ribosomal depleted RNA Incubate the RCP plate at room temperature for 15 minutes Place the RCP plate on the magnetic stand at room temperature for 5 minutes to make sure that all of the beads are bound to the side of the wells Remove and discard all of the supernatant from each well of the RCP plate NOTE Leave the RCP plate on the magnetic stand while performing the following 70 EtOH wash steps 5 6 With the RCP plate on the magnetic stand add 200 ul freshly prepared 70 EtOH to each well without disturbing the beads Incubate the RCP plate at room temperature for 30 seconds and then remove and discard all of the supernatant from each well Let the RCP plate stand at room temperature for 15 minutes to dry and then remove the plate from the magnetic stand Centrifuge the thawed room temperature Elution Buffer to 600 x g f
24. to Indemnification Obligations The parties indemnification obligations are conditioned upon the party seeking indemnification i promptly notifying the other party in writing of such claim or action ii giving the other party exclusive control and authority over the defense and settlement of such claim or action iii not admitting TruSeq Stranded Total RNA Sample Preparation Guide V infringement of any intellectual property right without prior written consent of the other party iv not entering into any settlement or compromise of any such claim or action without the other party s prior written consent and v providing reasonable assistance to the other party in the defense of the claim or action provided that the party reimburses the indemnified party for its reasonable out of pocket expenses incurred in providing such assistance Third Party Goods and Indemnification Illumina has no indemnification obligations with respect to any goods originating from a third party and supplied to Purchaser Third party goods are those that are labeled or branded with a third party s name Purchaser s indemnification rights if any with respect to third party goods shall be pursuant to the original manufacturer s or licensor s indemnity Upon written request Illumina will attempt to pass through such indemnity if any to Purchaser Part 15031048 Rev E Hevision History Part Revision Date Description of Change 15031048 E October Clarified P
25. well of the DFP plate Gently pipette the entire volume up and down 6 times to mix thoroughly Seal the DFP plate with a Microseal B adhesive seal and centrifuge briefly Return the First Strand Synthesis Mix Act D tube to 15 C to 25 C storage immediately after use Incubate 2 DFP 26 Place the sealed DFP plate on the pre programmed thermal cycler Close the lid then select and run the Synthesize 1st Strand program a Choose the pre heat lid option and set to 100 C b 25 C for 10 minutes Part 15031048 Rev E 2 c 42 C for 15 minutes d 70 C for 15 minutes e Hold at 4 C When the thermal cycler reaches 4 C remove the DFP plate from the thermal cycler and proceed immediately to Synthesize Second Strand cDNA on page 28 TruSeqStranded Total RNA Sample Preparation Guide A T VNQG pUeJig 18414 9ZISSY UAS Low Sample LS Protocol Synthesize Second Strand cDNA This process removes the RNA template and synthesizes a replacement strand incorporating dUTP in place of dTTP to generate ds cDNA The incorporation of dUTP quenches the second strand during amplification because the polymerase does not incorporate past this nucleotide AMPure XP beads are used to separate the ds cDNA from the second strand reaction mix At the end of this process you have blunt ended cDNA Consumables Item Quantity Storage Supplied By Optional End Repair Control 1 tube per 48 15 C to 25 C Ilumina CTE reactions Resuspens
26. 15026640 15026645 15026770 15026774 15026775 15026776 Description Ligation Mix A Tailing Mix Stop Ligation Buffer AA AAA ADRAADRAA R NA Adapter Index 13 NA Adapter Index 14 NA Adapter Index 15 NA Adapter Index 16 NA Adapter Index 18 NA Adapter Index 19 NA Adapter Index 2 NA Adapter Index 4 NA Adapter Index 5 NA Adapter Index 6 NA Adapter Index 7 NA Adapter Index 12 esuspension Buffer End Repair Control A Tailing Control Ligation Control Part 15031048 Rev E Set B Figure 13 TruSeq Stranded Total RNA LT Sample Prep Kit 48 Samples 12 Index Set B part 15032613 Slot Reagent Part Description ATL 15012495 A Tailing Mix Stop Ligation Buffer 15024662 RNA Adapter Index 20 15024663 RNA Adapter Index 21 15024664 RNA Adapter Index 22 15024665 RNA Adapter Index 23 15024667 RNA Adapter Index 25 15024668 RNA Adapter Index 27 15026633 RNA Adapter Index 1 15026635 RNA Adapter Index 3 15026641 RNA Adapter Index 8 15026642 RNA Adapter Index 9 15026643 RNA Adapter Index 10 15026644 RNA Adapter Index 11 Resuspension Buffer Ligation Mix End Repair Control A Tailing Control Ligation Control XO CO N BD OT A WD N A Ria jaja ww N oO NN 0 N D a e TruSeq Stranded Total RNA Sample Preparation Guide 99 S1U91U02 YM Supporting Information 48 Samples Box 1 of 2 Store as specified This box is shipped on refrigerated gel pac
27. 15031048 Rev E Table 13 User Supplied Consumables Additional Items for HS Processing Consumable Supplier Microseal 96 well PCR plates Bio Rad part 4 HSP 9601 HSP plate Microseal A film Bio Rad part MSA 5001 Table 14 User Supplied Equipment Equipment Supplier 96 well thermal cycler General lab supplier with heated lid 2100 Bioanalyzer Desktop System Agilent part G2940CA Agilent DNA 1000 Kit Agilent part 5067 1504 Magnetic stand 96 Life Technologies part AM10027 Microplate centrifuge General lab supplier Vortexer General lab supplier Table 15 User Supplied Equipment Additional Items for HS Processing Consumable Supplier High Speed Microplate Shaker VWR catalog 13500 890 110 V 120 V or 14216 214 230 V MIDI plate insert for heating system Illumina catalog Note Two inserts are recommended BD 60 601 to support successive heating procedures Stroboscope General lab supplier TruSeq Stranded Total RNA Sample Preparation Guide 1 O 9 juaudinby pue se qeuunsuo Supporting Information TU Consumable Supplier Part 15031048 Rev E Indexed Adapter Sequences This section details the indexed adapter sequences TruSeq Stranded Total RNA LT Sample Prep Kit Indexed Adapter Sequences The TruSeq Stranded Total RNA LT Sample Prep Kit contains the following indexed adapter sequences NOTE i The index numbering is not contiguous There is no Index 17 24 or 26
28. AATTGAGACTAAATAT TAACG TACCAT TAAGAGC TACCGTGCAACGACGAAAAGAATGATAACAG TAACACACT TCTGTTAACCTT ACGAAAAGAATGATAACAG TAACACACT TCTGT TAACCT TAAGAT TACTTGATCCACTGATTCAACGTACCGTAAAGAT TACT TGATCCACTGAT I CAACGTACCGTAACGAACGTATCAAT TGAGACTAAATAT TAACG TACCATTAAGAGOT CCE O A ORO ARTO TT CALC AATGATAACAGTAACACACTTCTGTTAACCTTAAGATTACTTGATCCACTGATTCAACGTA eer A eae AAATAT TAACGTACCAT TAAGAGC TACCG TCTTCTGTTAACCT TAAGAT TACTTGATCCACTGAT TCAACGTA ITACTTGATCCACTGATTCAACGTTAAGATTACTTGATCCACTGATTCAACGTACCGTAACGAACGTATCAAT TGAGCT TCTGT TAACCTTAAGAT TACTT GATCCACTGAT TCAACGTACCGTAACGAACGTAT CAAT I GAGACTAGCAACGACGAA TATCAATTGAGACTAAATATTAACGTACCAT TAAGAGTCTGT TAACCT TAAGAT TACT TGATCCACTGATTCAACG TACCGTAACGAACG TATCAAT TGAGAC TAAATAT TAACG TACCAT TAAGAGC TACCG T GCAACGAAAAGAAT GATAACAGTAAC MCGTACCGTAACGAACGTATCAT TAAGATTACTTGATCCACTGATTCAACGTACCGTAACGAACG TATCAAT TGAGAC TAAATAT TAACGTACCAT TAAGAGCTACCG TGCAACGACGAAAAGAAT GATAACAG TAACACACT TC TGT TAACCT TAAC I TACTTGATCCACTGATTCAACGTIAAGATTACTTGATCCACTGATTCAACGTACCGTAACGAACGTAT CAATTGAGCTTCTGTTAACCT TAAGAT TACT TGATCCACTGAT TCAACGTACCGTAACGAACGTATCAAT TGAGACTAGCAACGACGAA Me CAG AEE a eee ALIAS ATTE DEA ARABIE PORCH CT CREATA EARS e TINARUATS C TAG EI AATGATAACAGTAACACACT TC TGTTAACCT TAAGAT TA SABE ANI C o eli E LP yt CTAAATAT TAACGTACCAT TAAGAGCTACCGTCTTCTGTTAACCTTAAGAT TACTTGATCCACTGAT TCAACGTACCGTAA NTCCACTGATTCAACGTACCAAGATTACTTGATCCACTGAT TCAACGTACCGTAACGAACGTAT CAAT TGAGAC TAAATAT TAACGTACCAT TAAGAGC TACCGTCTTCTGT TAACCT
29. ACACT TCTGTTAACCT TAAGAT TACTTGATCCACTGAT TCAACGTACCGTAAAGAT TACT TGATCCACTGAT TCAACGTACCGTAACGAACGTATCAAT TGAGACTAAATAT TAACGTACCAT TAAGAGCTACC Illumina San Diego California 92122 U S A 1 800 809 ILMN 4566 1 858 202 4566 outside North America techsupport illumina com www illumina com
30. AT IGAACG 3ATAACAGTAACACACTT AACCTTAAGATTACTTGATCCACTGATTCAACG TACCG TAACGAACG TATCAAT T GAGAC TAAATAT TAACG TACCAT TAAGAGCTA TTCTG CCTTAAGATTACTTGATCCACTGA CCAT TAAGAGC TACCGTGCAACTTAACCTTAAGAT TACTTGATCCACTGATTCAACGTACCGTAACGAACGTATCAAT TGAGACTAAATAT TAACG TACCAT TAAGAGCTACCGTGCAACGACGAACTTCTGT TAACCT TAAGAT TACT TGAT CTAGOGIGCAAGGAAAN AAGC TTAAGATTACT IGATCCACTGAT ICAACGTAGTICTG TAAGGTTAAGATTACT IGATCCACT GAL CAACGACOGTAACGAACG TAI GAAT TGAGAG TAAGGAGCGIGCAACGACGAAAAGAATAT AAAAGAATGA e de UL R AACCTIAAGATTACTT EE AE GMT S M AAAGATTACTTGAT VER ACTGATICAACGTACCGTAACGAACG TA TTGAGACTAAATAT TAACGTACCAT TAAGAGCTACC 3ATAACAGTAACACACTTCTGTTAACCT TAAGAT TACT T PORT OCACTGALICAACGT ACCGTAACGAA ACTA TCAAT TGAGACTAAATAT TAACGT AC CATAAGAGCTACCGTOCAA AOGA OINA GA TAACAGTAACACACTTCTGTI CCATTAAGAGCTACEGT SC AACAGTAACACAC E TGTOT IAACCTTAAGATTACT GAT GGAGTGATTCAA OTACOG IAACGAACG IAT CAAT GAGAGTAAATAT TAACGTACGAI TAAGAGCTACCG I GCAACGACGARAAGAAT SATAN 3ATAACAGTAACACACT TCTGT TAACCT TAAGAT TACTTGATCCACTGAT TCAACGTACCGTAACGAACGTATCAAT TGAGACTAAATAT TAACGTACCAT TAAGAGC TACCGTCTTCT AAGAT T BOT GAT RG an O as aTACCGT AA ANC ATCATTAAGATTACTTGATCCACTGATTCAACGTACCGTAACGAACGTATCAATTGAGAC TAAATAT TAACG TACCATTAAGAGC TACCGTGCAACGA CORABACAA AGAT TAACAGTAACACACTTCTGTTAACCT T STTGATOCAGT GAIT GAACG TTAAGATTACTTGATCCACTGATT GAACGTACCGTAACGAACGTATCAATT GAGCTTCTG HACC AAGAT TACT IGATCCAG TGA CAAGOTACCGTAACGAACG TA CARTTGAGACTAGGAACGACG IAAAAGAATGATAACAGTAAC
31. C and centrifuge briefly Proceed immediately to Synthesize First Strand cDNA on page 63 Part 15031048 Rev E Synthesize First Strand cDNA This process reverse transcribes the cleaved RNA fragments that were primed with random hexamers into first strand cDNA using reverse transcriptase and random primers The addition of Actinomycin D to the First Stand Synthesis Act D mix FSA prevents spurious DNA dependent synthesis while allowing RNA dependent synthesis improving strand specificity Consumables Item Quantity Storage Supplied By First Strand Synthesis Act D 1 tube 15 C to 25 C Illumina Mix FSA Microseal B Adhesive Seal 1 JI C O SAS User RNase DNase free Eight Tube 1 15 C to 30 C User Strips and Caps if using multichannel pipettes RNase DNase free Reagent il IBC e SOC User Reservoirs if using multichannel pipettes SuperScript II Reverse 1 tube 15 C to 25 C User Transcriptase WARNING y First Strand Synthesis Act D Mix contains Actinomycin D a toxin Personal injury can occur through inhalation ingestion skin contact and eye contact Dispose of containers and any unused contents in accordance with the governmental safety standards for your region Refer to the product material safety data sheet MSDS for detailed environmental health and safety information MSDSs are available for this kit on the Illumina website at www illumina com msds Preparation Remove one tube of First Strand Synt
32. CACACT TCTGTTAACCTT TTGATCCACTGATTCAACGTACCGTAACGAA TCAATTGAGACTA CTGATTCAACGT CO CC MAR GAACGHATOATIAAGATTAC T GAT OCACIGATICAACGTA COTA AA AT CARTTQACA CTAAATAT T TGTTAACCTTAAC OS TATCAATTGAGCTICTGTTAACI AGCAACGA ACGAAAAGAATGATAACAGTAACACACT lCTGTTAACCT TAAGATTACTTGATCCACTGAT TCAACGTACCGTAAAGAT TACTTGATC AAGAGCTACCGT FOR RESEARCH USE ONLY ILLUMINA PROPRIETARY RS 122 9007DOGC Part 15031048 Rev E October 2013 This document and its contents are proprietary to Illumina Inc and its affiliates Illumina and are intended solely for the contractual use of its customer in connection with the use of the product s described herein and for no other purpose This document and its contents shall not be used or distributed for any other purpose and or otherwise communicated disclosed or reproduced in any way whatsoever without the prior written consent of Illumina lumina does not convey any license under its patent trademark copyright or common law rights nor similar rights of any third parties by this document The instructions in this document must be strictly and explicitly followed by qualified and properly trained personnel in order to ensure the proper and safe use of the product s described herein All of the contents of this document must be fully read and understood prior to using such product s FAILURE TO COMPLETELY READ AND EXPLICITLY FOLLOW ALL OF THE INSTRUCTIONS CONTAINED HEREIN MAY RESULT IN DAMAGE TO THE PRODUCT S
33. CCGTAACGAACGTATCATTAAGATTACTTGATCCACTGATTCAACGTACCGTAACGAACG TATCAAT TGAGA P pe E ACCGTGCAACGACGAAAAGAATGATAACAG TAACACACT TCTGT TAACCT A ZTTGATCCACTGATTCAACGTTIAAGATTACTTGATCCACTGATTCAACGTACCGTAACGAACG TATCAAT TGAGCTTCTGT TAACCT TAAGAT TACT TGAT CCACTGAT TCAACG TACCGTAACGAACGTAT CAAT TGAGACTAGCAACGACG IAAAAGAATGATAACAGTAACACAC T TCTGT TAACCT TAAGAT TACTT GATCCACTGAT TCAACGTACCGTAAAGATTACT TGATCCACTGAT TCAACGTACCGTAACGAACG TATCAAT TGAGACTAAATAT TAACGTACCAT TAAGAGCTACC 3ATAACAGTAACACACT TCTGTTAACCT TAAGAT TA quU A di eie SIL RE I Real AR SCIRE MAUS ARES ATTACTT OE Oe cU E ZACTGATTCAACGTACCAAGATTACTTGATCCACTGAT TCAACGTACCGTAACGAACGTATCAAT TGAGACTAAATAT TAACGTACCAT TAAGAGCTACCGTCTTCTGT TAACCT TAAGAT TACT TGATCCACTGATTCAACGTACCG TAACGA AAAAGANTGATAACAGTAAGAGAGTIGTGY IAACCLTAAGATIACT TGATCGACT GATT GAACGTAGCG AAAGAT AC EGATOCAC GAT ICAAGGTACCGTAACGAACGIATCAAI TGAGAC TAAATATTAACGTAGCATTAAGAGC AGO e a GTTAACCTTAAGATTACTTGATCCACTGATTCAACGTACCGTAACGAACG TATCAA LO E ARR eiue GATTACTTGATCCACTGATTCAACG TGAGACTAAATAT TAACGTTGTTAACCTTAAGATTACTTGATCCACTGATTCAACGTACCGTAACGAACGTATCAAT TGAGACTAAATA LU ae aa GCTTCTGTTAACCT TAAGAT TACTTGATCCACTGAT TCAACGTACCGTA ATCAATTGAGA CTAANTALT AACGTACTTAACCTIAAGAT TACTTGATCCACTGATTCAACGTACCGTAACGAACG TCTTCTGT TAACCT TAAGAT T KETIGMCCACIGATTCAACGT ACCGTAACGAACGTATCAAT TGAGACTAACGACGA SATAACAGTAACAGAG LT CTGLIAACG T TAAGA TACT GAT GOAGTGAT GAACGIAGGG TARO GAO O TALCA GAGAG AAATAT TAA DG ACCA TAAGAGCTACGGCT TCT GTTAAGG TANGATIACT IGATCUACT G
34. CTGATTCAACGTACCGTAACGAACGTATCAAT TGAGACTAAATAT TAACG TACCA WD A e CGACG TICTGTT Se ET GAGCTACCGTGCAACGAAAATAACCTTAAGATTACT TGATCCACTGAT TCAACGTACTTCTGTTAACCTTAAGAT TACTTGATCCACTGAT TCAACGTACCGTAACGAACGTA ICAATTGAGACTAAGO TACOGTOCAACGA CGAAAAGAATGAT RC GAAAAGAAT GATAACAGTAACAGACTTG TCH TAACC TIAAGATIACLIGATCCACTGATTCAKCOTACCG TANAGATIACTTGATCOACTCATICAASGTACCOTAASGAACCIATGRATT SAGACTAAMATTAACCTACCATTAAGACCTACECT AATGATAACAGTAACACACT TCTGTTAACCTTAAGA uod aes CCGTAACGAACGTATCAAT TGAGACT Ree e AA d e CI E CGACGAAAAGAA UES para Eve pee TE Aa GTACCAT TAAGAGC TACCGTGCAACAGTAACACACT TCTGT TAACCT TAAGAT TACT T GATCCACTGAT TCAACGTACCGTAACGAACGTAT CAAT TGAGAC TAAATAT TAACGTACCAT TAAGAGCTACCGTGCAACGACGAAAAGAATGATAACA AAT QATAACAGTAACAGACTICNG LIAAGGTIAAGATTAC LIGATCCAGTGATI OAACOTACCGIAACOAACOTATCAATI GAGA TAAATATTAAGGTACCATAAGHOCTASCOTCTTOTCO MAACO TIAAGATIACH GATGCACTGATICANCGTA ACGTACCGTAACGAACGTATCAT TAAGAT TA DEM I ERA eU UAI ED S M ecl Pe MEA a S afe CGAAAAGAATGA dae e CTTCTGTTAACCTTAAC I TACTTGATCCACT GRUSS CGTTAAGATTACTTGATCCACTGATTCAACGTACCGTAACGAACG TATCAAT TGAGCTTCTGTTAACCTTAAGAT TACTTGATCCACT RE AE n ATA TCAATTGAGACTAGCAACGACGAA ACGAAAAGAATGATAACAGTAACACAC T TCTGTTAACCT TAAGAT TACTT GATCCACTGATTCAACGTACCGTAAAGATTACTTGATCCACTGAT TCAACG TACCGTAACGAACG AT CAAT TGAGAC TAAATAT TAACGTACCAT TAAGAGC TACCGT NR OG OCCT ELTE TAS TIR S Ue CTA TA RARA ATA TIAACGTAC ANAACAGCTACNGTCLTCTGT TAAGCTIAAGAT TAC TICATCCAC GM TCAACGTA CO VAS LM poe ime M E ACCGTAACGAACG TATC
35. DP plate type options for LS protocol are a 0 3 ml PCR 2013 plate when pooling lt 40 samples or a 96 well MIDI plate when pooling gt 40 samples Created new appendix of Supporting Information containing Acronyms Kit Contents Consumables and Equipment and Indexed Adapter Sequences Replaced Best Practices section with a reference to content on the Illumina website Replaced Adapter Options and Pooling Guidelines sections with a reference to the TruSeq Sample Preparation Pooling Guide part 15042173 15031048 D April 2013 Added new TruSeq Stranded Total RNA plant and globin kit information in the following sections e Introduction Acronyms Kit Contents Ribo Zero Deplete and Fragment RNA procedures Usage Guidelines Added bioanalyzer and DNA 1000 Kit to equipment list Corrected Kit Contents box 1 shipping temperature Corrected storage temperature of rRNA Binding Buffer to 15 C to 25 C Removed the SIP and RIP plate transfer steps from the Ribo Zero Deplete and Fragment RNA procedures In Clean Up PCR HS protocol added centrifuge step to mixing procedures to make mixing consistent throughout protocol e Clarified in protocol steps that the PDP plate is a 0 3 m1 PCR plate in the LS protocol and an HSP plate in the HS protocol In the Alternate Fragmentation Protocols Appendix added an elution step for intact RNA with an insert length of 130 350 bp Moved Usage Guidelines to an Appendix TruS
36. GTACCG TAACGAACGTATCAAT TGAGACTAAATAT TAACGTACCAT TAAGAGCTACCG TCTTCTGT TAACCTTAAGAT TACTTGATCCACTGAT TCAACG STACCGT eU RE ee og OE A E vr M aces ATCAATTG A EU TTAAGAGCTACCGTGCAACGACGAAAAGAATGATAACAGTAACACACTTCTGTTAACCT TA JAUNES A LA CGTTAAGATTACTTGATCCACTGATTCAACG TACCGTAACGAACG TATCAAT TGAGCTICTGTIAACCTTY RAGATTAOT TE EAT TAL TET RON TCAATTGAGACTAGCAACGACQG NIN AAA CATA CACACICTGTIRAC TE o Near GTAACGAACGTATCAAT TGAGACTAAATATTAACGTACCAT TAAGAGC TACC SATAA AQTRACACAC TTCTGTTAACCT TAAGAT TACTTGATCCACTGATTCAACGTACCG TAACGAACGTATCAAT T GAGACTAAA AN KAGAGC TACCGTCTTCTGTIAACCTIAAGATIACTTGA YER EAT a STACCGTAACGAACGIA TCAT TAAGAT TACTTGATCCACT GATT CAACGTACCGTAACGAACG TAT CAAT TGAGACTAAATAT TAACGTACCAT TAAGAGCTACCGTGCAACGACGAAAAGAAT GATAACAGTAACACACTTCTGTTAACCTT IAAAAGAATGATAACAGTAACACACT TCTGTTAACC T TAAGAT TACT TGATCCACTGATT CAACGTACCGTAAAGAT TACT Ti GATCCACTGAT I GAACCTACCGTAACGAACGTAT CAME GAGACTAAATALTAASGIRCCATIAAGAGK ACG CCAT TAAGAGCTACCGTGCAACAGTAACACACTTCTGT TAACCT TAAGAT TACTTGATCCACTGAT TCAACGTACCGTAACGAACGTAT CAAT TGAGACTAAATAT TAACGTACCAT TAAGAGCTACCGT GCAACGACGAAAAGAAT GATAA 3ATAACAGTAACACACTTCTGTTAACCT TAAGATTACTTGATCCACTGATTCAACGTACCG TAACGAACGTATCAAT TGAGACTAAATAT TAACGTACCAT TAAGAGCTACCGTCTICTGTTAACCTTAAGAT TACTTGATCCACTGATTCAACG Z2LTGATCCACTGATTCAACGTTAAGAT TACTTGATCCACTGATTCAACGTACCGTAACGAACGTATCAAT TGAGCT TCTGT TAACCTTAAGAT TACT TGATCCACTGAT TCAACGTACCGTAACGAACGTAT CAAT TGAGAC TAGCAACGACQ A a O DARET C ACA AA ON Galt ore aL GTA
37. IAAAAGAATGATAACAGTAACACACTTCTGTTAACCTTAAGAT TACTTGATCCACTGAT TCAACGTACCGTAAAGATTACTTGATCCACTGAT TCAACGTACCGTAACGAACGTATCAAT TGAGACTAAATAT TAACGTACCAT TAAGAGCTACC 3ATAACAGTAACACACT TCTGTTAACCTIAAGAT TACT TGATCCACTGAT TCAACGTACCGTAACGAACGTATCAAT TGAGACTAAATAT TAACGTACCAT TAAGAGCTACCGTCTTCTGTTAACCT TAAGATTACTTGATCCACTGAT TCAACG TGAGACTAAATAT TAACGTTGTTAACCTTAAGATTACTTGATCCACTGATTCAACG TACCGTAACGAACG TATCAAT TGAGACTAAATATTAACGTACCAT TAAGAGCT TCTGT TAACCT TAAGAT TACTTGATCCACTGAT TCAACG TACCG TA ATCAAT TGAGAC TAAATAT TAACGTACT TAACCT TAAGAT TACT TGATCCACTGATTCAACGTACCGTAACGAACG TCTTCTGTTAACCTTAAGAT TACTT GATCCACTGATTCAACGTACCGTAACGAACG TATCAAT TGAGAC TAACGACGA SAC TAAATAT TAACGTACCAT TAAGAGCTACAACCT TAAGAT TACT TGATCCACTGATTCAACGTACCGTAACGAACG AT CAAT TGAGACTAAATAT TAACGTACCAT TAAGAGC TACCGTGCAACGACGAAAAGAAT GATAACAGTAACACA CCA CCTTAAGATTACTT C A VT TGAGACTAAATAT TAACG A AA CGAACTTCTGTTAA 3CIACCGTGCAACGAAAATAACCT TAAGATTACT TGATCCACTGAT TCAACGTACTTCTGTTAACCTTAAGAT TACTTGATCCACTGATTCAACGTACCG TAACGAACG TATCAAT TGAGACTAAGCTACCGTGCAACGACGAAAAGAATGAT A ae wise O MADE e A die EQUI USE M AOV Ate E PIE A YE a Sg VER AREIS TS S EUIS 3ATAACAGTAACACACT TCTGTTAACCT T Su AES E S pie p RH SEES TCAATTGAGACT m Uu CGACGAAAAGAATGATAACAGTAACACAC TTC TGT I CCAT TAAGAGC TACCGTGCAACAGTAACACACT TCTGTTAACCTTAAGAT TACT TGATCCACTGAT TCAACGTACCG TAACGAACGTAT CAAT TGAGACTAAATAT TAACGTACCAT TAAGAGCTACCGTGCAACGACGAAAAGAAT GATAA 3aATAACAGTAACACACT TCTGTTAACCT TAAGAT TACTTGATCCACTGAT TCAAC
38. IFE fe STO User Reservoirs if using multichannel pipettes Preparation Remove the PCR Master Mix and PCR Primer Cocktail from 15 C to 25 C storage and thaw them at room temperature Centrifuge the thawed PCR Master Mix and PCR Primer Cocktail tubes to 600 x g for 5 seconds Remove the Resuspension Buffer from 2 C to 8 C storage and bring it to room temperature Remove the AMPure XP Beads from 2 C to 8 C storage and let stand for at least 30 minutes to bring them to room temperature Review Best Practices for Handling Magnetic Beads See Additional Resources on page 10 for information on how to access TruSeq Stranded Total RNA Sample Preparation Best Practices on the Illumina website Remove the PCR plate from 15 C to 25 C storage if it was stored at the conclusion of Clean Up ALP on page 39 Let it thaw at room temperature Centrifuge the thawed PCR plate to 280 x g for 1 minute Remove the adhesive seal from the thawed PCR plate Pre program the thermal cycler with the following program and save as PCR Choose the pre heat lid option and set to 100 C 98 C for 30 seconds 15 cycles of 98 C for 10 seconds 60 C for 30 seconds 72 C for 30 seconds 72 C for 5 minutes Hold at 4 C Apply a TSP1 barcode label to a new 96 well 0 3 ml PCR plate TruSeq Stranded Total RNA Sample Preparation Guide A 3 s juauBe14 vNG u9uu3 Low Sample LS Protocol Make PCR 1 Add 5 ul of thawed PCR Primer Cocktail to each well of the PCR p
39. INJURY TO PERSONS INCLUDING TO USERS OR OTHERS AND DAMAGE TO OTHER PROPERTY ILLUMINA DOES NOT ASSUME ANY LIABILITY ARISING OUT OF THE IMPROPER USE OF THE PRODUCT S DESCRIBED HEREIN INCLUDING PARTS THEREOF OR SOFTWARE OR ANY USE OF SUCH PRODUCT S OUTSIDE THE SCOPE OF THE EXPRESS WRITTEN LICENSES OR PERMISSIONS GRANTED BY ILLUMINA IN CONNECTION WITH CUSTOMER S ACQUISITION OF SUCH PRODUCT S FOR RESEARCH USE ONLY O 2012 2013 Illumina Inc All rights reserved Illumina IlluminaDx BaseSpace BeadArray BeadXpress cBot CSPro DASL DesignStudio Eco GAIIx Genetic Energy Genome Analyzer GenomeStudio GoldenGate HiScan HiSeq Infinium iSelect MiSeq Nextera NuPCR SeqMonitor Solexa TruSeq TruSight VeraCode the pumpkin orange color and the Genetic Energy streaming bases design are trademarks or registered trademarks of Illumina Inc All other brands and names contained herein are the property of their respective owners Limited Use Label License This product and its use are the subject of one or more issued and or pending U S and foreign patent applications owned by Max Planck Gesellschaft exclusively licensed to New England Biolabs Inc and sublicensed to Illumina Inc The purchase of this product from Illumina Inc its affiliates or its authorized resellers and distributors conveys to the buyer the non transferable right to use the purchased amount of the product and components of the product by the buyer whether the buyer i
40. Insert length determined after clustering and sequencing with a paired end sequencing run b Instead of a 94 C incubation incubate at 65 C for 5 minutes followed by a 4 C hold This will elute the mRNA from the beads without fragmentation The resulting cDNA fragments are smaller than the mRNA due to internal priming by the random hexamers in the EPH TruSeq Stranded Total RNA Sample Preparation Guide 1 1 T YNY 198e u Joy au UOoezuow pelJ YNY JIPOIN Alternate Fragmentation Protocols 118 Figure 22 Shortened Fragmentation Time Results 8 t 12 min frag 0 2 t 0 frag Covaris amp te2mn frag O 6 te5 mn frag 3 t l min frog 0 5 t 3 min frag 7 t 8 min frag FU t 12 mn frag NOTE 1 The discrepancy between the reported insert size using the Agilent Bioanalyzer and the insert size determined after clustering and sequencing with a paired end sequencing run is due to the bias towards clustering smaller fragments To target a specific fragment size a gel size selection step is required after adapter ligation Part 15031048 Rev E Modify RNA Fragmentation Time for Degraded RNA For degraded RNA samples the fragmentation time must be adjusted to avoid over fragmentation of the RNA samples This is accomplished during the Ribo Zero Deplete and Fragment RNA procedures by either skipping fragmentation Incubate 1 DFP or modifying the thermal cycler Elution 2 Frag Prime program to 94 C for X minutes followed by
41. J YNY HIPON Alternate Fragmentation Protocols 122 Figure 25 Incubate Samples at 94 C for 6 Minutes Followed By a 4 C Hold Nucleotides Part 15031048 Rev E Figure 26 Incubate Samples at 94 C for 4 Minutes Followed By a 4 C Hold Fu T T 25 200 500 1000 2000 4000 Nucleotides pepeuJ6e 104 euui uorjejueuuDeJ YNY HIPON TruSeq Stranded Total RNA Sample Preparation Guide 1 2 3 Alternate Fragmentation Protocols 124 Figure 27 No Fragmentation Necessary Skip Incubate 1 DFP and Proceed to Synthesize First Strand cDNA Fu ij 25 200 500 1000 2000 4000 Nucleotides Part 15031048 Rev E Index A Acronyms 93 Actinomycin D 26 Add ATL 33 71 Add LIG 37 75 Add SMM 29 67 Add STL 39 77 ALP 28 66 Amp PCR 44 83 AMPure XP Beads 28 36 42 66 74 81 ATL 32 70 B Best Practices 10 BRB 19 57 C CAP 35 73 CCP 66 cDNA synthesis 17 55 Clean Up ALP 39 77 78 Clean Up DFP 30 68 Clean Ub PCR 44 84 Clean Up RCP 23 60 T n 2 50 90 CTA 32 70 CTE 28 66 CTL 35 73 customer support 127 D DCT 48 88 degraded RNA 20 23 58 60 116 119 DFP 19 57 documentation 127 ds cDNA 28 66 TruSeq Stranded Total RNA Sample Preparation Guide xepu E ELB 18 56 Elution 2 Frag Prime 117 EPH 18 56 experienced user card EUC 11
42. M RRM G RRM P and Mix Heat RNA RBB GRM RRM RRM G RRM P Mixture Incubate RNA RBB GRM RRM RRM G RRM P Mixture Add RRB to RRP Transfer Supernatant to RRP and Mix J NOTE Transfer Supernatant Transfer to RCP Clean with RNAClean XP Beads Resuspend with ELB Transfer Supernatant to DFP Add EPH and Mix Heat to Elute Fragment and Prime Ilumina recommends that you use 0 1 1 ug of total RNA and use PCR plates with a magnetic plate stand for this process TruSeq Stranded Total RNA Sample Preparation Guide 17 VNH Juewbes4 pue ajajdag 019Z 0qIH Low Sample LS Protocol 18 4 NOTE Allow the rRNA Removal Beads and the RNAClean XP Beads to fully pellet against the magnetic stand for 1 minute and 5 minutes respectively Remove the supernatant from the beads immediately while the beads are still pelleted against the magnetic stand Do not allow the rRNA Removal Bead pellets to dry amp NOTE The RNAClean XP bead wash steps use 70 Ethanol while 80 Ethanol is used for AMPure XP bead washes Consumables Item Quantity 1 tube per 48 reactions Elute Prime Fragment High Mix EPH 1 tube per 48 reactions Elution Buffer ELB 1 tube per 48 reactions One of the following depending on the kit you are using Globin Removal Mix GRM Ribo Zero Globin kit contents rRNA Removal Mix RRM Ribo Zero Human Mouse Rat kit contents rRNA Removal Mix Gold RRM G Ribo Z
43. MM Barcode labels for ALP Adapter Ligation Plate CCP cDNA Clean Up Plate MP Insert Modification Plate 96 well MIDI Plates AMPure XP Beads Freshly Prepared 80 Ethanol EtOH Microseal B Adhesive Seals RNase DNase free Eight Tube Strips and Caps if using multichannel pipettes RNase DNase free Reagent Reservoirs if using multichannel pipettes Quantity 1 tube per 48 reactions 1 tube 1 tube per 48 reactions 1 label per plate 2 90 ul per sample 400 ul per sample Storage Supplied By 2 C to 8 C Ilumina ZAC tiro BAC Illumina 15 C to 25 C Ilumina TIS ti XO Ilumina 15 C to 30 C User ZAC 110 BAC User 15 C to 30 C User NAC 10 SAC User 15 C to 30 C User IBA to 028 User Part 15031048 Rev E Preparation Add SMM 3 Remove the following from 15 C to 25 C storage and thaw them at room temperature End Repair Control NOTE j The use of the End Repair Controlis optional and it can be replaced with the same volume of Resuspension Buffer Second Strand Marking Master Mix Remove the Resuspension Buffer from 2 C to 8 C storage and bring it to room temperature Remove the AMPure XP beads from storage and let stand for at least 30 minutes to bring them to room temperature Review Best Practices for Handling Magnetic Beads See Additional Resources on page 10 for information on how to access TruSeq Stranded Total RNA Sample Preparation Best Practices o
44. NS INCLUDING WITHOUT LIMITATION THIS PRODUCT INCLUDING USE THEREOF AND ILLUMINA S PERFORMANCE HEREUNDER WHETHER IN CONTRACT TORT INCLUDING NEGLIGENCE STRICT LIABILITY OR OTHERWISE SHALL IN NO EVENT EXCEED THE AMOUNT PAID TO ILLUMINA FOR THIS PRODUCT Limitations on Illumina Provided Warranties TO THE EXTENT PERMITTED BY LAW AND SUBJECT TO THE EXPRESS PRODUCT WARRANTY MADE HEREIN ILLUMINA MAKES NO AND EXPRESSLY DISCLAIMS ALL WARRANTIES EXPRESS IMPLIED OR STATUTORY WITH RESPECT TO THIS PRODUCT INCLUDING WITHOUT LIMITATION ANY IMPLIED WARRANTY OF MERCHANTABILITY FITNESS FOR A PARTICULAR PURPOSE NONINFRINGEMENT OR ARISING FROM COURSE OF PERFORMANCE DEALING USAGE OR TRADE WITHOUT LIMITING THE GENERALITY OF THE FOREGOING ILLUMINA MAKES NO CLAIM REPRESENTATION OR WARRANTY OF ANY KIND AS TO THE UTILITY OF THIS PRODUCT FOR PURCHASER S INTENDED USES Product Warranty All warranties are personal to the Purchaser and may not be transferred or assigned to a third party including an affiliate of Purchaser All warranties are facility specific and do not transfer if the Product is moved to another facility of Purchaser unless Illumina conducts such move a Warranty for Consumables Illumina warrants that Consumables other than custom Consumables will conform to their Specifications until the later of i 3 months from the date of shipment from Illumina and ii any expiration date or the end of the shelf life pre printed on such Consuma
45. Seq Stranded Total RNA Sample Preparation Guide 19 Low Sample LS Protocol One of the following depending on the kit you are using Globin Removal Mix rRNA Removal Mix rRNA Removal Mix Gold rRNA Removal Mix Plant rRNA Binding Buffer Resuspension Buffer ly NOTE The Resuspension Buffer can be stored at 2 C to 8 C after the initial thaw Remove the following from 2 C to 8 C storage and let stand to bring to room temperature Elution Buffer rRNA Removal Beads Remove the RNAClean XP beads from 2 C to 8 C storage and let stand for at least 30 minutes to bring them to room temperature Pre program the thermal cycler with the following programs Choose the pre heat lid option and set to 100 C 68 C for 5 minutes save as RNA Denaturation 94 C for 8 minutes 4 C hold save as Elution 2 Frag Prime lay NOTE For inserts larger than 120 200 bp with a median size of 150 bp or if starting with degraded total RNA see Appendix A Alternate Fragmentation Protocols for the appropriate Elution 2 Frag Prime program settings Set the centrifuge to 15 C to 25 C if refrigerated Apply a BRP barcode label to a new 96 well 0 3 ml PCR plate Apply a DFP barcode label to a new 96 well 0 3 ml PCR plate Apply an RCP barcode label to a new 96 well 0 3 ml PCR plate Apply an RRP barcode label to a new 96 well 0 3 ml PCR plate Make BRP 1 Dilute the total RNA with nuclease free ultra pure water to a final volume of 10 ul in th
46. Total RNA LT RS 122 2402 48 12 Sample Prep Kit Set B with Ribo Zero Plant TruSeq Stranded Total RNA HT RS 122 2403 96 96 Sample Prep Kit with Ribo Zero Plant TruSeq Stranded Total RNA LT RS 122 2501 48 12 Sample Prep Kit Set A with Ribo Zero Globin TruSeq Stranded Total RNA LT RS 122 2502 48 12 Sample Prep Kit Set B with Ribo Zero Globin TruSeq Stranded Total RNA HT RS 122 2503 96 96 Sample Prep Kit with Ribo Zero Globin TruSeg Stranded Total RNA LT Sample Prep Kit The TruSeq Stranded Total RNA LT Sample Prep Kit contains four boxes an A or B box Box 1 Box 2 and a cDNA Synthesis PCR box 48 Samples 12 Index Set A and B You receive either box A or B in the kit depending on the set ordered TruSeq Stranded Total RNA Sample Preparation Guide O7 S1U91UO2 YM Supporting Information 98 Store at 15 C to 25 C These boxes are shipped on dry ice As soon as you receive your kit store the following components at 15 C to 25 C Set A Figure 12 TruSeq Stranded Total RNA LT Sample Prep Kit 48 Samples 12 Index Set A part 15032612 S o NIA OH B W NR gp o et Rl Rl Rl Re Re Rel Rl Rl O NIAN OT BH WD mc Reagent LIG ATL STL ARO13 ARO14 ARO15 ARO16 ARO18 ARO19 AR002 AR004 ARO005 AR006 AR007 ARO12 RSB CTE CTA CTL Part 15026773 15012495 15012546 15024655 15024656 15024657 15024658 15024660 15024661 15026634 15026636 15026637 15026638
47. a 4 C hold Whether or not the samples should undergo fragmentation and the amount of time used for fragmentation X is determined by the size range of the total RNA starting material To determine which fragmentation settings to use if any 1 Measure the size range of the total RNA starting material by running it on a Agilent RNA 6000 Nano or Pico chip 2 Compare the resulting electropherogram to Figure 23 Figure 27 which show UHR that has been fragmented to various size ranges 3 Determine which sample figure most resembles the size range of your starting material 4 Use the thermal cycler settings recommended in the figure title of that size range to fragment your degraded RNA samples For starting material smaller than that shown in Figure 27 no fragmentation is necessary Skip Incubate 1 DFP and proceed immediately to Synthesize First Strand cDNA pepeJ6eq 104 au uorjejueuubeJJ YNY HIPON TruSeq Stranded Total RNA Sample Preparation Guide 1 1 9 Alternate Fragmentation Protocols 120 Figure 23 Incubate Samples at 94 C for 8 Minutes Followed By a 4 C Hold 1000 Nucleotides Part 15031048 Rev E Figure 24 Incubate Samples at 94 C for 7 Minutes Followed By a 4 C Hold u 1 Meri 25 200 500 1000 2000 4000 Nucleotides TruSeq Stranded Total RNA Sample Preparation Guide 1 2 1 pepeuJ6e 104 au uorjejueuuDe
48. a website at www illumina com msds Preparation Remove one tube of First Strand Synthesis Act D Mix from 15 C to 25 C storage and thaw it at room temperature TruSeq Stranded Total RNA Sample Preparation Guide oo VNQ pues jsil eziseuu S Low Sample LS Protocol Add FSA Pre program the thermal cycler with the following program and save as Synthesize 1st Strand Choose the pre heat lid option and set to 100 C 25 C for 10 minutes 42 C for 15 minutes 70 C for 15 minutes Hold at 4 C E NOTE The First Strand Synthesis Mix Act D with SuperScript II added is stable to additional freeze thaw cycles and can be used for subsequent experiments If more than six freeze thaw cycles are anticipated divide the First Strand Synthesis Mix Act D and SuperScript II mix into smaller aliquots and store at 15 C to 25 C Remove the adhesive seal from the DFP plate Centrifuge the thawed First Strand Synthesis Mix Act D tube to 600 x g for 5 seconds Add 50 ul SuperScript II to the First Strand Synthesis Act D Mix tube If you are not using the entire contents of the First Strand Synthesis Act D Mix tube add SuperScript IL at a ratio of 1 ul SuperScript II for each 9 ul First Strand Synthesis Act D Mix Mix gently but thoroughly and centrifuge briefly Label the First Strand Synthesis Mix Act D tube to indicate that the SuperScript II has been added Add 8 ul of First Strand Synthesis Mix Act D and SuperScript II mix to each
49. al Assistance For technical assistance contact Illumina Technical Support Table 21 Illumina General Contact Information Illumina Website www illumina com Email techsupport illumina com Table 22 Illumina Customer Support Telephone Numbers Region Contact Number Region Contact Number North America 1 800 809 4566 Italy 800 874909 Austria 0800 296575 Netherlands 0800 0223859 Belgium 0800 81102 Norway 800 16836 Denmark 80882346 Spain 900 812168 Finland 0800 918363 Sweden 020790181 France 0800 911850 Switzerland 0800 563118 Germany 0800 180 8994 United Kingdom 0800 917 0041 Ireland 1 800 812949 Other countries 44 1799 534000 MSDSs Material safety data sheets MSDSs are available on the Illumina website at www illumina com msds Product Documentation Product documentation in PDF is available for download from the Illumina website Go to www illumina com support select a product then click Documentation amp Literature TruSeq Stranded Total RNA Sample Preparation Guide 1 p T 99UB SISSY e9IUuu2e AAAAGAATGATAACAGTAACACACTTCTGTTAACCTTAAGATTACTTGATCCACTGATTCAACGTACCGTAAAGATTACTTGATCCACTGATTCAACGTACCGTAACGAACGTATCAATTGAGACTAAATATTAACGTACCATTAAGAGCTACC SATAACAGTAACACACTTCTGTTAACCTTAAGATTACTTGT TGATCCACTGATTCAACGTACCGTATCAAT TGAGAC TAAATAT TAACGTACCAT TAAGAGCTACCGTCTTCTGTTAACCTTAAGAT TACT TGATCCACTGAT TCAACGTACCGT PATATE CEDAT ECT TOC RAD EAS STA TCRA RASTA AAT A TAM BOCA TANGO IR CELO PACTI TAGAT AC TRAE ABE TARTE TCR TAA
50. and Mix Heat RNA RBB GRM RRM RRM G RRM P Mixture Incubate RNA RBB GRM RRM RRM G RRM P Mixture Add RRB to RRP Transfer Supernatant to RRP and Mix J NOTE Transfer Supernatant Transfer to RCP Clean with RNAClean XP Beads Resuspend with ELB Transfer Supernatant to DFP Add EPH and Mix Heat to Elute Fragment and Prime Ilumina recommends that you use 0 1 1 ug of total RNA and use PCR plates with a magnetic plate stand for this process TruSeq Stranded Total RNA Sample Preparation Guide DO VNH uoue pue ajajdag 01987 OQqly High Sample HS Protocol 96 ley NOTE Allow the rRNA Removal Beads and the RNAClean XP Beads to fully pellet against the magnetic stand for 1 minute and 5 minutes respectively Remove the supernatant from the beads immediately while the beads are still pelleted against the magnetic stand Do not allow the rRNA Removal Bead pellets to dry amp NOTE The RNAClean XP bead wash steps use 70 Ethanol while 80 Ethanol is used for AMPure XP bead washes Item Elute Prime Fragment High Mix EPH Elution Buffer ELB One of the following depending on the kit you are using Globin Removal Mix GRM Ribo Zero Globin kit contents rRNA Removal Mix RRM Ribo Zero Human Mouse Rat kit contents rRNA Removal Mix Gold RRM C Ribo Zero Gold kit contents rRNA Removal Mix Plant RRM P Ribo Zero Plant kit contents Resuspension Buffer
51. ble by Illumina but in no event later than 12 months from the date of shipment With respect to custom Consumables i e Consumables made to specifications or designs made by Purchaser or provided to Illumina by or on behalf of Purchaser Illumina only warrants that the custom Consumables will be made and tested in accordance with Illumina s standard manufacturing and quality control processes Illumina makes no warranty that custom Consumables will work as intended by Purchaser or for Purchaser s intended uses b Warranty for Hardware Illumina warrants that Hardware other than Upgraded Components will conform to its Specifications for a period of 12 months after its shipment date from Illumina unless the Hard ware includes Illumina provided installation in which case the warranty period begins on the date of installation or 30 days after the date it was delivered whichever occurs first Base Hardware Warranty Upgraded Components means Illumina provided components modifications or enhancements to Hardware that was previously acquired by Purchaser Illumina warrants that Upgraded Components will conform to their Specifications for a period of 90 days from the date the Upgraded Components are installed Upgraded Components do not extend the warranty for the Hardware unless the upgrade was conducted by Illumina at Illumina s facilities in which case the upgraded Hardware shipped to Purchaser comes with a Base Hardware Warranty c Exclusions fr
52. by adding beads to the sample in the BRP plate Adding the sample from the BRP plate to beads in the RRP plate in step 3 will ensure optimal performance 3 Remove the adhesive seal from the BRP plate 4 Tansfer the entire contents 20 ul from each well of the BRP plate to the corresponding well of the RRP plate containing rRNA Removal Beads 5 Adjust the pipette to 45 ul then with the tip of the pipette at the bottom of the well pipette quickly up and down 20 times to mix thoroughly NOTE It is important to pipette up and down quickly to ensure thorough mixing Insufficient mixing leads to lower levels of rRNA depletion Pipetting with the tips at the bottom of the well and not pipetting the entire volume of the solution help prevent the solution from foaming Excessive foaming leads to sample loss because the foam is not transferred out of the plate efficiently T 6 Incubate the RRP plate at room temperature for 1 minute 7 Place the RRP plate on the magnetic stand at room temperature for 1 minute 8 Transfer all of the supernatant from each well of the RRP plate to the corresponding well of the new 96 well 0 3 ml PCR plate labeled with the RCP barcode 9 Place the RCP plate on the magnetic stand at room temperature for 1 minute NOTE j If any beads remain in the wells of the RCP plate place the RCP plate on the magnet stand for 1 minute and then transfer the supernatant to a new 0 3 ml PCR plate Repeat as necessary until
53. care not to disturb the beads Repeat steps 6 and 7 one time for a total of two 8076 EtOH washes With the ALP plate on the magnetic stand let the samples air dry at room temperature for 15 minutes Remove the ALP plate from the magnetic stand Add 52 5 ul Resuspension Buffer to each well of the ALP plate Gently pipette the entire volume up and down 10 times to mix thoroughly or until the beads are fully resuspended Incubate the ALP plate at room temperature for 2 minutes Place the ALP plate on the magnetic stand at room temperature for 5 minutes or until the liquid is clear Transfer 50 ul supernatant from each well of the ALP plate to the corresponding well of the new 0 3 ml PCR plate labeled with the CAP barcode Take care not to disturb the beads Vortex the AMPure XP Beads until they are well dispersed Add 50 ul of mixed AMPure XP Beads to each well of the CAP plate for a second cleanup Gently pipette the entire volume up and down 10 times to mix thoroughly Incubate the CAP plate at room temperature for 15 minutes Place the CAP plate on the magnetic stand at room temperature for 5 minutes or until the liquid is clear Remove and discard 95 ul supernatant from each well of the CAP plate Take care not to disturb the beads Part 15031048 Rev E 20 21 22 23 24 25 26 27 NOTE E Leave the CAP plate on the magnetic stand while performing the following 80 EtOH wash steps 20 22 With the CAP p
54. ccccccccccccccccccccccccccccccccooo 117 Table 21 Illumina General Contact Information o ooocccccccccccccccccccccccccccccccccoo 127 Table 22 Illumina Customer Support Telephone Numbers 127 TruSeq Stranded Total RNA Sample Preparation Guide XI Part 15031048 Rev E Overview Introduction a Ls onset bbb oh ddd deeds apto paiida 2 Protocol Features nine 4 RNA Input Recommendations occccccccccccccccnncnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnncccccos 6 In Eine Gontrol DINI 24 rt r eA rastas 8 Additional Resources 2 2 ieee cece cece cece ce cccceecececccceccececccceeceeeececceeeeeetecceeeees 10 poms at e uma a em a e p IB y Ar vf Cn n m SI TOC GE CA riy vegas ne Sn keane vcn am vo 3e Loca oa TruSeq Stranded Total RNA Sample Preparation Guide 1 LJe1deuo Overview Introduction This protocol explains how to convert total RNA into a library of template molecules of known strand origin and suitable for subsequent cluster generation and DNA sequencing using the reagents provided in the Illumina TruSeq Stranded Total RNA Sample Preparation kits TruSeq Stranded Total RNA with Ribo Zero Human Mouse Rat TruSeq Stranded Total RNA with Ribo Zero Gold and TruSeq Stranded Total RNA with Ribo Zero Globin support human mouse and rat organisms whereas TruSeq Stranded Total RNA with Ribo Zero Plant supports plant species All TruSeq Stranded Total RNA kits follow the same w
55. cles To maximize the use of the RAP process more than 24 samples at a time These samples can then be pooled in any supported configuration Stop Ligation Buffer NOTE k Do not remove the Ligation Mix tube from 15 C to 25 C storage until instructed to do so in the procedures sJo1depy oe1e6r Ligation Control NOTE The use of the Ligation Control is optional and it can be replaced with the same volume of Resuspension Buffer Remove the Resuspension Buffer from 2 C to 8 C storage and bring it to room temperature Remove the AMPure XP Beads from storage and let stand for at least 30 minutes to bring them to room temperature Review Best Practices for Handling Magnetic Beads See Additional Resources on page 10 for information on how to access TruSeq Stranded Total RNA Sample Preparation Best Practices on the Illumina website Pre heat the microheating system 1 to 30 C Apply a CAP barcode label to a new 96 well MIDI plate Apply a PCR barcode label to a new 96 well HSP plate Add LIG 1 Do one of the following If using RNA Adapter tubes centrifuge the thawed tubes to 600 x g for 5 seconds If using a RAP Thaw the plate for 10 minutes at room temperature on the benchtop Visually inspect the wells to make sure that they all are thawed Remove the adapter plate tape seal TruSeq Stranded Total RNA Sample Preparation Guide v 5 High Sample HS Protocol 76 Centrifuge the plate to 280 x g for 1 minute to collect all o
56. contents of this appendix confirmed your kit contents and obtained all of the requisite consumables and equipment 9 2 Part 15031048 Rev E Acronyms Table 9 TruSeq Stranded Total RNA Sample Preparation Acronyms Acronym ALP ATL BRP CAP CCP cDNA CPP CIA CTE ML DCT DFP ds cDNA ELB EPH EUG FFPE FSA Definition Adapter Ligation Plate A Tailing Mix Bind rRNA Plate Clean Up ALP Plate cDNA Clean Up Plate Complementary DNA Clean Up PCR Plate A Tailing Control End Repair Control Ligation Control Diluted Cluster Template Depleted RNA Fragmentation Plate Double Stranded Complimentary DNA Elution Buffer Elute Prime Fragment High Mix Experienced User Card Formalin Fixed Paraffin Embedded First Strand Synthesis Act D Mix TruSeq Stranded Total RNA Sample Preparation Guide Q 3 sul uoJov Supporting Information 94 Acronym GRM HS LIG LT PCR PMM RCP RRMP Definition Globin Removal Mix High Sample High Throughput Ligation Mix Low Throughput Polymerase Chain Reaction PCR Master Mix RNA Adapter Plate RNA CleanUp Plate rRNA Removal Mix rRNA Removal Mix Plant Part 15031048 Rev E Acronym Definition rRNA Ribosomal RNA RRP rRNA Removal Plate RSB Resuspension Buffer SMM Second Strand Marking Master Mix STIL Stop Ligation Buffer TSP Target Sample Plate TruSeq Stranded Total RNA Sample Preparation Guide 95 suJ uoJov Support
57. e 3 end of the adapter provides a complementary overhang for ligating the adapter to the fragment This strategy ensures a low rate of chimera concatenated template formation Consumables Item Quantity Storage Optional A Tailing Control 1 tube per 48 15 C to 25 C CTA reactions A Tailing Mix ATL 1 tube per 48 15 C to 25 C reactions Resuspension Buffer RSB 1 tube 2 C to 8 C Ice As needed to place a 15 to 252 plate on Microseal B Adhesive Seal 1 15 C to 30 C RNase DNase free Eight Tube 3 TIC io EE Strips and Caps if using multichannel pipettes RNase DNase free Reagent 3 15 C to 30 C Reservoirs if using multichannel pipettes 7O Supplied By Ilumina Illumina Illumina User User User User Part 15031048 Rev E Add ATL Preparation 1 Remove the following from 15 C to 25 C storage and thaw them at room temperature A Tailing Control NOTE The use of the A Tailing Control is optional and it can be replaced with the same volume of Resuspension Buffer A Tailing Mix Remove the Resuspension Buffer from 2 C to 8 C storage and bring it to room temperature Remove the ALP plate from 15 C to 25 C storage if it was stored at the conclusion of Clean Up DFP on page 68 Let it thaw at room temperature Centrifuge the thawed ALP plate to 280 x g for 1 minute Remove the adhesive seal from the ALP plate Pre heat two microheating systems system 1
58. e DFP plate from the thermal cycler and place it on the bench 3 Remove the adhesive seal from the DFP plate 4 Letthe DFP plate stand to bring it to room temperature Clean Up DFP 1 Vortex the AMPure XP beads until they are well dispersed 2 Add 90 ul of well mixed AMPure XP beads to each well of the new MIDI plate labeled with the CCP barcode 3 Transfer the entire contents from each well of the DFP plate to the corresponding well of the CCP plate containing AMPure XP beads Mix thoroughly as follows a Seal the CCP plate with a Microseal B adhesive seal b Shake the CCP plate on a microplate shaker at 1800 rpm for 2 minutes 4 Incubate the CCP plate at room temperature for 15 minutes 5 Centrifuge the CCP plate to 280 x g for 1 minute 6 Remove the adhesive seal from the CCP plate 7 Place the CCP plate on the magnetic stand at room temperature for 5 minutes to make sure that all of the beads are bound to the side of the wells 8 Remove and discard 135 ul supernatant from each well of the CCP plate 68 Part 15031048 Rev E 10 11 12 13 14 15 16 17 18 19 NOTE Leave the CCP plate on the magnetic stand while performing the following 80 EtOH wash steps 9 11 With the CCP plate on the magnetic stand add 200 ul freshly prepared 80 EtOH to each well without disturbing the beads Incubate the CCP plate at room temperature for 30 seconds and then remove and discard all of the supernatant from each w
59. e new 96 well 0 3 ml PCR plate labeled with the BRP barcode 2 Add5 ul of rRNA Binding Buffer to each well of the BRP plate 2 O Part 15031048 Rev E Add 5 ul of one of the following reagents to each well of the BRP plate depending on the kit you are using Globin Removal Mix rRNA Removal Mix rRNA Removal Mix Gold rRNA Removal Mix Plant Gently pipette the entire volume of each well of the BRP plate up and down 6 times to mix thoroughly Seal the BRP plate with a Microseal B adhesive seal Return the following to 15 C to 25 C storage rRNA Binding Buffer One of the following depending on the kit you are using Globin Removal Mix rRNA Removal Mix rRNA Removal Mix Gold rRNA Removal Mix Plant Incubate 1 BRP 1 Make RRP 1 Place the sealed BRP plate on the pre programmed thermal cycler Close the lid then select and run the RNA Denaturation program a Choose the pre heat lid option and set to 100 C b 68 C for 5 minutes After the 5 minute incubation place the BRP plate on the bench and incubate at room temperature for 1 minute Vortex the room temperature rRNA Removal Bead tube vigorously to resuspend the beads Add 35 ul of rRNA Removal Beads to each well of the new 96 well 0 3 ml PCR plate labeled with the RRP barcode TruSeq Stranded Total RNA Sample Preparation Guide 2 1 VNH 1uauuBeJ4J pue 9 90 d9eq 01987 oqly Low Sample LS Protocol ley NOTE It is important not to skip this step
60. eed immediately to Enrich DNA Fragments on page 81 you can 1 safely stop the protocol here If you are stopping seal the PCR plate with a Microseal B adhesive seal and store at 15 C to 25 C for up to seven days Part 15031048 Rev E Enrich DNA Fragments This process uses PCR to selectively enrich those DNA fragments that have adapter molecules on both ends and to amplify the amount of DNA in the library The PCR is performed with a PCR Primer Cocktail that anneals to the ends of the adapters Minimize the number of PCR cycles to avoid skewing the representation of the library NOTE PCR enriches for fragments that have adapters ligated on both ends Fragments with only one or no adapters on their ends are by products of inefficiencies in the ligation reaction Neither species can be used to make clusters Fragments without any adapters cannot hybridize to surface bound primers in the flow cell Fragments with an adapter on only one end can hybridize to surface bound primers but cannot form clusters Consumables Item Quantity Storage Supplied By PCR Master Mix PMM 1 tube per 48 15 C to 25 C Ilumina reactions PCR Primer Cocktail PPC 1 tube per 48 15 C to 25 C Ilumina reactions Resuspension Buffer RSB 1 tube 2 C to 8 C Ilumina Barcode labels for 1 label per plate AE 0 0C Illumina CPP Clean Up PCR Plate barcode label TSP1 Target Sample Plate barcode label 96 well HSP Plate 1 15 C to 30 C User 96
61. een ooo c RIS 48 d TTE na ha e aiia 077 of ea gt n T rro m SI ATGC GG C ry vegas cce rCU O4 TruSeq Stranded Total RNA Sample Preparation Guide 1 3 c Je1deuo Low Sample LS Protocol Introduction This chapter describes the TruSeq Stranded Total RNA Sample Preparation LS protocol Illumina recommends the following kit sample number and protocol combinations Table 5 Kit and Sample Number Recommendations Number of Samples Recommended Processed Kit At One Time lt 24 ET 24 48 Eron HI gt 48 HT Table 6 Kit and Protocol Recommendations Kit Number of Number of Samples Protocol Samples Supported per Kit o LT 48 lt 48 LS gt 48 HS HT 96 lt 24 ES 224 HS Follow the protocol in the order described using the specified volumes and incubation parameters Before proceeding review the following Best Practices See Additional Resources on page 10 for information on how to access TruSeq Stranded Total RNA Sample Preparation Best Practices on the Illumina website TruSeq Sample Preparation Pooling Guide part 15042173 See Additional Resources on page 10 for information on how to download the guide from the Illumina website 1 a Part4 15031048 Rev E Appendix A Supporting Information Confirm your kit contents and make sure that you have obtained all of the requisite equipment and consumables for the ES protocol TruSeq Stranded Total RNA Sample Preparation Guide 1 5 uononpoJiu Low Sam
62. ell Repeat steps 9 and 10 one time for a total of two 80 EtOH washes Let the CCP plate stand at room temperature for 15 minutes to dry and then remove the CCP plate from the magnetic stand Centrifuge the thawed room temperature Resuspension Buffer to 600 x g for 5 seconds Add 17 5 ul Resuspension Buffer to each well of the CCP plate Mix thoroughly as follows a Seal the CCP plate with a Microseal B adhesive seal b Shake the CCP plate on a microplate shaker at 1800 rpm for 2 minutes Incubate the CCP plate at room temperature for 2 minutes Centrifuge the CCP plate to 280 x g for 1 minute Remove the adhesive seal from the CCP plate Place the CCP plate on the magnetic stand at room temperature for 5 minutes Transfer 15 ul supernatant ds cDNA from the CCP plate to the new MIDI plate labeled with the ALP barcode SAFESTOPPING POINT If you do not plan to proceed immediately to Adenylate 3 Ends on page 70 you can safely 1 stop the protocol here If you are stopping seal the ALP plate with a Microseal B adhesive seal and store at 15 C to 25 C for up to 7 days TruSeq Stranded Total RNA Sample Preparation Guide 6 9 VNQ9 pue4is puooesg aziseyju s High Sample HS Protocol Adenylate 3 Ends A single A nucleotide is added to the 3 ends of the blunt fragments to prevent them from ligating to one another during the adapter ligation reaction A corresponding single T nucleotide on th
63. ely Each reagent contains dsDNA fragments designed to report the success or failure of a specific enzymatic activity used in the library preparation process Sequencing determines the readout If the sequence of an in line control is in the final sequencing data viewed in the Sequence Analysis Viewer SAV it indicates that its corresponding step was successful If it does not or if it is in substantially diminished numbers it indicates the step failed The controls are intended for troubleshooting and are useful for identifying the specific mode of failure but are uninformative in cases where sequencing data are not generated from a library ley NOTE The use of these controls is optional and they can be replaced with the same volume of Resuspension Buffer The control molecules work through the design of their ends Controls are added to the reactions before their corresponding step in the protocol Their end structures match those of a DNA molecule that has not gone through the step If the step is successful the control molecule will be modified to participate in downstream reactions of library generation and resulting in sequencing data If the step fails the control molecule will not go forward in the process and no sequencing data will be generated Using 100 ng of starting material the controls yield approximately 0 276 of clusters although this can vary based on library yield Part 15031048 Rev E Table 4 In Line Control Functio
64. en using less RNA or highly degraded RNA these controls might need further dilution If no controls are added use Resuspension Buffer in place of the controls in the protocol It is important to know the quality of the RNA starting material The fragmentation conditions were optimized for high quality RNA Degraded RNAs are shorter than full length RNA If the same fragmentation conditions for degraded RNAs are used it will cause the libraries to be shorter and can result in low yield or failure of the protocol If starting with degraded RNA the fragmentation time must be adjusted to avoid over fragmentation of the RNA samples For more information see Appendix A Alternate Fragmentation Protocols RNA that has DNA contamination will result in an underestimation of the amount of RNA used 6 Part 15031048 Rev E The following figure shows a Universal Human Reference UHR starting RNA Bioanalyzer trace Figure 1 Starting RNA Bioanalyzer Trace suonepueuJulooeH 1ndu YNY Positive Control Illumina recommends using Agilent Technologies Human UHR total RNA catalog 740000 as a positive control sample for this protocol TruSeq Stranded Total RNA Sample Preparation Guide T Overview In Line Control DNA The End Repair Control A Tailing Control and Ligation Control reagents contain DNA fragments used as controls for the enzymatic activities of the Second Strand Marking Master Mix A Tailing Mix and Ligation Mix respectiv
65. eq Stranded Total RNA Sample Preparation Guide VI Part 4 15031048 15031048 15031048 Revision C B A Date September 2012 July 2012 April 2012 Description of Change Added New England Biolabs Inc licensing to notices Corrected PCR Primer Cocktail part number in LT Kit Contents Corrected kit name with 96 Sample cDNA Synthesis PCR Box Reformatted the consumables list at the start of each procedure to a table After initial thaw for each process that uses Resuspension Buffer added a preparation step to remove it from 2 C to 8 C storage Added TruSeq Stranded Total RNA HT Sample Prep Kit content and functionality to the following sections Usage Guidelines Kit Contents Indexed Adapter Sequences Adapter Options Pooling Guidelines Ligate Adapters procedures Enrich DNA Fragments procedures Normalize and Pool Libraries procedures Added reagent volume table to Usage Guidelines Revised Tracking Tools documentation download information Removed detailed Sample Sheet description from Tracking Tools Added instructions for which assay to select when using the Illumina Experiment Manager Corrected storage temperature for rRNA Binding Buffer and Elution Buffer as 2 to 8 C Added optional Agilent RNA 6000 Nano or Pico kits for alternative fragmentation to Consumables and Equipment list Specified storage temperature for Resuspension Buffer at 2 to 8 C after initial thaw Make
66. ero Gold kit contents rRNA Removal Mix Plant RRM P Ribo Zero Plant kit contents Resuspension Buffer RSB 1 tube 1 tube per 48 reactions rRNA Binding Buffer RBB Storage 15 C to 25 C PACO 15 C to 25 C 15 C to 25 C 15 C to 25 C Supplied By Ilumina Ilumina Ilumina Ilumina Ilumina Part 15031048 Rev E Item rRNA Removal Beads RRB Barcode labels for BRP Bind rRNA Plate DFP Depleted RNA Fragmentation Plate RCP RNA Clean Up Plate RRP rRNA Removal Plate 96 well 0 3 ml PCR Plates Freshly Prepared 70 Ethanol EtOH Microseal B Adhesive Seals RNAClean XP Beads RNase DNase free Eight Tube Strips and Caps if using multichannel pipettes RNase DNase free Reagent Reservoirs if using multichannel pipettes Ultra Pure Water Preparation Quantity 1 tube per 48 reactions 1 label per plate 4 200 ul per sample 2 99 ul per sample 6 Enough to dilute each total RNA sample to a final volume of 10 ul Storage 2AC U0 BAC 15 C to 30 C TC tro SUE 15 C to 30 C IBC to SUC 2 C to 8 C JI 0 OC 15 C to 30 C TIC e 30E Bs Supplied By O Mumi F lumina N D Illumina O UO D o D User fev User a T User g User 3 User O mD JJ User Z User Remove the following from 15 C to 25 C storage and thaw them at room temperature Elute Prime Fragment High Mix Tru
67. es and 8 bases are sequenced per indexed read Table 18 TruSeq Stranded Total RNA HT Sample Prep Kit Indexed Adapter 1 Sequences Adapter Sequence Adapter Sequence D701 ATTACTCG CTGAAGCT E ICE CNML o cacas Table 19 TruSeq Stranded Total RNA HT Sample Prep Kit Indexed Adapter 2 Sequences seouenbes Jeldepy pexepu Adapter Sequence Adapter Sequence D501 TATAGCCT AGGCGAAG D502 ATAGAGGC D506 TAATCTTA D503 CCTATCCT AA CAGGACGT D504 GGCTCTGA D508 GTACTGAC TruSeq Stranded Total RNA Sample Preparation Guide 1 1 3 1 1 A Part 15031048 Rev E Alternate Fragmentation Protocols v xipueddaw Introduction osodedig gto III I lIIIllILLLllllzlzlmLLLlllll222222211 116 Modify RNA Fragmentation Time for Intact RNA suuin enne 117 Modify RNA Fragmentation Time for Degraded RNA sseeeeeeeeeeeee 119 ff TruSeq Stranded Total RNA Sample Preparation Guide T15 Alternate Fragmentation Protocols Introduction 116 Fragmentation of the nucleic acids is required for optimal library preparation clustering and sequencing When starting with intact RNA the TruSeq Stranded Total RNA fragmentation protocol for transcriptome analysis is performed on the RNA after rRNA depletion using elevated temperatures This results in libraries with inserts ranging in size from 120 200 bp with a median size of 150 bp The TruSeq Stranded Total RNA fragmentation protocol ensures the best coverage of t
68. f Ligation Mix to each well of the ALP plate Low Sample LS Protocol 7 Return the Ligation Mix tube to 15 C to 25 C storage immediately after use 8 Do one of the following If using RNA Adapter tubes add 2 5 ul of the thawed RNA Adapter Index to each well of the ALP plate Gently pipette the entire volume up and down 10 times to mix thoroughly If using a RAP Place the RAP on the benchtop so that the part number barcode on the long side of the plate is facing you and the clipped corner is on the lower left Figure 4 Correct RAP Orientation 3 8 Part 15031048 Rev E 9 Do one of the following to pierce the foil seal If using the entire plate at one time use the bottom of a clean 96 well semi skirted PCR plate to pierce a hole in all of the well seals simultaneously Gently but firmly press the clean plate over the foil seal If using only part of the plate use the bottom of a clean eight tube strip with caps attached to pierce holes in the seals of the wells that will be used for ligation Repeat with a new clean eight tube strip with caps attached for each row or column of adapters that will be used for ligation Using an eight tip multichannel pipette transfer 2 5 ul of the thawed RNA Adapter from the RAP well to each well of the ALP plate Gently pipette the entire volume up and down 10 times to mix thoroughly Seal the ALP plate with a Microseal B adhesive seal 10 Centrifuge the ALP plate to 280 x g fo
69. f the adapter to the bottom of the well Remove the plastic cover Save the cover if you are not processing the entire plate at one time If it is the first time using this RAP apply the RAP barcode label to the plate Centrifuge the Ligation Control if using Ligation Control and Stop Ligation Buffer tubes to 600 x g for 5 seconds Immediately before use remove the Ligation Mix tube from 15 C to 25 C storage Remove the adhesive seal from the ALP plate Do one of the following If using the in line control reagent Dilute the Ligation Control to 1 100 in Resuspension Buffer For example 1 ul Ligation Control 99 ul Resuspension Buffer before use Discard the diluted Ligation Control after use Add 2 5 ul of diluted Ligation Control to each well of the ALP plate If not using the in line control reagent add 2 5 ul of Resuspension Buffer to each well of the ALP plate Add 2 5 ul of Ligation Mix to each well of the ALP plate Return the Ligation Mix tube to 15 C to 25 C storage immediately after use Do one of the following If using RNA Adapter tubes add 2 5 ul of the thawed RNA Adapter Index to each well of the ALP plate fusing a RAP Place the RAP on the benchtop so that the part number barcode on the long side of the plate is facing you and the clipped comer is on the lower left Figure 9 Correct RAP Orientation Part 15031048 Rev E Do one of the following to pierce the foil seal If using t
70. for 1 label per plate TIC e SNA Illumina CAP Clean Up ALP Plate PCR Polymerase Chain Reaction Plate RAP RNA Adapter Plate if using the HT kit sJe1depy oe1e6r TruSeq Stranded Total RNA Sample Preparation Guide 3 5 O S Item Quantity Storage Supplied By o 96 well 0 3 ml PCR Plates 2 15 C to 30 C User pes CL AMPure XP Beads 92 ul per sample 2C a9 BAC User 0 Freshly Prepared 80 Ethanol 800 ul per sample 15 C to 30 C User EtOH or eb Microseal B Adhesive Seals 2 ISAC tig BOC User Q RNase DNase free Eight Tube 4 28 15 C to 30 C User Strips and Caps a if using multichannel pipettes o RNase DNase free Reagent 4 28 15 to 30 E User Reservoirs 9 if using multichannel pipettes Preparation Remove the following from 15 C to 25 C storage and thaw them at room temperature Appropriate RNA Adapter tubes depending on the RNA Adapter Indices being used or the RAP NOTE Review the TruSeq Sample Preparation Pooling Guide part 15042173 See Additional Resources on page 10 for information on how to download the guide from the Illumina website When indexing libraries using adapter index tubes Illumina recommends arranging samples that are going to be combined into a common pool in the same row Also include a common index in each column This arrangement facilitates pipetting operations when dispensing indexed adapters and pooling indexed libraries later in the protocol
71. gent 1 2 RRB 3 DTL 4 DTE 5 DTA 96 Samples Ribo Zero Box Part 15031727 15026807 15026766 15026805 Description rRNA Removal Beads CTL Dilution Tube CTE Dilution Tube CTA Dilution Tube Storage Temperature 2 C to 8 C Room Temperature Room Temperature Room Temperature You will receive one of the following boxes depending on the kit ordered These boxes also contain plate barcode labels Store as specified This box is shipped on dry ice As soon as you receive it store the following components as specified Figure 21 TruSeq Stranded Total RNA HT Sample Prep Kit 96 Samples Ribo Zero TruSeq Stranded Total RNA Sample Preparation Guide 105 S1u91U02 1M Supporting Information Ribo Zero H M R part 15032626 Slot Reagent Part Description Storage Temperature 1 2 15031737 rRNA Binding Buffer 15 C to 25 C 34 15 C to 25 C 5 PC to C 7 8 15029211 Elute Prime Fragment High Mix 15 C to 25 C Ribo Zero Gold part 15032627 Slot Reagent Part Description Storage Temperature 1 2 RBB 15031737 rRNA Binding Buffer 15 C to 25 C 34 15 C to 25 C 5 6 PCFC 7 8 15029211 Elute Prime Fragment High Mix 15 C to 25 C Ribo Zero Plant part 15035749 Slot Reagent Part Description Storage Temperature 1 2 15031737 rRNA Binding Buffer 15 C to 25 C 34 15 C to 25 C 5 6 2 C to 8 C 7 8 15029211 Elute Prime Fragment High Mix
72. ghly 3 Seal the ALP plate with a Microseal B adhesive seal TruSeq Stranded Total RNA Sample Preparation Guide 3 3 Spu3 e aje huspy Low Sample LS Protocol Incubate 1 ALP 1 Place the sealed ALP plate on the pre programmed thermal cycler Close the lid then select and run the ATAIL70 program a Choose the pre heat lid option and set to 100 C b 37 C for 30 minutes c 70 C for 5 minutes d Hold at 4 C 2 When the thermal cycler temperature is 4 C remove the ALP plate from the thermal cycler then proceed immediately to Ligate Adapters on page 35 3 A Part 15031048 Rev E Ligate Adapters This process ligates multiple indexing adapters to the ends of the ds cDNA preparing them for hybridization onto a flow cell Consumables Item Quantity Storage Supplied By Optional Ligation Control 1 tube per 48 15 C to 25 C Ilumina CTL reactions Choose from the following 1 tube of each index 15 to 25 C Illumina depending on the kit you are being used per using column of 8 reactions TruSeq Stranded Total RNA or LT Sample Prep Kit contents 1 RAP RNA Adapter Indices AR001 AR016 ARO18 AR023 AR025 AR027 TruSeq Stranded Total RNA HT Sample Prep Kit contents RAP RNA Adapter Plate Ligation Mix LIG 1 tube per 48 15 C to 25 C Ilumina reactions Resuspension Buffer RSB 1 tube 2 Cto E Illumina Stop Ligation Buffer STL 1 tube per 48 15 C to 25 C Ilumina reactions Barcode labels
73. h indexed gt 24 with indexed processed at one time adapter plate adapter plate Plate Type 96 well 0 3 ml PCR 96 well HSP 96 well MIDI 96 well MIDI Incubation Equipment 96 well thermal cycler 96 well thermal cycler Microheating system Mixing Method Pipetting Microplate shaker Ilumina recommends the following kit sample number and protocol combinations Table 2 Kit and Sample Number Recommendations Number of Samples Recommended Processed Kit At One Time 24 ET 24 48 JLT xe ant gt 48 HT 4 Part 15031048 Rev E Table 3 Kit and Protocol Recommendations Kit Number of Samples Supported TruSeq Stranded Total RNA Sample Preparation Guide Number of Samples Processed At One Time Protocol ES HS LS HS 9 N 894 0901014 Overview RNA Input Recommendations It is important to follow the TruSeq Stranded Total RNA Sample Preparation input recommendations Total RNA Input This protocol is optimized for 0 1 1 ug of total RNA Lower amounts might result in inefficient ligation and low yield The protocol has been tested using 0 1 1 ug of high quality universal human reference total RNA as input Use of RNA from other species tissues or qualities might require further optimization regarding the initial input amount The protocol recommends diluting the in line controls for tracking the steps involved in converting dsDNA into libraries The dilution is optimized for 0 1 1 ug of high quality input RNA Wh
74. he entire plate at one time use the bottom of a clean 96 well semi skirted PCR plate to pierce a hole in all of the well seals simultaneously Gently but firmly press the clean plate over the foil seal If using only part of the plate use the bottom of a clean eight tube strip with caps attached to pierce holes in the seals of the wells that will be used for ligation Repeat with a new clean eight tube strip with caps attached for each row or column of adapters that will be used for ligation Using an eight tip multichannel pipette transfer 2 5 ul of the appropriate thawed RNA Adapter from the RAP well to each well of the ALP plate 9 Mix thoroughly as follows a Seal the ALP plate with a Microseal B adhesive seal b Shake the ALP plate on a microplate shaker at 1800 rpm for 2 minutes 10 Centrifuge the ALP plate to 280 x g for 1 minute Incubate 2 ALP 1 Place the sealed ALP plate on the pre heated microheating system Close the lid and incubate at 30 C for 10 minutes 2 Remove the ALP plate from the microheating system Add STL 1 Remove the adhesive seal from the ALP plate 2 Add 5 ul of Stop Ligation Buffer to each well of the ALP plate to inactivate the ligation mix Mix thoroughly as follows a Seal the ALP plate with a Microseal B adhesive seal b Shake the ALP plate on a microplate shaker at 1800 rpm for 2 minutes 3 Centrifuge the ALP plate to 280 x g for 1 minute Clean Up ALP 1 Remove the adhesive
75. he transcriptome with efficient library production Illumina recognizes that some customers have different purposes for their sequencing experiments The need for larger inserts is greater than the need for the best coverage for applications such as splice variant analysis studies To vary the insert size of your library see Modify RNA Fragmentation Time for Intact RNA on page 117 Illumina also recognizes that it is not always possible to extract intact total RNA For instance RNA extracted from FFPE samples is typically degraded To vary the fragmentation time for degraded RNA see Modify RNA Fragmentation Time for Degraded RNA on page 119 Part 15031048 Rev E Modify RNA Fragmentation Time for Intact RNA To modify the fragmentation of the RNA to allow for longer RNA fragments the time of fragmentation can be shortened This is accomplished during the Ribo Zero Deplete and Fragment RNA procedures by modifying the thermal cycler Elution 2 Frag Prime program 94 C for X minutes followed by a 4 C hold for the thermal cycler X is determined by the length of RNA desired A range of suggested times and sizes is described in Table 20 Table 20 Library Insert Fragmentation Time Time at 94 C Range of Insert Median Insert Average Final Library Size minutes Length bp Length bp Bioanalyzer bp 0 130 350 200 467 1 130 310 190 439 2 130 290 185 410 3 125 250 165 366 4 120 225 160 326 8 120 210 155 309 12 115 180 140 272 a
76. here are remaining columns in the DCT plate The result is a PDP plate with pooled samples in column 1 Mix the PDP plate as follows Seal the PDP plate with a Microseal B adhesive seal Shake the PDP plate on a microplate shaker at 1800 rpm for 2 minutes Centrifuge the PDP plate to 280 x g for 1 minute Remove the adhesive seal from the PDP plate Combine the contents of each well of column 1 into well A2 of the PDP plate for the final pool 3 Mix the PDP plate as follows a Seal the PDP plate with a Microseal B adhesive seal b Shake the PDP plate on a microplate shaker at 1800 rpm for 2 minutes 4 Centrifuge the PDP plate to 280 x g for 1 minute 5 Do one of the following Proceed to cluster generation For more information see the cluster generation section of the user guide for your Illumina platform Store the sealed PDP plate at 15 C to 25 C 9 O Part 15031048 Rev E Supporting Information Introduction ccc 92 ACLONYIMS o oo dee klk beni ti ei 93 WIE COTS soe aes ERROREM 96 Consumables and Equipment 2 0 0 0 cece cece c cece cece esses ee ellen ssl 107 Indexed Adapter Sequences 2 2 eee cce cee cccccccceecccccceceecccccceceeeccccceeeeeeecees 111 AA e pur 977 Sr aAI mi IA TGE GG CA ripa vegas enano TruSeq Stranded Total RNA Sample Preparation Guide 9 1 v xipueddw Supporting Information Introduction The protocols described in this guide assume that you have reviewed the
77. hesis Act D Mix from 15 C to 25 C storage and thaw it at room temperature TruSeq Stranded Total RNA Sample Preparation Guide 6 3 VNQ pues 18114 eziseuu S High Sample HS Protocol Add FSA 64 Pre program the thermal cycler with the following program and save as Synthesize 1st Strand Choose the pre heat lid option and set to 100 C 25 C for 10 minutes 42 C for 15 minutes 70 C for 15 minutes Hold at 4 C Make sure that the microplate shaker is properly calibrated to 1000 rpm using a stroboscope 4 NOTE The First Strand Synthesis Mix Act D with SuperScript II added is stable to additional freeze thaw cycles and can be used for subsequent experiments If more than six freeze thaw cycles are anticipated divide the First Strand Synthesis Mix Act D and SuperScript II mix into smaller aliquots and store at 15 C to 25 C Remove the adhesive seal from the DFP plate Centrifuge the thawed First Strand Synthesis Mix Act D tube to 600 x g for 5 seconds Add 50 ul SuperScript II to the First Strand Synthesis Act D Mix tube Mix gently but thoroughly and centrifuge briefly If you are not using the entire contents of the First Strand Synthesis Act D Mix tube add SuperScript II at a ratio of 1 ul SuperScript II for each 9 ul First Strand Synthesis Act D Mix Label the First Strand Synthesis Mix Act D tube to indicate that the SuperScript II has been added Add 8 ul of First Strand Synthesis Mix Act D and SuperScript II mix to
78. his Product or components thereof to any analysis not expressly authorized in this Products Documentation iii gain access to or attempt to determine the methods of operation of this Product or iv transfer to a third party or grant a sublicense to any Software or any third party software Purchaser further agrees that the contents of and methods of operation of this Product are proprietary to Illumina and this Product contains or embodies trade secrets of Illumina The conditions and restrictions found in these terms and conditions are bargained for conditions of sale and therefore control the sale of and use of this Product by Purchaser 5 Limited Liability TO THE EXTENT PERMITTED BY LAW IN NO EVENT SHALL ILLUMINA OR ITS SUPPLIERS BE LIABLE TO PURCHASER OR ANY THIRD PARTY FOR COSTS OF PROCUREMENT OF SUBSTITUTE PRODUCTS OR SERVICES LOST PROFITS DATA OR BUSINESS OR FOR ANY INDIRECT SPECIAL INCIDENTAL EXEMPLARY CONSEQUENTIAL OR PUNITIVE DAMAGES OF ANY KIND ARISING OUT OF OR IN CONNECTION WITH WITHOUT LIMITATION THE SALE OF THIS PRODUCT ITS USE ILLUMINA S PERFORMANCE HEREUNDER OR ANY OF THESE TERMS AND CONDITIONS HOWEVER TruSeq Stranded Total RNA Sample Preparation Guide ARISING OR CAUSED AND ON ANY THEORY OF LIABILITY WHETHER IN CONTRACT TORT INCLUDING NEGLIGENCE STRICT LIABILITY OR OTHERWISE ILLUMINA S TOTAL AND CUMULATIVE LIABILITY TO PURCHASER OR ANY THIRD PARTY ARISING OUT OF OR IN CONNECTION WITH THESE TERMS AND CONDITIO
79. illumina TruSeq Stranded Total RNA sample Preparation Guide ACGAAAAGAATGATAACAGTAACACACTTCTGTTAACCTTAAGATTACTTGATCCACTGATTCAACGTACCGTAAAGATTACTTGATCCACTGATTCAACGTACCGTAACGAACGTATCAATTGAGACTAAATAT TAACGTACCAT TAAGAGCTACCGT AATGATAACAGTAACACACTTCTGTTAACCTTAAGATTACTTGT TGATCCACTGAT TCAACGTACCG TATCAAT TGAGAC TAAATAT TAACGTACCAT TAAGAGCTACCGTCTTCTGTTAACCTTAAGAT TACT TGATCCACTGAT TCAACGTACCGTAA CT LEER Dean TAG Pe GUC TA TOG AREN AACGAACGT TRA RAGAT DAMES USC T ACCATTAAGAGCTACCGTCTTCTGT T e PS al Y ACCGIAACGAAC ACGAAAAGAATGATAACAGTAACACACTTCTGTTAACCTTAAGAT T ATCCACTGATTCAACGTACCGTAAAGATTACTTGATCCACTGAT TCAACGTACCGTAACGAA TTGAGACTAAATAT TAACGTACCAT TAAGAGCTACCGT AAT EATAACAGTRACAGAS LIC TGLTAACCTIAAGATIAGTTGATCCACT GATICAAGGTACCGTAACGAACG TAT GANTT GAGAC TAAATAT TAACGTACCATTAAGAGCIACUGTOIICTOLAACC LTAAGATTAC TIGATCCAC TAT CAACITA PAT TAA HAA DV ESTIS AACCTTAAGATTACTTGATCCACTGAT TCAACGTACCGTAACGAACGTATCAATTGAGACTAAATATTAACGTACCAT TAAGAGCT TCTGTTAACCT TAAGAT TACTTGATCCACTGATTCAACGTACCGTAAC CGTATCAATTGAGAC TAAATAT TAACGTACT TAACCT TAAGAT TACT TGATCCACTGATTCAACGTACCGTAACGAACG TCTTC TGT TAACC T TAAGAT TAC T TGATCCACTGATTCAACGTACCGTAACGAACG TATCAAT TGAGAC TAACGACGAAA GAGAC TAAATAT TAACGTACCAT TAAGAGCTACAACCT TAAGAT TACT TGATCCACTGAT TCAACGTACCGTAACGAACGTAT CAAT TGAGACTAAATAT TAACG TACCAT TAAGAGC TACCGTGCAACGACGAAAAGAAT GATAACAGTAACACACT a NO ATE Gad TASA oS Ta TAA CAO Toe TTC T TAS MARA TACT a Leg PARIS ALS EL GTACCATTAAGAGC TACCGTGCAACTTAACCTTAAGAT TACTTGATCCA
80. ing Information Kit Contents 96 Check to make sure that you have all of the reagents identified in this section before starting the TruSeq Stranded Total RNA Sample Preparation protocol The TruSeq Stranded Total RNA LT Sample Prep Kits are available as Set A and B Each TruSeq Stranded Total RNA LT Sample Prep Kit contains enough reagents to prepare up to 24 samples When used together TruSeq Stranded Total RNA LT Sample Prep Kits A and B allow for pooling up to 24 samples using the 12 different indices in each Kit Table 10 TruSeq Stranded Total RNA Sample Preparation Kits Kit Name Catalog Number Number of of Samples Indices Supported TruSeq Stranded Total RNA LT RS 122 2201 48 12 Sample Prep Kit Set A with Ribo Zero Human Mouse Rat TruSeq Stranded Total RNA LT RS 122 2202 48 12 Sample Prep Kit Set B with Ribo Zero Human Mouse Rat TruSeq Stranded Total RNA HT RS 122 2203 96 96 Sample Prep Kit with Ribo Zero Human Mouse Rat TruSeq Stranded Total RNA LT RS 122 2301 48 12 Sample Prep Kit Set A with Ribo Zero Gold TruSeq Stranded Total RNA LT RS 122 2302 48 12 Sample Prep Kit Set B with Ribo Zero Gold Part 15031048 Rev E Kit Name Catalog Number Number of of Samples Indices Supported TruSeq Stranded Total RNA HT RS 122 2303 96 96 Sample Prep Kit with Ribo Zero Gold TruSeq Stranded Total RNA LT RS 122 2401 48 12 Sample Prep Kit Set A with Ribo Zero Plant TruSeq Stranded
81. ion Buffer RSB 1 tube PAC to E Illumina Second Strand Marking Master 1 tube per 48 15 C to 25 C Illumina Mix SMM reactions ALP Adapter Ligation Plate 1 label per plate TIC ti SOE Illumina Barcode Label 96 well 0 3 ml PCR Plate 1 15 C to 30 C User AMPure XP Beads 90 ul per sample 2C tio C User Freshly Prepared 8076 Ethanol 400 ul per sample 15 C to 30 C User EtOH Microseal B Adhesive Seals 2 TIS PC e SUE User RNase DNase free Eight Tube 5 15 C to 30 C User Strips and Caps if using multichannel pipettes RNase DNase free Reagent 5 ISS tro S0 User Reservoirs if using multichannel pipettes 2 8 Part 15031048 Rev E Preparation Remove the following from 15 C to 25 C storage and thaw them at room temperature End Repair Control ley NOTE The use of the End Repair Controlis optional and it can be replaced with the same volume of Resuspension Buffer Second Strand Marking Master Mix Remove the Resuspension Buffer from 2 C to 8 C storage and bring it to room temperature Remove the AMPure XP beads from storage and let stand for at least 30 minutes to bring them to room temperature Review Best Practices for Handling Magnetic Beads See Additional Resources on page 10 for information on how to access TruSeq Stranded Total RNA Sample Preparation Best Practices on the Illumina website Pre heat the thermal cycler to 16 C Choose the thermal cycler pre heat lid option and set to 30 C Apply an ALP barcode
82. ive Seals 7 15 C to 30 C User E RNase DNase free Eight Tube 4 28 15 to 30 C User o Strips and Caps if using multichannel pipettes X O RNase DNase free Reagent 4 28 15 C to 30 C User T Reservoirs if using multichannel pipettes Preparation Remove the following from 15 C to 25 C storage and thaw them at room temperature Appropriate RNA Adapter tubes depending on the RNA Adapter Indices being used or the RAP NOTE f Review the TruSeq Sample Preparation Pooling Guide part 15042173 See Additional Resources on page 10 for information on how to download the guide from the Illumina website When indexing libraries using adapter index tubes Illumina recommends arranging samples that are going to be combined into a common pool in the same row Also include a common index in each column This arrangement facilitates pipetting operations when dispensing indexed adapters and pooling indexed libraries later in the protocol When indexing libraries with the RAP arrange samples that will be pooled together in the same orientation as the indices in the RAP F 4 Part 15031048 Rev E NOTE When indexing libraries with the RAP Review Handling Adapter Plate in the TruSeq Sample Preparation Pooling Guide part 15042173 See Additional Resources on page 10 for information on how to download the guide from the Illumina website Illumina recommends that the RAP does not undergo more than four freeze thaw cy
83. ize Second Strand cDNA suuutLtuuuususu Adenylate 3 Ends 2 222 222 0000 Ligate Adapters o ooooooocccccccccccccccccccconccccccnnnnccccccio Enrich DNA Fragments 022 2222 eee cece ee eee eee ee Validate Library 0 222 2220 Normalize and Pool Libraries 0000000 0002 Appendix A Supporting Information ooo TruSeq Stranded Total RNA Sample Preparation Guide Introduction s erect tte eet e tete aene e A 92 AGFODVITISTTE bae O bmi te ae neo oe atest os lr a Rennie Lise 93 KItCODterits sco LS dor Ble ee e eut la t S i RAD ober 96 Consumables and Equipment o ooocccccccccccccccccccconccccccccccnnnnnncccccccns 107 Indexed Adapter Sequences oocccccccccccccccccccccccccccccccccccccncccccncccons 111 Appendix A Alternate Fragmentation Protocols ooo 115 Introduction e P e AA BANS BRE Lh el gs eee ees 116 Modify RNA Fragmentation Time for Intact RNA 117 Modify RNA Fragmentation Time for Degraded RNA 119 E 125 Technical Assistance ba 127 X Part 15031048 Rev E List of Tables Table 1 Protocol Features 22 ccc cee ce cece cccceececececcceceeeeeeecececeeeeeteeeeee 4 Table 2 Kit and Sample Number Recommendations 222222 22202222 eee 4 Table3 Kit and Protocol Recommendations ooooooccccccccccccccccccccccccnnncccccccnoos 5 Table 4 In Line Control Functions seseeessss
84. ks As soon as you receive it store the following components as specified Figure 14 TruSeq Stranded Total RNA LT Sample Prep Kit 48 Samples Box 1 of 2 part 4 15032615 Slot Reagent Part Description Storage Temperature 1 DTE 15026766 CTE Dilution Tube Room Temperature 2 DTA 15026805 CTA Dilution Tube Room Temperature 3 DTL 15026807 CTL Dilution Tube Room Temperature 4 RRB 15031727 rRNA Removal Beads 2 C to 8 C 48 Samples Ribo Zero Box You will receive one of the following boxes depending on the kit ordered These boxes also contain plate barcode labels Store as specified This box is shipped on dry ice As soon as you receive it store the following components as specified 1 OO Part 15031048 Rev E Figure 15 TruSeq Stranded Total RNA LT Sample Prep Kit 48 Samples Ribo Zero Slot Reagent Part Description Storage Temperature 1 15 C to 25 C 2 15 C to 25 C 3 2 C to BO 4 Elute Prime Fragment High Mix 15 C to 25 C Ribo Zero Gold part 15032619 Slot Reagent Part Description Storage Temperature 1 RBB 15031737 rRNA Binding Buffer 15 C to 25 C 2 15 C to 25 C 3 PCOSC 4 Elute Prime Fragment High Mix 15 C to 25 C Ribo Zero Plant part 15035748 Slot Reagent Part Description Storage Temperature 1 RBB 15031737 rRNA Binding Buffer 15 C to 25 C 15033135 rRNA Removal Mix Plant 15 C to 25 C 15026780 Elution Buffer 2
85. lS e supuso ais eo ooo a bie deis 73 Enrich DNA Fragments 0 0 0000200 c cece ccc cece nn 81 Validate Library cr 86 Nommaliz and Pool Eibrares ceste conc Ru peu doi acorta lcu 2s 88 d TTE na ha e E 077 a ea gt ft T rro m SI ATGC ceca ry vegas c rc 4 TruSeq Stranded Total RNA Sample Preparation Guide 5 1 e Jeydeyo High Sample HS Protocol Introduction This chapter describes the TruSeq Stranded Total RNA Sample Preparation HS protocol Illumina recommends the following kit sample number and protocol combinations Table 7 Kit and Sample Number Recommendations Number of Samples Recommended Processed Kit At One Time lt 24 ET 24 48 Eron HI gt 48 HT Table 8 Kit and Protocol Recommendations Kit Number of Number of Samples Protocol Samples Supported per Kit Pra LT 48 48 LS 248 HS HT 96 lt 24 LS 224 HS Follow the protocol in the order described using the specified volumes and incubation parameters Before proceeding review the following Best Practices See Additional Resources on page 10 for information on how to access TruSeq Stranded Total RNA Sample Preparation Best Practices on the Illumina website TruSeq Sample Preparation Pooling Guide part 15042173 See Additional Resources on page 10 for information on how to download the guide from the Illumina website 5 y Part 15031048 Rev E Appendix A Supporting Information To confirm your kit contents and make
86. label to a new 96 well 0 3 ml PCR plate Add SMM 1 Remove the adhesive seal from the DFP plate 2 Do one of the following If using the in line control reagent Centrifuge the thawed End Repair Control tube to 600 x g for 5 seconds Dilute the End Repair Control to 1 50 in Resuspension Buffer For example 2 ul End Repair Control 98 ul Resuspension Buffer before use Discard the diluted End Repair Control after use Add 5 ul of diluted End Repair Control to each well of the DFP plate If not using the in line control reagent add 5 ul of Resuspension Buffer to each well of the DFP plate 3 Centrifuge the thawed Second Strand Marking Master Mix to 600 x g for 5 seconds 4 Add 20 ul of thawed Second Strand Marking Master Mix to each well of the DFP plate Gently pipette the entire volume up and down 6 times to mix thoroughly TruSeq Stranded Total RNA Sample Preparation Guide p 9 VNOQ9 pue4is puooesg aziseyju s Low Sample LS Protocol 5 Seal the DFP plate with a Microseal B adhesive seal 6 Return the Second Strand Marking Master Mix tube to 15 C to 25 C storage after use Incubate 3 DFP 1 Place the sealed DFP plate on the pre heated thermal cycler Close the lid and incubate at 16 C for 1 hour 2 Remove the DFP plate from the thermal cycler and place it on the bench 3 Remove the adhesive seal from the DFP plate 4 Letthe DFP plate stand to bring it to room temperature Clean Up DFP 1 Vortex the AMPure XP beads
87. late 2 Add25 ul of thawed PCR Master Mix to each well of the PCR plate Gently pipette the entire volume up and down 10 times to mix thoroughly 3 Seal the PCR plate with a Microseal B adhesive seal 1 Place the sealed PCR plate on the pre programmed thermal cycler Close the lid then select and run PCR to amplify the plate a Choose the pre heat lid option and set to 100 C b 98 C for 30 seconds c 15 cycles of 98 C for 10 seconds 60 C for 30 seconds 72 C for 30 seconds d 72 C for 5 minutes e Hold at 4 C Clean Up PCR 1 Remove the adhesive seal from the PCR plate 2 Vortex the AMPure XP Beads until they are well dispersed 3 Do one of the following depending on the adapter type used If using the RNA Adapter tubes add 50 ul of the mixed AMPure XP Beads to each well of the PCR plate containing 50 ul of the PCR amplified library Gently pipette the entire volume up and down 10 times to mix thoroughly If using the RAP add 47 5 ul of the mixed AMPure XP Beads to each well of the PCR plate containing 50 ul of the PCR amplified library Gently pipette the entire volume up and down 10 times to mix thoroughly 4 Incubate the PCR plate at room temperature for 15 minutes A A Part 15031048 Rev E 10 11 12 13 14 Place the PCR plate on the magnetic stand at room temperature for 5 minutes or until the liquid is clear Remove and discard 95 ul supernatant from each well of the PCR plate NOTE j Leave the PCR p
88. late on the magnetic stand add 200 ul freshly prepared 80 EtOH to each well Take care not to disturb the beads Incubate the CAP plate at room temperature for 30 seconds and then remove and discard all of the supernatant from each well Take care not to disturb the beads Repeat steps 20 and 21 one time for a total of two 80 EtOH washes With the CAP plate on the magnetic stand let the samples air dry at room temperature for 15 minutes and then remove the plate from the magnetic stand Add 22 5 ul Resuspension Buffer to each well of the CAP plate Gently pipette the entire volume up and down 10 times to mix thoroughly or until the beads are fully resuspended Incubate the CAP plate at room temperature for 2 minutes Place the CAP plate on the magnetic stand at room temperature for 5 minutes or until the liquid is clear Transfer 20 ul supernatant from each well of the CAP plate to the corresponding well of the new 0 3 ml PCR plate labeled with the PCR barcode Take care not to disturb the beads SAFESTOPPING POINT If you do not plan to proceed immediately to Enrich DNA Fragments on page 42 you can q safely stop the protocol here If you are stopping seal the PCR plate with a Microseal B adhesive seal and store at 15 C to 25 C for up to seven days TruSeq Stranded Total RNA Sample Preparation Guide A sJo1depy o1e6rq Low Sample LS Protocol Enrich DNA Fragments 42 This process uses PCR to selectively e
89. late on the magnetic stand while performing the following 80 EtOH wash steps 7 9 With the PCR plate on the magnetic stand add 200 ul freshly prepared 80 EtOH to each well without disturbing the beads Incubate the PCR plate at room temperature for 30 seconds and then remove and discard all of the supernatant from each well Repeat steps 7 and 8 one time for a total of two 80 EtOH washes With the PCR plate on the magnetic stand let the samples air dry at room temperature for 15 minutes and then remove the plate from the magnetic stand Add 32 5 ul Resuspension Buffer to each well of the PCR plate Gently pipette the entire volume up and down 10 times to mix thoroughly Incubate the PCR plate at room temperature for 2 minutes Place the PCR plate on the magnetic stand at room temperature for 5 minutes or until the liquid is clear Transfer 30 ul supernatant from each well of the PCR plate to the corresponding well of the new 0 3 ml PCR plate labeled with the TSP1 barcode SAFESTOPPING POINT If you do not plan to proceed immediately to Validate Library on page 46 you can safely stop the protocol here If you are stopping seal the TSP1 plate with a Microseal B adhesive seal and store at 15 C to 25 C for up to 7 days TruSeq Stranded Total RNA Sample Preparation Guide A 5 s juauBe14 vNG u9uu3 Low Sample LS Protocol Validate Library Illumina recommends performing the following procedures for quality control
90. luster generation For more information see the cluster generation section of the user guide for your Illumina platform Seal the DCT plate with a Microseal B adhesive seal and store at 15 C to 25 C For pooled libraries proceed to Make PDP for pooling only Make PDP for pooling only amp NOTE Do not make a PDP plate if you are not pooling samples 1 Determine the number of samples to be combined together for each pool NOTE j Make a note of which sample goes into which well to avoid pooling two samples with the same index TruSeq Stranded Total RNA Sample Preparation Guide 8 9 SeueJqr OOd pue ezieuuoN High Sample HS Protocol 2 Do one of the following If pooling 2 24 samples Transfer 10 ul of each normalized sample library to be pooled from the DCT plate to one well of the new HSP plate labeled with the PDP barcode The total volume in each well of the PDP plate should be 10X the number of combined sample libraries and 20 240 ul 2 24 libraries For example the volume for 2 samples is 20 ul the volume for 12 samples is 120 ul or the volume for 24 samples is 240 ul If pooling 25 96 samples Using a multichannel pipette transfer 5 ul of each normalized sample library in column 1 from the DCT plate to column 1 of the new HSP plate labeled with the PDP barcode Transfer 5 ul of each normalized sample library in column 2 from the DCT plate to column 1 of the PDP plate Repeat the transfer for as many times as t
91. n Buffer 34 A Tailing Mix 56 Ligation Mix 7 8 15026774 End Repair Control 9 10 15026775 A Tailing Control 11 12 15026776 Ligation Control 13 14 15012546 Stop Ligation Buffer 96 Samples cDNA Synthesis PCR Box Store at 15 C to 25 C This box is shipped on dry ice As soon as you receive it store the following components at 15 C to 25 C TruSeq Stranded Total RNA Sample Preparation Guide 1 O 3 S USJUO YM Supporting Information 104 Figure 18 TruSeq Stranded Total RNA HT Sample Prep Kit 96 Samples cDNA Synthesis PCR Box part 4 15032621 eee ET Slot Reagent Part Description 1 2 PMM 15026785 PCR Master Mix 34 PPC 15031748 PCR Primer Cocktail 5 6 FSA 15031094 First Strand Synthesis Act D Mix 7 8 SMM 15031098 Second Strand Marking Master Mix 96 Samples Adapter Plate Box Store at 15 C to 25 C This box is shipped on dry ice As soon as you receive it store the contents at 15 C to 25 C Figure 19 TruSeq Stranded Total RNA HT Sample Prep Kit 96 Adapter Plate Box part 4 15032622 Slot Reagent Part Description 1 RAP 15016427 RNA Adapter Plate 96plex 96 Samples Box 1 of 2 Store as specified This box is shipped on refrigerated gel packs As soon as you receive it store the following components as specified Part 15031048 Rev E Figure 20 TruSeq Stranded Total RNA HT Sample Prep Kit 96 Samples Box 1 of 2 part 4 15032625 Slot Rea
92. n the Illumina website Pre heat the thermal cycler to 16 C Choose the thermal cycler pre heat lid option and set to 30 C Apply an ALP barcode label to a new 96 well MIDI plate Apply a CCP barcode label to a new 96 well MIDI plate Remove the adhesive seal from the DFP plate Do one of the following If using the in line control reagent Centrifuge the thawed End Repair Control tube to 600 x g for 5 seconds Dilute the End Repair Control to 1 50 in Resuspension Buffer For example 2 ul End Repair Control 98 ul Resuspension Buffer before use Discard the diluted End Repair Control after use Add 5 ul of diluted End Repair Control to each well of the DFP plate If not using the in line control reagent add 5 ul of Resuspension Buffer to each well of the DFP plate Centrifuge the thawed Second Strand Marking Master Mix to 600 x g for 5 seconds TruSeq Stranded Total RNA Sample Preparation Guide 67 VN pues puooesg aziseyju s High Sample HS Protocol 4 Add 20 ul of thawed Second Strand Marking Master Mix to each well of the DFP plate Mix thoroughly as follows a Seal the DFP plate with a Microseal B adhesive seal b Shake the DFP plate on a microplate shaker continuously at 1600 rpm for 20 seconds 5 Return the Second Strand Marking Master Mix tube to 15 C to 25 C storage after use Incubate 3 DFP 1 Place the sealed DFP plate on the pre heated thermal cycler Close the lid and incubate at 16 C for 1 hour 2 Remove th
93. nd set to 100 C 98 C for 30 seconds 15 cycles of 98 C for 10 seconds 60 C for 30 seconds 72 C for 30 seconds 72 C for 5 minutes Hold at 4 C Apply a CPP barcode label to a new 96 well MIDI plate Apply a TSP1 barcode label to a new 96 well 0 3 ml PCR plate Make PCR 1 Add 5 ul of thawed PCR Primer Cocktail to each well of the PCR plate 2 Add 25 ul of thawed PCR Master Mix to each well of the PCR plate a Seal the PCR plate with a Microseal A film 1 WARNING Follow vendor instructions for applying Microseal A sealing films Improper use could lead to inefficient sealing evaporation of sample or cross contamination or too efficient sealing parts of the seal remain in the well after removing the whole seal e b Shake the PCR plate on a microplate shaker at 1600 rpm for 20 seconds 3 Centrifuge the PCR plate to 280 x g for 1 minute Amp PCR 1 Place the sealed PCR plate on the pre programmed thermal cycler Close the lid then select and run PCR to amplify the plate a Choose the pre heat lid option and set to 100 C b 98 C for 30 seconds c 15 cycles of 98 C for 10 seconds 60 C for 30 seconds 72 C for 30 seconds TruSeq Stranded Total RNA Sample Preparation Guide 8 3 sjueuJBeJ4 vNG u9uu3 High Sample HS Protocol d 72 C for 5 minutes e Hold at 4 C Clean Up PCR 1 Remove the adhesive seal from the PCR plate 2 Vortex the AMPure XP Beads until they are well dispersed 3 Do one of the following
94. ng Globin Removal Mix rRNA Removal Mix rRNA Removal Mix Gold rRNA Removal Mix Plant ar TruSeq Stranded Total RNA Sample Preparation Guide High Sample HS Protocol Make BRP o8 1 rRNA Binding Buffer Resuspension Buffer ley NOTE The Resuspension Buffer can be stored at 2 C to 8 C after the initial thaw Remove the following from 2 C to 8 C storage and let stand to bring to room temperature Elution Buffer rRNA Removal Beads Remove the RNAClean XP beads from 2 C to 8 C storage and let stand for at least 30 minutes to bring them to room temperature Pre program the thermal cycler with the following programs Choose the pre heat lid option and set to 100 C 68 C for 5 minutes save as RNA Denaturation 94 C for 8 minutes 4 C hold save as Elution 2 Frag Prime Igy NOTE For inserts larger than 120 200 bp with a median size of 150 bp or if starting with degraded total RNA see Appendix A Alternate Fragmentation Protocols for the appropriate Elution 2 Frag Prime program settings Set the centrifuge to 15 C to 25 C if refrigerated Apply a BRP barcode label to a new 96 well HSP plate Apply a DFP barcode label to a new 96 well HSP plate Apply an RCP barcode label to a new 96 well MIDI plate Apply an RRP barcode label to a new 96 well MIDI plate Dilute the total RNA with nuclease free ultra pure water to a final volume of 10 ul in the new 96 well HSP plate labeled with the BRP barcode Add 5 ul
95. nrich those DNA fragments that have adapter molecules on both ends and to amplify the amount of DNA in the library The PCR is performed with a PCR Primer Cocktail that anneals to the ends of the adapters Minimize the number of PCR cycles to avoid skewing the representation of the library NOTE A PCR enriches for fragments that have adapters ligated on both ends Fragments with only one or no adapters on their ends are by products of inefficiencies in the ligation reaction Neither species can be used to make clusters Fragments without any adapters cannot hybridize to surface bound primers in the flow cell Fragments with an adapter on only one end can hybridize to surface bound primers but cannot form clusters Consumables Item Quantity Storage Supplied By PCR Master Mix PMM 1 tube per 48 reactions 15 C to 25 C Illumina PCR Primer Cocktail PPC 1 tube per 48 reactions 15 C to 25 C Illumina Resuspension Buffer RSB 1 tube 2 C to 8 C Ilumina TSP1 Target Sample Plate 1 label per plate 15 Cto 302E Ilumina Barcode Label 96 well 0 3 ml PCR Plate 1 15 C to 30 C User AMPure XP Beads 50 ul per sample AC to SC User Freshly Prepared 8076 400 ul per sample 15 C to 30 C User Ethanol EtOH Microseal B Adhesive Seals 2 ISE fe STO User RNase DNase free Eight 5 15 C to 30 C User Tube Strips and Caps if using multichannel pipettes Part 15031048 Rev E Item Quantity Storage Supplied By RNase DNase free Reagent 5
96. ns Reagent Second Strand Marking Master Mix Second Strand Marking Master Mix A Tailing Mix Ligation Mix Function End repair Generate blunt ended fragments by 3 gt 5 exonuclease and 5 gt 3 polymerase activities End repair Add 5 phosphate groups needed for downstream ligation A tailing Make fragments compatible with adapters and prevent self ligation by adding a 3 A overhang Ligation Join 3 T overhang adapters to 3 A overhang inserts Control End Repair Control 1 End Repair Control 2 5 A Tailing Control Ligation Control Structure of Control DNA Ends 5 overhang at one end 3 overhang at other end Blunt with 5 OH group Blunt with 5 phosphate group Single base 3 A base overhang End Repair Control 1 and End Repair Control 2 are separate controls included in the End Repair Control reagent The control reagents can be used for various library insert sizes Each is provided in ladders ranging from approximately 150 850 bp in 100 bp increments Each control molecule has a unique DNA sequence indicating both its function and size The RTA software v1 9 and later recognizes these sequences and isolates the control sequences from the main body of sequencing reads RTA reports the control sequences counts per lane in the controls tab of the RTA status html page For more information regarding the control read out in the SAV see the Sequence Analysis Viewer User Guide par
97. nute Proceed immediately to Ligate Adapters on page 73 Part 15031048 Rev E Ligate Adapters This process ligates indexing adapters to the ends of the ds cDNA preparing them for hybridization onto a flow cell Consumables Item Quantity Storage Supplied By Optional Ligation Control 1 tube per 48 15 C to 25 C Ilumina CTL reactions Choose from the following 1 tube of each index 15 to 25 C Illumina depending on the kit you are being used per using column of 8 reactions TruSeq Stranded Total RNA or LT Sample Prep Kit contents 1 RAP RNA Adapter Indices AR001 AR016 ARO18 AR023 AR025 AR027 TruSeq Stranded Total RNA HT Sample Prep Kit contents RAP RNA Adapter Plate Ligation Mix LIG 1 tube per 48 15 C to 25 C Ilumina reactions Resuspension Buffer RSB 1 tube 2 Cto E Illumina Stop Ligation Buffer STL 1 tube per 48 15 C to 25 C Illumina reactions Barcode labels for 1 label per plate TIC e SNA Illumina CAP Clean Up ALP Plate PCR Polymerase Chain Reaction Plate RAP RNA Adapter Plate if using the HT kit sJe1depy oe1e6r TruSeq Stranded Total RNA Sample Preparation Guide F 3 O S Item Quantity Storage Supplied By o 96 well HSP Plate 1 15 C to 30 C User pes CL 96 well MIDI Plate 1 ISAC 0208 User dp AMPure XP Beads 92 ul per sample 2 C to 8 C User I Freshly Prepared 80 Ethanol 800 ul per sample IDC tic SOC User o EtOH Q Microseal B Adhes
98. o normalize the concentration of each sample library to 10 nM Storage 15 C to 30 C IC e HOKE 15 C to 30 C AC O SAS 15 C to 30 C Supplied By Illumina Remove the TSP1 plate from 15 C to 25 C storage if it was stored at the conclusion of Clean Up PCR on page 84 Let it thaw at room temperature Centrifuge the thawed TSP1 plate to 280 x g for 1 minute Remove the adhesive seal from the thawed TSP1 plate Apply a DCT barcode label to a new 96 well MIDI plate For pooling only Apply a PDP barcode label to a new 96 well HSP plate Part 15031048 Rev E Make DCT 1 Transfer 10 ul of sample library from each well of the TSP1 plate to the corresponding well of the new MIDI plate labeled with the DCT barcode 2 Normalize the concentration of sample library in each well of the DCT plate to 10 nM using Tris HCl 10 mM pH 8 5 with 0 1 Tween 20 NOTE Depending on the yield quantification data of each sample library the final volume in the DCT plate can vary from 10 400 ul 3 Mix the DCT plate as follows a Seal the DCT plate with a Microseal B adhesive seal b Shake the DCT plate on a microplate shaker at 1000 rpm for 2 minutes 4 Centrifuge the DCT plate to 280 x g for 1 minute 5 Remove the adhesive seal from the DCT plate 6 Depending on the type of library you want to generate do one of the following For non pooled libraries the protocol stops here Do one of the following Proceed to c
99. om Warranty Coverage The foregoing warranties do not apply to the extent a non conformance is due to i abuse misuse neglect negligence accident improper storage or use contrary to the Documentation or Specifications ii improper handling installation maintenance or repair other than if performed by Illumina s personnel iii unauthorized alterations iv Force Majeure events or v use with a third party s good not provided by Illumina unless the Product s Documentation or Specifications expressly state such third party s good is for use with the Product d Procedure for Warranty Coverage In order to be eligible for repair or replacement under this warranty Purchaser must i promptly contact Illumina s support department to report the non conformance ii cooperate with Illumina in confirming or diagnosing the non conformance and iii return this Product transportation charges prepaid to Illumina following Illumina s instructions or if agreed by Illumina and Purchaser grant Illumina s authorized repair personnel access to this Product in order to confirm the non conformance and make repairs IV Part 15031048 Rev E Sole Remedy under Warranty Illumina will at its option repair or replace non conforming Product that it confirms is covered by this warranty Repaired or replaced Consumables come with a 30 day warranty Hardware may be repaired or replaced with functionally equivalent reconditioned or new Hardware or component
100. or 5 seconds Add 11 pl Elution Buffer to each well of the RCP plate Gently pipette the entire volume up and down 10 times to mix thoroughly Incubate the RCP plate at room temperature for 2 minutes Place the RCP plate on the magnetic stand at room temperature for 5 minutes Return the Elution Buffer to 2 C to 8 C storage Transfer 8 5 ul supernatant from the RCP plate to the new 96 well 0 3 ml PCR plate labeled with the DFP barcode TruSeq Stranded Total RNA Sample Preparation Guide 2 3 VNH 1uauuBeJ4J pue ajejdag 01987 oqly Low Sample LS Protocol 14 Add 8 5 ul Elute Prime Fragment High Mix to each well of the DFP plate Gently pipette the entire volume up and down 10 times to mix thoroughly 15 Seal the DFP plate with a Microseal B adhesive seal 16 Return the Elute Prime Fragment High Mix to 15 C to 25 C storage and the RNAClean XP Beads tube to 2 C to 8 C storage Incubate 1 DFP 1 Place the sealed DFP plate on the pre programmed thermal cycler Close the lid then select and run the Elution 2 Frag Prime program NOTE For inserts larger than 120 200 bp with a median size of 150 bp or if starting with degraded total RNA make sure the appropriate Elution 2 Frag Prime program settings have been set See Appendix A Alternate Fragmentation Protocols for more information a Choose the pre heat lid option and set to 100 C b 94 C for 8 minutes Hold at 4 C 2 Remove the DFP plate from the thermal cycler when
101. orkflow The first step involves the removal of ribosomal RNA rRNA using biotinylated target specific oligos combined with Ribo Zero rRNA removal beads The Ribo Zero Human Mouse Rat kit depletes samples of cytoplasmic rRNA and the Ribo Zero Gold kit depletes samples of both cytoplasmic and mitochondrial rRNA Ribo Zero Globin kit depletes globin encoding mRNA in addition to the rRNA species targeted with Ribo Zero Gold Ribo Zero Plant kit targets cytoplasmic and chloroplast rRNA Following purification the RNA is fragmented into small pieces using divalent cations under elevated temperature The cleaved RNA fragments are copied into first strand cDNA using reverse transcriptase and random primers followed by second strand cDNA synthesis using DNA Polymerase I and RNase H These cDNA fragments then have the addition of a single A base and subsequent ligation of the adapter The products are purified and enriched with PCR to create the final cDNA library This sample preparation protocol offers Strand information on RNA transcript Library capture of both coding RNA as well as multiple forms of non coding RNA Degraded RNA can be used with minor adjustments to fragmentation procedures Reduced total assay time Optimized workflows for processing low sample LS and high sample HS numbers in parallel Compatibility with low throughput LT and high throughput HT kit configurations The TruSeq Stranded Total RNA LT Sample Prep Kit contains ada
102. perienced User Card and Lab Tracking Form part 15031060 TruSeq Stranded Total RNA Sample Preparation High Sample Experienced User Card and Lab Tracking Form part 15031059 TruSeq Sample Preparation Pooling Guide part 15042173 Illumina Experiment Manager IEM TruSeq Stranded Total RNA Sample Preparation Guide Description Provides LS protocol instructions but with less detail than what is provided in this user guide New or less experienced users are advised to follow this user guide and not the EUC and Lab Tracking Form Click Documentation amp Literature on TruSeq Stranded Total RNA LT Sample Prep Kit Support or Click Documentation amp Literature on TruSeq Stranded Total RNA HT Sample Prep Kit Support Provides HS protocol instructions but with less detail than what is provided in this user guide New or less experienced users are advised to follow this user guide and not the EUC and Lab Tracking Form Click Documentation amp Literature on TruSeq Stranded Total RNA LT Sample Prep Kit Support or Click Documentation amp Literature on TruSeq Stranded Total RNA HT Sample Prep Kit Support Provides TruSeq pooling guidelines for sample preparation Review this guide before beginning library preparation Click Documentation amp Literature on TruSeq Stranded Total RNA LT Sample Prep Kit Support or Click Documentation amp Literature on TruSeq Stranded Total RNA HT Sample Prep Kit S
103. pernatant ds cDNA from the DFP plate to the new 96 well 0 3 ml PCR plate labeled with the ALP barcode SAFESTOPPING POINT If you do not plan to proceed immediately to Adenylate 3 Ends on page 32 you can safely 1 stop the protocol here If you are stopping seal the ALP plate with a Microseal B adhesive seal and store at 15 C to 25 C for up to 7 days TruSeq Stranded Total RNA Sample Preparation Guide 31 VN pues puooesg aziseyju s Low Sample LS Protocol Adenylate 3 Ends A single A nucleotide is added to the 3 ends of the blunt fragments to prevent them from ligating to one another during the adapter ligation reaction A corresponding single T nucleotide on the 3 end of the adapter provides a complementary overhang for ligating the adapter to the fragment This strategy ensures a low rate of chimera concatenated template formation Consumables Item Optional A Tailing Control CTA A Tailing Mix ATL Resuspension Buffer RSB Microseal B Adhesive Seal RNase DNase free Eight Tube Strips and Caps if using multichannel pipettes RNase DNase free Reagent Reservoirs if using multichannel pipettes Preparation Quantity 1 tube per 48 reactions 1 tube per 48 reactions 1 tube il 3 3 Storage 15 C to 25 C 15 C to 25 C 2 C to 8 C IST to BOC 15 C to 30 C AE e OCC Supplied By Illumina Illumina Illumina User User
104. perty rights is or are granted expressly by implication or by estoppel Purchaser is solely responsible for determining whether Purchaser has all intellectual property rights that are necessary for Purchaser s intended uses of this Product including without limitation any rights from third parties or rights to Application Specific IP Illumina makes no guarantee or warranty that purchaser s specific intended uses will not infringe the intellectual property rights of a third party or Application Specific IP 3 Regulatory This Product has not been approved cleared or licensed by the United States Food and Drug Administration or any other regulatory entity whether foreign or domestic for any specific intended use whether research commercial diagnostic or otherwise This Product is labeled For Research Use Only Purchaser must ensure it has any regulatory approvals that are necessary for Purchaser s intended uses of this Product 4 Unauthorized Uses Purchaser agrees a to use each Consumable only one time and b to use only Illumina consumables reagents with Illumina Hard ware The limitations in a b do not apply if the Documentation or Specifications for this Product state otherwise Purchaser agrees not to nor authorize any third party to engage in any of the following activities i disassemble reverse engineer reverse compile or reverse assemble the Product ii separate extract or isolate components of this Product or subject t
105. plate in step 3 will ensure optimal performance Remove the adhesive seal from the BRP plate TruSeq Stranded Total RNA Sample Preparation Guide 5 9 VNH 1uauuBeJ4J pue ajejdag 01987 oqly High Sample HS Protocol 4 Transfer the entire contents 20 ul from each well of the BRP plate to the corresponding well of the RRP plate containing rRNA Removal Beads 5 Mix the contents of the RRP plate thoroughly as follows a Seal the RRP plate with a Microseal B adhesive seal b Shake the RRP plate on a microplate shaker continuously at 1000 rpm for 1 minute 6 Remove the adhesive seal from the RRP plate 7 Place the RRP plate on the magnetic stand at room temperature for 1 minute 8 Transfer all of the supernatant from each well of the RRP plate to the corresponding well of the new 96 well MIDI plate labeled with the RCP barcode 9 Place the RCP plate on the magnetic stand at room temperature for 1 minute ley NOTE If any beads remain in the wells of the RCP plate place the RCP plate on the magnet stand for 1 minute and then transfer the supernatant to a new MIDI plate Repeat as necessary until there are no beads remaining The last MIDI plate will be the RCP plate used during Clean Up RCP 10 Return the rRNA Removal Beads to 2 C to 8 C storage Clean Up RCP 1 Vortex the RNAClean XP beads until they are well dispersed then add 99 ul of well mixed RNAClean XP beads to each well of the RCP plate containing ribosomal depleted RNA Mix tho
106. ple LS Protocol Sample Prep Workflow The following illustrates the processes of the TruSeq Stranded Total RNA Sample Preparation LS protocol to prepare templates using 24 indexed adapter tubes or a RAP Figure 2 TruSeq Stranded Total RNA Sample Preparation LS Workflow Prepare for Pooling Y Ligate Adapters Aure XP Deo 0 1 1 ug Total RNA pigro ls EtOH uc RNA Adapters or RAP RSB RiboZero Deplete and SL Fragment RNA Platos CAP Consumables PCR ELB EPH RBB RRB GRM RRM RRM G RRM P EtOH RNAClean XP Beads Water 1 Plates BRP DFP RCP RRP PCR Amplification AMPure XP Beads EtOH PMM PPC First Strand RSB cDNA is Synthesi TSPI FSA SuperScript II Piste DFP 4 Validate Library Second Strand i cDNA Synthesis Normalize and Pool AMPure XP Beads Libraries CTE Optional EtOH Consumables RSB Tris HCI 10 mM w Tween 20 SMM Plates Plate oct ccp ALP PDP indexing only 1 B Adenylate 3 Ends Consumables ATL CTA Optional RSB Plate ALP 1 6 Part 15031048 Rev E Hibo Zero Deplete and Fragment HNA This process depletes rRNA from total RNA After the rRNA is depleted the remaining RNA is purified fragmented and primed for cDNA synthesis It is important to follow this purification procedure exactly to be sure of reproducibility Reference the following diagram while performing the procedures Figure 3 TruSeq Stranded Total RNA Sample Preparation Purification Workflow Dilute Total RNA Add RBB and GRM RR
107. pter index tubes recommended for preparing and pooling 24 or fewer samples for sequencing The TruSeq Stranded Total RNA HT Sample Prep Kit contains a 96 well plate with 96 uniquely indexed adapter combinations designed for manual or automated preparation of 96 uniquely indexed samples The protocol is compatible with no indexing or a lower indexing pooling level The libraries generated do not require PCR amplification to enable cluster generation although Part 15031048 Rev E PCR is recommended in the standard protocol to robustly meet the yield requirements of most standard applications TruSeq Stranded Total RNA Sample Preparation Guide 3 uoI onpo1 u Protocol Features This guide documents the sample preparation protocol using the Illumina TruSeq Stranded Total RNA LT Sample Prep Kit or TruSeq Stranded Total RNA HT Sample Prep Kit Chapter 2 Low Sample LS Protocol explains how to perform the TruSeq Stranded Total RNA Sample Preparation using the Low Sample Protocol Chapter 3 High Sample HS Protocol explains how to perform the TruSeq Stranded Total RNA Sample Preparation using the High Sample Protocol Overview Equivalent results can be expected from either protocol and their distinguishing elements are as follows Table 1 Protocol Features Low Sample High Sample LT Kit Number of samples lt 48 with indexed gt 48 with indexed processed at one time adapter tubes adapter tubes HT Kit Number of samples lt 24 wit
108. r 1 minute Incubate 2 ALP 1 Place the sealed ALP plate on the pre heated thermal cycler Close the lid and incubate at 30 C for 10 minutes 2 Remove the ALP plate from the thermal cycler Add STL 1 Remove the adhesive seal from the ALP plate 2 Add 5 ul of Stop Ligation Buffer to each well of the ALP plate to inactivate the ligation Gently pipette the entire volume up and down 10 times to mix thoroughly Clean Up ALP 1 Vortex the AMPure XP Beads for at least 1 minute or until they are well dispersed 2 Add 42 ul of mixed AMPure XP Beads to each well of the ALP plate Gently pipette the entire volume up and down 10 times to mix thoroughly 3 Incubate the ALP plate at room temperature for 15 minutes 4 Place the ALP plate on the magnetic stand at room temperature for 5 minutes or until the liquid is clear TruSeq Stranded Total RNA Sample Preparation Guide 3 9 sJo1depy oe1e6r Low Sample LS Protocol 40 10 11 12 13 14 15 16 17 18 19 Remove and discard 79 5 ul supernatant from each well of the ALP plate Take care not to disturb the beads NOTE j Leave the ALP plate on the magnetic stand while performing the following 80 EtOH wash steps 6 8 With the ALP plate on the magnetic stand add 200 ul freshly prepared 80 EtOH to each well without disturbing the beads Incubate the ALP plate at room temperature for 30 seconds and then remove and discard all of the supernatant from each well Take
109. rmalized sample library in column 1 of the DCT plate to column 1 of the new 0 3 ml PCR or MIDI plate labeled with the PDP barcode Transfer 5 ul of each normalized sample library in column 2 of the DCT plate to column 1 of the PDP plate Repeat the transfer for as many times as there are remaining columns in the DCT plate The result is a PDP plate with pooled samples in column 1 Gently pipette the entire volume of each well of column 1 up and down 10 times to mix thoroughly Combine the contents of each well of column 1 into well A2 of the PDP plate for the final pool 3 Gently pipette the entire volume up and down 10 times to mix thoroughly 4 Do one of the following Proceed to cluster generation For more information see the user guide for your Illumina sequencer Seal the PDP plate with a Microseal B adhesive seal and store at 15 C to 25 C 5 O Part 15031048 Rev E High Sample HS Protocol INTFOGUCTION 22 2 ccc alllcelolicnlel2liD22nslojusezlocnll Aim conica a a a a 52 Sample Prep Workflow ssssssssssssssmII I IIR rrlmlrrmlmlmllllll2 22222 54 Ribo Zero Deplete and Fragment RNA sssssssssssssssssssssssss essere 55 Synthesize First Strand CDNA 0 2 2 22 eco cece cece cece cece cece cece eee eeeeeeeeeeeeeceees 63 Synthesize Second Strand CDNA 2 0 0 cee cece c cece cccccccceccccccceeeeccccceceeeeeeeceeees 66 Adenylate 3 Ends coordina rola e dadtigs tx LU REEL ed sd 70 MENG ALS Adaple
110. rom 10 400 pl 3 Gently pipette the entire normalized sample library volume up and down 10 times to mix thoroughly 4 Depending on the type of library you want to generate do one of the following For non pooled libraries the protocol stops here Do one of the following Proceed to cluster generation For more information see the cluster generation section of the user guide for your Illumina platform Seal the DCT plate with a Microseal B adhesive seal and store at 15 C to 25 C For pooled libraries proceed to Make PDP for pooling only Make PDP for pooling only i NOTE Do not make a PDP plate if you are not pooling samples TruSeq Stranded Total RNA Sample Preparation Guide A 9 SeueJqr OOd pue ezieuJoN Low Sample LS Protocol 1 Determine the number of samples to be combined together for each pool NOTE j Note the sample that is in each well to avoid pooling two samples with the same index 2 Do one of the following If pooling 2 24 samples Transfer 10 ul of each normalized sample library to be pooled from the DCT plate to one well of the new 0 3 ml PCR plate labeled with the PDP barcode The total volume in each well of the PDP plate is 10 X the number of combined sample libraries and 20 240 ul 2 24 libraries For example the volume for 2 samples is 20 ul the volume for 12 samples is 120 ul or the volume for 24 samples is 240 ul If pooling 25 96 samples Using a multichannel pipette transfer 5 ul of each no
111. rom the magnetic stand Add 52 5 ul Resuspension Buffer to each well of the ALP plate Mix thoroughly as follows a Seal the ALP plate with a Microseal B adhesive seal b Shake the ALP plate on a microplate shaker at 1800 rpm for 2 minutes Incubate the ALP plate at room temperature for 2 minutes Centrifuge the ALP plate to 280 x g for 1 minute Remove the adhesive seal from the ALP plate Part 15031048 Rev E 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 Place the ALP plate on the magnetic stand at room temperature for 5 minutes or until the liquid is clear Transfer 50 ul supernatant from each well of the ALP plate to the corresponding well of the new MIDI plate labeled with the CAP barcode Take care not to disturb the beads Vortex the AMPure XP Beads until they are well dispersed Add 50 ul of mixed AMPure XP Beads to each well of the CAP plate for a second cleanup Mix thoroughly as follows a Seal the CAP plate with a Microseal B adhesive seal b Shake the CAP plate on a microplate shaker at 1800 rpm for 2 minutes Incubate the CAP plate at room temperature for 15 minutes Centrifuge the CAP plate to 280 x g for 1 minute Remove the adhesive seal from the CAP plate Place the CAP plate on the magnetic stand at room temperature for 5 minutes or until the liquid is clear Remove and discard 95 ul supernatant from each well of the CAP plate Take care not to disturb the beads
112. roughly as follows ley NOTE If starting with degraded total RNA add 193 ul of well mixed RNAClean XP beads to each well of the RCP plate containing ribosomal depleted RNA a Seal the RCP plate with a Microseal B adhesive seal b Shake the RCP plate on a microplate shaker at 1800 rpm for 2 minutes 2 Incubate the RCP plate at room temperature for 15 minutes 3 Remove the adhesive seal from the RCP plate 4 Place the RCP plate on the magnetic stand at room temperature for 5 minutes to make 60 sure that all of the beads are bound to the side of the wells Part 15031048 Rev E 5 10 11 12 13 14 15 16 17 18 Remove and discard all of the supernatant from each well of the RCP plate NOTE Leave the RCP plate on the magnetic stand while performing the following 70 EtOH wash steps 6 7 With the RCP plate on the magnetic stand add 200 ul freshly prepared 70 EtOH to each well without disturbing the beads Incubate the RCP plate at room temperature for 30 seconds and then remove and discard all of the supernatant from each well Let the RCP plate stand at room temperature for 15 minutes to dry and then remove the RCP plate from the magnetic stand Centrifuge the thawed room temperature Elution Buffer to 600 x g for 5 seconds Add 11 ul Elution Buffer to each well of the RCP plate Mix thoroughly as follows a Seal the RCP plate with a Microseal B adhesive seal b Shake the RCP plate on a micropla
113. s if only a component of Hardware is non conforming If the Hardware is replaced in its entirety the warranty period for the replacement is 90 days from the date of shipment or the remaining period on the original Hardware warranty whichever is shorter If only a component is being repaired or replaced the warranty period for such component is 90 days from the date of shipment or the remaining period on the original Hardware warranty whichever ends later The preceding states Purchaser s sole remedy and Illumina s sole obligations under the warranty provided hereunder Third Party Goods and Warranty Illumina has no warranty obligations with respect to any goods originating from a third party and supplied to Purchaser hereunder Third party goods are those that are labeled or branded with a third party s name The warranty for third party goods if any is provided by the original manufacturer Upon written request Illumina will attempt to pass through any such warranty to Purchaser 9 Indemnification a Infringement Indemnification by Illumina Subject to these terms and conditions including without limitation the Exclusions to Illumina s Indemnification Obligations Section 9 b below the Conditions to Indemnification Obligations Section 9 d below Illumina shall i defend indemnify and hold harmless Purchaser against any third party claim or action alleging that this Product when used for research use purposes in accordance with these
114. s an academic or for profit entity The purchase of this product does not convey a license under any claims in the foregoing patents or patent applications directed to producing the product The buyer cannot sell or otherwise transfer this product or its components to a third party or otherwise use this product for the following COMMERCIAL PURPOSES 1 use of the product or its components in manufacturing or 2 use of the product or its components for therapeutic or prophylactic purposes in humans or animals Read Before Using this Product This Product and its use and disposition is subject to the following terms and conditions If Purchaser does not agree to these terms and conditions then Purchaser is not authorized by Illumina to use this Product and Purchaser must not use this Product 1 Definitions Application Specific IP means Illumina owned or controlled intellectual property rights that pertain to this Product and use thereof only with regard to specific field s or specific application s Application Specific IP excludes all Illumina owned or controlled intellectual property that cover aspects or features of this Product or use thereof that are common to this Product in all possible applications and all possible fields of use the Core IP Application Specific IP and Core IP are separate non overlapping subsets of all Illumina owned or controlled intellectual property By way of non limiting example Illumina intellectual propert
115. search Use Only Rights Subject to these terms and conditions and unless otherwise agreed upon in writing by an officer of Illumina Purchaser is granted only a non exclusive non transferable personal non sublicensable right under Illumina s Core IP in existence on the date that this Product ships from Illumina solely to use this Product in Purchaser s facility for Purchaser s internal research purposes which includes research services provided to third parties and solely in accordance with this Product s Documentation but specifically excluding any use that a would require rights or a license from Illumina to Application Specific IP b is a re use of a previously used Consumable c is the disassembling reverse engineering reverse compiling or reverse assembling of this Product d is the separation extraction or isolation of components of this Product or other unauthorized analysis of this Product e gains access to or determines the methods of operation of this Product f is the use of non Illumina reagent consumables with Illumina s Hardware does not apply if the Specifications or Documentation state otherwise or g is the transfer to a third party of or sub licensing of Software or any third party software All Software whether provided separately installed on or embedded in a Product is licensed to Purchaser and not sold Except as expressly stated in this Section no right or license under any of Illumina s intellectual pro
116. sssssssssmmIIIImImIIIIIl 9 Table5 Kit and Sample Number Recommendations 222222 222022222 14 Table6 Kit and Protocol Recommendations oooooooccccccccccccccccccccccccncncncnccccozo 14 Table7 Kit and Sample Number Recommendations 222222 222022222 52 Table8 Kit and Protocol Recommendations oooocccccccccccccccccccccccccnnnnnccccccozs 52 Table9 TruSeq Stranded Total RNA Sample Preparation Acronyms 93 Table 10 TruSeq Stranded Total RNA Sample Preparation Kits 96 Table 11 User Supplied Consumables 22 2 00 22 22 cece cece cece ccceeees 107 Table 12 User Supplied Consumables Additional Items for LS Processing 108 Table 13 User Supplied Consumables Additional Items for HS Processing 109 Table 14 User Supplied Equipment 022 2222 cc cece eee cccc eee eeeeecceeeee 109 Table 15 User Supplied Equipment Additional Items for HS Processing 109 Table 16 TruSeq Stranded Total RNA LT Sample Prep Kit Set A Indexed Adapter Sequences NR Nu 112 Table 17 TruSeq Stranded Total RNA LT Sample Prep Kit Set B Indexed Adapter DOQUENCOS ORE RR IE 112 Table 18 TruSeq Stranded Total RNA HT Sample Prep Kit Indexed Adapter 1 SEQUENCES NE RERUM 113 Table 19 TruSeq Stranded Total RNA HT Sample Prep Kit Indexed Adapter 2 A A Mle et TAE AA ahaa eee iat 113 Table 20 Library Insert Fragmentation Time o cccccc
117. t 15020619 TruSeq Stranded Total RNA Sample Preparation Guide VNC I041u01 eurT u Overview Additional Resources The following resources are available for TruSeq Stranded Total RNA Sample Preparation protocol guidance and sample tracking Access these and other resources on the Illumina website at supportillumina com sequencing kits ilmn Then select TruSeq Stranded Total RNA LT Sample Prep Kit Support or TruSeq Stranded Total RNA HT Sample Prep Kit Support Resource Training Best Practices 10 Description Illustrates elements of the TruSeq Stranded Total RNA Sample Preparation process Viewing these videos is recommended for new and less experienced users before starting sample preparation Click Training on TruSeq Stranded Total RNA LT Sample Prep Kit Support or Click Training on TruSeq Stranded Total RNA HT Sample Prep Kit Support Provides best practices specific to this protocol Review these best practices before starting sample preparation Topics include Handling Liquids Handling Master Mix Reagents Handling Magnetic Beads Avoiding Cross Contamination Potential DNA Contaminants Temperature Considerations Equipment Click Best Practices on TruSeq Stranded Total RNA LT Sample Prep Kit Support or Click Best Practices on TruSeq Stranded Total RNA HT Sample Prep Kit Support Part 15031048 Rev E Resource TruSeq Stranded Total RNA Sample Preparation Low Sample Ex
118. te shaker at 1800 rpm for 2 minutes Incubate the RCP plate at room temperature for 2 minutes Centrifuge the RCP plate to 280 x g for 1 minute Remove the adhesive seal from the RCP plate Place the RCP plate on the magnetic stand at room temperature for 5 minutes Return the Elution Buffer to 2 C to 8 C storage Transfer 8 5 ul supernatant from the RCP plate to the new 96 well HSP plate labeled with the DFP barcode Add 8 5 ul Elute Prime Fragment High Mix to each well of the DFP plate Mix thoroughly as follows a Seal the DFP plate with a Microseal B adhesive seal b Shake the DFP plate on a microplate shaker continuously at 1600 rpm for 20 seconds Return the Elute Prime Fragment High Mix to 15 C to 25 C storage and the RNAClean XP Beads tube to 2 C to 8 C storage TruSeq Stranded Total RNA Sample Preparation Guide 61 VNH 1uauuBeJ4J pue ejejdeq 01987 oqly High Sample HS Protocol Incubate 1 DFP 62 1 f Place the sealed DFP plate on the pre programmed thermal cycler Close the lid and select Elution 2 Frag Prime to fragment and prime the RNA NOTE If starting with degraded total RNA make sure the appropriate Elution 2 Frag Prime program settings have been set See Appendix A Alternate Fragmentation Protocols for more information a Choose the pre heat lid option and set to 100 C b 94 C for 8 minutes c Hold at 4 C Remove the DFP plate from the thermal cycler when it reaches 4
119. to 37 C and system 2 to 70 C Prepare ice to cool the plate Do one of the following If using the in line control reagent Centrifuge the thawed A Tailing Control tube to 600 x g for 5 seconds Dilute the A Tailing Control to 1 100 in Resuspension Buffer For example 1 ul A Tailing Control 99 ul Resuspension Buffer before use Discard the diluted A Tailing Control after use Add 2 5 ul of diluted A Tailing Control to each well of the ALP plate If not using the in line control reagent add 2 5 ul of Resuspension Buffer to each well of the ALP plate Add 12 5 ul of thawed A Tailing Mix to each well of the ALP plate Mix thoroughly as follows a Seal the ALP plate with a Microseal B adhesive seal b Shake the ALP plate on a microplate shaker at 1800 rpm for 2 minutes Centrifuge the ALP plate to 280 x g for 1 minute TruSeq Stranded Total RNA Sample Preparation Guide 11 Spu3 e aje huspy High Sample HS Protocol Incubate 1 ALP 2 1 Place the sealed ALP plate on the pre heated microheating system 1 Close the lid and incubate at 37 C for 30 minutes Immediately after the 37 C incubation remove the ALP plate from system 1 and place the plate on the pre heated microheating system 2 Close the lid and incubate at 70 C for 5 minutes Set the microheating system 1 to 30 C in preparation for Ligate Adapters Immediately remove the ALP plate from the microheating system 2 and place the plate on ice for 1 mi
120. until they are well dispersed 2 Add 90 ul of well mixed AMPure XP beads to each well of the DFP plate containing 50 ul of ds cDNA Gently pipette the entire volume up and down 10 times to mix thoroughly 3 Incubate the DFP plate at room temperature for 15 minutes 4 Place the DFP plate on the magnetic stand at room temperature for 5 minutes to make sure that all of the beads are bound to the side of the wells 5 Remove and discard 135 ul supernatant from each well of the DFP plate 30 NOTE Leave the DFP plate on the magnetic stand while performing the following 8076 EtOH wash steps 6 8 With the DFP plate on the magnetic stand add 200 ul freshly prepared 80 EtOH to each well without disturbing the beads Incubate the DFP plate at room temperature for 30 seconds and then remove and discard all of the supernatant from each well Repeat steps 6 and 7 one time for a total of two 80 EtOH washes Let the DFP plate stand at room temperature for 15 minutes to dry and then remove the plate from the magnetic stand Part 15031048 Rev E 10 11 12 13 14 Centrifuge the thawed room temperature Resuspension Buffer to 600 x g for 5 seconds Add 17 5 ul Resuspension Buffer to each well of the DFP plate Gently pipette the entire volume up and down 10 times to mix thoroughly Incubate the DFP plate at room temperature for 2 minutes Place the DFP plate on the magnetic stand at room temperature for 5 minutes Transfer 15 ul su
121. upport Enables you to create and edit appropriate sample sheets for Illumina sequencers and analysis software and record parameters for your sample plate To download the software Click Downloads on TruSeq Stranded Total RNA LT Sample Prep Kit Support or Click Downloads on TruSeq Stranded Total RNA HT Sample Prep Kit Support To download the documentation Click Documentation amp Literature on TruSeq Stranded Total RNA LT Sample Prep Kit Support or Click Documentation amp Literature on TruSeq Stranded Total RNA HT Sample Prep Kit Support 11 S92JnoseH EeuonippV 12 Part 15031048 Rev E Low Sample LS Protocol Introd ctlon ccaccs och esd Ah ede a bd cade bw a ld deddvsaveigudebieceices 14 Sample Prep Workflow 0 0 0 2 22 ccc cece cece cece cece cece cece cece eee eeeeeeeeeeeeeteeeettteeteees 16 Ribo Zero Deplete and Fragment RNA 00 00000 eee ee cee cece eee eeeeeeeeees 17 Synthesize First Strand cDNA 0 2 2 2 2 2 occ e cece cece ce a aaao aaia aani 25 Synthesize Second Strand CDNA 2 00 2 cece cece cece ccccccececcccccceeeeecccceceeeeeeceeeees 28 Adenylate 3 Ends csr dot eis agdcen ta yt ae isa serenade das tu E EU Ee Lees 32 MENG ALS Adapter sure rosas e ae de eee isis 35 Enrich DNA Fragments 0 0000200 c cece ccc nos 42 Validate Library 2000 0 ec ccc cece a a ccc cece cece cece cece cess eeeeteteeeeeeeeeees 46 Nomnalize and Pool LIBraneS sescca epee e
122. urposes ii the use of this Product in any manner not in accordance with its Specifications its Documentation the rights expressly granted to Purchaser hereunder or any breach by Purchaser of these terms and conditions iii the use of this Product in combination with any other products materials or services not supplied by Illumina iv the use of this Product to perform any assay or other process not supplied by Illumina or v Illumina s compliance with specifications or instructions for this Product furnished by or on behalf of Purchaser each of i v is referred to as an Excluded Claim Indemnification by Purchaser Purchaser shall defend indemnify and hold harmless Illumina its affiliates their non affiliate collaborators and development partners that contributed to the development of this Product and their respective officers directors representatives and employees against any claims liabilities damages fines penalties causes of action and losses of any and every kind including without limitation personal injury or death claims and infringement of a third party s intellectual property rights resulting from relating to or arising out of i Purchaser s breach of any of these terms and conditions ii Purchaser s use of this Product outside of the scope of research use purposes iii any use of this Product not in accordance with this Products Specifications or Documentation or iv any Excluded Claim Conditions
123. well MIDI Plate 1 IC to SUC User AMPure XP Beads 50 ul per sample 2 C to 8 C User Freshly Prepared 80 Ethanol 400 ul per sample 15 to 30 E User EtOH TruSeq Stranded Total RNA Sample Preparation Guide 81 sjueuJBeJ4 vNG u9uu3 High Sample HS Protocol Item Quantity Microseal A Film 1 Microseal B Adhesive Seals 3 RNase DNase free Eight Tube 5 Strips and Caps if using multichannel pipettes RNase DNase free Reagent 5 Reservoirs if using multichannel pipettes Preparation Storage 15 C to 30 C 15 to 30 E 15 C to 30 C AC 10 XU Supplied By User User User User Remove the PCR Master Mix and PCR Primer Cocktail from 15 C to 25 C storage and thaw them at room temperature Centrifuge the thawed PCR Master Mix and PCR Primer Cocktail tubes to 600 x g for 5 seconds Remove the Resuspension Buffer from 2 C to 8 C storage and bring it to room temperature Remove the AMPure XP Beads from 2 C to 8 C storage and let stand for at least 30 minutes to bring them to room temperature Remove the PCR plate from 15 C to 25 C storage if it was stored at the conclusion of Clean Up ALP on page 77 Let it thaw at room temperature Centrifuge the thawed PCR plate to 280 x g for 1 minute Remove the adhesive seal from the thawed PCR plate Part 15031048 Rev E Pre program the thermal cycler with the following program and save as PCR Choose the pre heat lid option a
124. y a CAP barcode label to a new 96 well 0 3 ml PCR plate Apply a PCR barcode label to a new 96 well 0 3 ml PCR plate Add LIG 1 Do one of the following If using RNA Adapter tubes centrifuge the thawed tubes to 600 x g for 5 seconds If using a RAP Thaw the plate for 10 minutes at room temperature on the benchtop Visually inspect the wells to make sure that they all are thawed Remove the adapter plate tape seal TruSeq Stranded Total RNA Sample Preparation Guide 37 Centrifuge the plate to 280 x g for 1 minute to collect all of the adapter to the bottom of the well Remove the plastic cover Save the cover if you are not processing the entire plate at one time If it is the first time using this RAP apply the RAP barcode label to the plate 2 Centrifuge the Ligation Control if using Ligation Control and Stop Ligation Buffer tubes to 600 x g for 5 seconds 3 Immediately before use remove the Ligation Mix tube from 15 C to 25 C storage 4 Remove the adhesive seal from the ALP plate 5 Do one of the following If using the in line control reagent Dilute the Ligation Control to 1 100 in Resuspension Buffer For example 1 ul Ligation Control 99 ul Resuspension Buffer before use Discard the diluted Ligation Control after use Add 2 5 ul of diluted Ligation Control to each well of the ALP plate If not using the in line control reagent add 2 5 ul of Resuspension Buffer to each well of the ALP plate 6 Add2 5 ul o
125. y rights for specific diagnostic methods for specific forensic methods or for specific nucleic acid biomarkers sequences or combinations of biomarkers or sequences are examples of Application Specific IP Consumable s means Illumina branded reagents and consumable items that are intended by Illumina for use with and are to be consumed through the use of Hardware Documentation means Illumina s user manual for this Product including without limitation package inserts and any Part 15031048 Rev E other documentation that accompany this Product or that are referenced by the Product or in the packaging for the Product in effect on the date of shipment from Illumina Documentation includes this document Hardware means Illumina branded instruments accessories or peripherals lumina means Illumina Inc or an Illumina affiliate as applicable Product means the product that this document accompanies e g Hardware Consumables or Software Purchaser is the person or entity that rightfully and legally acquires this Product from Illumina or an Illumina authorized dealer Software means Illumina branded software e g Hardware operating software data analysis software All Software is licensed and not sold and may be subject to additional terms found in the Software s end user license agreement Specifications means Illumina s written specifications for this Product in effect on the date that the Product ships from Illumina 2 Re

TruSeq Stranded Total RNA Sample Preparation Guide 15031048 E

Contents

Download Pdf Manuals

Related Search

Related Contents