Home

miRZip™ Lentivector-based Anti- MicroRNAs

image

Contents

1. 3048 Copepod green fluorescent protein similar to regular EGFP but with brighter color as a reporter for the transfected transduced cells T2A 3049 3102 Thosea asigna virus 2A translational cleavage site containing 18 amino acid residues Cleavage occurs via a co translational ribosome skipping mechanism between the C terminal Glycin and Prolin residues leaving 17 residues attached to the end of copGFP and 1 residue to the start of the puromycin resistance marker Puro 3103 3702 Puromycin resistant marker for selection of the ransfected transduced cells WPRE 3703 4291 Woodchuck hepatitis virus posttranscriptional regulatory element enhances the stability of the viral transcripts 3 ALTR AU3 4631 4813 Required for viral reverse transcription self inactivating 3 LTR with deletion in U3 region prevents formation of replication competent viral particles after integration into genomic DNA H1 RNA 4526 4616 RNA polymerase III promoter for expression of anti microRNA insert promoter SV40 Poly A 4911 5219 Transcription termination and polyadenylation SV40 Ori 4911 5219 Allows for episomal replication of plasmid in eukaryotic cells pUC Ori 5584 6252 Allows for high copy replication in E coli AmpR 6397 7257 C Ampicillin resistant gene for selection of the plasmid in E coli Page 8 ver 1 081208 www systembio com miRZips Lentivector based anti microRNAs Cat MZIPxxx PA 1 B Related Products Lentivector Packaging
2. Infected Cells Because infected cells stably express copGFP and puromycin as well as the anti microRNA cloned into the miRZip vector they can be selected either for GFP positive cells by FACS or for puromycin resistance cells by puromycin treatment Since puromycin resistance can vary from cell type to cell type we recommend you generate a killing curve of your target cells with different concentrations of puromycin in a 96 well plate and then use the lowest concentration that can kill your target cells the next day after the addition of puromycin for selecting your infected cells 888 266 5066 Toll Free 650 968 2200 outside US Page 7 System Biosciences SBI lll Appendix User Manual A Map and Features for miRZip Vector RSV promoter HIVLTR AmpR pUC Ori S40 ori A ean O p X pGFP Bat T2A H 1promoter a FGNF sequencing primer WPRE Feature Location Function RSV S LTR 7 413 Hybrid RSV promoter R U5 long terminal repeat required for viral packaging and transcription gag 566 920 Packaging signal RRE 1076 1309 Rev response element binds gag and involved in packaging of viral transcripts cPPT 1806 1923 Central polypurine tract includes DNA Flap region involved in nuclear translocation and integration of transduced viral genome CMV promoter 1929 2278 Human cytomegalovirus CMV constitutive promoter for transcription of copGFP T2A puro copGFP 2293
3. Kits For FIV based Vectors pPACKF1 Cat LV100A 1 For HIV based Vectors pPACKH1 Cat LV500A 1 Unique plasmid mixes that produce all the necessary viral proteins and the VSV G envelope glycoprotein from vesicular stomatitis virus required to make active pseudoviral particles Producer Cell Line 293TN SBI Cat LV900A 1 transiently transfected with the packaging plasmids and an HIV based lentiviral construct produce packaged viral particles containing the lentiviral construct of interest 293TN Human Kidney Producer Cell Line Cat LV900A 1 For packaging of plasmid lentivector constructs Peg it virus precipitation solution Cat 4 LV810A 1 Concentrate lentiviral particles 10 to 100 fold pGreenPur empty lentivector control Cat SIB05A 1 e Lentivector UltraRapid Titer PCR Kit Cat 4 L V960A 1 for human cells LV960B 1 for mouse cells Allows you to measure copy number MOI of integrated lentiviral constructs in genomic DNA of target cells after transduction with any of SBI s FIV or HIV based lentivectors using qPCR Lenti miR microRNA precursor clone collection PMIRHxxx PA 1many Choose from an extensive collection library or have your pre microRNA of choice custom built as a service The collection will be expanded to include all known Human pre miRNAs MicroRNA qPCR profiling systems measure all Human or Mouse microRNAs from a single cDNA synthesis e QuantiMir microRNA cat RA420A 1 and e miRNome Pr
4. cleaves the loop In both approaches the siRNA molecules are transcribed from constitutive RNA polymerase IIl promoters i e U6 and or H1 and terminated with TTTTT Ts sequences The U6 and H1 promoters are different in size but contain the same conserved sequence elements pSIH H1 Vector H1 Promoter 44 EcoRI nPPPPP AATTCATCTATGT BI 0 ee ee lew ERE IIT IPIE PPP p GTAGATACA P53 siRNA template oligos 1 P Sense Loop Antisense Terminator 5 gatccGACTCCAGTGGTAATCTACcttcctgtcagaGTAGATTACCACTGGAGTCtttttg 3 3 gCTGAGGTCACCATTAGATGgaaggacagtctCATCTAATGGTGACCTCAGaaaaacttaa 5 Fig 1 Design of the single promoter miRZip shRNA anti microRNA expression cassette The dotted lines at the top of the figure indicate the position of the stuffer fragment that is removed during linearization by digesting the vector with BamHI EcoRI Your miRZip template sequence is directionally inserted between the BamHI and EcoRI nucleotide overhangs The miRZip Vector is designed to express a single stranded shRNA sequence with a fold back stem loop structure also known as a hairpin from a RNA polymerase Ill H1 promoter The hairpin type siRNA shRNA template oligonucleotides need to be cloned into unique BamHI EcoRI sites located just downstream of an H1 promoter Figure 1 When the anti microRNA construct is expressed from the constitutive H1 promoter and terminated with the TTTTT sequence the shRNA transcript folds
5. into the hairpin structure which is recognized by the DICER enzyme and is processed to produce functional single stranded anti microRNAs To sequence your hairpin clone use this primer Fwd GNH Primer TOCATGTCGCTATGTGTTCTGGGA 888 266 5066 Toll Free 650 968 2200 outside US Page 3 System Biosciences SBI User Manual Each miRZip hairpin interfering RNA is designed to generate the full length antisense microRNA for a specific targeted microRNA The target microRNAs are zipped miR ZIPs permanent microRNA knockdown Reverse P Sense Loop Antisense Terminator tccGACTCCAGTGGTAATCTACcttcctgtcagaGTAGATTACCACTGGAGTCtttttgaa aggCTGAGGTCACCATTAGATGgaaggacagtctCATCTAATGGTGACCTCAGaaaaactt Transcription ttc 5 GACUCCAGUGGUAAUCUACT t shRNA transcript 3 uuCUGAGGUCACCAUUAGAUG4 Sac Fig 2 Example shRNA anti microRNA template construct The nucleotides for the specific anti microRNA sequence targeting the microRNA of choice are shown in capital letters The shRNA sense and antisense sequences flank the region coding for the loop structure In addition a terminator sequence for the RNA polymerase Ill is included after the antisense portion After transcription a stem loop stem shRNA molecule is produced This molecule is processed by the DICER enzyme to generate a double stranded anti microRNA effector D List of Components Each miRZip construct comes as a bacterial stock Incubate your miR
6. license agreement destroy all Products containing WPRE in you control and so notify SBI in writing This License shall be governed in its interpretation and enforcement by the laws of California Contact for WPRE Licensing The Salk Institute for Biological Studies 10010 North Torrey Pines Road La Jolla CA 92037 Attn Office for Technology Management Phone 858 435 4100 extension 1275 Fax 858 450 0509 CMV Promoter The CMV promoter is covered under U S Patents 5 168 062 and 5 385 839 and its use is permitted for research purposes only Any other use of the CMV promoter requires a license from the University of lowa Research Foundation 214 Technology Innovation Center Ilowa City IA 52242 SBI has pending patent applications on various features and components of the Product For information concerning licenses for commercial use contact SBI Purchase of the product does not grant any rights or license for use other than those explicitly listed in this Licensing and Warranty Statement Use of the Product for any use other than described expressly herein may be covered by patents or subject to rights other than those mentioned SBI disclaims any and all responsibility for injury or damage which may be caused by the failure of the buyer or any other person to use the Product in accordance with the terms and conditions outlined herein Limited Warranty SBI warrants that the Product meets the specifications described in the accompanyin
7. pictures were taken 24 hour after the initiation of the puromycin treatment 888 266 5066 Toll Free 650 968 2200 outside US Page 5 System Biosciences SBI User Manual ll How miRZips Work miRZip anti sense microRNAs are stably expressed RNAi hairpins that produce mature anti microRNAs These miRZips antagonize its endogenous microRNA target and inhibit its function The miRZip construct produces high levels of anti sense small RNAs that target a specific microRNA Upon binding the miRZip provides a more stable template for the microRNA to bind to and sequestering it from participating in RISC associated target mRNA translation inhibition pmiRZIP lentivector miRZIP Permanent microRNA inhibition Endogenous microRNAs Transfection and Analysis of microRNA Suppression Efficiency If you are planning to use SBI s miRZip anti microRNA constructs for viral delivery we recommend comparing efficiencies of several transfection procedures e g Invitrogen s Lipofectamine 2000 Cat 11668 027 Roche FuGENE 6 Cat 11 815 091 001 The goal of these experiments is to achieve at least 90 95 transfection efficiency of target cells which can be measured by analysis of GFP positive cells For microRNA suppression studies using transfection it is important to optimize the selected transfection protocol and then keep the parameters constant to ensure reproducible results Depending on what is appropriate for your targ
8. system are pseudotyped with envelope G glycoprotein from Vesicular Stomatitis Virus Despite the above safety features use of HIV based vectors falls within NIH Biosafety Level 2 criteria For a description of laboratory biosafety level criteria consult the Centers for Disease Control Office of Health and Safety Web site at http www cdc gov od ohs biosfty bmbl4 bmbl4s3 htm It is also important to check with the health and safety guidelines at your institution regarding the use of lentiviruses and always follows standard microbiological practices which include Wear gloves and lab coat all the time when conducting the procedure All procedures are performed carefully to minimize the creation of splashes or aerosols Work surfaces are decontaminated at least once a day and after any spill of viable material All cultures stocks and other regulated wastes are decontaminated before disposal by an approved decontamination method such as autoclaving Materials to be decontaminated outside of the immediate laboratory are to be placed in a durable leakproof container and closed for transport from the laboratory miRZip lentivector constructs can be used for both GFP sorting and Puromycin selection for stable cell lines Phase contrast GFP fluorescence HEK 293 cells were transfected with empty miRZip anti microRNA expression vector and puromycin 50 ug ml final concentration was then added to the cells 24 hours after transfection The
9. 15 F Safety Guidelines SBI s miRZip lentivectors together with the pPACKH1 packaging plasmids comprises a third generation HIV 1 based cloning vector system These lentivectors are based on the vectors developed for gene therapy applications by Dr J G Sodroski US patent 45 665 577 and 5 981 276 This system is designed to maximize its biosafety features including Deletion in the enhancer of U3 region of S LTR ensures self inactivation of lentiviral construct after transduction and integration into genomic DNA of the target cells RSV promoter upstream of 5 LTR in miRZip expression vector allows efficient Tat independent production of viral RNA reducing the number of genes from HIV 1 that are used in this system Number of HIV 1 viral genes necessary for packaging replication and transduction is reduced to three gag rev and pol and these genes are expressed from different plasmids lacking packaging signals and significant homology to the miRZip expression vector VSV G expression vector or each other to prevent generation of recombinant replication competent virus None of the HIV 1 genes gag pol rev will be present in the packaged viral genome as they are expressed from packaging plasmids lacking packaging signal therefore the lentiviral particles generated are replication incompetent Pseudoviral particles will carry only the expression construct of your target gene The lentiviral particles produced in this
10. SSBI System Biosciences miRZip Lentivector based Anti MicroRNAs Cat MZIPxxxPA 1 User Manual Grow bacterial stock on receipt Make plasmid DNA for experiments A limited use label license covers this product By use of this product you accept the terms and conditions outlined in the Licensing and Warranty Statement ver 1 081208 contained in this user manual miRZips Lentivector based anti microRNAs Cat MZIPxxx PA 1 Contents l Introduction and Background Purpose of this Manual Lentiviral miRZip Expression System miRZip shRNA Expression Lentivector List of Components sss Additional Required Materials Safety Guidelines mmoomop Or avv lll Appendix A Map and Features for miRZip Vector B Related Products o o co 888 266 5066 Toll Free 650 968 2200 outside US Page 1 System Biosciences SBI User Manual I Introduction and Background A Purpose of this Manual This manual provides details and information for the use of miRZip anti microRNA expression lentiectors Specifically it provides critical instructions on the lentivector design the H1 expression cassette of the vector and verifying the construct This manual does not include information on packaging the miRZip construct into pseudotyped viral particles or transducing your target cells of choice with these particles This information is available in the user manual Lentivector Expression Syste
11. Zip construct bacterial stock plate at 37 C overnight Select 1 to 2 single colonies for construct propagation Grow your construct in LB Carbinicillin or 50 ug ml Ampicillin overnight shaking at 30 C This is important to avoid potential undesired lentivector recombination events E Additional Required Materials For Purifying miRZip Constructs after Propagation e Plasmid purification kit Recommended QIAGEN Endotoxin free Plasmid Kit The following kit combinations can be used for Midi scale preparation of endotoxin free DNA gt QIAfilter Plasmid Midi Kit Cat 12243 and EndoFree Plasmid Maxi Kit Cat 12362 gt QIAfilter Plasmid Midi Kit Cat 12243 and EndoFree Plasmid Buffer Set Cat 19048 Please visit the QIAGEN website to download the specialized protocol that is not contained in the user manual gt http www1 giagen com literature protocols pdf QP 15 pdf Transfection of miRZip Constructs into Target Cells e Transfection reagent Recommended Lipofectamine 2000 Invitrogen Cat 11668 027 Packaging of miRZip Constructs in Pseudoviral Particles Page 4 ver 1 081208 www systembio com miRZips Lentivector based anti microRNAs Cat MZIPxxx PA 1 pPACKH1 Lentivector Packaging Kit SBI Cat LV500A 1 293TN Producer Cell Line SBI Cat LV900A 1 or ATCC 293T 17 Cat CRL 11268 Lipofectamine Transfection Reagent Invitrogen Cat 18324 111 Plus Reagent Invitrogen Cat 4 11514 0
12. escription of SBI s Lentivector expression system please refer to the Lentivector Expression Systems Guide to Packaging and Transduction of Target Cells user manual C miRZip shRNA Expression Lentivector The miRZip expression vector is based upon SBI s pGreenPur lentivector an improved third generation of HIV based expression lentivector developed for gene therapy applications See section F for safety guidelines The miRZip vector see detailed functional map in Appendix provide the following features e H1 expression cassette provides constitutive and efficient RNA polymerase Ill dependent transcription of anti microRNA transcripts in a wide range of cell lines e CMV promoter promotes high level of expression of both copGFP fluorescent reporter and puromycin N acetyl transferase drug selectable marker in the same vector for detection and selection of either transduced or transfected cells Page 2 ver 1 081208 www systembio com miRZips Lentivector based anti microRNAs Cat MZIPxxx PA 1 e Hybrid RSV 5 LTR promoter provides a high level of expression of the full length viral construct in 293 cells e Genetic elements cPPT GAG LTRs necessary for packaging transducing and stable integration of the viral expression construct into genomic DNA e V40 origin for stable propagation of the miRZip plasmid in 293 producer cells e The pUC origin for high copy replication and maintenance of the plasmid in E c
13. et gene the inhibition efficiency of different anti microRNA constructs can be estimated by determining the amount of targeted mRNA repressed by the suppressed microRNA assessing the amount of target protein by Western blot or ELISA or assaying for activity of the target protein Usually miRZip constructs with 70 80 inhibition efficiency are suitable for microRNA functional analysis studies Page 6 ver 1 081208 www systembio com miRZips Lentivector based anti microRNAs Cat MZIPxxx PA 1 You can package this miRZip construct into pseudoviral particles and efficiently transduce these anti microRNA constructs into target cells of your choice For this purpose you will need to purchase the pPACKH 1 Lentivector Packaging Kit SBI Cat LV500A 1 and 293TN Producer Cell Line SBI Cat LV900A 1 The pPACKH1 User Manual Lentivector Expression Systems Guide to Packaging and Transduction of Target Cells includes the procedural information for packaging the shRNA lentivector constructs This user manual is also available on the SBI web site www systembio com Although you can create stable transfectants with the miRZip constructs using standard transfection and selection protocols transduction of the lentiviral miRZip anti microRNA constructs using packaged pseudoviral particles is the most efficient way to express siRNA in wide range of cells including dividing non dividing and hard to transfect varieties Selection of Stably
14. g Product Analysis Certificate If it is proven to the satisfaction of SBI that the Product fails to meet these specifications SBI will replace the Product or provide the purchaser with a refund This limited warranty shall not extend to anyone other than the original purchaser of the Product Notice of nonconforming products must be made to SBI within 30 days of receipt of the Product SBI s liability is expressly limited to replacement of Product or a refund limited to the actual purchase price SBI s liability does not extend to any damages arising from use or improper use of the Product or losses associated with the use of additional materials or reagents This limited warranty is the sole and exclusive warranty SBI does not provide any other warranties of any kind expressed or implied including the merchantability or fitness of the Product for a particular purpose SBI is committed to providing our customers with high quality products If you should have any questions or concerns about any SBI products please contact us at 888 266 5066 2008 System Biosciences SBI Page 10 ver 1 081208 www systembio com
15. ms Guide to Packaging and Transduction of Target Cells which is available on the SBI web site www systembio com Before using the reagents and material supplied with this system please read the entire manual B Lentiviral miRZip Expression System Short double stranded RNAs with sizes 19 29 bp can efficiently mediate the delivery of small RNAs in mammalian cells Synthetic single stranded anti microRNA molecules can be introduced into cells to suppress microRNA function transiently Alternatively miRZips can stably express anti microRNAs and provide permanent microRNA inhibition and in any cell type of choice Lentiviral expression vectors are the most effective vehicles for delivering genetic material to almost any mammalian cell including non dividing cells and whole model organisms As with standard plasmid vectors it is possible to introduce miRZip lentivector constructs in plasmid form into the cells with low to medium efficiency using conventional transfection protocols However by packaging the lentiviral miRZip construct into pseudoviral particles you can obtain highly efficient transduction and heritable expression of anti microRNAs even with most difficult to transfect cells like primary stem and differentiated cells The expression construct transduced in cells is integrated into genomic DNA and provides stable long term expression of the target gene Endogenously expressed anti microRNA effectors provide long term suppressio
16. n of the target microRNA and allow the researcher to generate cell lines and transgenic organisms with a stable microRNA inhibition phenotype for functional studies SBI offers a third generation of the most popular HIV 1 based lentivector expression system consisting of three main components 1 The lentiviral expression vector e g miRZips pSIH1 H1 Puro 2 The lentiviral packaging plasmids e g pPACKH17M Packaging Plasmid mix 3 A pseudoviral particle producer cell line e g 293TN cells The lentiviral expression vector contains the genetic elements responsible for packaging transduction stable integration of the viral expression construct into genomic DNA and expression of the anti microRNA effector sequence The packaging vector provides all the proteins essential for transcription and packaging of an RNA copy of the expression construct into recombinant viral particles For production of a high titer of viral particles producer cells e g HEK 293 cells need to be transiently co transfected with the expression and packaging vectors Expression constructs packaged in pseudoviral particles are secreted by producer cells in culture media and could be used directly to transduce expression construct in target cells Following transduction into the target cells this expression construct is reverse transcribed integrated into the genome of the target cell and provides a high level of expression of anti microRNAs For a detailed d
17. ofilers cats RA660A 1 RA670A 1 Global MicroRNA Amplification amp Cloning Kit cat RA400A 1 Clone and amplify all small RNAs C Technical Support For more information about SBI products to download manuals in PDF format and to get vector map and sequence information please use our web site http www systembio com For additional information or technical assistance please call or e mail us at System Biosciences SBI 1616 North Shoreline Blvd Mountain View CA 94043 Phone 650 968 2200 888 266 5066 Toll Free Fax 650 968 2277 E mail tech systembio com 888 266 5066 Toll Free 650 968 2200 outside US Page 9 System Biosciences SBI User Manual IV Licensing and Warranty Statement Limited Use License Use of the miRZip anti microRNA Expression Construct i e the Product is subject to the following terms and conditions If the terms and conditions are not acceptable return all components of the Product to System Biosciences SBI within 7 calendar days Purchase and use of any part of the Product constitutes acceptance of the above terms HIV Vector System This product is for non clinical research use only Use of this Product to produce products for resale or for any diagnostic therapeutic clinical veterinary or food purpose is prohibited In order to obtain a license to use this Product for these commercial purposes contact the Office of Research and Technology Ventures at the Dana Farbe
18. oli cells e The ampicilin resistance gene for selection in E coli cells WPRE element enhances stability and translation of the CMV driven transcripts e The SV40 polyadenylation signal enables efficient termination of transcription and processing of recombinant transcripts The miRZips and its parental empty lentivector pGreenPur Cat SI505A 1 contain a puromycin resistance gene to enable drug selection of target cells stably expressing the anti microRNA and a copGFP gene The COpGFP is a novel fluorescent protein derived from copepod plankton Panalina sp which is similar to EGFP but has a brighter color This gene serves as a fluorescent reporter for the transfected or transduced cells The open reading frames of puromycin resistance and copGFP genes are connected by a T2A sequence and are transcribed from the CMV promoter as a bicistronic transcript The two proteins are then separated through translational cleavage at the T2A site Two approaches have been developed for in vivo expression of interfering RNAs from plasmid and viral vectors In one approach the sense and anti sense strands are transcribed separately from two independent promoters and form the interfering RNA duplex With the second approach a single stranded shRNA sequence with a fold back stem loop structure also known as a hairpin is expressed from a single promoter This sequence is then converted into double stranded siRNA after intracellular processing
19. r Cancer Institute Inc in Boston Massachusetts USA This Product or the use of this Product is covered by U S Patents Nos 5 665 577 and 5 981 276 and foreign equivalents owned by the Dana Farber Cancer Institute Inc WPRE Technology System Biosciences SBI has a license to sell the Product containing WPRE under the terms described below Any use of the WPRE outside of SBI s Product or the Products intended use requires a license as detailed below Before using the Product containing WPRE please read the following license agreement If you do not agree to be bound by its terms contact SBI within 10 days for authorization to return the unused Product containing WPRE and to receive a full credit The WPRE technology is covered by patents issued to The Salk Institute for Biological Studies SBI grants you a non exclusive license to use the enclosed Product containing WPRE in its entirety for its intended use The Product containing WPRE is being transferred to you in furtherance of and reliance on such license Any use of WPRE outside of SBI s Product or the Product s intended use requires a license from the Salk Institute for Biological Studies This license agreement is effective until terminated You may terminate it at any time by destroying all Products containing WPRE in your control It will also terminate automatically if you fail to comply with the terms and conditions of the license agreement You shall upon termination of the

Download Pdf Manuals

image

Related Search

Related Contents

Hygiena Luminometer Manual  Prime-Line D 1607 Instructions / Assembly  SMART THERMOSTAT User Manual  Extreme Weather WindObserver User Manual  Valueline VLCP52055I20 serial cable  KFC Cruautés - Massacre animal  Toastautomat PC-TA 1014  Instrucciones de servicio  Original- Bedienungsanleitung Luftbefeuchter Air Vital  instrucciones de manejo DSN  

Copyright © All rights reserved.
Failed to retrieve file