Home

tutorial 1 - Textco BioSoftware

1. are considered comments The first line without a semicolon is the sequence ID name Everything following this line is consid ered sequence Pearson FASTA Any line starting with gt is a comment line Lines starting with gt indicate the Page 8 2 Appendix Import File Formats start of a new sequence Pearson files can have multiple sequences in the same file Sequence lines are those that do not start with gt NBRF The first line is the HEADER line and the second line is the TITLE both these lines are put into comments The sequence follows starting on the third line and continues until an asterisk is reached Everything following the asterisk is comments Text Everything in a TEXT file is considered sequence All non nucleotide charac ters are removed lower case letters are converted to upper case letters and U s are converted to T s GCG Wisconsin Everything is comment until two adjacent periods Everything after the periods is considered sequence EMBL SwissProt Starting at the first line of the file every line is considered a comment includ ing the line that starts with sa The line immediately after the sq line starts the sequence Sequence information continues until 7 Staden Sequence and comments are mixed All comments start with lt and end with gt Everything else is considered sequence The Gene Construction Kit expects Staden sequence
2. Page 3 28 Construct Window Silent Mutations be candidates for removal of a site It is the basic restriction enzyme chooser GCK needs to be sure that any enzyme site you choose to remove is actu ally there and also will provide you with other alternative enzymes if you choose to see them In Figure 3 25 a number of enzymes have been chosen to be viewed as candidates for removal Pressing the OK button will bring up Figure 3 26 Sites to Remove Select sites to remove by silent mutation Site pos enzyme name Site is marked Accll BstMWI Dpni BfuCl 0 352 CviAll 366 Bsc4 375 BstX2I 375 BspLI 375 BamHI yes 375 AcIW 376 Dpni BfuCl A Cancel e a Figure 3 26 Removing Sites 2 Figure 3 26 page 3 29 has three columns of data listing possible sites that can be removed by silent mutation The first column shows the positions of all the possible cuts in the DNA using the enzymes selected in the first step those that were chosen in Figure 3 25 The second column shows the names of each of the enzymes that have recognition sites in the DNA indi cated in the first column The third column either shows a yes or is empty depending on whether the site is actually marked in the current view of the construct In the list provided in Figure 3 26 you need to specify which site s you want to remove by silent mutation In the figure shown the BamHI g Note that this DNA corresponds to the DNA whi
3. 7 Click somewhere in the sequence and then choose Edit gt Select All Choose Format gt Grouping gt Group by Tens If you can adjust the width of your window to contain 100 characters per line it will be easier to make selections in subse quent steps 8 We need to now define introns Double click on the first intron it is green You should see 200 321 in the lower left corner of the construct win dow Choose Construct gt Features gt Define Intron This will invert the selection so that the letters appear white on a green background Repeat this process for the second intron 9 The next step is to define what we want to translate From Step 2 above we know that the coding region starts at 108 and ends at 1566 Select this range of nucleotides confirm that you have selected the correct range by looking in the bottom left of the construct window 10 Now choose Construct gt Features gt Make Region This will allow you to trans late the selected sequence Enter a name in the dialog box and make sure to check the Protein Sequence checkbox It should look like Figure 2 76 Once Region Info eS Name G Gamma alobin First Pos 108 V Protein Sequence Read from Last Pos 5 1566 e top strand Generation 0 C bottom strand Comments Figure 2 76 Making a globing region you have this window appropriately set press the OK button You will now see the translated protein created by reading codons in the exons a
4. cota A A eee 7 71 Show Partial Digests iii 7 72 Show Hide Gel Legend comccccccccccnonononnnncnnncnnnnnnnnnnnnnnrrn nn 7 71 Show Hide Runoff Count cococcconnnccnccnccnnnncnonnonnncnnnnnnnnnnnnnnnnnnnnnnonnncnnnnnnnnancnnnns 7 71 Show Hide Standard Sizes ccccsccccsseeeceeeceaseeceeeeecaeeceaeeeceesesseeesseeesaass 7 71 gels OXPOMING aree la decided lec 5 5 fragment size table ooooccccccnnonononcnnnnnnncnnnnnnnnnnnnnnnnrnnnnnnnnnnnnnnnrnrrnnrnnnnnnnnnnnnrnnnnnns 5 3 full digest ecc A ELE Naa 7 71 OO tic DA A A ii 5 2 7 71 MADINOS eeir e a eteee sees tye vei ESEE 7 15 OVERVIGW A owtas O O TT 1 4 partial digests ocio a eee Re eee 5 4 7 72 rearranging Tanes wis fecctias las eA ere etek tie cau 5 4 PUTIN Gs O E MIES 2 45 r no count aa e e r dietas 5 2 7 71 SIZE INdICAtO ua a datada 5 1 Standard SIZES A A hideeeteds cutie de tden ends cdaeeees 7 71 thresholdS eles cet eect o Aids cae EE E aro Le 5 2 7 72 GenBank suicida ia ii 2 64 8 2 MES ri oca 2 64 eaten 2 64 Index 6 JM a o iO 2 70 Gene Inspector mii dad o ti 2 61 3 40 8 3 general info cia dde 7 68 generate PIMES escritora Ele 7 41 generations see chronography genene CONSTTUC S iii A sprints cope 2 56 JTOUPING Characters iii A DA A eens 3 19 H hide COMMONS sereoo aan aaa e a eraa eae Aa aa eraa aurae a aarde 2 71 Illustration menu Align Selection isiccce sat sfectasenrdeccecay cdceteg ea aaae aa cites 7 75 Bino to Front sia 7 75 RedUCION escr
5. v J_segment Y LTR gt Y mat_peptide MPVK Y misc_binding comment v misc_difference region Y misc_feature region Y misc_recomb region 7v misc RNA region v misc_signal region v misc structure region v modifed_base marker Y mRNA region gt v mutation marker o Y N_region segnent CE Y old_sequence comment H v operon region v oriT region o Y polyA_signal frame Figure 2 68 Deluxe Import conversion defaults you to toggle between a check mark and an x by clicking with the mouse Only those features that are checked will be transferred to GCK The second column shows the GenBank feature Name while the third column Type shows how that feature will be indicated within GCK You can change how each feature will be treated by selecting the feature and then using the Feature menu and the Format menu to change the appearance of the feature in GCK Under Tools gt Deluxe Import gt you can Save or restore you choices of conversion defaults Page 2 65 Tutorials Importing GenBank Sequence Files Using Deluxe Importing 4 After pressing the Convert to GCK button you will end up with a new construct like that shown in Figure 2 69 This figure shows all of the Gen variation See AAA EAN A gt 4 gt Figure 2 69 Imported construct Bank features that were selected to be imported in the original GenBank file You can click on each feature and cho
6. Constructs gels and sequences can be selected in their own windows and pasted into the Illustration Window Selection vs Targeting An important concept regarding objects in the Illustration window is the selec tion or targeting of an object Clicking once on an object will select the object Selected Object Targeted Object Figure 6 1 Selection vs Target which will the appear with 8 handles around it as shown in the left side of Figure 6 1 A selected object can be resized by dragging one of the handles as in other applications Clicking in the middle of a selected object allows the object to be dragged to a different location within the illustration Constructs or Gels that are pasted into the Illustration window can be selected as just described In addition these objects can also be targeted by double clicking on them A targeted object will have a gray border around it and items within Page 6 1 The Illustration Window Using the Illustration Window the object can be edited If a Gel object is targeted a Gel menu will appear to the right of the Illustration menu If a construct is targeted a Construct menu will appear to the right of the Illustration menu When either of these objects is targeted all items in the Construct or Gel menus will be available except for those which change the view of the object This means that you cannot change from a graphic view to a text sequence view This is because a change between
7. Lists might also be used to store primer sequences for PCR Cut sites are relevant only to restriction enzymes and are of no consequence in other kinds of sites If no cut site is defined for the entry in the list the rec ognition marker will be placed at the beginning of the recognition sequence Page 4 2 List Window New List Entries 0008 lt List commercial_with_comments Number of Items 602 Name Accill Sequence TCCGGA Comments Isoschizomer with BspMII Aor13HI Bbf74111 BbvAlll Bla7920l Bifl BseAl BsiGl BsiMl BsiOl Bsp131 Bsp228l Bsp2331 Bsp508l BspEl BspH2261 BstZ1I BstZ31 Bsu22l Bsu231 CauB3l Cfr571 EspHK261 Kpn21 Mrol PinBll Ptal Tsp507l Tsp5 141 Uba11361 Ubal2791l Ubal3751 and Uba14251 Available from Stratagene 1 03 Qbiogene 4 03 Nippon Gene Co Ltd 6 00 Takara Bio Inc 9 04 and Promega Corporation 6 03 Figure 4 3 A List Window Comments are optional and can be used to list isoschizomers or other infor mation When an item is selected in the list the three fields on the right of the win dow become filled In Figure 4 3 AccII in the commercial_with_comments list provided with GCK has been selected Selected items in lists will have a bullet next to them to indicate that the information on the right side of the window pertains to the bulleted item on the left side of the window This list with comments contains information about isoschi
8. Matches were found in the following files pXa1 gcc pUC amp 9 gec Len pMEX8 gcc pMEX7 gcc Open All pMEX6 gcc pMEX5 gcc pLITMUS39 gcc pLITMUS38 gcc pIBI31 gcc Save List nIRIAN ace a K Location Figure 2 46 Search Results 3 in entering comments anyone will be able to search the comments of all the files at the organization and by looking at the comments know who to contact about obtaining the construct Page 2 44 Tutorials Running Gels and Orientation Analysis TUTORIAL 9 RUNNING GELS AND ORIENTATION ANALYSIS Often in a cloning project there is a need to assay the success of each clon ing step Typically this is done by gel electrophoresis This tutorial will teach you how to run gels in GCK 1 Start GCK and open the files construct 6 and construct 7 which you cre ated in Tutorial 6 Cloning a DNA Segment and Silent Mutations page 2 23 If you don t have these files available you can use the files that were installed in your tutorial files folder by the same names Recall that these files Mark Sites File all_enzymes 3 Mark only those enzymes with Y blunt ends Y 5 overhang ends Y 3 overhang ends Bsil I Enzymes to mark BsiHKAI ce BsiGl Add All gt BsiHl E BsiHKAl Get Info BsiHKCI v TS Mark enzymes for which Display new sites OD more than 0 sites are found as symbols 7 less than 32000 sites are found as
9. This site is maintained by the U S Government and is protected by various provisions of Title 18 of the U S Code Violations of Title 18 are subject to criminal prosecution in a federal court For site security purposes as well as to ensure that this service remains available to all users we use software programs to monitor traffic and to identify unauthorized attempts to upload or change information or otherwise cause damage In the event of authorized law enforcement investigations and pursuant to any required legal process information from these sources may be used to help identify an individual Whitehead Institute for Biomedical Research Primer3 Copyright c 1996 1997 1998 1999 2000 2001 2004 Whitehead Institute for Biomedical Research All rights reserved Redistribution and use in source and binary forms with or without modification are permitted pro vided that the following conditions are met Page 8 7 Appendix Textco BioSoftware Inc License Agreement Redistributions must reproduce the above copyright notice this list of conditions and the following disclaimer in the documentation and or other materials provided with the distribution Redistribu tions of source code must also reproduce this information in the source code itself If the program is modified redistributions must include a notice in the same places as above indi cating that the redistributed program is not identical to the version distributed by Whiteh
10. page 7 46 Once created the region Page 7 45 Menu Items Region Info Name actin First Pos 27480 Y Protein Sequence Read from Last Pos 31747 _ top strand Generation 3 bottom strand Comments the actin SC geng Figure 7 31 Creating a New Region can be selected and then modified using any of the appropriate commands on the Format menu You can adjust the starting and ending nucleotides to be used for creation of this region by typing in the value you wish Checking Protein Sequence in this dialog will cause GCK to translate the sequence using the default codon table Choose Codon Table page 7 45 when ever the construct is displayed as a sequence The Protein Direction but tons allow you to define which strand will be used to create the protein sequence Note that the direction of a selected region can also be changed by using the Format gt Lines menu and choosing a different direction for the arrowhead Find Open Reading Frames The Construct gt Features gt Find Open Reading Frames menu item will search the con struct and find all open reading frames according to the parameters set in the dialog shown in Figure 7 32 If part of the construct is selected the ORF search will look only at the selected segment If no segment of DNA is selected the entire construct will be searched The starting and ending offsets nucleotide positions are indicated in this dialog along with the codon table to
11. 2 INOS econ Aa E E AAAA EAA ANATOLE 2 70 inverting Sequences cooccconccccnncconnnnncnncnnnnncnnnrnnonnnnrnnrrnnnnennarennnnnnns 2 26 3 26 7 14 J JPEG PIGS 1 A A A A A AA 2 62 7 6 JUNCHION Markers cerros 3 26 K keyword Sea eP o a eh A Ae ieee eens Peete Pee TE 2 81 L legal nucleotide Characters 2 cececeeeeeeeee eee ee eeeeeeeeeeeee ee Nirien eddi Leye 8 1 License Agreement 8 5 faye seer eee aaa EE ERO ONORARI eae cere 8 8 ENTRA eee eieee sy eed A eres 2 28 3 25 Nale DORAGKS 2c 5c3 oxcSecces sea cadence oeecek ace oestucse wecexbas tome TAT 3 20 7 58 ING Breaks tiza idad 3 20 7 29 ESPACIO LA A E A A A eee ene ee 7 59 line thicknesS oiac a ceca eee ee 2 4 A ON 2 54 List menu Alphabetical ist ceso ii adds 7 77 Define Cut Site roaie ci id aiii 7 77 New LIS EMI ccoo Pi eo ee ee da 7 77 list Of OPEN WINGOWS cccccccceeeeeeeceeeeeeeeeeeeeeeeeeeeaeeeeeeaaeeeeenaaeeeesaeeeeesenseeeenaes 7 16 Index 8 list WINDOW OVEIVIeW ssi leiten iaeiei eaaeo iaaa eiaa daade aoaaa aaa aasa aiaa 1 3 list WNdOWS tt E A a des 4 2 listing sites ii rial 3 15 7 51 lists alphabetical cit iii gt dae dadevely 4 5 and GCK Data folder aaan a a a Gaee aaa ata aa daa datada 4 2 ereat OW A A AA AA A 4 5 defining Cut Sites orita ane ted les Ae pede evpe rere cee 4 4 A ean ee a hie aia ean te ee ee 4 6 NeW entintado 4 3 OPONE A A A A A AAA AE 4 2 location prefs Gusta ta 2 64 7 35 Making TEGI ic a 7 45 making illustratio
12. 7 28 Set Scale Dialog 7 28 Since the screen is limited in its resolution to an integral number of pix els inch on the screen typically 72 pixels per inch GCK will show you the actual scale on screen in addition to the value you entered The scale legend Page 7 42 Desired Scale on Screen nts cm Scale Legend Length cm 11 00 Actual Scale on Screen nts cm 110 89 Cancel Menu Items length refers to the length of the bar that will be drawn in the window to indi cate the scale Once you have defined a specific scale with this dialog you are telling GCK that you want to see the construct represented at that particular scale There fore when you resize the construct window the scale will not automatically change If you shrink the window the scroll bars will become active to allow you to navigate around the construct To have the construct automatically change size when the window is resized choose Fit To Window page 7 43 Z00m In Zoom Out Selecting Construct gt Magnification gt Zoom In fl command fl ctrl will magnify the view and center it on the location of the insertion point or the selection It will provide a 2 fold magnification with each iteration of the command Con struct gt Magnification gt Zoom Out ff command f ctrl will decrease the magnifica tion by a factor of two with each iteration to allow more of the construct to be seen Fit To Window Constru
13. CONSTRUCT AS A SEQUENCE 1 Up to now we have been working with a graphical view of the construct but underneath all of this is a real DNA sequence Start GCK and open the file construct 3 that you saved in the previous tutorial If you do not have this file you can start with construct 3 from the tutorials folder provided 2 Choose Construct gt General Info You will see something like Figure 2 14 Construct Info construct32 gcc Cole JE Name construct 2 gcc Size 2964 Comments This file was downloaded from the 12 87 VecBase by Keith AJohnson on a Dec 14 1989 Modified by Bob Gross 12 26 89 ENTRY BLUEKSP TYPE DNA CIRCULAR TITLE BlueScribe KS Plus Cloning vector DATE 28 JAN 1987 sequence 02 FEB 1987 sequence 04 MAR 1987 sequence 03 APR 1987 ACCESSION VB0078 z Figure 2 14 General Info Dialog The General Info is stored with the construct as a whole and is not attached to any specific segment or region of the DNA This means that it will not be lost if you reformat the construct or cut and paste segments It is a useful place to store information such as storage location for the DNA and other information as shown in construct 3 In combination with the File Searching ability Tutorial 8 Finding Comments and File Searching page 2 38 the comments can be used to create a database of information on all your clones 3 Use the scroll bar until you see the information stating that the f1 DNA wh
14. DNA segments and the construct has many generations it might be difficult to get an overall picture of the history of the construct This option will create a TEXT file that contains all the com ments in the construct from all objects in all generations The comments will be listed in order from most recent to most ancient generation and by dis tance from the origin or 5 end of linear constructs The TEXT file can then be opened from any standard word processing package and printed or viewed The precise format of the output file is shown Comment Export For mat page 8 4 Exporting Illustrations Exporting from the Illustration Window provides similar choices to those just described for the Construct Window Selecting File gt Export will give you a dia log box similar to that shown in Figure 3 41 page 3 42 but only PICT JPEG and Illustration buttons will be available Exporting Gels Exporting from the Gel Window also provides similar choices Gel TEXT and PICT TEXT format will save a list of all the cut sites and fragment sizes as if they were viewed in the Gel Window as a Table see Viewing a Frag ment Size Table page 5 3 Exporting Lists Exporting from the List Window provides similar choices to those just described already Selecting File gt Export will give you a dialog box similar to Page 7 7 Menu Items that shown in Figure 3 41 page 3 42 but only List and TEXT buttons will be availabl
15. E eaaa aaa a aE eda 2 47 Creating NeW ISIS iio E A E TAE E ete eee eee ete 4 5 CUSCO oo 2 17 7 22 D database Searching seiniin niaaa ea id 2 81 7 41 database SOIVEN sihire ir eaa ees ells EEEa Seen cee aaa aaia senda 2 81 keyword lt SCQ rCh rrna Ea it ey ee yee 2 81 use current selection for DNA protein Search ccceeseeeceeeeeeeeeeeneeeeesaneess 2 82 default Construc anciaia dando 7 33 defatltidel etica cia 7 34 default illustration ici iaa 7 34 A eer e a EE a Eea pe ae eao 2 64 7 35 digest tables o ed cdo es dol eo E E 5 3 discarding generations ccccoonnccccnnonnnncnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnrrnnnnnnrnnnnannnnes 3 36 7 31 DNAIDESTS i raro A acetate cae et 2 47 DNAS INSPECctor Cerina ia A A A see ee 3 40 8 2 double st decicion cpa adeasleabaye 7 58 Index 3 E E Edit menu A NOS 7 13 COPY ia ca 7 11 A O Ea 7 11 Paste iii A Ra 7 11 Salett Al ti A RA A ata 7 14 Show Gel Construct Margins oommcnccnnccncnononnnnnnnnnnnnnnnnnnnnnnnnnnnn rr nn nr nena 7 15 SHOWOVEIVIEW iii a e 7 14 Shw Selection akrein eara ii A a aaa 7 15 Show Hide Clipboard sssr dit id T EA E 7 14 Show Hide Page Breaks cccccccccnonnncncnnccnnnonnnnnnnnnnnnnn non nn nnnnnnn nn nr rr rra 7 15 Special Pastori eed T O tae ened co dtvietant Savietacoexael odddvdnel eves 7 14 NGO EA A id 7 11 Editing Codon tables arses n en O o 7 44 Editing construct ends acicate lirio lidia AEA ai iA 7 64 editing CUU SIES caida Ee e EE RE EEE ee te
16. File Search Results Criteria Search text for ampicillin Directory Users bobgross Desktop GCK 3 GCK2 vectors Matches were found in the following files puc9 puCc8 pUC19 puc18 pSP64 pGEM4 pGEM3 pGEM2 pGEM1 Open All Save List Location Users bobgross Desktop GCK 3 GCK2 vectors pUC19 Figure 2 43 Search Results 1 Search Query and then lists all of the files that matched the criteria set in the search Clicking on a file in the list will allow you to open it You can also press the Save List button to create a text file containing all the matches with your query This might be useful for generating a list for example of all Page 2 41 Tutorials Finding Comments and File Searching the constructs containing an ampicillin resistance gene or those stored in room 211 freezer box 3B 8 Let s do another search Choose File gt Search Files again and fill in the query to match Figure 2 44 page 2 42 In this case the search is more lt File Search Criteria x Search GCK constructs for text in feature names and comments or for DNA sequence that match the following criteria Text x zi Empicilin El and Ez contains zi Balactosidase y ay fetracycliine contains and doesn t contain Add Remove Scan the directory C Users AdministratoriDesktop GCK30a3 Y Scan subdirectories Set Directory Search text for ampicill
17. File Searching page 2 38 Press the Cancel button to return to the graphical window Select the entire DNA of the construct by choosing Edit gt SelectAll or pressing command A Mac ctrl A Windows 7 Choose Format gt Chronography gt Restriction Sites to bring you back to the most recent generation of the construct Remember this is really just a different view of the same sequence you have been looking at throughout this tutorial 8 Choose File gt Open and open the file called actin DNA which is in the tutorial files folder Double click on the Sa fragment to select it Figure 2 35 and then choose Edit gt Copy We will be cloning this fragment into Construct actin DNA gcc LoJ 0 2 Figure 2 35 Sall Fragment of Actin DNA pBR322 9 Click once in the pBR322 window to make it the active window and then put the insertion point at the Sa site on the pBR322 DNA You can do this either by clicking in the DNA at the location of the Sa marker or by clicking on the Sa marker itself Once the insertion point is correctly located choose Edit gt Paste to paste the actin DNA Sa fragment into the pBR322 at the Sall site You will get a warning that you are about to delete a region the tetracy cline region in generation 1 is there even though you cannot see it click OK and then you will see Figure 2 36 page 2 35 Note that the positions in the Sa markers have been updated and the size of the construct has b
18. Files from GenBank 2 67 Translating Across IntronS 000 00 eee ee eee 2 70 PGR YAMAlYSIS Acta tu bl hides bk A a sc dnhbtAS 2 74 Shotgun ClONIN8 osses igas sba roue ee een eens 2 78 Database Searching iii a a ee ee te 2 81 Construct Window OVEIWIOW as A aw OER ye Ce A OL A 3 1 Some Important Definitions 0 0 00 eee 3 2 Selecting SESMENTS Vino Sac bw neki He ee ee i ee le 3 3 Changing the Construct Display 0 00 c eee eee eee 3 3 Regions of Interest and Translating DNA 0 cece eee eee 3 5 Attaching Comments to Objects in Construct Window 3 6 Marking SITES visir aida ae 3 10 Site Markers din o A A a A 3 12 TABLE OF CONTENTS Listing Sites ooo oo a o E na in a 3 15 Viewing the Construct as a Sequence 0 ooccocccococno 3 18 Formatting A Sequence Listing 00 cee eee eee 3 18 Inserting New Nucleotides by Typing 0 00e eee ee 3 21 Searching Comments 02 ccc eee ees 3 22 Finding A SCQUENCE maroni ias laa sects ig eee bide end eee 3 23 Cutting Copying and Pasting Segments 0 cece eens 3 24 Silent MutationS 00 cee eens 3 28 Chronography Tracking Construct History 20000005 3 32 Finding Open Reading Frames 0 00 eee eee eee 3 36 Importing Sequences Into GCK 2 00 eee eee 3 38 Exporting Data From GOK es ww ke eens 3 41 Magnification and Construct Scale 0 00 e eee ees 3 44 Editin
19. Homo sapiens human Homo sapiens1952 genes Escherichia coli found in GenBank 63 0 Nicotiana tabacum chloro Produced by J Michael Cherry cerevisi with the GCG program Zea mays chloroplast CodonFrequency Duplicates pseudogenes mutant and 4 Cancel 550K Figure 3 38 Choosing a Codon Table 2 60 discusses some issues regarding importing of sequences Sequence information can be imported into the Gene Construction Kit in several ways Any sequence information you have generated in other applications can be copied to the clipboard from the other application and then pasted directly into an empty Construct Window This will give you a sequence that can be manipulated in the standard GCK way either graphically or as text sequence This procedure will not check the sequence for non valid charac ters however It will accept whatever you paste in as a valid DNA sequence gt Import Look in mM DNAs to Import y ARA El Name Date modified Type Size dna text bd _ DNA GenBank gbk DNA ibi bt DNA NBRF PIR txt DNA vearson bdt File mame DNAgbk Files of type Gen Bank files bt gbk Cancel C DNA Inspector C Text GenBank GCG Wisconsin C Intelligenetics EMBL SwissProt FASTA C Staden C NBRF PIR C Gene Inspector Figure 3 39 Import Dialog Using File gt Import provides you with the ability to import sequence information from files in several other types o
20. Italic M command 1 f ctrl 1 Underline ft command u Tl ctrl U Outline f command 0 ff ctrl 0 Shadow ft command S fl ctrl S Condense and Extend Left ustify f command L fl ctrl L Center f command C f ctrI C and RightJustify f command R fl ctrl R are available when text is being edited in the Illustration window In addition there are a few other styles that are unique to GCK When working in a sequence view of a construct Case as Typed Upper Case and Lower Case are available Note that these are styles just like Bold they modify the way a character is displayed but do not actually change the character The last two erase behind Figure 7 12 Erase Behind Text items in this menu also apply to text in the Illustration window Erase Behind Text will cover up any object that lies behind the text itself Draw Behind Text will allow the background object to be drawn as shown in Figure 7 12 Size The Format gt Sizesubmenu allows you to set the size of the currently selected text Page 7 21 Menu Items Color Pick a Color Add a Color Remove a Color predefined colors user defined colors The Format gt Color submenu allows you to define the color of a selected object You can define an object s color even on a black and white system by choos ing the desired color from the Color submenu You can also use Adda Color and Remove a Color to customize the Color menu The n
21. Modified by Bob Gross 12 26 89 ENTRY BLUEKSP TYPE DNA CIRCULAR TITLE BlueScribe KS Plus Cloning vector DATE 28 JAN 1987 sequence O2 FEB 1987 sequence O4 MAR 1987 sequence O3 APR 1987 Figure 3 6 General Info Dialog Comments can be associated with different objects in the Construct Window The comments for any object can be viewed by selecting the object and then choosing Construct gt Get Info command I ctrl I Each kind of object will show a slightly different Get nfo box A typical site marker Get Info box is shown in Figure 3 7 In this Get Info box you can view the recognition sequence dotted line in sequence and actually alter the cutting site for the enzyme The cut site can be changed by dragging the arrows adjacent to the sequence or by clicking the mouse at the new location to which you want the triangle to move Be careful when you do this however since the site name will remain the same but the cut site will be different from the standard site If you were to copy or cut the fragment delineated by the altered site and paste it into a new construct the end of the new fragment would not in reality Page 3 8 Construct Window Attaching Comments to Objects in Construct Window Site Info a Site Marker Name BamH Site Marker Comments Position 689 Generation 0 Figure 3 7 Site Marker Get Info Dialog be a correct end If you alter the cut site for a restriction enzyme it is
22. Standard Codon Table Indicate the minimum qualifying length of open reading frames in amino acids aero EE Start with ATG Indicate which strands to search Cancel Y Search Top Strand Y Search Bottom Strand OK Figure 3 37 Open Reading Frame Dialog minimum can be changed by typing in a new value in the text box The Standard Codon Table is used by default but this can be changed by choosing Construct gt Features gt Choose Codon Table which will bring up Figure 3 38 page 3 39 In this case a Petunia codon table has been chosen As each table is selected descriptive text is displayed on the right hand side of the dialog box The Gene Construction Kit can read Gene Inspector codon tables for use in GCK This will happen automatically when you place a Gene Inspector codon file into the GCK Data folder If you open and edit a codon table that is in Gl format see Edit Codon Tables page 7 44 it will be saved in GCK format from then on Most of the codon tables are the same with only the mitochondrial and some trypanosome tables utilizing dif ferent codons Because these files are also used in Gl for codon preference analyses they also contain additional information used by Gl Importing Sequences Into GCK Tutorial 12 Importing and Exporting Sequences and Other Information page Page 3 38 Construct Window Importing Sequences Into GCK Set Codon Table Select a Codon Table Comments
23. TEXT file This New Folder Page 3 43 Construct Window Magnification and Construct Scale option will produce a text file containing all the line numbers restriction sites spacing and amino acid sequences Note that in order to view these output files correctly formatted in another application you will need to use a mono spaced font like Monaco or Courier Magnification and Construct Scale The scale legend see Figure 3 1 page 3 1 indicates the scale at which the construct is drawn in nucleotides centimeter The scale legend can be shown or hidden using Construct gt Display gt Show Hide Scale When you resize the window and you have selected Construct gt Magnification gt FitTo Window the scale legend will be updated to show the new scale Double clicking on the scale legend will allow you to set the desired scale as shown in Figure 3 43 page 3 44 The scale can also be set using Construct gt Magnification gt Set Scale Once the scale is set manually the construct size will not automatically change scale when you change the window size To have the construct fit the window gt lt Set Scale ese Desired Scale on Screen nts cm Scale Legend Length cm 1 00 Actual Scale on Screen nts cm 110 89 coro Figure 3 43 Set Scale choose Construct gt Magnification gt Fit To Window Construct gt Magnification gt Fit to Printer Page will resize the construct to fit within the currently select
24. TEXTCO BIOSOFTWARE AND ARE IN LIEU OF ALL OTHER WAR RANTIES EXPRESSED OR IMPLIED INCLUDING BUT NOT LIMITED TO IMPLIED WARRANTIES OF MERCHANTABILITY AND OF FITNESS FOR A PARTICULAR PUR POSE THIS WARRANTY GIVES LICENSEE SPECIFIED LEGAL RIGHTS AND LICENSEE MAY ALSO HAVE OTHER RIGHTS WHICH VARY FROM JURISDICTION TO JURISDICTION SOME JURISDICTIONS DO NOT ALLOW THE EXCLUSION OR LIMITATION OF WAR RANTIES SO THE ABOVE LIMITATIONS OR EXCLUSIONS MAY NOT APPLY TO LICENSEE General This License is the complete and exclusive statement of the parties agreement Should any provision of this License be held to be invalid by any court of competent jurisdiction that pro vision will be enforced to the maximum extent permissible and the remainder of the License shall nonetheless remain in full force and effect This License shall be controlled by the laws of the State of New Hampshire and the United States of America as applicable If you have any questions regarding this License please call Textco BioSoftware Customer Service at 603 643 1471 or write to our business office Page 8 10 Appendix Textco BioSoftware Inc License Agreement Rider For U S Governmental Entity Users This is a Rider to the Textco BioSoftware Inc CUSTOMER SOFTWARE LICENSE License and shall take precedence over the License where a conflict occurs 1 The Software was developed at private expense no portion was developed with government funds is a trade
25. a convenient way to rearrange the compo nents of the illustration on the page When reduced it is not possible to tar get page 6 1 any of the illustration objects Targeting an object can only be done when there is no reduction The ability to edit constructs from within the Illustration window allows the Illustration window to function as a kind of interactive cloning project manage ment tool Since each construct s history is maintained in the Illustration win dow it can be used as an automatic archiving facility The ability to store constructs allows the Illustration window to become a graphical database for constructs As you become more familiar with the capabilities of the window you will find more uses of your own for it Page 6 7 The Illustration Window Exporting Illustrations Exporting Illustrations Exporting from the Illustration Window provides similar choices to those just described for the Construct Window Selecting File gt Export will give you a dia log box similar to that shown in Figure 3 41 page 3 42 but only PICT and Illustration buttons will be available Page 6 8 Menu Items Chapter 7 Menu Items File Menu The File Menu deals with reading and writing data to disk or printer or specify ing files to be used by Gene Construc tion Kit The various options allow you to create new windows or files save files import or export files print and define which data is to be used by GC
26. allows you to define the way in which site markers are arranged for circular constructs When site markers are dis played using automatic arrangement with circular constructs the automatic arrangement can be done in two ways as shown in Figure 7 14 In part A Xmnl BsaHI Scal Bluescr Bluescr Figure 7 14 Autoarrangement Styles the site names are arranged along the construct In part B the site names are arranged along the window borders You can choose which way to dis play the site markers using the dialog shown in Figure 7 15 page 7 25 Let ting GCK Choose the last radio button will allow GCK to change between different methods depending on the circumstances of the view This can be particularly useful when zooming in to a high magnification In this case arranging the site markers along the construct makes sense in the magnified view while it might be preferable to view them vertically arranged when the entire construct is showing Note that this menu item is only available when a construct is circular Page 7 24 Menu Items Auto Arrangement Settings Choose prefered style of site marker arrangement for the circular construct gt Arrange Markers Along Bounds s Arrange Markers Along Construct fa Let GCK Choose Arrangement Style Cancel j fok 3 Figure 7 15 Auto Arrangement Settings Show Site as Text Show Site as Symbol These two items in the Format gt Site Markers submenu allow you to set
27. and Tutorial 2 Marking Sites page 2 8 You cannot set this property for just one site marker If you are interested in having different site markers dis played under different situations and do not want to dispose of any site mark ers you can do this using Chronography see Chronography Tracking Construct History page 3 32 You can use a different chronography gener ation to display each set of site markers you are interested in displaying Show Hide Comments As the name suggests this menu item will toggle the display of comment indicators on or off Comments can be attached to any segment of DNA to store annotations that are easily available Sometimes however you might Sspl Aatll Clal Hindlll Smal EcoRY Nhel comment indicator AlwNl Aft Sapl Ndel Bst1107 BsaAl Tthi11 BsmBl Pvull Figure 7 46 Comment Indicator lose track of the comments and not recall which segment of DNA contains the Page 7 62 Menu Items comments in which you are interested A comment indicator is shown in Fig ure 7 46 and is discussed in Attaching Comments to Objects in Construct Window page 3 6 The presence of a comment indicator denotes that there are comments associated with that particular segment of DNA You can view the comments by clicking once on the segment indicator to select it and then choosing Construct gt Get Info You can double click on the comment indicator to select the corresponding segment of DNA and th
28. best to change the name of the site also Regions also have Get Info boxes as shown in Figure 3 8 This dialog con Region Info Name ampicillin resistance First Pos 1976 M Protein Sequence Read from Last Pos 2833 J top strand Generation 0 bottom strand Comments contains the amp lactamase gene Figure 3 8 Region Get Info Dialog tains information about the selected region You can change the direction of Page 3 9 Construct Window Marking Sites the region by clicking the Top Strand or Bottom Strand radio buttons Changing the numbers in the First or Last Nucleotide box will change the length of the region The Protein Sequence check box determines if the region is to be translated or not when viewed as a sequence Marking Sites Sites can be marked along a construct by using Construct gt Features gt Mark Sites comment M ctrl M This will present you with Figure 3 9 Using this dialog gt Mark Sites x File commercial_no_isoschizomers gcl v Mark only those enzymes with M blunt ends M 5 overhang ends IV overhang ends a Enzymes to mark Mark enzymes for which Display new sites occur exclusively within the selection I more than f sites are found C as symbols M Jessthan sites are found as enzyme names Mark enzymes whose sites arefound in the selected sequence A Cancel occur exclusively outside of the selection Fi
29. close any open files and do not save any changes Page 2 37 Tutorials Finding Comments and File Searching TUTORIAL 8 FINDING COMMENTS AND FILE SEARCHING You have seen in previous tutorials how you can enter comments in associa tion with site markers segments of DNA chronographic generations and regions of interest Given that you may have many generations in a construct it might sometimes be difficult not only to remember where in a construct you have stored information but in which file the information was stored In addi tion if you store information such as storage locations for a given construct as part of the general information associated with each construct it is useful to be able to search quickly through all the files you have to obtain a list for example of all the constructs in the freezer in room 211 This is done using the File Searching capability of GCK 1 Start GCK and open the file pBR322 in the tutorial files folder You might recall that there is an origin of replication in this vector but it is not visible in the view you see nor can you remember with which generation it is associ ated You can identify the location of this feature by using the Search Comments function 2 Choose Construct gt Search Comments which will bring up a dialog box Type the word origin into the Key Text field and press Search This will bring up Figure 2 39 This search examines all comments and feature names associ S
30. dialog 4 Searching comments is very useful for looking just within a single con struct but what about looking through all the files on a disk or in a specific folder or even in a folder on a common file server This is where the file searching capability comes in File Searching allows you to set up sophisti cated search criteria and find files on your disk Choose Tools gt Search Files to bring up Figure 2 41 page 2 40 In this dialog you enter your search criteria in the lines at the top of the dialog For now we will do a simple search Just type in ampicillin in the top line Note that you could just as easily search for something like room 211 3B to find all the constructs stored in the freezer in room 211 Box 3B IF you had entered this is the comments The goal here is to find all of the files that have comments indicating that they Page 2 39 Tutorials Finding Comments and File Searching e File Search Criteria Search GCK constructs for text in feature names and comments or for DNA sequence that match the following criteria Text F contains fampicillin Add Scan the directory Users bobgross Desktop GCK 3 Y Scan subdirectories Set Directory Search text for ampicillin teers Figure 2 41 Searching Files contain the word ampicillin in their comments this is not the same as searching for the DNA sequence If you are careful in entering comments for each
31. entry These are all taken from the GenBank features table The third column Source shows the GenBank text that is associated with whatever is selected in the features column If nothing is selected as shown here the Source field shows everything in the GenBank comments Try clicking on a few Features to see what the associated Source text is 3 The Location Prefs button allows you to define how different indica tors of position in GenBank files are translated into GCK positions The Page 2 64 Tutorials Importing GenBank Sequence Files Using Deluxe Importing Transfer Prefs button allows you to tell GCK how to handle the transfer of information into GCK You can take a look at these choices but for now do not change any of them Press the Convert To GCK button This will bring up the conversion default as shown in Figure 2 68 The Use column allows 00608 Conversion Defaults Use Name Type Format Description v allele marker o 1 region of DNA at which regulation of termination of transcription occurs which controls the expression of some w Cregion segnent E bacterial operonsjb sequence segment Y CAAT_signal segnent located between the promoter and the Y CDS protein MPVK first structural gene that causes y conte mortar partial termination of transcription v D loop segnent v D_segment C v enhancer Y exon v gap Y GC signal 7v gene EZZZZZZZZA Y DNA Y intron v J_region CE
32. graphics and text will most likely require either a change in size of the object or necessitate the appearance of scrollbars Resizing the object will alter the appearance of the illustration and might cover up other objects while putting scrollbars on the object will violate the WYSIWYG What You See Is What You Get guidelines what you see on the screen is not what will be printed Therefore you are not allowed to make this change Using the Illustration Window Figure 6 2 shows a typical Illustration Window There are a number of items e009 illustration untitled 1 O Hindi It Pst Sall BamHI Smal Sstl EcoRI GAATACAAGCT TGGGCTGCAGGTCGACTCTAGAGGATCCCCGGGCGAGCTCGAATTC CTTATGTTCGARCCCGACGTCCAGCTGAGATCTCCTAGGGGCCCGCTCGAGCTTAAG Q 1 pMhsp22 antisense Ndel 100005 2 pMhsp22 sense Ndel 50003 3 pRmHa3 Ndel kak 4 BRL DNA Stds 1 kb ladder 25007 2000 1500 2911 bp 1000 232 O Hindill Pstl O Sall BamHl Smal e Sst amp EcoRI 500 Wri lt Figure 6 2 An Illustration Window in this window A shows a gel The lanes present in this illustration were originally selected in a GCK Gel window copied and then pasted into the Illustration window to give the figure shown here B shows a sequence that was copied from the sequence view of a construct This sequence represents Page 6 2 The Illustration Window Using the Illustration Window the polycloning site from the con
33. gt Paste You will be shown a dialog warning you that the editing operation you are about to perform pasting in a fragment will disrupt a region in the current construct the B galactosidase segment that spans the polycloning site Press OK to that dialog You should see Figure 2 26 12 Notice in this figure that the coding region from hsp70 is intact and dis played and that the size of the construct shown in the center of the window is adjusted to reflect the newly inserted fragment Because a BamHI fragment was pasted into a BamHI site both of the BamH markers have been restored 13 Choose File gt Save As name the file construct 6 and save it in your own folder please do not replace the tutorial files provided because others might want to use them later 14 Make sure that the blue inserted DNA segment is still selected and then choose Edit gt Special Paste Since the hsp70 fragment is still on the clipboard in e You might notice that the selection pauses at the location of the former middle BamHI site This is because the changed nucleotide has a different color and represents a boundary in the sequence Selections in the graphical view occur between boundaries f This alert is shown to warn you of editing operations that you might not be aware of If you are pasting into a site that is part of a feature in the construct the pasting opera tion will disrupt that feature Therefore it needs to be remo
34. gt Site Markers gt Show Site AsSymbol will force any selected site markers to be displayed as symbol Other items under the Format gt Site Markers submenu can be used to define what infor mation is to be shown if the site marker is shown as fexf and how the site marker is connected to the construct see Site Markers page 7 23 for a complete discussion Site markers may be quite crowded together under some circumstances To spread out the site markers select the site markers you wish to spread out and then choose Format gt Site Markers gt Automatic Arrangement This will spread out the selected markers and will designate them to remain spread out even if you resize the window To prevent them from automatically rearranging them selves you can either move the site by hand or choose Format gt Site Markers gt Manual Arrangement Moving site markers manually can be accomplished by clicking on a site marker to select it and then dragging with the mouse You can also move a site marker one pixel at a time with the arrow keys To change a property for a group of site markers e g to make them all red or Times you can use the mouse to drag a selection rectangle over the sequences you are interested in selecting This makes it easy to select a set of markers such as those at a polycloning site and set them to auto arrange while leaving the rest of the non crowded sites to be arranged manually Other choices under the Format menu wi
35. in Tutorial 7 Chronography Tracking Cloning History page 2 30 Start New Generation The appearance of a construct can be changed without losing the current dis play by defining a new generation at any time The information defined in a generation consists of the line thickness fill pattern color and direction of each specific segment of the construct the marked sites and the regions i e all aspects of the appearance of the construct Using the Format gt Chronography gt Start New Generation fl command G f ctrl G option will define a new generation Page 7 30 Menu Items After selecting this option you will see a dialog box allowing you to keep or not features of the current display in the new generation that is being defined see Figure 7 18 Checking a box will keep that information dis played in the new generation you are creating You can provide a name for each generation to help you in tracking all the steps and alternative views in your construct You can also enter any comments you wish for the genera tion This might be a convenient spot to store information about the construc tion process Remove Generations Select generations to discard restriction sites regions of interest DNA sources Warning this action cannot be undone Figure 7 19 Discarding Generations Discard Generations Format gt Chronography gt Discard Generations allows you to dispose of one or more gener
36. in the desired sequence clicking the OK button will place the new nucleotides into the sequence at the location of the cursor Page 3 21 Construct Window Searching Comments Pressing the Cancel button will leave the sequence unchanged You can also bring up this dialog by choosing Construct gt InsertTyping Nucleotides can be deleted in the sequence view by first selecting the char acters to be deleted and then Cutting them It is not possible to delete nucle otides by backspacing delete key because of potential ambiguous situations Searching Comments All the comments associated with constructs can be searched for key words Comments and names associated with regions of interest marked sites general information and with DNA segments can all be searched This is Search Comments Key text Instances ampicillin M Search general info Y Search segments Y Search regions Y Search site markers Y Search generations E Search Done Show Info Figure 3 19 Search Comments Dialog accomplished using Construct gt Search Comments You will be presented with a e For example it is not clear if GCK should stagger a deletion on each strand at an actual cut site Also if a site marker is selected the insertion point will reside at the actual cut site while the site marker remains selected When the delete key is pressed in this situ ation it is not clear if the site marker should be deleted or if the
37. isoschiz list shows in the popup menu at the top of the dialog A list of enzymes will appear in the left scrollable area Press the Add All gt button to add all the enzymes in this list to the right side list of Enzymes to mark 4 In the middle section on the left set the numbers to match that in the fig ure so you will be specifying enzymes that cut more than O times but less than 2 times i e unique cutters Page 2 8 Tutorials Marking Sites 5 Finally choose the middle radio button on the bottom left of the dialog box to specify that you want to see those enzymes which cut exclusively within the selected segment of DNA Now press the OK button to mark the sites 6 You will see the construct labeled as shown in Figure 2 9A Note that all A B C c113611 amp Bstxl A Alel BstDS Dx fr421 ciNl H Bsex3l Xbal O Ah x hb BamHI fral Xx BspMaAl coR 9 co321 o indlll e Ban a Accel G o si gt BssHI Drall 2 Apal Acc6S Figure 2 9 Marked Sites the sites are crowded together While all the newly marked sites are still selected choose Format gt Site Markers gt Automatic Arrangement This will rearrange the site markers so that they do not overlap resulting in something that looks like Figure 2 9B 7 As was the case for a selected segment of DNA when a site marker is selected you have access to items in the Format menu to change the display of the site marker Now shift click on the BamHI
38. lt gt O0 0 A Page 8 1 Appendix Import File Formats Import File Formats NOTE All files are imported using the rules defined below All files with the exception of Staden files which can use non standard nucleotide characters are filtered to accept only legal nucleotide characters as defined by interna tional standards Legal Nucleotide Characters page 8 1 Lower case letters are converted to upper case and Us are converted into Ts Any non nucle otide characters are discarded This includes all numbers RETURNS TABS and line feeds Importing sequences is discussed in Importing Sequences Into GCK page 3 38 DNA Inspector Standard file format generated by DNA Inspector lle These file formats are listed in the corresponding DNA Inspector manuals Note that this file format is provided as an import option for our customers who still have DNA Inspec tor lle which is no longer a current product of Textco BioSoftware s Textco BioSoftware has replaced DNA Inspector lle with Gene Inspector See our web site for more information GenBank Using File gt Import everything is put into comments through the line starting with ORIGIN Any text after this line is considered sequence To import all GenBank features as GCK features use Tools gt Deluxe Import page 7 35 See Tutorial 6 Cloning a DNA Segment and Silent Mutations page 2 23 for more details Intelligenetics All lines beginning with a
39. means that every construct in the Illustration window can be edited as a construct after being placed into the Illustration window Upon double clicking a construct making it the target a new Construct menu will appear to the right of the Illustration menu as described on page 6 1 This allows you to view different generations retrieve sequences change line attri Page 6 5 The Illustration Window Tracking Complex Construction Projects Cloning Hsp26 into pRmHa3 BamHI SpM sa bhta transcript pRmHa3 arkicillin resistnos A J1B ASPLEI PROFIL 350 Pwl PstI cut with EcoRI and Bani fill ends with Klenow pucta ADH poly 4 region metallothionein promoter polycloning AS E ext with Smor PstI j Antisense clone Figure 6 5 Multiple Constructs in an Illustration butes etc even after the construct has been pasted into the Illustration win dow You can even copy or cut a segment from a construct in the Illustration window and paste it into a new Construct window including all the Chronography that was attached to the segment when it was originally placed in the Illustration window The ability to edit a construct within the Illustration window allows you to keep an up to date Illustration containing all of the constructs being used in a proj ect and make changes to the constructs as needed You never have to go back to the original construct files to change them just to main
40. nucleotide to the left of the insertion point should be deleted Not enabling the delete key eliminates these poten tial ambiguous areas f Searching comments was the subject of Tutorial 8 Finding Comments and File Search ing page 2 38 reviewing this tutorial will provide a hands on perspective for getting the most out of GCK comments Page 3 22 Construct Window Finding a Sequence dialog box like the one shown in Figure 3 19 If no segment is selected the search will apply to the entire construct If a segment is selected however the search will be confined to only the selected segment of the DNA and all of its associated sites segments and regions in all generations To initiate the search type in the text you would like to search for in the Key Text box define which parts of the construct you want to search using the check boxes along the left and press the Search button In Figure 3 20 the word Search Comments Key text Instances IW Search general info MV Search segments v Search regions Y Search site markers Y Search generations Search Done Show Info Figure 3 20 Search Results ori was used and matches were found in four instances as listed in the right of the dialog box Double clicking on the item in the Instances list or selecting the item and then pressing the Show Info button will open the Get Info box for that particular match Searches are conducted on a
41. nucleotides and regions do not have to correspond to segments of DNA e Site Marker A site marker is a feature attached to the DNA at a specific location between two nucleotides Site markers are placed outside circular constructs or above linear constructs to avoid overlapping regions Site markers may represent restriction sites or other sites placed on the DNA by the user Selecting Segments Individual segments of DNA can be selected and modified The first step to modifying a segment is to select the segment There are several ways to select a segment Dragging the mouse over the actual sequence in the sequence view of a construct will select characters one at a time just as would occur in a word processor In the graphic view of a construct dragging the mouse will select between borders on the construct display The selection will actually extend from one border to the next as the mouse passes over the midway point between the two borders Double clicking in the DNA will select the segment that contains the location being double clicked Double clicking will work in the graphical view as well as in the sequence view Finally if a region is shown double clicking on the region will select the cor responding DNA This is a convenient way to select polycloning sites coding regions or origins of replication Changing the Construct Display The appearance of a selected region of the construct can be changed by using the choices under th
42. number Figure 7 50 Set Start Position represents a segment of a much larger sequence but the segment it repre sents is not the first segment of the DNA In this case it might be easier to maintain consistency if the segment numbering started at a position repre senting the actual position of the nucleotide in the whole sequence e g 86 Another case might be to indicate the position relative to the start of tran scription e g 266 For creating figures for papers this feature is very handy Page 7 66 Menu Items Select Frame Frames represent a way to highlight specific parts of a sequence listing Frames are discussed in Tutorial 5 Modifying the Construct Appearance page 2 20 and in Make Frame page 7 48 The sequence view of a construct allows you to select site markers segments of DNA and regions as well as frames Sometimes it might be confusing as to how to select a frame Choos ing Construct gt Select Frame will change the cursor to a cross hair clicking inside any frame will select that frame Frames can also be selected by triple clicking on the DNA sequence inside the frame or by holding down the option key and clicking inside the frame you wish to select Once a frame is selected you can use the items in the Format menu to modify the appearance of the frame Select Sites By Kind Construct gt Select Sites By Kind will select a subset of the marked sites on any construct depending o
43. of choices in an intuitive way it provides revealed complexity Chronography gt Preferences gt Many of the items in the Format menu are available from a number of win Figure 7 9 Fill Patterns dows For example Font is available in all windows except List windows Fill is available in Construct and Illustration windows Symbol is available only in the Construct window and Grouping is available only in the sequence view of the Construct window Page 7 17 Menu Items Fill The Format gt Format Fill submenu provides the ability to define the pattern to be used for filling selected objects The choice of fill patterns is shown in Figure 7 9 page 7 17 Clicking on any pattern with the mouse will fill the selected object with that pattern This can be used to define segment patterns in the graphic view of constructs or the fill pattern for ellipses rectangles and round rectangles in the Illustration window Selecting none will produce a transpar ent object in the Illustration or Construct windows other objects can be seen through objects that have a none fill pattern Fill can be used in conjunction with colors to produce a large variety of effects This is especially useful if your constructs are used on both black and white and color monitors Page 7 18 Menu Items Lines Pick a Width _ ET SE sy Sa vo a gt q gt Size Arrowhead Figure 7 10 Lines Menu Pick a Widt
44. of your files File Searching can work as a searching tool for your data base of constructs 5 Note that the search query box will display the text you are searching for In the Find Match n section of the dialog you can specify if you want to search DNA sequences or comments and titles Click the radio button that says Any Comments You next need to specify the Search Directory This is the folder that you wish to search to find matches satisfying the search cri teria If you choose a folder that has other folders inside it and you want to search the contents of those folders too you should check the Check Sub directories checkbox at the bottom of the dialog 6 Press the Set Directory button to define the directory folder you wish to search You will see Figure 2 42 Select the directory containing the files you wish to search In this case just select the GCK3 folder 7 Now you are ready to do the search Press the Search button as shown Page 2 40 Tutorials Finding Comments and File Searching Browse for Folder xs Choose a GCK Data folder MZ Desktop a Network E Administrator Jo Public E Computer Lo Adobe FrameMaker 8 1 GCK30a3 Lo Gl Installer 167 Lo GI Installer old dy GI_167Update GCK30 a3 zip o cons Figure 2 42 Set Directory in Figure 2 41 page 2 40 You will see a progress indicator informing you of what is going on and then you will see Figure 2 43 This window shows the eN
45. s DNA Inspector and Gene Inspector files are not TEXT files but rather are files in a specific format used by those other Textco programs The other eight file formats contain textual information only The only difference between these different file formats is the way in which the information is reorganized within the file These file formats are well established and can be used as a way to transfer information between differ ent programs If you want to create your own file in a word processing docu ment for importing into GCK make sure to save it from the word processor as a TEXT only file If it is not saved as TEXT only then you will not see it in the list shown in Figure 7 3 Importing From File Formats Not Listed GCK construct files contain sequence information along with other information that GCK uses to display the sequence and allow you to perform certain manipulations on the sequence The exact organization of the information in that file is dictated by programming needs Textco will sometimes need to change file formats when new features are added to the program Since every other software developer faces similar needs and will periodically change their internal file formats it is difficult if not impossible to support other program specific file formats for importing into GCK Almost every program available however can export a sequence as a TEXT file and some can export the sequence into one of the other standard file form
46. secret of Textco BioSoftware and its licensor for all purposes of the Freedom of Information Act is commercial computer software subject to limited utilization as provided in any contract between the vendor and the government entity and in all respects is proprietary data belonging solely to Textco BioSoftware and its licensor 2 For units of the DOD the Software is sold only with Restricted Rights as that term is defined in the DOD Supplement to DFAR 252 227 7013 b 3 ii and use duplication or disclosure is subject to restrictions set forth in subparagraph c 1 ii of the Rights in Technical Data and Com puter Software clause at 252 227 7013 Manufacturer Textco BioSoftware Inc 27 Gilson Road West Lebanon NH 03784 USA 3 If the Software was acquired under a GSA Schedule the Government has agreed to refrain from changing or removing any insignia or lettering from the Software or Documentation or from pro ducing copies of manuals or disks except for backup purposes and 1 Title to and ownership of the Software and Documentation and any reproductions thereof shall remain with Textco BioSoft ware and its licensor 2 use of the Software shall be limited to the facility for which it is acquired and 3 if the use of the Software is discontinued at the original installation and the Government wishes to use it at another location it may do so by giving prior written notice to Textco BioSoft ware specifying the new loc
47. site marker can be displayed as either a symbol or as text When shown as text the name of the marker and or the position of the cut site can be displayed The items in this menu all deal with determining how the site is marked on the construct in both sequence and graphics display modes Manual Arrangement This option complements the Automatic Arrangement page 5 23 in the previ ous section When Format gt Site Markers gt Manual Arrangement is chosen any site marker that is selected will not be automatically moved when the window is resized or zoomed It is a property of each site marker Automatic Arrangement When a site marker is selected and then Format gt Site Markers gt Automatic Arrange ment is chosen GCK will automatically move that marker to a position in which it does not overlap any other site markers If the Construct window is Page 7 23 Menu Items resized or zoomed in or out these site markers will be automatically placed in non overlapping positions This is very useful for locations along the DNA in which there may be many overlapping sites such as polycloning regions Note that Automatic Arrangement is a property of the site marker almost like a specific style This property will stay with the site marker until you either choose Manual Arrangement page 5 23 or drag the site marker with the mouse Auto Arrangement Settings Format gt Site Markers gt Auto Arrange Settings
48. site to deselect it all the other sites remain selected Select the Format gt Site Markers gt Show Site As Symbol to change all of the sites to symbols except the BamHI site Click on the BamHI marker and use the Format gt Style menu to make the text bold use the Format gt Size menu to make the text 10 point You should end up with some Page 2 9 Tutorials Marking Sites thing that looks like Figure 2 9C 8 While the BamHI site marker is still selected choose Construct gt Get Info or press command 1 Mac or ctrl 1 Windows This will provide you with the infor mation shown in Figure 2 10 If you wanted to you could actually change the Site Info 23 Name BamH Location 689 Cut site STEGCEGCCGCTCT TAGTGGATCCC CACCECCEGCGAGE ATCACCTAGGG Generation 0 Comments Figure 2 10 Site Marker Get Info Dialog name of the enzyme not a good idea or enter comments in the comments text box The horizontally scrollable area in the lower part of the dialog box indicates the actual sequence at that location The dotted red rectangle indi cates the recognition sequence for the restriction enzyme and the two arrows indicate the actual cut sites for the enzyme You can change the cut site by clicking on an arrow and dragging it Press Cancel to close this dialog with out saving any changes 9 Choose File gt SaveAs name the file construct 2 and save it in your own folder please do not replace the
49. software You can now remove the CD from your computer Please read the notes below and enjoy using Gene Construc tion Kit On Windows 1 Insert the CD into the drive of the computer on which you wish to run Gene Construction Kit Page 1 1 Overview Installing Gene Construction Kit 2 From this installation CD double click on the application file titled Setup exe to launch the installer program Click Yes or Next to keep the defaults and install the application into the Program Files folder of your hard drive 3 With the CD still in the computer start up the GCK application by choos ing Start gt Program Files gt Gene Construction Kit Enter the personalization information The first time you run the software GCK needs to verify itself by checking the CD For subsequent launches this is not necessary 4 You are finished installing the software You can now remove the CD from your computer Please read the notes below and enjoy using Gene Con struction Kit A few notes about the installation e On the Mac it is important to drag the entire folder from the CD to ensure that the application will run properly Dragging just the application from the CD to your hard disk will not work If you have a previous version of GCK and have files that you would like to keep with the application you can place them into the new GCK folder once you have dragged it from the CD e On both Mac and Windows the first time you run
50. spans are related but no order is implied A separate feature will be created for each of the spans Y span of contiguous bases e g 34 456 A region protein comment frame or segment may be created Y A site between two bases e g 12413 a one of feature to be found at one of the locations A site marker may be created Y 1 a single base to be found in a range e g 12 21 Y replace replace the span with literal sequence A comment may be created for the specified range A region comment frame or segment may be created A comment may be created for each of the specified locations Features that contain an operator that is not selected will be switched off Cancel QS Figure 2 72 Location Preferences Dialog want to handle those situations in this window Feel free to try different operations using the Deluxe Importer The searching works the same way as an Entrez search would work at the NCBI web site Page 2 69 Tutorials Translating Across Introns TUTORIAL 15 TRANSLATING ACROSS INTRONS When importing genomic sequences there is typically a need to deal with exons and introns in order to determine protein sequences This can be done easily in GCK3 This tutorial illustrates how the process works 1 Start the application and choose Tools gt Deluxe Import gt Open Sequences File and then select the file called G gamma globin gbk and open the file This file contains GenBank entry X03109 wh
51. ss mRNA YRT 05 JAN 4 1993 DEFINITION Xenopus laevis rhodopsin mRNA complete cds ACCESSION L07770 KEYWORDS G protein coupled receptor phototransduction protein retinal protein rhodopsin transmembrane protein SOURCE Xenopus laevis library lambda ZAPII adult retina cDNA to mRNA ORGANISM Xenopus laevis Eukaryota Animalia Chordata Vertebrata Amphibia Lissamphibia nura Archeobatrachia Pipoidea Pipidae Xenopodinae REFERENCE 1 bases 1 to 1684 y Figure 3 40 Importing a Gene Inspector Sequence sin will show comments if any associated with that sequence in the bottom of the window and then allow you to import that particular sequence by press ing the Import button Finally you can import graphics images into the Illustration Window of the Gene Construction Kit through the clipboard Once the images are placed into the Illustration Window they can be moved around like any other object but you will not be able to edit them any further Exporting Data From GCK Information from the GCK can be exported in a number of ways from each of the different window types of the program This is accomplished using the File gt Export Tutorial 12 Importing and Exporting Sequences and Other Informa tion page 2 60 discusses some issues regarding exporting of sequences Page 3 41 Construct Window Exporting Data From GCK Exporting Constructs When viewing the construct as graphics in the Construct Window choosin
52. that have migrated off the bottom of the gel These numbers can be made visible or not by using the Gel gt Show Hide Runoff Count menu option Along the left side of the gel to the left of lane 1 are a set of standard size indicators You can show or hide the standard numbers by using Gel gt Show Hide Standard Sizes Each solid band in the standard represents a multiple of the threshold value see Threshold for the gel The dotted lines represent 1 5x and 15x the threshold value We have also included a number of standard digests that you can copy from the standards gel in the Tutorial folder to the particular gel you are examining Threshold The threshold value which is set using Gel gt SetThreshold represents the min imum sized fragment that remains on the gel This will bring up Figure 5 2 lt Choose Gel Threshold ese Indicate threshold oK Cancel Figure 5 2 Set Threshold Page 5 2 Gel Window Viewing a Fragment Size Table By changing the threshold you can do the equivalent of running different per cent agarose gels It is very useful for pointing out which size range might be useful for the analytical gels that you actually run in the lab The gel pattern is determined using the algorithm of Schaeffer and Sederoff Analytical Biochem 115 113 122 1981 which calculates the mobility as inversely proportional to the molecular weight of the molecule This has proven to be more a
53. that shown in Fig ure 2 21 page 2 22 The ability to alter the display of the sequence in so many ways provides a great deal of flexibility in pointing out specific features of any sequence with which you are working 7 Choose Construct gt Display gt Display Graphics Note that the new region you b A frame can be selected by option clicking on the Mac on the frame or by choosing Construct gt Select Frame and then clicking on the frame you want to select For those of you who are quick fingered you can also select a frame by triple clicking on the DNA contained within a frame Page 2 21 Tutorials Modifying the Construct Appearance Sac 613 GGC CAG TGA ATT GTA ATA CGA CTC ACT ATA GGG CGA ATT GGA GCT 6844 2 Leu Ser Ase Tyr Tyr Ser Glu Ser Tyr Pro Ser Asn Ser Ser Sacll Eagl BstxIDsal Notl 658 CCA CCG CGG TGG CGG CCG C pS 534 Trp Arg Pro Pro Pro Arg Glu Leu Vel Leu Pro Asp Giy Pro Ser Figure 2 21 A Modified Framed Sequence defined as the origin of replication also appears in the graphical display and is selected as it was in the sequence display There is a direct correspondence between the two views of the construct Changes you make in the graphical view appear in the sequence view and changes you make in the sequence view appear in the graphical view The graphical view just represents an eas ier way to visualize your construct For cloning fragments Tutorial 6 Cloning a DNA Segment and Silent Mutations p
54. the banding patterns in each lane and in the case of partial digests specifies the extent of digestion The legend consists of lane numbers and the actual legend adjacent to the gel The legend can be made visible or not using Gel gt Show Hide Gel Legend command L ctrl L Show Hide Standard Sizes Along the left side of the gel to the left of lane 1 are a set of standard size indicators Show or hide the standard numbers by using Gel gt Show Hide Standard Sizes Each solid band in the standard represents a multiple of the threshold value see Threshold page 5 2 for the gel The dotted lines represent 1 5x and 15x the threshold value Show Full Digest Selecting a lane on the gel and choosing Gel gt Show Full Digest will show the Page 7 71 Menu Items bands that would result if complete digestion took place This option is used to convert a partial digest lane see next section Show Partial Digest Partial digests were discussed in Partial Digests page 5 4 Choosing Gel gt Show Partial Digest brings up a dialog Figure 5 4 page 5 5 that allows you to define the extent of digestion by the enzymes chosen Bands on the gel that are the result of a partial digest will be represented as a dotted blue line instead of a solid black line Set Threshold Gel gt Set Threshold command T ctrl T defines the minimum sized fragment that will remain on the gel The dialog box is shown in Figure 5 2 page 5
55. this page so choose Illustra tion gt Set Construct Scale and set the scale to 800 nts cm You should have a figure that looks like Figure 2 55 12 Now open the file hsp70 Bam Select the entire construct copy it and paste it below the hsp70 construct in the Illustration window As you did in the last step set the scale of this construct to 800 nts cm Page 2 52 Tutorials Illustration cloning project gci An Important Cloning Project a Making Illustrations construct 5 gcc 2564 bp Figure 2 54 Illustration 2 0600 illustration cloning project An Important Cloning Project construct 5 2964 bp BamHI BamHI BamHI _ hsp70 5066 bp Figure 2 55 Illustration 3 13 We want to indicate in the Illustration what was done to get from hsp70 to hsp70 Bam To do this we need to type in some descriptive text between Page 2 53 Tutorials Making Illustrations these two constructs To make room for this text you first need to move the construct title for hsp70 to the top of the construct itself we are creating Fig ure 2 56 if you want to look ahead Double click on the hsp70 construct to make it the target and then drag the construct title above the DNA 14 Now click on the T tool again in the bottom left corner of the window so that you can enter your description of the procedure Click between the two linear constructs you will get a blinking insertion
56. to be associated with your new entry in the list see Figure 4 4 page 4 4 It will create a new list entry temporarily indicated by a bullet with an ellipses in the list at the left Fill in the name of the new entry the sequence you want this entry to represent and any comments to be associated with sites on the construct when that entry is used to mark sites Define Cut Site To define the actual site at which the enzyme cuts the DNA use the Define Cut Site command D option This will bring up the dialog box shown in Figure 4 5 page 4 4 Use the triangles to define the cut site Alphabetical List If the Alphabetical List menu item is checked then the list will be maintained in alphabetical order and all new entries into the list will be placed alphabeti cally If the list is not alphabetical new entries will be placed at the end of the list Page 7 77 Menu Items Page 7 78 Appendix Chapter 8 Appendix Legal Nucleotide Characters Legal Nucleotide Characters Letter Nucleotide s Complement adenosine cytosine guanosine thymidine A G puRine C T pYrimidine A C aMino in large groove G T Keto in large groove G C Strong A T Weak A C G T C G T not A A G T not C A C T not G lt T OJW zZ S O A Z lt I 110 0 gt A C G not T W O T lt Z S O Z A D
57. to use and how they are to be deciphered The Transfer Prefs button results in Figure 7 24 Once all of these parameters have been set Feature Location Preferences Unary Operators Mos send of span less than specified eg lt 1 8 lt Binary Operators V span of contiguous bases e g 34 456 yn protein commen so between two bases e g 12713 Features that contain an operator that is not selected will be switched off Specialized Operators v complement the feature is on the bottom strand egion or protein the be re Ase E order ame are related and ordered will be created for each of the spans m group spans are related but no order is implied ach of the spans l one of feature to be found at one of the locations A comment frame or segment may Cancel Figure 7 23 Feature Location Preferences GCK will remember them so you will not have to set them more than once Importing the file uses the Conversion Defaults as illustrated in Figure 2 68 page 2 65 Retrieve Sequence The Retrieve Sequence menu option allows for the retrieval of specific Page 7 36 Menu Items Feature Transfer Preferences Translate entries into _ Gene Construction Kit sequences Gene Construction Kit constructs Y Review feature transfers before saving recommended Y Open files in Gene Construction Kit after saving Y Bring Gene Constr
58. tutorial files provided because others might want to use them later You will need it again in the next tutorial You can quit now or continue on to Tutorial 3 Marking Open Reading Frames page 2 11 If you plan on continuing you can leave the file you just created construct 2 open If not close this file Page 2 10 Tutorials Marking Open Reading Frames TUTORIAL 3 MARKING OPEN READING FRAMES 1 Start GCK and open the construct file you created in the last tutorial construct 2 If you do not have this file you can start with construct 2 from the tutorial files folder provided 2 You will finish annotating this construct in this tutorial and learn how to define open reading frames ORFs First choose Construct gt Display gt Show Con struct Title which will place the title of the construct and the length of the con struct into the center of the window 3 Now choose Construct gt Features gt Find Open Reading Frames You will see the dialog shown in Figure 2 11 This dialog gives you complete information about Find Open Reading Frames This command will create regions corresponding to open reading frames found in the following selected segment Start offset 1 End offset 2964 The following codon table will be used for translations Codon table name Standard Codon Table Indicate the minimum qualifying length of open reading frames in amino acids Minimum ORF length 100 Y Start with ATG Indicate
59. under a new name If you only have a small set of enzymes you want in a new file it might be easiest to create a new list file File gt New and then paste in the enzymes you want in that new file The list commercial comments contains comments listing any isoschizomers and commercial sources for the enzyme selected Alphabetical Lists Lists can be defined as being alphabetical or not by selecting List gt Alphabetical List When this item is checked the list will always be maintained in an alpha betical order This means that creating new entries renaming entries cutting from and pasting into the list will all result in alphabetical lists GCK will sort the list after you have performed your operation If the Alphabetical List option is not checked pasting cutting etc will not necessarily result in an alphabetical list A non alphabetical list might be used for storing linkers in order or size or Page 4 5 List Window Exporting Lists date of creation or some other criterion Exporting Lists Exporting from the List Window provides similar choices to those just described already Selecting File gt Export will give you a dialog box similar to that shown in Figure 3 41 page 3 42 but only List and TEXT buttons will be available Page 4 6 Gel Window Chapter 5 Gel Window Gel electrophoresis is a standard analytical tool used to track construction project progress It is often desirable to examine poten
60. vV OMIM V PDB V PFAM M PubMed V SCOP M SwissProt UniGene y Figure 2 86 Keyword databases available 2 Choose Keyword Search from the popup menu This will show you a list of the currently available web sites that can be searched for key words by GCK As new sites become available and others go offline Textco BioSoftware will update the database server to reflect those changes You can choose which databases to search by using the checkboxes Leave them all selected in this case 3 Type in the keyword insulin and press the Search button You will be taken to your web browser to see the result You should see something resembling Figure 2 87 This shows all of the searches that have been initi ated As each search completes its status will change from Processing to Completed If you click on the Completed link you can see the results of your Page 2 81 Tutorials Database Searching Search Parameters Search type Keywords Criteria insulin Search Requested 2007 12 17 02 16 48 Expiration date 2007 12 18 02 16 48 Current date 2007 12 17 02 16 31 Search Results Database Site Search Status Processing Processing Completed Completed Completed Completed Processing click search status to see results User Information Username Textco BioSoftware Inc DB Search license expiration 2007 12 31 Figure 2 87 Database search in progress search displayed in your web browser 4 Now lets do a prot
61. which was installed when GCK was installed This folder holds DNAs in a number of different file formats for you to test importing The radio buttons in this dialog allow you to specify in which file format you believe the file to be Clicking on the radio button might also change the list of files that are visible Gene Inspector and DNA Inspector Page 2 60 Tutorials Importing and Exporting Sequences and Other Information files are not plain text files so clicking on one of those buttons will limit the list of displayed files to just those specific types of non text files 2 Click on the GCG button and select the file DNA GCG to be imported as shown in Figure 2 63 page 2 60 Press Import 3 The sequence will now be imported and displayed as a sequence in a new Construct window Any comments associated with the text file in the specified format will be imported and placed in the General Info for the con struct Choose Construct gt General Info to see the comments that were part of this particular GCG formatted file 4 Gene Inspector files might contain multiple sequences so you will be presented with a dialog like Figure 2 64 This shows the dialog presented pa Open Look in jy DNA Sequences eE img Edy thm ip Recent Places 2 Dros 185 rRNA nuc Desktop Q Drosophila 5S nuc Name Date modif Type Size E Q Drosophila Hsps nuc ej Q lactate dehydrogenases nuc Administrator Q lysozymes nuc A p
62. will actually place site markers on the construct List Sites will create a text listing of sites on the construct ListSites is discussed in detail in Listing Sites page 3 15 Mark Location Construct gt Features gt Mark Location is will place a marker on the construct at a defined location Unlike Mark Sites Mark Location requires the exact position for e lt Mark Location ese New Site Position 5346 New Site Comments change of A gt C ndicate New Site By Symbol Text Figure 7 37 Mark Location Dialog the site marker and the name for the site marker to be typed into the dialog box shown in Figure 7 37 Comments to be associated with the marked loca tion may also be entered These comments will remain with the site marker during subsequent cutting and pasting operations Marking a location might be useful for indicating features that are not easy to store in a List window Examples are transcription start sites polyadenylation signals and splice Page 7 51 Menu Items sites Marked locations function the same as marked sites in enabling the selection of segments of DNA In the most ancient generation of the pBR322 construct packaged with GCK the three pieces of DNA that were source plasmids for pBR322 were originally defined by placing marked locations at the specific nucleotides needed to define each segment Once the segments had been defined the marked locati
63. 2 1 This folder should be in the GCK a DKs Open Gene Construction Kit Enable All GCK Document Types B Sm gt tutorial files B a Name A Date Modified lt actin DNA 4 21 99 4 is Bluescript KS gcc lt cloning project 3 24 97 lt construct 1 3 24 97 construct 2 4 13 06 construct 3 3 24 97 lt S constructi4 3 24 97 S construct 5 3 24 97 lt S construct 6 3 24 97 S construct 7 3 24 97 lt lt construct 22 1 1 06 lt S hsp70 3 24 97 lt hsp70 Bam 3 24 97 lt lambda gcc 12 17 07 lt orientation analysis 3 24 97 E aman DALDAL lt New Folder Cancel Open Figure 2 1 Opening a file folder that was created when the program was installed The buttons on the Page 2 2 Tutorials Working with Constructs bottom let you choose to have listed different types of files in the list on the left Since we are opening a construct file leave the radio button set on Con struct When you open other kinds of GCK files the buttons will be useful to you Select the Bluescript KS file and press the Open button You will see Figure 2 2 lt Construct Bluescript KS gcc Lo Figure 2 2 Bluescript KS 3 This construct has a number of segments or sections of DNA indicated in different colors and patterns The title of the file is indicated in the title bar at the top of the window In the lower left corner of the Construct window is an indicator of the location of the current insertion poin
64. 2 and thresholds are discussed in Threshold page 5 2 Display Table Display Graphics Gel gt Display Table Display Graphics command ctrl will toggle the display between listing the fragments for each lane in a tabular form Figure 5 3 page 5 3 and illustrating the predicted gel pattern graphically Figure 5 1 page 5 1 Each view presents the same data but one is graphical and the other is textual Page 7 72 Menu Items Illustration Menu Set Construct Scale The Illustration menu is simple and consists of Reduction b just a few items It allows you to set the scale j E Send To Back 36 in nts cm for constructs to set the drawing Bring To Front 96 scale for the whole window and to arrange Align Selection 38 Y objects in the Illustration window Note that other controls for the Illustration window are located in the bottom left corner of the window frame itself in the Tool Palette Figure 6 3 page 6 3 Set Construct Scale The Illustration gt Set Construct Scale menu option is available when one or more construct s is selected in the Illustration window Set Construct Scale sets the drawing scale for any construct using the dialog box shown in Figure 7 54 It Set Scale x Nucleotides Per Centimeter Bo OK Cancel Figure 7 54 Set Construct Scale does not place an indicator on the screen To set all the constructs in an Illustration to the same scale select one of th
65. 313 GCAGGCATTGTGTGTGAGTT 1762 1781 AGGTCATTTGTTTGGCAGAAA 1292 1312 GCAGGCATTGTGTGTGAGTT 1762 1781 GGTAGGTCATTTGTTTGGCAG 1289 1309 GCAGGCATTGTGTGTGAGTT 1762 1781 TGGTAGGTCATTTGTTTGGC 1288 1307 GCAGGCATTGTGTGTGAGTT 1762 1781 Pair Explain considered 6 ok 6 Left Explain considered 535 low tm 276 high tm 59 ok 200 Right Explain considered 1285 GC content failed 17 low tm 826 high tm 83 ok 359 Show Info Add Primer Done Figure 2 80 Selecting a primer pair the Done button 7 You will see Figure 2 81 which shows the two primers Clicking on either primer will select the primer pair Once you click on the pair you can get information by pressing command Mac or control Windows or choos ing the Construct gt Get Info menu item The results of the Get Info window are lt lt lt Tw hsp70 protein 5066 bp Figure 2 81 Marked primers shown in Figure 2 82 This provides all the details of how the primer was actually generated from the original sequence 8 You can double click on the primer pair either of the primers will work and it will select the DNA amplified by the primer pair You can now copy this sequence to another window or another application to work with it in more Page 2 76 Tutorials detail Primer Info PCR Analysis Name Primer Pair 5 Location 1293 1312 5 Sequence GGTCATTTGTTTGGCAGAAA 3 Location 1762 1781 3 Sequence GCAGGCATTGTGTGTGAGTT Gen
66. 68 E T a AE A et eee eae oe ee 7 68 GIOUN aniston a ei iis See 7 29 INnsertiNS tancia ts dico er idad vale 7 64 INSOLE TYPING 22 att A E ds 7 64 A ieee hace cee EE E E E E E ETE A TE 7 19 Magnification eaa e 6 arti ae aa a aeaea aa raaa e iaaa et 7 42 Make Lin ar Circular seepe Ep a ra aE Ea EEA e rE G 7 69 Preferentes ueerciiianiii iana a E EE ANEA A E E T alee 7 33 Redefine Origin oir id 7 66 RAIN i 7 27 Search Comments ilicaiaaa 7 69 SelectiETaMES 200 sear cesses A AAA AAA a A AAA 7 67 Select Sites by Kind ooooccooconnocnncnconencncnoonnnnnnnnnennnnn nono nnnnn ee eeeeeeeeeaaeaneeeeeeeesee 7 67 Set Beginning Position ooomononnncnnnnncnononncnnnnnnnnnnnnnnnnnnnnnnnnnnnrnnnnnnnnnnnnnnanannnnnns 7 66 Site Markers cio da iaa 7 23 SILO da aida 7 21 Sile in eae abe ae a a EE 7 21 O OT 7 22 vertical attachment positions ocooonccconnccnnnnncnoncnnnnncnnnnnonnnnnnnnnrcnnnrnnnnnnnnnnninn 7 27 Index 5 G formatting SOQUENCeS enmcccccccccconononnnnnnncnnnnnnnnnnnnnnn a a daie E a aaa Ea aaa an iaia aa 3 18 frames CCU ia aa N E 7 48 OVEIVIOW ini ride E E A 3 20 selecting ona a ae A E Sc ee eee ee 7 49 7 67 setting Contents ceci 2 21 7 49 MORA ia in FET 2 20 G AG iaa 8 3 GCK Acknowledgement ccseeeeeeeeeeeeee cece ee ae aa aae a aaae E a aaae aaae 8 5 GCK Data folder viii ao 4 2 7 9 Gel menu Display Graphics ui a dada 7 72 Display Tables aa 7 72 Set Thresholdiviciciisia aaa 7 72 Show Full Digests
67. BR322 nuc Computer Q rat globins nuc a Network Y rhodopsins nuc File name acetylcho ne recptors nuc Files of type All files 5 Figure 2 64 Importing Sequences from Gene Inspector when a file containing multiple sequences is selected You must choose one of the sequences and then press Import 5 Exporting file information is another way GCK can interact with other applications Since GCK can display information in graphical as well as sequence formats both formats are available to export Choose File gt Open and open pBR322 in the tutorial files folder This will open a graphical view Page 2 61 Tutorials Importing and Exporting Sequences and Other Information 6 Choose File gt Export and you will see Figure 2 65 Choosing the JPEG A Save Gene Construction Kit Export As Save As pBR322 jpg fa Ts en new tutorials ry Q i NewHampshire3 4 H name 44 Date Modified Network EUF E NH3 HD ES Platinum ES Exptl System Installers S ES movie station LS C Vista Premi a E Desktop A Applications 4 bobgross Documents _ KeyServering f J TextcoBioSoft 2 Utilities Format PICT File DNA Sequence As Text File FT Cancel Pet Cancel Save sici n A Comments As Text File career rerererezacancal Figure 2 65 Export Graphics o file popup menu as shown here will create a file that can be imported into most graphics programs The DNA Sequence as TEXT fil
68. E 137 428311 a Figure 2 32 pBR322 Generation 2 Page 2 32 Tutorials Chronography Tracking Cloning History different segments that were used to construct the original pBR322 plasmid 600 lt Construct pBR322 1 1 TTCTCATGTTTGACAGCTTATCATCGATAAGCTTTAATGCGGTAGTTTATCACAGTTAAATTGCTA 67 ACGCAGTCAGGCACCGTGT 86 ATG ARA TCT AAC AAT GCG CTC ATC GTC ATC CTC GGC ACC GTC ACC CTG bite Lys Ser Asn Asn Ala Lew ile Val ile Leu Gly Thr Val Thr Leu 134 GAT GCT GTA GGC ATA GGC TTG GTT ATG CCG GTA CTe CCG GGC CTC TTG 17b Asp Ala Val Gly ile Gly Lew Val Met Pro Val Leu Pro Gly Leu Leu 182 CGG GAT ATC GTC CAT TCC GAC AGC ATC GCC AGT CAC TAT GGC GTG CTG 33b Arg Asp ite Val His Ser Asp Ser ile Ala Ser His Tyr Gly Val Lew 23 CTA GCG CTA TAT GCG TTG ATG CAA TTT CTA TGC GCA CCC GTT CTC GGA 49 Lev Ala Leu Tyr Ala Leu Met Gln Phe Leu Cys Ala Pro Val Lew Gly 278 GCA CTG TCC GAC CGC TTT GGC CGC CGC CCA GTC CTG CTC GCT TCG CTA BSPAle Leu Ser Asp Arg Phe Gly Arg Arg Pro Val Leu Leu Ala Ser Leu 326 CTT GGA GCC ACT ATC GAC TAC GCG ATC ATG GCG ACC ACA CCC GTC CTG Blbleu Gly Ala Thr tle Asp Tyr Ala tle Met Ala Thr Thr Pro Val Leu 374 TGG ATC CTC TAC GCC GGA CGC ATC GTG GCC GGC ATC ACC GGC GCC ACA 97 Trp tle Leu Tyr Ala Gly Arg tle Val Ala Gly tle Thr Gly Ala Thr 422 GGT GCG GTT GCT GGC GCC TAT ATC GCC GAC ATC ACC GAT GGG GAA GAT 1130 Gly Ala Val Ala Gly Ala Tyr ile Ala Asp ile Thr Asp Gly Glu Asp 499 470 CGG GCT CGC CAC TTC GGG CTC ATG AGC GCT TG
69. EN reading frames ccoooccccccnnnnnncnnnanncennnnnncnnnnnnncnnnnnnnnrrnnannncrnnanannnnnns 2 11 3 36 OVOIVIOW cuina ia 1 3 pasting Segments A id 2 34 placing Sites ceive ee saeh ed ievte tee chee eee dete a eater 2 56 3 15 7 52 POSIUONS hue erara cade duds sens AAA Da des deca aes 3 19 protei SCQUENCES ereccion iaa 3 5 EC 3 44 region INTO iii bd ds 3 9 E O Ae cae ee A ER 2 12 2 13 3 2 3 5 E 2 50 7 73 A A O cepsente 7 59 Searching COMMENTS inaya a a ia aaa a dea ea i iadaaa aaiae 2 38 3 22 Index 2 D Segmentso stos ee de Ce cn eo e o do 2 3 3 2 3 24 Selecting segments ver ad 3 3 sequence listing an 3 18 SEQUENCE VS graphics occooonccconnncconnncnnnnconncnnnnencnnnnn nn rncnnnn nan nrrnnnr naar rn nena 7 64 SHOW COMMENTS visi di A ia ici 3 7 SHOW MOUSE POSITION cios o a a daa ana Geaa 3 2 SHOW POSITIONS 10 AA A Ai 2 16 SHOW selection TANDO 2 0iiocorecicc ara lt 3 2 Show title 522 sorscis ee ect ee tied Re A ee ee ee 7 61 single stranded viii ta 3 4 site MarkerS ita ida iaa 2 10 2 22 2 30 3 3 3 12 Ml deidad 2 11 translating DNA oscar toda 3 5 VIEWING AS SEQUENCE siglar a a aa ai d iaa E iea aa a aaaea dadoa Kaa 2 15 3 18 WOFKING WN aaae cado nl bits 2 2 zooming NN 2 4 conversion def Ulloa da 2 65 conversi n defaults oooooocccccnnoncccccnnononcnnnnnncnononnnnnnnnannnnnnnnnnnnrnnnnnnnrrnnnnnnrrnnnaannnns 7 38 conver to GOK i e NRA A a E a IR 2 66 Creating New fil s serrian oura a e tesa aapi aa as
70. GCG Tata TCG ACT CCT GCT lala TCT AGA Tarn CGA GGA TGA lee AGC ccc GGC TGC Irs AGG CGG GGG TGG ITrn AGT CGT GGT TGT Inve ATA CTA Then GTA TTA ATC CTC fien GTC TTC Phe ATG CTG then GTG TTG ATT file CTT fleu GTT TTT TAA TAC ITvr lt wi TETE ii A AO S15 TERT 2 3 z z gt 5 AAA Figure 7 29 Edit Codon Tables will see a list of all the available codon tables in your GCK Data folder In Figure 7 29 there are only 4 tables listed In the bottom part of this window is a table containing all the codons and the amino acids they code for using the currently selected table The selected table will be bulleted in the list on the left Standard human in this case its name will be shown in the Name box and any comments related to the table will be shown in the Comments box The OK button will accept any changes you have made in the table and a If you have codon tables you have generated in the Gene Inspector Textco s sequence analysis and molecular biologist s notebook application they can be placed directly into the GCK Data folder to be used from within GCK Page 7 44 Menu Items will close the window The Cancel button will close the window without sav ing any changes Choosing New Codon Table will copy the codon defini tions currently visible and create a new table to name and modify Any new codon tables you create w
71. GENE CONSTRUCTION KITE 3 0 Tutorials User Manual from Textco BioSoftware Inc June 2008 First Edition Gene Construction Kit 3 0 Manual is Copyright Textco BioSoftware Inc 2003 2008 All rights reserved TEXTE LEADERS IN MOLECULAR BIOLOGY SOFTWARE Textco BioSoftware Inc 27 Gilson Road West Lebanon New Hampshire 03784 U S A voice FAX 603 643 1471 email info textco com URL http www textco com TABLE OF CONTENTS Overview Installing Gene Construction KIO 0 eee 1 1 OVERVIOW ace ours Dd 1 3 Running The Program eei ea a eee 1 4 Tutorials Working with ConstructS 0 0 000 cece eee eee eens 2 2 Marking SHES oyn a n il diia haat o 2 8 Marking Open Reading Frame S 0 0 cece eee eee eee 2 11 Viewing the Construct as a SEQUENCE 1 ees 2 15 Modifying the Construct Appearance 0 c eee eee eee 2 20 Cloning a DNA Segment and Silent Mutations 05 2 23 Chronography Tracking Cloning History 0 000 eee 2 30 Finding Comments and File Searching ocooocoooooomoo 2 38 Running Gels and Orientation Analysis 00 cece eee eee 2 45 Making Illustrations 000000 eee 2 50 Working With Generic Constructs 0000 e cece eee ees 2 56 Importing and Exporting Sequences and Other Information 2 60 Importing GenBank Sequence Files Using Deluxe Importing 2 64 Searching and Retrieving Sequence
72. GGCGGTGC TCARCGGCCT Sall 650 681 CAACCTACTA CTGGGCTGCT TCCTAATGCA GGAGTCGCAT AAGGGAGAGC GTCGACCGAT 661 GCCCTTGAGA GCCTTCARCC CAGTCAGCTC CTTCCGGTGG GCGCGGGGCA TGACTATCGT 721 CGCCGCACTT ATGACTGTCT TCTTTATCAT GCAACTCGTA GGACAGGTGC CGGCAGCGCT 781 CTGGGTCATT TTCGGCGAGG ACCGCTTTCG CTGGAGCGCG ACGATGATCG GCCTGTCGCT 841 TGCGGTATTC GGAATCTTGC ACGCCCTCGC TCAAGCCTTC GTCACTGGTC CCGCCACCAA 981 ACGTTTCGGC GAGAAGCAGG CCATTATCGC CGGCATGGCG GCCGACGCGC TOGGCTACGT 961 CTTGCTGGCG TTCGCGACGC GAGGCTGGAT GGCCTTCCCC ATTATGATTC TTCTCGCTTC 1621 CGGCGGCATC GGGATGCCCG CGTTGCAGGC CATGCTGTCC AGGCAGGTAG ATGACGACCA 1681 TCAGGGACAG CTTCAAGGAT CGCTCGCGGC TCTTACCAGC CTARCTTCGA TCACTGGACC 1141 GCTGATCGTC ACGGCGATTT ATGCCGCCTC GGCGAGCACA TGGAACGGGT TGGCATGGAT 1201 TGTAGGCGCC GCCCTATACC TTGTCTGCCT CCCCGCGTTG CGTCGCGGTG CATGGAGCCG 1261 GGCCACCTCG ACCTGARTGG ARGCCGGCGG CACCTCGCTA ACGGATTCAC CACTCCARGA 1321 ATTGGAGCCA ATCAATTCTT GCGGAGARCT GTGRATGCGC ARACCAACCC TTGGCAGAAC 1381 ATATCCATCG CGTCCGCCAT CTCCAGCAGC CGCACGCGGC GCATCTCGGG CAGCGTTGGG 1441 TCCTGGCCAC GGGTGCGCAT GATCGTGCTC CTGTCGTTGA GGACCCGGCT AGGCTGGCGG 1591 GOTIGCCTTA CTAGLTAGGA GAATGAATCA CCGATACGCG AGCGAACGIG AAGCGACTAC 363 v Figure 2 30 pBR322 as Text construct sequence as well as the graphical construct appearance This view of the sequence is a simple one consisting just of the sequence grouped in tens and a few sites marked 3 Choose Construct gt Display gt Display Graphics to return to the graphical view as in F
73. If you leave these fields blank all sites are shown The top field More than n sites are found lets you define the minimum number of times an enzyme recognition site must be present in the target DNA in order for that enzyme to be marked To activate a minimum number make sure that the check box at the left of the text has an x in it The bottom field Less than n sites are found lets you define the maximum number of times an enzyme recognition site must be present in the target DNA in order for that enzyme to be marked By checking both checkboxes you can specify a range of cut frequencies to be found For example if you Page 3 16 Construct Window Listing Sites Site List botas Name of construct searched construct 5 2 Date Mond h less than 3 were found 480 2266 y nm om O M 3 nN D Figure 3 15 List Sites Output want to see all enzymes that cut only once unique cutters you would put a 0 in the top box and a 2 in the bottom box e The List enzymes whose sites cluster allows you to define which parts of the construct are to be used as the target for the searching The only time the radio buttons are active in this cluster is when you actually have a selection in the DNA otherwise the choices do not make any sense If no DNA is selected the search will take place on the entire construct DNA Choosing are found in the selected sequence will l
74. Info Construct gt General Info differs from Get Info in that it provides information about the entire construct and is not attached to any particular object within the construct This dialog is shown in Figure 3 6 page 3 8 General informa Page 7 68 Menu Items tion will always stick with the construct it remains attached to the window file and will not be lost when segments are cut and pasted within the win dow This is in contrast to the segment comments which are lost whenever the segment is disrupted Copying an entire construct and pasting it into a new window will copy the general information Pasting the entire construct as a segment of another construct will result in the conversion of the general information into info attached to the new segment resulting from the paste operation Search Comments The Construct gt Search Comments option was discussed in Searching Com ments page 3 22 It provides the ability to search through all the comments associated with a construct in all generations As shown in Figure 3 19 page 3 22 general info segments regions marked sites and chronography gen erations can be searched in an intuitive way Matches that are found are listed and comments can then be viewed Make Linear Make Circular Construct gt Make Linear Make Circular command ctrl toggles the display of the construct between linear and circular Making a circular construct into a line
75. K New File gt New command N ctrl N creates an empty window of the type specified by the popup menu item chosen in the new dialog box Figure 7 1 page 7 2 The New Open Import Open Recent Save AS Export Set Print Options Page Setup Print Choose GCK Data Folder N 0 G 36 P new window can be a Construct Illustration List or Gel window In addition to specifying the type of window you can enter the name of the window to be created Note that this does not save the window as a document on disk it merely gives it a name for identification If you later choose Save from the File menu the name you assign in the New dialog box will be used to save the file Instead of using the mouse to select the buttons in this dialog you can use command key equivalents as shortcuts command C ctrl C for Construct command l ctrl for Illustration command l ctrl L for List and command G ctrl G for Gel Pa ge 7 1 Menu Items lt New Window ese Select File Type e Construct Ctri C List Ctri L Illustration Ctr 1 Gel Ctr G New File Name antite 3 O Figure 7 1 New Dialog Open File gt Open command O ctrl 0 will allow you to select a file to open as shown in Figure 7 2 page 7 2 The buttons on the bottom of this dialog box serve to limit the files that are displayed in the scrollable area to the type that corre spond to the selec
76. NNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN BamHI NNNNNGGATCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN v 2001201 Y Figure 2 61 A Placed Site Sequence View 6 In Figure 2 61 you can see that the BamHI recognition sequence has actually replaced some of the Ns This is therefore a real site that can be cut with the enzyme and used to produce fragments from this DNA 7 Choose Construct gt Display gt Display Graphics This will bring up Figure 2 62 page 2 59 You can now select fragments and use them in cloning steps as was done for fully sequenced DNAs in previous tutorials As more sequence informati
77. OCAtION srainnsear iea E A e E EE 7 27 Index 1 1 T source DNA cui ie doradas 7 38 special Paste mint dt doi ridad doit eee 2 26 3 26 stack ng WINGOWS aio 7 16 A A O 8 3 SIISSPTO di a 8 3 SYMDOIS ici A Da age A Ra Ae gel 7 23 T tardet DNAri a canes 7 38 targeting vs Selectng sistimaren AA R A a AA AE aE 2 51 6 1 texXtioODjecdis casas a eee ce 2 51 tool palette ccoo Paia Soe Gene Pera ves eect aa a a eudann 6 3 TOBIE MEn o A SA ia 7 35 transfer Drese iii ds 2 65 7 36 translating across INtFONS occcconnncccnonnnnnccnnnnnncnnnnnnnnnnnnnnnnrnnnnn nr rre 2 70 translating DNA consi a dec edhe ee 3 5 Tutorial Chronography Tracking Cloning History ooooccccccccccnonnnnnnnnnnnnnnnnonennnnnnannnnns 2 30 Cloning a DNA Segment and Silent Mutations cccooonncnnncncnnncnnnnnnanannnnnnnnnos 2 23 Finding Comments and File Searching ccccccccccononnnonnnnnnncnononnnnnnnnnnnnnnnnn nana 2 38 Importing and Exporting Sequences and Other Information 00c0 2 60 Making Illustrations lt ceeett tenet eae eben ii 2 50 Marking Open Reading Fames ceeccecceeeeeeeeeeeeeeeeeeeaeaaaaeeeeeeeeeeaeaaaaaeaes 2 11 Marking Sites ais cist Asie tate ae AAA aes 2 8 Modifying the Construct Appearance cccccccccnononnnnnnnncnnnnnnnnnnnnnnnnnnnrnn rra 2 20 Running Gels and Orientation Analysis eeeeeeeeeeeneeeeeeeeeeeeeeaeeeneees 2 45 Viewing the Construct as a Sequence cnconccncnnncncnonnnnnnnnnnenonn
78. OK button is disabled because the operation is not biologically possible To Page 2 28 Tutorials Cloning a DNA Segment and Silent Mutations adjust the ends you can drag the arrows with the mouse until you have com patible ends As soon as the ends are made compatible the OK button will become enabled and you will be asked to deal with the other junction between the fragment being pasted and the target sequence There is a shortcut to this process using Edit gt Special Paste which is discussed in detail in Special Paste page 7 14 For now press Cancel 18 Close construct 6 and hsp70_Bam but do not save any changes You may continue with the next tutorial now or quit the program Page 2 29 Tutorials Chronography Tracking Cloning History TUTORIAL 7 CHRONOGRAPHY TRACKING CLON ING HISTORY One of the most useful features of GCK is called chronography This feature allows you to keep track of construct history as well as to store different views of the same sequence in a single file It is important to realize that although you will be seeing different graphics on screen there is only a single sequence in each construct file Chronography allows you the flexibility of dis playing the same sequence in a number of ways to bring out key features 1 Start GCK and open the file called pBR322 in the tutorial files folder You will see Figure 2 29 This is a fairly standard view of a construct with a Cons
79. OSITION INGICATOFS 2 2 ee eee cece eect cee ee eee eee eee T sean eee eeeaaee 7 58 PRIMGERS e caged onccaa sale vau bees veustoncdstoaewSeencganteens 2 74 8 7 pr tein SEQUENCES as s se it ca us dace eles Ai id 3 5 7 27 redefining the origin 2 cceceeeeeeceeeeeeeeeeeeeeeeeeeeeeeeeaeeeeeeeeeeeeaeeaeeeeeees 3 44 7 66 A ea 6 7 region DAMOS sosistas onn ces vedud ewes aaa 7 28 regions creating ica 3 5 7 45 JEt INTO rca seagscediseerecens A a eE E emus atau uneidterpereeetewvesteese 3 9 MOVING A e S od Sua lest etl toe N 7 27 SHOWING names cerca cti E 7 28 restore conversion defaults cccececeeeceeeceeeeeeeeeeceeeeeseaaeeeeseaaeeeeeeadeeeeseaneeeeees 7 38 restriction digests a roeie aaa rante rior ias nee 2 47 7 72 CITE 7 36 rotating A CONSUUCE iia aa 7 66 FUNNING GEIS ora A A tee 2 45 runoff Count ta iio aer 5 2 7 71 S save conversion defaults ccconccnnconnconnconcnncnoncnoncnonncnncnnnonnnonnnnnncnnnanncannnnnna 7 38 search THES ii dada 7 35 Search GenBank E N dan 7 37 Searching COMMENUS icsi niidina naii daa naaa aaia ideada 3 22 7 69 Index 10 searching GenBank inci ia 2 67 Selecting frames ali ad di e dd 7 67 Selecting SEGIMEM S edi O A ed eR ee 3 3 Selecting VS targeting voor lirio eater 6 1 selo cton Tng met da a CEA EEE EAE 3 2 sequence display saaa a eed ee A Slee ee eee 3 18 SEQUENCE POSITIONS epica see aa eee ceed ect evs See A 3 19 Set Beginning POSITION socio iris
80. OSSIBILITY OF SUCH DAMAGE Textco BioSoftware Inc License Agreement TEXTCO BIOSOFTWARE INC Customer Software License Page 8 8 Appendix Textco BioSoftware Inc License Agreement READ THIS BEFORE USE Please read this License carefully You are purchasing a license to use the accompanying Textco BioSoftware The Software is owned by and remains the property of Textco BioSoftware Inc is protected by international copyrights and is transferred to the original purchaser and any subsequent owner of the Software media for their use only on the license terms set forth below Opening the packaging and or using Textco Bio Software indicates your acceptance of these terms Grant of License Textco BioSoftware Inc a New Hampshire corporation with business offices located at 27 Gilson Road West Lebanon NH 03784 USA Textco BioSoftware grants the orig inal purchaser Licensee the limited rights to possess and use the Textco BioSoftware Software Software consisting of machine readable computer code and documentation on the terms and conditions specifically set out in this License Term This License is effective as of the time Licensee receives the Software and shall continue in effect until Licensee ceases all use of the Software and destroys or returns to Textco BioSoftware all copies thereof or until automatically terminated upon the failure of Licensee to comply with any of the terms of this License Y
81. PIE A Figure 2 5 Segment Get Info Box Page 2 5 Tutorials Working with Constructs ated with it These comments can be used to store important information about the construct and can be searched using the Search Files capability of GCK Tutorial 8 Finding Comments and File Searching page 2 38 We will talk more about this dialog box later Tutorial 7 Chronography Track ing Cloning History page 2 30 For now just press the Cancel button you don t want to make any changes 8 You should still have the T7 promoter selected as shown in Figure 2 4 page 2 5 If you do not then select it again by double clicking on the seg ment First let s change the line thickness by choosing Format gt Lines gt and choose the third line down to change the width of the selected DNA segment to 3 pixels Next add an arrowhead pointing in the clockwise direction by choosing Format gt Lines gt and choosing the rightward pointing arrow in the sec ond section of the Lines menu 9 The last step is to adjust the arrowhead size This is done by choosing Format gt Lines gt Size Arrowhead You will see Figure 2 6 Click and drag the O O Set Arrow Size Cancel SOK Figure 2 6 Size Arrowhead mouse in the dialog box to resize the arrowhead to be approximately what is shown in this figure Click OK 10 We now need to adjust the T3 promoter segment to point in the counter clockwise direction This can be
82. Rc 7 66 Set dIneCtOny aes inv eee aie aie ee Ae es 2 40 Set printer Margio cinco is eet eee ea ede eden 7 8 Set roor URL ov ie cee eece ever o lees ded ees A dees RO 7 37 Shotgun ClONING poi ia 2 78 7 38 generate CONSIIUCIS 22 s cccteeniovccccenereeatcnwendteanct waded snwepecudebedcceouescodtdeedteccdanmeoane 2 79 SCISCIHSNZY MES a ai red pads ec re ered as vee eee yee 7 40 Select lOCAUOM cti 7 40 UU iaa 2 79 target Sie durar aio AR rea ticas 2 79 USE TITLE dni 7 40 silent mutations INSEMMING Ste DY Lia a 3 31 7 55 rEMOVING Site Dy cosita teed EA EA 3 28 7 58 torial a e s 2 23 single stranded tiva 7 58 site markers Arando SES A MEL Ms eee nets bee Monet Ses Scovel hae ed 7 23 as symbols era eea ntegeteppedeCeepunevea nec AEE R 2 22 O OO 3 12 A e A A hee det R A 3 14 at Sequence ii E E E E E 3 14 automatic arrangement coooccconcccnnnncononnnnnnncnnnnnnnnnrnnnnnnn nr ren rr ttnn nenn nn nnne 2 9 3 13 ale T eE EEEE EA eee A ee AT 2 10 3 8 horizontal attachment location ccooonccccononnnnncnononnncnonnnnnnnnnnnnnnnnnnnnnnnnnnnnnnrnnnnn 7 26 Manual arrangement neor aroo ree a n E eee teen eee E EEO E 3 13 OVENVIOW ui A A A eee ia EE 3 12 placement il ita 7 53 SHOW AICS at a e o e eh ee ee eee aes 2 30 SHOWING locatiON coast EE EE A cudvtvieeelel os pockets 7 25 SHOWING NAMES E anaes ie ened eet ea en aes 7 25 A dedecdaderte2e dee de chads eaae gee coh de each esecccash lay tects aeae 3 12 7 23 vertical attachment l
83. Site Through Silent Mutation This process is similar to that for Removing a Site Through Silent Mutation page 3 28 Select a protein sequence and then choose Construct gt Features gt CTG TGG argc TAC GCC Leu Trp lle Leu Tyr Ala Figure 3 28 Removing Sites 4 Insert Sites by Silent Mutation to start the process You will see Figure 3 29 page 3 31 in which you can choose those enzymes that are candidates for possi ble sites in the DNA corresponding to the region you have selected In this pa Choose Enzyme s Ea File commercial_no_isoschizomers gcl v List only those enzymes with M blunt ends IV 5 overhang ends IV 3 overhang ends Enzymes to try Click OK to view sites that can be introduced by silent mutation Cancel OK Figure 3 29 Inserting Sites 1 step you might limit your selection of enzymes to those you have in the lab or to one or two specific enzymes that might meet other criteria you have in your cloning project Pressing OK takes you to the next dialog shown in Figure 3 30 page 3 32 There are 5 columns in this list The first column Site Pos shows the posi tion of the start of the recognition sequence for the new enzyme site to be created The second column shows the name of the enzyme whose recogni tion site will be created Column 3 lists the position of the individual nucle otide that is to be altered in case there is an exact match with the recognition sequenc
84. T TTC GGC GTG GGT ATG 129 Arg Ala Arg His Phe Gly Leu Met Ser Ala Cys Phe Gly Val Gly Met 518 GTG GCA GGC CCC GTG GCC GGG GGA CTG TTG GGC GCC ATC TCC TTG CAT 145 Va Ala Gly Pro Val Ala Gly Gly Leu Leu Gly Ala tle Ser Leu His 566 GCA CCA TTC CTT GCG GCG GCG GTG CTC AAC GGC CTC AAC CTA CTA CTG 161b Ale Pro Phe Lew Ala Ala Ala Val Leu Asn Gly Leu Asn Lew Leu Leu 614 GGC TGC TTC CTA ATG CAG GAG TCG CAT AAG GGA GAG CGT CGA CCG ATG 177b Gly Cys Phe Leu Met Gin Glu Ser His Lys Gly Glu Arg Arg Pro Met 662 CCC TTG AGA GCC TTC AAC CCA GTC AGC TCC TTC CGG TGG GCG CGG GGC v 3297 4146 v Figure 2 33 pBR322 Generation 1 Sequence 6 Double click on the blue segment from about 12 o clock to 5 o clock to select that segment Now choose Construct gt Get Info or press command Mac ctrl 1 Windows You will see Figure 2 34 This provides information Segment Info Name pSC101 derived materiall First Pos 1 Last Pos 1762 Generation 2 Comments This segment was derived from pSC101 and contains the tetracycline resistance gene Cancel CS Figure 2 34 Segment Info about the source of each DNA segment in the construct By carefully docu menting the sources of each DNA segment the entire history of a construct Page 2 33 Tutorials Chronography Tracking Cloning History can be maintained easily All the comments entered can also be searched using the File Searching capabilities of GCK see Tutorial 8 Finding Com ments and
85. ThrArgA LaG LuG LuSerAsnArg CCAGCTGGCGAAAGGGGGATGTGCTGCARGGCGATTAAGTTGGGTAACGCCAGGGTTTTCCCAGTC 4TrpSerA LaPheProProH i sA laf LaLeuArgAsnLeuG LnThr a LG LyProfsnG LuTrpAsp Sacl BstXI ACGACGTTGTRARACGACGOCCAGTGARTTGTRATACGACTCACTATAGGGCGARTTGGAGCTCCA 4ArgArgG InleutYalYalAlaLeuSerAsnTyrTyrSer luSerTyrProSerAisnSerSerTrp Sacll Eagl Smal Dsal Not Xbal Spel BamHI Pstl EcoRI EcoRY Hindlll Clal CCGCGGTGGCGGCCGCTCTAGAACTAGTGGATCCCCCGGGCTGCAGGAATTCGATATCAAGCTTAT 4ArgProProProArg6 lLuLeuValLeuProAspG lyProSerCysSerAsnSer leLeuSer le Sall Hinell Apal Accel Xhol Eco0109IKpn CGATACCGTCGACCTCGAGGGGGGGCCCGGTACCCAGCTTTTGTTCCCTTTAGTGAGGGTTAATTC 4 coo e a hibenslalTenloan carol Tb a Tila Figure 2 15 Viewing the Construct as Sequence sequence all the way to the top of the window Notice the correspondence between the graphical view and the sequence view Colors are maintained sites are marked and regions are indicated However since we specified that the regions we marked are protein regions Figure 2 13 page 2 13 the translated peptide is displayed below the actual DNA sequence The small tri angles adjacent to the amino acid line numbers indicate the direction of trans lation 4 Before we can mark the f1 origin of replication we need to be able to identify the nucleotides to be marked Let s add position indicators by choos ing Construct gt Display gt Show Positions Remember how double clicking on a seg ment in the graphical view of
86. You can select this name and alter the appearance of the text by using appropriate items under the Format menu The region name text can be dragged around the construct window When the region name text is selected it is highlighted along with the region itself making it clear which region is connected with the text 8 Now select the left region by clicking on it once with the mouse Choose Construct gt Get Info Change the name of this region to ampicillin resistance and put in comments indicating that the gene product is beta lactamase Click OK 9 Note that when you have a region selected you have access to many items in the Format menu This will allow you to change the appearance of the arrow in the construct and even change directions by using the Format gt Lines menu This would be equivalent to changing the protein direction in Figure 2 13 10 Choose File gt Save As name the file construct 3 and save it in your own folder please do not replace the tutorial files provided because others might want to use them later You will need it again in the next tutorial Page 2 13 Tutorials Marking Open Reading Frames You can quit now or continue on to Tutorial 4 Viewing the Construct as a Sequence page 2 15 If you plan on continuing you can leave the file you just created construct 3 open If not close this file Page 2 14 Tutorials Viewing the Construct as a Sequence TUTORIAL 4 VIEWING THE
87. a description of the item on the right side of the window in the Descrip tion field Once you press the Generate Primers button GCK will return a list of possible primer pairs Figure 2 80 page 2 76 Choose a pair and press the Show Info button to see details about how the various attributes of the primer pair scored Once a pair is selected you can add it to the con struct by pressing Add Primer button Once you are finished adding the primers press the Done button to close the window Any primers that you added to the construct are displayed as pairs of opposite facing indicators one on the top and one on the bottom of the construct DNA You can click on a primer pair Get Info and see the same information that was available in the Show Info window Database Searching There are many databases available over the Internet which contain informa tion relevant to biologists For details on how to use the DB searching capa bilities see Tutorial 18 Database Searching page 2 81 The basic idea is that you can provide keywords protein or DNA sequences to GCK and the pro gram will send that information to one or more database sites on the web The searching is managed through a DB searching engine on Textco BioSoft ware s web server The DB server accepts either DNA protein or keyword information and sends out queries to various web sites The DB server con tains information on how to format queries for different sites and format
88. again later You can quit now or continue on to Tutorial 2 Marking Sites page 2 8 If you plan on continuing you can leave the file you just created construct 1 open If not close this file Page 2 7 Tutorials Marking Sites TUTORIAL 2 MARKING SITES 1 Start GCK and open the file construct 1 which you created in the first tutorial If you do not have this file you can start with construct 1 from the tutorial files folder provided 2 The next thing to do is to mark restriction enzyme sites that are located only in the polycloning region and nowhere else To begin double click on the polycloning segment which has a blue lined pattern and is located at about 3 o clock You should see the segment become selected 3 Choose Construct gt Features gt Mark Sites You will see Figure 2 8 This dialog Mark Sites File commercial_no_isoschizomers gcl z Mark only those enzymes with M _blunt ends V _ 5 overhang ends V 3 overhang ends Enzymes to mark Add All gt Get Info Mark enzymes for whichE Display new sitesE IV more than o sites are found C as symbols M Jess than sites are found as enzyme names Mark enzymes whose sites E are found in the selected sequence Cancel occur exclusively outside of the selection OK Figure 2 8 Mark Restriction Sites is discussed more fully in Marking Sites page 3 10 For now make sure that the commercial no
89. age 2 23 this is essential to main taining an easy to use interface 8 Click on the BamH site marker name and then select all site markers by pressing command A Mac ctrl A Windows or by choosing Edit gt Select All We want to change the appearance of all the site markers except for the BamHI site so we need to deselect the BamH site while leaving the others selected This is done in the standard way of holding down the shift key and clicking on the BamH site this process is called shift clicking Make sure that you have all the sites selected with the exception of the BamHI site Now choose Format gt Site Markers gt Show Site As Symbol You have something resembling Figure 2 9 page 2 9C Note that you might not have the same set of symbols as shown in this figure 9 Choose File gt SaveAs name the file construct 5 and save it in your own folder please do not replace the tutorial files provided because others might want to use them later You will need it again in the next tutorial That tutorial will explain how to use your new vector as the recipient of foreign DNA You can quit now or continue on to Tutorial 6 Cloning a DNA Segment and Silent Mutations page 2 23 If you plan on continuing you can leave the file you just created construct 5 open If not close this file c Note that you could accomplish the same result by clicking on a single site marker and then holding down the shift key and clicking on
90. al Note that a frame must be selected it must appear high lighted in the window in order for items in the Format menu to have any effect on the frame itself With the frame selected choose Format gt Lines gt and choose Page 2 20 Tutorials Modifying the Construct Appearance the second line thickness in the menu it is two pixels wide Choose Format gt Color gt Yellow and then choose a fill pattern using Format gt Fill You can try dif ferent patterns and colors to see how they look If you plan to print the sequence remember to use a light color for the fill pattern so that it does not obscure the text 5 Note that the frame encompasses the site markers the DNA and the region You can limit what is enclosed in the frame by choosing Construct gt Fea tures gt Set Frame Contents as shown in Figure 2 20 This dialog allows you to gt Set Frame Contents eS Indicate the contents to be enclosed by the frame V Include segments Include regions Figure 2 20 Set Frame Contents define which items will be enclosed in the frame Set your dialog box to look like the one shown here and then press OK 6 It is somewhat difficult to distinguish between the DNA sequence and the protein sequence so let s change the appearance of the protein sequence Click once to select the protein sequence and then choose Format gt Font gt Times then Format gt Style gt Italic Your display should now resemble
91. ar one presents the option of opening the construct either at the insertion point or at the origin as shown in Figure 7 53 Converting a linear construct to cir Open Construct At Choose a location at which to open the construct Open at start of selection _ Open at construct origin Cancel Figure 7 53 Make Linear Dialog Page 7 69 Menu Items cular joins the ends of the linear construct to become the origin If a ligation dialog box is needed it will be shown Page 7 70 Menu Items Gel Menu Hide Runoff Count The Gel Window is discussed in detail in Hide Gel Legend Ctrl L Chapter 5 Gel Window A typical gel Hide Standard Sizes window is shown in Figure 5 1 page 5 1 Show Hide Runoff Count Set Threshold Ctrl T Display Table Ctrl At the bottom of each lane in a gel win dow is an indication of the number of fragments that have migrated off the bot tom of the gel If no fragments are smaller than the threshold set for the gel then no number is placed below the lane If too many fragments run off the gel increase the threshold for the gel see Set Threshold page 7 72 These numbers are called the runoff count and can be made visible or not by using the Gel gt Show Hide Runoff Count menu option Show Hide Gel Legend The Gel legend is discussed in Legend page 5 2 The legend is visible just to the right of the gel and indicates which DNA and enzyme s were used to produce
92. arked sites select the site marker and then choose the desired default font from the Font submenu of the Format menu Default Construct For the Construct window you can set the following default attributes for graphical display margins linear or circular construct segment thickness Page 7 33 Menu Items segment fill pattern segment color segment direction arrowheads display site as text or symbol auto arrange or manual arrange placement of site markers site marker font site marker font size site marker font style site marker font color site marker text justification site marker symbol and site marker color For sequence display you can also set the grouping line spac ing show hide positions font size style and color Default Gel For the Gel window you can set the following attributes margins legend table font legend table font style legend table font size threshold value and which items should be displayed legend runoff count size standards Default Illustration For the Illustration window you can set the following attributes object color object fill pattern object line thickness line color line thickness line direction arrowheads text font text size text style text justification and text color Page 7 34 Menu Items Tools Men 100153 Menu Search Files Search Files EAS Import gt Shotgun Cloning File gt Search Files was discussed in Tutorial 8 Fi
93. asy to identify as shown in Figure 7 44 This dialog box is the standard Get Info dialog available by choosing Construct gt Get Info Get Info page 7 68 Page 7 56 Menu Items Select Site Select sites to insert by silent mutation Site pos enzyme name Nuc pos Old nuc New nuc 2401 Aocl 2405 c a E 2405 Sse86471 2405 C A 2405 Rsrll 2411 T G 2405 Rsr2l 2411 T G 2405 Cspl 2411 T G 2405 Cpol 2411 T G 2438 TspRi exact match 2440 TspRi exact match 2465 TspRi exact match 0 2467 TspRi exact match 2481 TspRi 2483 T Cc 2483 TspRi 2483 T G gt Figure 7 43 Creating a New Site Site Info Site Marker Name Cpol Site Marker Comments Position 2405 Generation CSSTIASCICCTT POLA TONInm A GUANO _ Figure 7 44 A Silent Mutation Note that the last g in the sequence is in lower case because it was changed from the original sequence The Cpo recognition sequence is boxed Page 7 57 Menu Items Remove Site By Silent Mutation Construct gt Features gt Remove Site By Silent Mutation was discussed in detail in Tuto rial 6 Cloning a DNA Segment and Silent Mutations page 2 23 and comple ments Remove Site By Silent Mutation page 7 58 This option will create a single point mutation to remove a restriction enzyme recognition site without altering the coding of that segment of DNA As is true for the Insert Sites By Silent Mutati
94. at Y Formatted Listing As Text File DNA Sequence As Text File GCG File Comments As Text File Ence Figure 2 66 Export Sequence New Folder This concludes this tutorial You can close the open window don t save changes you will not need this file any more Page 2 63 Tutorials Importing GenBank Sequence Files Using Deluxe Importing TUTORIAL 13 IMPORTING GENBANK SEQUENCE FILES USING DELUXE IMPORTING Through the Deluxe Import feature Gene Construction Kit contains compre hensive features to allow GenBank searching and file retrieval over the Inter net with importing directly into GCK All GenBank features are converted one to one to GCK features using a conversion scheme you can customize The following tutorial illustrates the basics of these features Images alternate between Macintosh and Windows screenshots The program works the same way on each platform 1 Select Tools gt Deluxe Import gt Open Sequences File Choose the tutorial file called gbmam_sample gbk for this tutorial You will see Figure 2 67 lt gbmam_sample gbk Co con x Figure 2 67 Deluxe import initial window 2 Note in this figure that there are actually 5 different genes in the single file we are examining These are listed along the left side of the window in the Entries list The first entry BOVNEURXIA is selected in the figure The second list Features shows all of the features of this particular
95. ation site and class of computer 4 Governmental personnel using the Software other than under a DOD contract or GSA Schedule are hereby on notice that use of the Software is subject to restrictions that are the same or similar to those specified above Page 8 11 Appendix Textco BioSoftware Inc License Agreement Page 8 12 A Index A addinga Color seahna llo a A a EA Leda vee eee 2 17 aligning opacis macarra 7 75 AOW TOO Re ne e E E EE 2 54 arrowheads UTE a N A A E 2 6 SIZING Cia R E R E ene lee ee 2 6 auto arranging site markers ooccccconnncccnonnnnncnnnonnncnnnnnnncennnnnnnrnnnnnnnrrnnnnnnrennnnnnennnns 2 9 DANG EAE Lt a EE NE 5 1 C CDS aaa ey civbodesaedinecnaaken tae dawcealadedevaivuncue dleuueveadvecdvncdews is 2 70 chronography discarding generations cceceeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeaeeeeeeaaeeeeeneaeees 3 36 7 31 generations iii anaa ia ee eee ave eine este 2 31 3 33 O A 3 32 start MEW JONeratiON ci ii 3 33 tOdO A aa iia 2 30 Circularizing CONSTTUC S spiese torero ad 7 69 Coding Sequences Lai A naan eee 2 70 codon tables CHOOSING eri ed MCU oid 3 38 7 45 EANG eh 55 00 2c a BP oe eee a as sek 2B Shh Be Pa eles 208 Be 7 44 comment export format licitar Eaa aaaeaii k Eind 8 4 comment indicator via dada 3 7 construct Scale shan See eats Paes ede bao aes 7 42 constructtilS iii da 7 61 construct WINGOW OVESVICW cococcocconcncconcnnconnoncnnnonnnnroncnnnroncnrnoncnnrancnrnoncnnra
96. ations that you no longer need Disposing of generations will make the file size smaller The dialog is shown in Figure 7 19 To delete more than one generation you can hold down the shift key while you make multiple selec tions from the list with the mouse shift clicking Note that this operation is not undoable Once a generation is deleted it can never be recovered Get Info For Current Generation Each generation can have information stored with it The information can be Page 7 31 Menu Items entered when the generation is first created Figure 7 18 page 7 30 but once the generation is created you can access and edit the information by choosing this menu option It will bring up Figure 7 20 page 7 32 Generation Info ese Generation Name resinction sites Generation Comments This shows the unique cutting sites in the plasmid OK Cance Figure 7 20 Generation Information Show Previous Generation Show Next Generation Format gt Chronography gt Show Next Generation fl command gt fl ctrl gt and Format gt Chro nography gt Show Previous Generation fl command lt f ctrl lt will be selectable only when appropriate when there is a more recent or more ancient generation to be shown If your selection in the construct contains segments in more than one generation you will be shown the alert box in Figure 7 21 page 7 33 In general if the Gene Construction Kit cann
97. ats like GCG or GenBank These exported files can then be read into GCK Another alternative is to copy and paste the sequence from the other program into GCK Close File gt Close command W ctrl W will close the currently active front most win dow If changes have been made since the last Save you will be shown the dialog box in Figure 7 4 Selecting the Yes button will save the changes and Page 7 4 Menu Items Save changes before closing Do you want to save the changes you made to the document untitled Don t Save Cancel Save Figure 7 4 Save Changes then close the window Selecting the No button will close the window without saving any changes made since the last Save Selecting Cancel will return you to the state you were in before selecting Close Save File gt Save command S ctrl S will save any changes you have made in the cur rently active window It also resets the Revert To Saved menu choice see Revert to Saved page 7 8 to revert to the window conditions that are now being saved Save As File gt Save As will present Figure 7 5 You do not have any choice in file for Save this document as ex Save in Tutorial Files y E ey Edy Name Date modified Type Size 2 s actin_DNA gec s s Bluescript_KS PLUS gec lt cloning_project gci S e S construct 1 gcc S construct 2 gcc E lt S construct 3 acc File name jactin_DNA gec Save Save as ty
98. be used in doing the translations set the codon table using Choose Codon Table page 7 45 In most instances the standard table will be appropriate This corresponds to the standard genetic code found in most text Page 7 46 Menu Items IS Find Open Reading Frames ES This command will create regions corresponding to open reading frames found in the following selected segment Start offset 1 End offset 6349 The following codon table will be used for translations Codon table name Standard Codon Table indicate the minimum qualifying length of open reading frames in amino acids Minimum ORF length pe ne IV Start with ATG Indicate which strands to search Y Search Bottom Strand oK Figure 7 32 Find ORFs Dialog books If you are working with some mitochondrial genomes or other unusual organisms you might need to choose a different table If there is no table corresponding to your organisms you can create one using Edit Codon Tables page 7 44 Also in this dialog box you can type in a number for the minimum length open reading frame to be reported anything less than this length will not be shown Use the Start with ATG check box to specify whether all reading frames should start with ATG or not For prokaryotic sequences you probably want to check this box For eukaryotic sequences be careful not to check this box if you are looking at downstream exons Finally you can
99. bgross Desktop GCK 3 GCK2 vectors Scan subdirectories Set Directory Search DNA for CAACATTTCCGTGTC and GCGGATAACAATTTC Es Figure 2 45 Searching Files 3 button that says DNA Sequence We want to find constructs that contain an ampicillin gene and also contain the f galactosidase gene You can use a 15 nucleotide sequence to represent each gene For ampicillin resistance B lac tamase gene type in CAACATTTCCGTGTC you can use lower case too for B galactosidase type in GCGGATAACAATTTC Your screen should match Figure 2 45 page 2 43 Press Search when you are ready 10 The search results you obtain will be accurate because every file has a DNA sequence Thus if a file has both query sequences it will appear in the list Your search results should be similar to Figure 2 46 In this case pGFP is selected so the pathname to get to the pGFP construct is shown in the Search Directory area of this window 11 This concludes this tutorial You should close all open windows at this time do not save changes to pBR322 File searching is a very powerful feature You might elect to have all the con structs at your organization stored on a file server If users are conscientious Page 2 43 Tutorials Finding Comments and File Searching lt File Search Results y Criteria Search DNA for CAACATTTCCGTGTC and GCGGATAACAATTTC Directory C Users AdministratoriDesktop GCK30a3 GCK_vectors win
100. ble only in the sequence view of the construct It can be activated either by selecting it from the menu or by placing the cur sor in the sequence at the location you wish and then starting to type This is discussed Inserting New Nucleotides by Typing page 3 21 Edit Construct End Edit Cut Site When the cursor is placed at the end of a linear construct the Construct gt Edit Page 7 64 Menu Items Construct End command E ctrl E menu option is enabled Selecting this menu item will bring up the dialog box shown in Figure 7 48 page 7 65 As the Edit End Edit construct end Cancel Figure 7 48 Edit Construct End picture in the upper left of the dialog indicates the visible sequence repre sents the right end of the construct This end can be edited in the standard Gene Construction Kit fashion either drag the arrows to trim nucleotides from a strand or click the mouse at the desired new location for the arrow If the cursor is not located at an end in the construct but is instead at a marked site the menu changes to Edit Cut Site and will present you with a dia log box similar to Figure 7 49 By dragging the arrows you can adjust the cut Locate Cut _ _ 3s Edit cut site BamHI CGACCACACCCGTCCTGTGGATCCTCTACGCCGGACGC GCTGGTGTGGGCAGGACACCTAGGAGATGCGGCCTGCG Cancel 0K Figure 7 49 Edit Cut Site site for the particular enzyme Be sure to change the name of t
101. box will change when you use different printers Print File gt Print command P ctrl P will print the currently active window Note that with the Construct Gel and Illustration windows the image size might be greater Page 7 8 Menu Items than one page This can be determined by selecting Edit gt Show Page Breaks page 7 15 before initiating printing If no page break lines are visible then the image will fit on one page Note also that in the Construct window the image can be scaled to fit on one page by using Construct gt Magnification gt Fit to Page page 7 43 Choose GCK Data Folder The GCK Data folder holds data that is used by GCK to perform some of its tasks This is where restriction enzyme lists and codon tables are stored for OC Choose GCK Data Folder The current GCK Data folder is NH3 HD Users bobgross Desktop GCK 2 5 GCK Data Cancel Change Figure 7 6 Current GCK Data Folder example When you first install GCK the GCK Data folder will be placed in the same folder as the GCK application GCK assumes that the GCK Data folder is in this location If for some reason you would like to move the GCK application or the GCK Data folder to another location you can tell GCK which GCK Data folder to use Choosing File gt Choose GCK Data Folder will bring up Figure 7 6 page 7 9 This dialog informs you of the location of the cur rent GCK Data folder In this case it is on a computer wh
102. c locations on the DNA The details of Mark Location are discussed in Mark Location page 7 51 Construct gt Features gt Place Sites allows you to place specific restriction enzyme sites at specific locations This is very useful for working with generic con structs whose restriction maps are known but whose sequence is incomplete or missing entirely This was discussed in Tutorial 11 Working With Generic Constructs page 2 56 and is also detailed in Place Sites page 7 52 Listing Sites The setup for this is almost identical to the setup for Marking Sites Marking Sites page 3 10 Choosing Construct gt Features gt List Sites command L ctrl L will bring up Figure 3 14 Using this dialog box you can list sites in the construct using enzymes from many different lists and define your own parameters of the kinds and numbers of sites to actually be marked Here are the options in this dialog e The popup menu at the top of the dialog allows you to specify which enzymes will be displayed in the left side list in this dialog The enzyme lists that are in the GCK data folder are the only ones that will show up in the popup menu e The List only those enzymes with cluster contains three check boxes that allow you to show any combination of blunt ends 5 over hang ends and or 3 overhang ends Check all three of these d Note that you can always download the most recent lists
103. cation for the attachment This auto matic attachment allows you to move the site marker around and still have the line connected to the marker text at an aesthetically pleasing location Regions Move Region Outwards Upwards Move Region Inwards Downwards Once Regions have been created it is sometimes desirable to rearrange them This can be accomplished using the Format gt Regions gt Move Region Outwards Upwards ff command f ctrl and Format gt Regions gt Move Region Inwards Downwards f command fl ctrl menu items Selecting a Region and then choosing one of these options will move the selected region to the outermost top or inner most bottom location Show As Protein Don t Show As Protein These two menu items are available when one or more regions are selected Page 7 27 Menu Items In the graphical view of a construct only an arrow will be drawn but in the sequence view Format gt Regions gt Show As Protein will cause the region to be drawn as a series of amino acids translated from the corresponding DNA in the orientation indicated by the arrow direction Format gt Regions gt Don t Show As Pro tein will convert any translated regions back to plain graphic arrows Show Region Names Hide Region Names Selecting a region and then choosing Format gt Regions gt Show Region Names will place the name of the region near the graphic of the region as seen in Figure 600 lt S Cons
104. cation for the line you wish to draw Once drawn the line can be altered by using Format gt Lines In addition to line width and color you can set the direction of the line and if the line has arrowheads you can adjust the shape of the arrowheads see Lines page 7 19 Once lines are drawn they can be moved at either end grab the end to move or moved intact grab in the middle of the line with the selection tool and drag If an end of a line is placed within a construct the line end will stick to the construct and will be moved automatically when the construct is moved in the Illustration window Holding the shift key down when moving an end or creating a new line will confine the angle of the line on the screen line to increments of 45 Newly created lines will have the same attributes as the most recently created lines or will reflect the Preferences settings The rectangle round rectangle and ellipse tools OJO lo can be used to generate shapes for illustrative graphics as shown in Figure 6 4 which might represent binding sites for specific transcription factors along a gene Using the Illustration gt Send to Back and Illustration gt Bring to Front menu options the different objects can be arranged as desired The horizontal DNA is actually a linear construct pasted into the Illustration window Holding the shift key down when creating or editing a rectangle or round rectangle will constrain the shape to a square Hold
105. ccurate than the more common method of calculating the mobility in proportion to the logarithm of the molecular weight and functions equally well on agarose and acrylamide gels Viewing a Fragment Size Table As in the Construct Window the display can be changed from a graphics view to a TEXT view using Gel gt DisplayTable Shown in Figure 5 3 is a repre 0008 Gel orientation analysis 706 658 BSiHKAl 1363 BsiHKAI E 501 1364 BsiHKAI 1864 BsiHKAI 85 4846 BSsiHKAI 4930 BsiHKAI Digest 5 construct 7 5177 BsiHKAI size from to 1448 2237 BsiHKAI 3684 BsiHKAI 1161 3685 BsiHKAI 4845 BsiHKAI 904 4931 BsiHKAI 657 BsiHKAI 786 950 BsiHKAI 1735 BsiHKAI 501 1736 BsiHKAI 2236 BsiHKAI 292 658 BsiHKAI 949 BsiHKAI 85 4846 BsiHKAI 4930 BsiHKA Digest 1 BRL DNA Stds 83885 1 kb ladder position site 75 1 kb ladder 209 1 kb ladder 363 1 kb ladder 564 1 kb ladder 784 1 kb ladder 1081 1 kb ladder 1426 1 kb ladder 1822 1 kb ladder Figure 5 3 Gel Window as Text sentative listing of the two formats for the Table listing of the digest frag ments This view is much more precise than the cursor in the graphics view in giving the exact sizes of the fragments It provides a complete list of every fragment and which enzymes led to the production of the particular fragment Page 5 3 Gel Window Creating and Rearranging Gel Lanes The first listing is given in descending size order and the secon
106. ch codes for the region you have selected Page 3 29 Construct Window Silent Mutations recognition site starting at position 375 has been selected Pressing OK brings up Figure 3 27 page 3 30 lt Silent Mutations E Site pos 375 Enzyme name BamHl Select a silent mutation to remove this site Old pattern New pattern Nuc pos Cancel OK Figure 3 27 Removing Sites 3 At the top of this figure are indicated the recognition site position and restric tion enzyme being considered Note that the site position at the top of the window is the first nucleotide in the recognition sequence for the enzyme shown in the window Like the previous dialog this dialog also has three col umns of data representing the possible changes that can be made in the rec ognition site starting at 375 without altering the coding capacity of the DNA corresponding to the selected region The first column is the current recogni tion pattern for the chosen enzyme with the nucleotide to be changed in lower case The second column is the suggested new pattern that would rep resent the mutation The third column shows the actual position of the changed nucleotide In this case changing GGATCC to GGATtC has been selected the C at position 379 will be changed to a T Once this substitu tion is made it is highlighted in the sequence view of the construct as shown in Figure 3 28 Page 3 30 Construct Window Silent Mutations Introducing a
107. change to Construct gt Display gt Display Graphics The sequence view of the construct will display the actual sequence along with other attributes you have selected Show Hide Generations Show Hide Regions Show Hide Sites and Show Hide Comments are still available These choices func tion the same in the sequence view as in the graphics view of the construct Sites will be displayed with the first letter of the site name aligned to the start of the recognition sequence in the DNA If the region being displayed has been defined as a protein region it will be displayed as an amino acid sequence below the DNA sequence Formatting A Sequence Listing As described in Tutorial 4 Viewing the Construct as a Sequence page 2 15 any GCK construct can be viewed and edited as a sequence The sequence display of the sequence can be modified in a number of ways enabling you to produce a formatted output suitable for publication or for slides or posters A typical sequence view is shown in Figure 3 16 This view Page 3 18 Construct Window Formatting A Sequence Listing 00608 lt Construct construct 5 544 GGG ATG TGC TGC AAG GCG ATT AAG TTG GGT AAC GCC AGG GTT a 914 Pro His Ala Ala Leu Avg Asn Leu Gin Thr Vel Giy Pro Asn 586 TTC CCA GTC ACG ACG TTG TAA AAC GAC GGC CAG TGA ATT GTA P74 Giu Trp Asp Avg Arz Gin Leu Vai Val Ala Leu Ser Asn Tyr 3 O T 628 ATA CGA CTC ACT ATA GGG CGA ATT GGA GCT CCA CCG CGG TGG 634 Tyr Ser Ser Ser Trp A
108. choose Format gt Color gt origin of replication to change the color of the region to indicate its function 11 You can also use the Format menu now to change the line thickness and arrowheads if you so desire When you are done you should see something like Figure 2 18 page 2 19 You can now easily recognize the origin of repli Construct constructs2 gcc kodas Figure 2 18 Origin of Replication Indicated cation by color and can use that region to select the corresponding DNA by double clicking on the region 12 Choose File gt Save As name the file construct 4 and save it in your own folder please do not replace the tutorial files provided because others might want to use them later You will need this file in the next tutorial That tutorial will explain how to enhance the appearance of your sequence in the construct window You can quit now or continue on to Tutorial 5 Modifying the Construct Appearance page 2 20 If you plan on continuing you can leave the file you just created construct 4 open If not close this file Page 2 19 Tutorials Modifying the Construct Appearance TUTORIAL 5 MODIFYING THE CONSTRUCT APPEARANCE 1 Start GCK and open the file construct 4 that you saved in the previous tutorial If you do not have this file you can start with construct 4 from the tutorials folder we provided 2 It is possible to modify the sequence appearance using many of the items in the Fo
109. coRI co32l indill Ban all Acc incll Amas BssHl Drall Apal Acc65l Figure 7 41 Selected Region for Inserting Silent Mutation convenient restriction enzyme sites or to remove inconvenient sites see Remove Site By Silent Mutation page 7 58 and Tutorial 6 Cloning a DNA Segment and Silent Mutations page 2 23 Construct gt Features gt Insert Sites By Silent Mutation allows you to define a segment of DNA into which you want to place a new enzyme site To begin you must first select a translated region this is essential because GCK must know which reading frame is to be conserved This is shown in Figure 7 41 In this case the goal is to insert a new restriction site for a 7 base recognition site enzyme When the region is selected Figure 7 41 Insert Sites By Silent Mutations becomes enabled Unless a region is selected the menu item will be disabled Choosing Insert Sites By Silent Mutations will bring up a dialog box asking you to Page 7 55 Menu Items choose candidate enzymes shown in Figure 7 42 There are several sections Pa Choose Enzyme s x File all_enzymes_7 gcl v List only those enzymes with M blunt ends IW 5 overhang ends IW 3 overhang ends Enzymes to try A Click OK to view sites that can be introduced by silent mutation ES OK Figure 7 42 Choosing Enzymes for Inserting Silent Mutations to this dialog box The popup list at the top allows an enzy
110. ct gt Magnification gt Fit To Window fl command W T ctrl W proportions the con struct to fit nicely within the window If FitTo Window is chosen the construct will be redrawn and rescaled each time the window is resized With any of the other options the construct will not be rescaled if the window size is changed To keep the construct drawing at a specific scale choose Set Scale page 7 42 Fit To Printer Page Construct gt Magnification gt Fit To Printer Page will resize the drawing of the construct to fill up a single printed page as defined in File gt Page Setup You can view the off screen parts by using the scroll bars on the right and bottom of the Page 7 43 Menu Items Construct window To make everything visible again choose Construct gt Magnifi cation gt Fit to Window Features Edit Codon Tables Choosing Construct gt Features gt Edit Codon Tables will bring up Figure 7 29 You 200 Edit Codon Tables Number of Tables 5 Name je Homo sapiens hum Homo sapiens human Escherichia coli Nicotiana tabacum c Comments Saccha e aa ma c Homo sapiens1952 genes found 4 in GenBank 63 Produced by J Michael Cherry with the GCG program CodonFrequency M Cancel New Codon Table AAA CAA Ifin GAA AAC CAC THis GAC AAG liwe CAG Ifin GAG TAG AAT Asn CAT THis GAT TAT Tvr ACA CCA GCA lala TCA ACC CCC GCC lala TCC ACG CCG
111. ct nucleotides along the DNA as it should and will not select the frame How then can you select a frame A frame can be selected by option clicking holding down the option key and clicking on the frame or by choosing Construct gt SelectFrameand then clicking on the frame you want to select For those of you who are quick fingered you can also select a frame by triple clicking on the DNA contained within a frame A selected frame will have its border high lighted Figure 2 19 page 2 20 Inserting New Nucleotides by Typing Because of the complexity of the sequence display window it would be unac ceptably slow to allow typing in new nucleotides while the program updates the screen including all the graphic elements in the sequence view after each nucleotide is typed Therefore the Gene Construction Kit allows you to place the cursor in the DNA sequence at the site you wish to add new nucleotides and then start typing as you normally would Instead of entering each letter into the sequence display window as it is typed the program opens up a dia log box Figure 3 18 page 3 21 into which you type your sequence Each lt Insert Typing ese Insert the following sequence ACGTTATACGATCGATCGATCG Figure 3 18 Insert Nucleotides letter is checked as it is entered to ensure that it is a valid nucleotide charac ter see Legal Nucleotide Characters page 8 1 and then placed into the box Once you have typed
112. d listing is given from 5 to 3 end for digests of linear constructs or clockwise from the origin for digests of circular constructs Especially in the case of partial digests the identification of each end of a fragment is very useful Creating and Rearranging Gel Lanes Gel lanes are created by pasting in information from a Construct Window or from another gel lane To create a new gel lane from a construct is simple In the Construct Window select the marked sites that you wish to use to create the digest and then copy them to the clipboard using Edit gt Copy Make sure to select the site markers and not the fragments themselves an example is given in Tutorial 9 Running Gels and Orientation Analysis page 2 45 Multiple sites can be selected by holding down the shift key and clicking on all desired sites All sites of a given type e g all Hind sites can be selected by double clicking on any one of them Once the sites are copied to the clipboard either create a new Gel Window using the File gt New or open an older Gel Window select the location to paste the new lane by clicking at the top of the gel between two lanes and then paste the digest from the clip board Once the digests have been defined you might want to rearrange or even delete some of the lanes This can be done by following the same logical steps you know from the Macintosh interface Click on a lane to select it use shift click to select more than on
113. d they may not be used for advertising or product endorsement purposes External Links Some NCBI Web pages may provide links to other Internet sites for the convenience of users NCBI is not responsible for the availability or content of these external sites nor does NCBI endorse warrant or guar antee the products services or information described or offered at these Page 8 6 Appendix GCK Acknowledgements other Internet sites Users cannot assume that the external sites will abide by the same Privacy Policy to which NCBI adheres It is the responsibility of the user to examine the copyright and licensing restrictions of linked pages and to secure all necessary permissions Pop Up Advertisements When visiting our Web site your Web browser may produce pop up advertisements These advertisements were most likely pro duced by other Web sites you visited or by third party software installed on your computer The NLM does not endorse or recommend products or ser vices for which you may view a pop up advertisement on your computer screen while visiting our site Medical Information It is not the intention of NLM to provide specific medical advice but rather to provide users with information to better understand their health and their diag nosed disorders Specific medical advice will not be provided and NLM urges you to consult with a qualified physician for diagnosis and for answers to your personal questions Conditions of Use
114. done by following the same steps we just did for the T7 promoter Briefly do the following Se ect the lower green segment the T3 promoter by double clicking on it If you cannot see this segment in the window use the scroll bars to bring it into view Choose Format gt Lines gt and select the third line down to change thickness choose Format gt Lines gt and select the eftward pointing arrow This will add an arrowhead that is the same size as the last arrowhead created so you should have symmetrical Page 2 6 Tutorials Working with Constructs arrowheads 11 Finally we want to see the whole construct again so choose Construct gt Magnification gt Fitto Window This will produce Figure 2 7 page 2 7 We have 00608 lt Construct Bluescript KS gcc 296411 v Figure 2 7 Modified Bluescript KS now formatted the segments of this construct to meet our needs 12 You now need to save the construct under a new name You might first want to create a folder on your desktop to hold the different tutorial files you will be creating in this and in subsequent tutorials Having a single folder will make it easier to find the tutorial files you create as you need them in later tutorials Choose File gt Save As name the file construct 1 and save it in your own folder please do not replace the tutorial files provided because others might want to use them later on Make sure you know where you are saving this file You will need it
115. dow as the active window To create a generic construct of 5000 nucleotides choose Construct gt Insert Ns command H ctrl N This will bring up Figure 2 58 Enter 5000 and es Insert Ns EXE Number of Ns to insert 5000 OK Cancel Figure 2 58 Inserting Ns press the OK button 2 You should now have a linear construct containing 5000 Ns In the graphical view it will simply appear as a horizontal line Choose Construct gt Dis play gt Display Sequence to view the sequence as a series of Ns Now you need to place restriction sites at specific locations in the construct 3 Choose Construct gt Features gt Place Sites command ctrl You will see Fig ure 2 59 page 2 57 This is very similar to the mark sites dialog you saw previously Figure 2 8 page 2 8 You select enzymes in the top list and press the Add button to move them to the bottom Sites to Place list For this tutorial choose BamHI and EcoAl 4 The next step is to define the locations of each of the enzyme sites you will be placing into the construct This is done by first selecting an enzyme in Page 2 56 Tutorials Working With Generic Constructs Define Sites File commercial_no_isoschizomers B EcoRI a Cook gt Fall 1 Fall 2 ee Fau Cancel auNDI 0 A ENEE Fsel A FspAl v Add Sites to Place EcoRI Bami MAA Info _ Show Symbols a Show Text Figure 2 59 Place Sites Dialog the bottom list and then defining the loca
116. ds that are left will have to be joined together using the rules discussed above Second a junction marker will be created when a linear construct is converted to a circular construct This is just a special case of joining two ends together Obviously if you do not have a need for a junction marker it can be deleted select it and press the delete key It is put in to preserve the junction infor mation in case you do need it The philosophy is that it is better to provide the information and let you dispose of it than not to provide it at all Text sequence can be maneuvered within the sequence view of the construct by cutting and pasting Sequences can be selected cut or copied and pasted into another window another construct or elsewhere in the same con struct It can also be pasted into another program through the clipboard If a segment of a construct is pasted into a text editor the DNA sequence will be pasted if it is pasted into a graphics program the clipboard will be treated as a graphic and will include all elements of the selection If you have selected text from another program and transferred it by pasting from the clipboard into Page 3 27 Construct Window Silent Mutations the Gene Construction Kit the text will be placed at the location of the cursor Silent Mutations In cloning projects there is often a need to manipulate fragments that do not have restriction sites at convenient locations lt is therefore us
117. e Revert to Saved File gt Revert to Saved will discard all changes made to the current window since the time of the last save If changes have been made you will see the dialog box shown in Figure 7 4 page 7 5 Clicking Cancel will return the program to the state it was in when you selected the Revertto Saved option Clicking OK will discard any changes made since the last save and restore the window to the condition it was in at the time it was last saved or when it was opened if no saves have occurred Set Print Options Chh oosing this menu item will bring up a dialog allowing you to set a num ber of options The set margins values allow you to define the amount of space between the maximum area the printer can utilize and the edge of the usable space in the current window If this is set to zero than the maximum area usable by the printer will be utilized in the GCK window The Print document name in header checkbox will force the name of the current document to be printed at the top of very page Print page numbers will cause each page to be numbered when it is printed These last two options are especially important when printing out multiple page sequence documents Page Setup File gt Page Setup is the standard dialog box designed to help format printing appropriately More information on this and other Page Setup dialogs is avail able in your Printer and computer manuals Note that the layout in the dialog
118. e exact match is shown Columns 4 and 5 show the current nucleotide and the nucleotide it will be changed into In Figure 3 30 page 3 32 an Afa recognition site will be created starting at nucleotide 120 by changing the C to a T at position 121 Pressing OK will make the change Page 3 31 Construct Window Chronography Tracking Construct History Select Site Select sites to insert by silent mutation Site pos enzyme name Nuc pos Old nuc New nuc 00 Acell 100 T G 112 AcIWi 112 G G 115 Ajnl 118 G O 119 AccB1i exact match 119 Acc65l 12 C T 120 Afal 121 G T 130 Ajni exact match 137 Acil 139 T G 48 Aatl 152 T C 151 Ajnl 152 T C 164 Afal exact match 172 Aatl 172 G A 181 Acil exact match y Figure 3 30 Inserting Sites 2 Figure 3 31 shows the result of this operation Note that the altered nucleotide is in lower case and the restriction site is marked GTC ATC CTC GGt ACC GTC ACC Val Ile Leu Gly Thr Val Thr Figure 3 31 Inserting Sites 3 Chronography Tracking Construct History Chronography was discussed in length in Tutorial 7 Chronography Track ing Cloning History page 2 30 Please see that tutorial for details on how chronography works Chronography is one of the most powerful features of the Gene Construction Kit Because of its uniqueness however it is also one of the most challenging to understand and utilize effectively Chronography is designed to perform two major functi
119. e page 7 67 and then click on the frame you want to select e triple click on the sequence contained in the frame 9et Frame Contents This topic was discussed in Tutorial 5 Modifying the Construct Appearance page 2 20 The frame shown in Figure 7 34 page 7 49 encloses not only the sequence but the marked sites and the translated protein sequence Con struct gt Features gt Set Frame Contents will allow you to adjust what is actually enclosed in the frame Selecting this option will bring up Figure 7 35 By Set Frame Contents ndicate the contents to be enclosed by the frame Include segments IV Include regions Include site markers Figure 7 35 Adjusting Frame Contents using the checkboxes in this dialog it can be specified whether the frame should include segments of DNA regions graphic arrows or translated sequences and or marked sites Page 7 49 Menu Items Mark Sites This was discussed in great detail in Tutorial 2 Marking Sites page 2 8 Con struct gt Features gt Mark Sites comment M ctrl M is used to search the DNA sequence and place site markers at the locations corresponding to recognition sequences of items in the chosen list Lists are GCK files that contain restric tion enzymes or other items that can recognize specific sequences see Chapter 4 List Window page 4 1 Choosing Mark Sites will bring up Fig ure 7 36 page 7 50 As explained in more detail in Marking Site
120. e Format menu The items that are enabled under Page 3 3 Construct Window Changing the Construct Display the Format menu depend on what is actually selected in the Construct window For example if you have some nucleotides selected in the sequence view the line thickness menu will not be available similarly if you have a graphical segment selected the Font menu will not be available Therefore depending on what you have selected the availability of items in the Format menu might change The Format menu options allow the line thickness Format gt Lines gt page 7 19 fill pattern Format gt Fill gt page 7 18 and color Format gt Color gt page 7 22 of the selected segment s to be altered The Format gt Lines gt menu also allows placing an arrowhead at one or both ends of the segment thus adding direc tionality to the segment itself If the segment has one or two arrowheads the appearance of the arrowhead can also be adjusted Format gt Lines gt Size Arrow head This is discussed in more detail in Size Arrowhead page 7 19 Pre defined line thicknesses can be chosen or you can define your own line thickness A so see Tutorial 5 Modifying the Construct Appearance page 2 20 There are many features in Gene Construction Kit many kinds of information that can be displayed in the Construct Window In order to prevent informa tion overload you have the option of customizing the display by turning on and
121. e being displayed To address this problem GCK allows you to indicate the display of different generations using the Construct gt Display gt Show Hide Generations When you are showing generations you will get an extra set of lines on the outside of the construct for all segments not being displayed in the current generation as shown in Figure 3 35 page 3 37 Those segments being displayed in the current generation will not have an indicator line next to them which is the case for the new segment just pasted into the construct The adjacent fragments are being displayed in previous generations and therefore are indicated as such by the gray indicator around the outside of the circle h Once any segment is selected it can be displayed in any generation by using the Chro nography menu In this way it is possible to display different segments in different gener ations Page 3 35 Construct Window Finding Open Reading Frames HindIII Paol Sall 785 pBR322 4497 bp Figure 3 34 New Fragment Generation 1 Although you are not likely to ever reach the limitation of 32 000 generations viewable in GCK you may on occasion want to dispose of some of the extra generations you no longer wish to keep track of This can be done by using Format gt Chronography gt Discard Generations This presents you with the option to throw away any generations of the selected fragments You will be presented with the dialog box shown in Figu
122. e button will cre ate a text only file of the DNA sequence which can be opened by any word processing program as well as almost any other sequence analysis package Click Cancel to dismiss this dialog unless you are really interested in playing with the output files in other programs New Folder 7 With the pBR322 window active choose Construct gt Display gt Display Sequence to change the construct view to a sequence listing Now choosing File gt Export will bring up a slightly different dialog Figure 2 66 In this case there is an extra option called Formatted Listing as TEXT file This option will pro duce a text file containing all the line numbers restriction sites spacing and amino acid sequences Note that in order to view these output files correctly formatted in another application you will need to use a monospaced font like Monaco or Courier Page 2 62 Tutorials Importing and Exporting Sequences and Other Information Oe Save Gene Construction Kit Export As Save As actinDNAtDt i fa Pa fem 2 new tutorials Fy Q search NewHampshire3 A Name A Date Modified Network BOVNEURXIA gcc 12 15 07 A NH3 HD y 7 EX Platinum ES Exptl System gck3 new tutorials doc 12 17 07 E Installers hsp70 proteir 12 14 07 ES movie station eh WayfarerlV a Troy 0 0 g Desktop A Applications bobgross 1 Documents gt KeyServering f FI TexteoBiosofr Form
123. e constructs by clicking on it choose Edit gt Select All and then choose Set Construct Scale Reduction The items in the Reduction submenu allow you to set the degree of reduction for drawing the Illustration window It is not possible to view the Illustration window at a magnification of more than 1x You can either view the window at full size no reduction or at various degrees of reduction Set Reduction Illustration gt Reduction gt Set Reduction allows you to enter a value in the dialog box shown in Figure 7 55 to specify the actual reduction In this case a value Page 7 73 Menu Items Choose Display Scale Display scale 1 00 Cancel C ok Figure 7 55 Set Reduction Dialog of 0 5 has been entered so the drawing will be at 50 normal size In reduced mode you will be able to move objects around but you cannot edit them they are non targetable Reduce Choosing Illustration gt Reduction gt Reduce will reduce the area of the Illustration window by approximately 50 Note that this is not the same as a 50 reduction in linear dimensions which would reduce the area to 25 Enlarge Choosing Illustration gt Reduction gt Enlarge will increase the area of the Illustration window by approximately 50 Note that this is not the same as a 50 increase in linear dimensions which would increase the area by 400 No Reduction Illustration gt Reduction gt No Reduction is the same as s
124. e converted into a GCK feature As discussed in Tutorial 13 Importing Gen Bank Sequence Files Using Deluxe Importing page 2 64 you can choose any number of ways to have GenBank features represented in the final GCK construct you create The Conversion Defaults window is shown in Figure 2 68 page 2 65 The correspondences you specify in the Conversion Defaults are used to define how any particular conversion will be done How ever each time you perform a conversion you have the option of overriding the default conversions individually or as a whole Save Conversion Defaults Once you have defined a set of Conversion Defaults that you like you can save them in a file to be recalled later if needed If you have several different sets of Conversion Defaults you can create several different files using this option Restore Conversion Defaults This menu item allows you to open any of the files you may have saved under Save Conversion Defaults to be used as the new set of defaults Shotgun Cloning Shotgun cloning refers to the process of fragmenting a DNA segment and then placing each fragment into a restriction site of a target vector Gene Construction Kit allows you to choose any enzyme to digest your DNA and to use as a target site within the vector DNA Thus there are two DNAs involved in this process the source DNA and the target DNA These DNAs and the enzymes used for the digest as well as the details of the output files a
125. e lane and then use Edit gt Copy Edit gt Cut and Edit gt Paste to move and replace lanes on the gel You can rearrange lanes on a single gel and even paste lanes from one gel into another This might be useful if you have a specific set of standards that you run on your gels You could set up a gel containing those standards and save it Anytime you want to put a standard lane on a new gel simply open up your saved standards Copy the lane you want and paste it into the new gel Partial Digests Occasionally restriction enzyme digests do not go to completion resulting in extra bands on the gel Using the GCK you can simulate these partial Page 5 4 Gel Window Exporting Gels lt Define Partial Digest ese Define digestion parameters show only partially digested fragments C show all fragments from partial digest also show fragments from complete digest Number of Cuts Completion Figure 5 4 Partial Digest Dialog digests to see if they can explain your laboratory gel results Select the lane containing the digest that you want to view as a partial digest and then choose Gel gt Show Partial Digest You will see a dialog box like the one shown in Figure 5 4 page 5 5 The extent of the digest can be set by using the slide control on the left of the dialog box The left scale is the number of cuts to be made and the right scale shows the corresponding percentage completion The al
126. e mouse at the new location you desire for the side of the arrowhead The thickness of the horizontal line in the dialog is the same as the thickness of the line being edited Font The standard Format gt Font menu lists all of the available fonts from your sys tem It operates in the same way Font menus work in most other applications This submenu along with the Style page 5 21 and Size page 5 21 is available anytime that text is selected in the Illustration window or the Con struct window either the graphics or sequence views and will function to alter the display of the selected text In the Gel window setting these attri butes will set the display of the legend text and the text of digests when viewed as a table In this submenu and in all other submenus the command Mac control windows key equivalent to selecting the menus is to press the shift key Page 7 20 Menu Items indicated by the symbol 1 in combination with the command control key indicated by the symbol Thus f command B f ctrl 3 means to press the shift key the command ctrl key and the B simultaneously In the Gene Construc tion Kit regular menu keyboard equivalents are chosen with the command key and submenu keyboard equivalents are chosen with command and shift keys Style The Format gt Style menu contains the standard style options that are found in other programs including Plain Text f command P fl ctrl P Bold ff command B TT ctrl B
127. e name orientation analysis Cancel Eo Figure 2 49 Creating a new Gel window 4 Choose Edit gt Copy to copy the selected sites to the clipboard Notice that you are not copying a DNA sequence but rather a set of markers Page 2 46 Tutorials Running Gels and Orientation Analysis 5 Choose File gt New which will bring up Figure 2 49 Select the Gel popup menu to specify that you want to create a new Gel window and then type in the name orientation analysis for the new file name Press the OK button to create the new Gel window You will see Figure 2 50 Along the left side are Gel orientation analysis S Es Figure 2 50 An empty gel window size markers The blinking triangle at the top of the window indicates the insertion point where the next lane will be created 6 Choose Edit gt Paste to paste the site markers into lane 1 You will see Fig ure 2 51A page 48 This shows the predicted migration of the restriction fragments on a gel For more details on features of the Gel window see Chapter 5 Gel Window Click the mouse in this window near the top right corner of the gel just above the gel tab that is sticking up This will place the blinking triangle insertion point at that location 7 Now bring the construct 6 window to the front again and double click on a BsiHKAI site to select all of these sites Choose Edit gt Copy to copy the g In actuality what is on the clipboard is not j
128. e of a selected region can be altered using many items listed in the Format menu just as can be done for segments see Changing the Construct Display page 3 3 Page 3 5 Construct Window Attaching Comments to Objects in Construct Window The dialog box shown in Figure 3 3 can be viewed by selecting a region and then choosing Construct gt Get Info command l ctrl 1 You can type in new values in the First Nucleotide and Last Nucleotide boxes to adjust the end points of the region You may type up to 32 000 characters of comments into each Get Info dialog box These comments can be searched for key words using Construct gt Search Comments page 7 69 or by using File gt Search Files page 7 35 See Tutorial 8 Finding Comments and File Searching page 2 38 for a hands on example of searching for comments Also see Search ing Comments page 3 22 Regions can also be rearranged by moving them to the outside or the inside see Move Region Outwards Upwards page 7 27 If a region is selected and moved to the top GCK will move the selected region to the top of the stack of regions being displayed it will never move the region to the outside of a circular construct or above a linear construct Attaching Comments to Objects in Construct Window Comments may be attached to any segment of the construct which is selected by using Construct gt Get Info These comments may be used to store Seg
129. e which will bring up a dialog box like that shown in Figure 4 5 The actual cut site is defined by either dragging the arrows to the appropriate locations along the DNA sequence or by clicking the mouse at the position to which you wish to move the arrow If an arrow is moved away from the actual sequence into neighboring DNA an indicator will appear displaying the number of nucle otides between the end of the recognition sequence and the current position Page 4 4 List Window Creating New Lists of the arrow GCK can use as many lists as are present in the GCK Data folder Textco has included some standard lists including lists of commercially available enzymes that represent 4 5 6 7 or 8 base recognition sequences Creating New Lists List entries may be selected by choosing them in the list at the left side of the dialog Figure 4 3 page 4 3 Once selected list entries can be copied or cut and pasted into other lists As in most standard lists you can select adjacent multiple entries by clicking on each additional entry with the shift key down To select non adjacent entries hold down the command key Macin tosh or the ctrl key Windows and then click with the mouse on the new item to select To create a list of enzymes that you use often you might start with the com mercially available list and then cut out those enzymes that you do not use Choosing File gt Save As will allow you to save the new edited file
130. e with the insertion site you will be presented with the ligation dialog box shown in Fig ure 3 22 The diagram in the upper left of the dialog box tells you which Ligate Ends es C Ligate left ends IGCGGTTAGCTCCTICGGTCCT ICGCCAATCGAGGAAGCCAGGAGGC ATGCGGCCTGCGTAGCACC garcen CTACCCSGACGCAT BIO KE gt Figure 3 22 Ligation Dialog junction of the ligation you are viewing and will vary depending on whether you are pasting into a linear or circular construct as shown in the figure The black circle highlights the actual junction that is being presented in the dialog The OK button cannot be selected until the segment ends are made compat ible This can be done by moving each of the four arrows to the desired loca tions by dragging with the mouse or simply by clicking at the desired new location for the cut site After adjusting the left junction for the insertion you will be presented with a similar dialog box for the right junction for the inser tion if necessary In the current figure the left end of the segment to be inserted the sequence shown on the right of the dialog box is blunt ended while the sequence shown on the left of the dialog represents the left side of the opening in the construct which is receiving the segment This end has a staggered cut Dragging the top arrow in the left side sequence to the end of the sequence to the right of the TT will create a blunt end and allow the liga
131. ead Insti tute All advertising materials mentioning features or use of this software must display the following acknowledgment This product includes software developed by the Whitehead Institute for Biomedical Research The name of the Whitehead Institute may not be used to endorse or promote products derived from this software without specific prior written permission We also request that use of this software be cited in publications as Steve Rozen and Helen J Skaletsky 2000 Primer3 on the WWW for general users and for biolo gist programmers In Krawetz S Misener S eds Bioinformatics Methods and Protocols Methods in Molecular Biology Humana Press Totowa NJ pp 365 386 Source code available at http fokker wi mit edu primer3 THIS SOFTWARE IS PROVIDED BY THE WHITEHEAD INSTITUTE AS IS AND ANY EXPRESS OR IMPLIED WARRANTIES INCLUDING BUT NOT LIMITED TO THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE ARE DISCLAIMED IN NO EVENT SHALL THE WHITEHEAD INSTITUTE BE LIABLE FOR ANY DIRECT INDIRECT INCIDENTAL SPECIAL EXEMPLARY OR CON SEQUENTIAL DAMAGES INCLUDING BUT NOT LIMITED TO PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES LOSS OF USE DATA OR PROFITS OR BUSINESS INTERRUPTION HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY WHETHER IN CONTRACT STRICT LIABILITY OR TORT INCLUDING NEGLIGENCE OR OTHER WISE ARISING IN ANY WAY OUT OF THE USE OF THIS SOFTWARE EVEN IF ADVISED OF THE P
132. earch Comments Key text Instances brigin MBT derived material pSF2124 derived material origin Ampicilin Resistance MEA Figure 2 39 Searching Comments ated with all chronography segments regions site markers or part of gen eral info for the key work origin You can limit your search to just specific Page 2 38 Tutorials Finding Comments and File Searching features of the construct by using the checkboxes on the left of the dialog box 3 The list that appears in the right of Figure 2 39 contains all those fea tures which have the word origin in their names or in their comments Click on the word origin in the right side list and press Show Info to see the context of the match This will bring up Figure 2 40 This is the standard Region Info Name origin First Pos 2484 Protein Sequence Last Pos 2723 Generation 1 Comments Origin of replication for the entire plasmid Replication proceeds anticlockwise from this location This is the location of the switch from an RNA primer to DNA synthesis Cancel Figure 2 40 Origin Found region get info box Note that the word origin is highlighted in the Region Comments field so that you can easily see where it is located From this dia log you know that the origin of replication is from nucleotides 2484 to 2723 and can be found as a region in generation 1 as indicated in the bottom left corner of the
133. ecular struc tures molecular variation gene expression and mapping data They are designed to provide and encourage access within the scientific community to sources of current and comprehensive information Therefore NCBI itself places no restrictions on the use or distribution of the data contained therein However some submitters of the original data or the country of origin of such data may claim patent copyright or other intellectual property rights in all or a portion of the data that has been submitted NCBI is not in a posi tion to assess the validity of such claims and therefore cannot provide com ment or unrestricted permission concerning the use copying or distribution of the information contained in the molecular databases Disclaimer Liability For documents and software available from this server the U S Government does not warrant or assume any legal liability or responsibility for the accuracy completeness or usefulness of any information apparatus product or process disclosed Various content on this site may be subject to copyright by journals and publishers Use of the copyrighted material is sub ject to the terms and conditions of use established by the journal or publisher Endorsement NCBI does not endorse or recommend any commercial prod ucts processes or services The views and opinions of authors expressed on NCBI s Web sites do not necessarily state or reflect those of the U S Gov ernment an
134. ed 7 64 eding ends Tieren teats a NA EE E E ittezada 3 44 EMBL 2000 od ta 8 3 EXONS uriena O 2 70 EX DANG NO mic it ia eee 2 73 EXPOMINO mitico 2 60 3 41 OXPOMINgG GEIS vi AA A RT TEO 7 7 exporting llustrations cee keeles E a eet ee eee 7 7 EXPOMING StS lt 2 se eA ee ee Se 7 7 F File menu Choose GCK Data Folder a T Ta devs datada didas 7 9 CIOS id daa 7 4 e 7 6 IMPOR S ici dada 7 3 NEW ER dt E cdetnc nae 7 1 DP ii iaa 7 2 A A NA 7 8 POE o a A a a a 7 8 QUIE tl a rd ia e g 7 10 RevVertto SaVed iaa ia da lies 7 8 Index 4 VB A A A tata cede 7 5 SV AS I AA A A Gate Biter leet 7 5 Search Files ii ia 7 35 lA eree ten Mecereetsnendcedss cevect sos ceceed ton eestetereecacancuakdesfeecerdae duel 2 38 files Creating MEW 2ivessees Age A ae das is s 2 47 O O ee SE eet ti ee pe ee eee 4 2 finding a SEQUENCE cit Mbccdeyeeceueavdeens 3 23 7 65 FINGING COMMENTS 2 22 eceee cece eee e eee eee ne ee ee cece eee eee ee ee ee ee ee ee aaa seen seeeaeaaeeneeees 2 38 finding ORFS sica ie it tate Se AL 7 46 Format menu Chronography ci ida iio 7 30 CONOR mi di tn cata 7 22 DISPO Ida thet 7 58 Edit Construct Ed vex iii da deidad a 7 64 Edit Cut Site is ii diana 7 64 A spnee cdonperedeseunuss dea shacgade2 cwegaceunen dees Pode vad cp Oa aS 7 44 Fil eho Me See cca SR eT a Ae Se Ee 7 18 Find Seguen Sf A eat le ae 7 65 FOME veces aces seca oes deat esas ce eae ae Bw eave t 7 20 General IMO aii TA a tica 7
135. ed by choosing File gt Open and pressing the List button as shown in Figure 4 2 page 4 2 All of the list files supplied with GCK can is Open Ea Look in ry GCK Data y e ex Edy Name Date modified Type Size H_erizyiries_ 7 yer L all_enzymes_8 gcl S all_enzymes_with_comments gcl L commercial gcl commercial_5 gcl File name Icommercial_4 gcl Files of type List files gc z _ me Construct e List C All Files C Illustration Gel Figure 4 2 Opening a List File be found in the GCK Data folder If you create your own list files they should be placed in the GCK Data folder to become available from within the Mark Sites dialog Figure 4 1 If you obtain new files from Textco s web site they should also be placed directly into the GCK Data folder The GCK Data folder is a common place to store lists and codon tables If the files are not in this blessed folder they will not be available for use in the program although you will still be able to open and edit them The List Window An example of a List Window is shown in Figure 4 3 It is designed to store lists of sequences to be recognized in constructs Each entry in the list con tains a name a sequence comments about the entry and the position of the cut site within the sequence List windows can store lists of restriction enzyme sequences linkers and specific gene features such as poly A signals TATA boxes etc
136. ed page size Con struct gt Magnification gt ZoomIn Zoom Out will enlarge the current construct size or reduce the current construct size Only the Fitto Window option will allow the construct scale to be resized automatically when the window is resized since the construct will always be redrawn to fit the window size Editing Construct Ends and Redefining the Origin Linear constructs have ends which can be edited by placing the cursor at the Page 3 44 Construct Window Editing Construct Ends and Redefining the Origin end of the construct and then choosing Construct gt Edit ConstructEnd A dialog box for the right 3 end of a DNA fragment is shown in Figure 3 44 The ends Edit End e Edit construct end Cancel E oK Figure 3 44 Editing a Construct End of the DNA strands can be adjusted by dragging the arrowheads to the desired location Using this option one can create and then store linkers or adapters as short constructs having precisely defined ends These could then be used to paste into other constructs when appropriate Circular constructs do not have ends but it is possible to redefine the origin for these constructs by choosing Construct gt Redefine Origin This option will rotate the construct so that the current insertion point becomes the origin of the cir cular construct and is displayed at 12 o clock If you have a selected segment of DNA and choose Construct gt Redefine Origin the 5 e
137. ed to be the current generation is now one generation in the past and is called generation 1 Once the promoter and polycloning site are pasted into the current generation that was just created a construct with the appearance of that in Figure 3 33 page 3 35 will be created This shows a construct whose current generation includes the original pBR322 along with the two fragments just pasted in along with any comments associated with the fragments Choosing Format gt Chronography gt Show Previous Generation will reveal these frag ments as a thin gray line Figure 3 34 indicating that they were not present in the previous generation Chronography therefore can archive the steps taken in generating the construct and can be very useful especially since all comments can be searched rapidly If fragments pasted into a construct contain their own history that history will be pasted when the DNA is pasted and will appear when the previous gener ation is shown This was demonstrated in Tutorial 7 Chronography Track ing Cloning History page 2 30 It is possible likely that multiple generations will exist in some of the con structs you accumulate Given the possibility of displaying different segments Page 3 34 Construct Window Chronography Tracking Construct History pBR322 4497 bp Figure 3 33 New Fragment in pBR322 in different generations it might become difficult to keep track of which gen erations ar
138. eee 7 8 Choose GCK Data Folder 20 oases ranar eee 7 9 QUIT onc RSet A a bs 7 10 Edit MENU a sets asters ak Rend aS A Oh ae ae 7 11 UNO Liar RR ae es Pee aed he aA eee ee 7 11 GUE cts see rar rod 7 11 COPY ee Vee SEA behead deka ee bode ee 7 11 PASTO 2 cre esc RE A ds os eee 7 11 Clear ssc eee iio Meck ditties Wak dew Ba ei ee A ee 7 13 Special Paste t reas ve ti 7 14 SelEctAll at td del 7 14 Show Hide Clipboard s e soset aore ie iea eens 7 14 SNOW OVervi W essorer er niee n EER en AEREE a San dt 7 14 SNOW Selec ii E ee ee 7 15 Show Hide Page BreakS 0 00 ccc cece eee eee ees 7 15 Set Gel Construct Margins 0 cece ee 7 15 Window M nu islas dae o oleae chee ee 7 16 Stack WINdOWS o ccc cece ee eee teens 7 16 list Of open WINdOWS 6 0 0 eee eens 7 16 Format MENU ss bits ctl til ics do told 7 17 TABLE OF CONTENTS A O O 7 18 LINES cuarto ee ages Wes o to O ees 7 19 FON sida vs da Uo Sina bisa sn din yw isn 7 20 A nate th dale stare wate 7 21 SIZE 2h sie heed boa hee behead AAA 7 21 COO eee te Sie shee a o on Rte a e ed 7 22 S MbBO ica ost a e a ar cee 7 22 Sie Markers ii ia i 7 23 REBIONS ud teed A A A Dis SELES 7 27 OU e eda ae od 7 29 Chronography e coo a a a a ee 7 30 Preferentes su iio dan o a A Ra a 7 33 MOOIS MENU dimite a 7 35 DEANCHIPISS vss a E ta Ce A eG a dd 7 35 Deluxe IMpOrt coi as 7 35 Shotgun Cloning 0 cece eee 7 38 PCR ANAlySIS ui 7 40 Database Searching e
139. een updated in the center of the window 10 Choose Edit gt SelectAll to select the entire construct and then choose Format Page 2 34 Tutorials Chronography Tracking Cloning History 600 lt S Construct pBR322 EcoRI Hindill BamHI Prat PstI Sall 650 pBR322 5163 bp Sall 1450 Figure 2 36 Actin Fragment into pBR322 gt Chronography gt Show Previous Generation This will bring up Figure 2 37 What you Construct pBR322 gcc kodas EcoRI Hindili BamHI PstI 516311 Ml Figure 2 37 Actin Fragment into pBR322 Generation 1 see here is that the previous generation of the actin DNA was copied when the actin fragment was copied A generations of a fragment of DNA are cop Page 2 35 Tutorials Chronography Tracking Cloning History led when that fragment is copied This provides an easy way to keep track of where all the different pieces of DNA have come from when you assemble a construct of your own If comments are entered with each segment it is always possible to figure out the entire construct history by looking at different generations 11 Again choose Format gt Chronography gt Show Previous Generation again This brings up Figure 2 38 page 2 36 Notice here that the actin fragment is just 000 lt S Construct pBR322 pBR322 5163 bp 186 516311 v Figure 2 38 Actin Fragment into pBR322 Generation 1 a plain gray line because there was no generation specified
140. eful to make a change in the DNA sequence to allow the creation or removal of a restriction site In addition it sometimes happens that the site of the sequence change lies within a coding region In this case it is desirable to be able to create the sequence change at the DNA level without changing the protein sequence coded for by that stretch of DNA This type of mutation is called a silent mutation because it does not alter the encoded protein Tutorial 6 Cloning a DNA Segment and Silent Mutations page 2 23 provides a hands on illustra tion of removing a site through silent mutation GCK allows the creation of new restriction sites by silent mutation and also allows the removal of existing restriction sites through silent mutation Before a silent mutation can be created you need to select a protein region so that the program knows which reading frame is to be preserved If no protein region is selected the menu options will be disabled Choose Enzyme s x File commercial_no_isoschizomers gcl v List only those enzymes with V blunt ends V 5 overhang ends V 3 overhang ends Click OK to view sites that can be removed by silent mutation Cancel Figure 3 25 Removing Sites 1 Removing a Site Through Silent Mutation Choose Construct gt Features gt Remove Sites by Silent Mutation to start the process You will see Figure 3 25 This first dialog lets you choose which enzymes are to
141. ein search Open the HSP70 protein file and select the protein sequence which is the arrow below the construct do this by clicking on the arrow once If you view this as a sequence Construct gt Display gt Display Sequence you will see that it is a single letter representation of the HSP70 protein Now copy the selection and choose Tools gt Database Search Make sure that you check the checkbox that says Use current selection for DNA protein search and make sure that the text field at the top of the window is empty Now press the Search button to see the results Page 2 82 Tutorials Database Searching Note how you have the ability to use whatever you have selected in GCK to initiate the search This makes it very easy to find out more information about whatever sequence you might be examining This concludes the tutorials For more details about specific features plesae use the index to look elsewhere in the index Enjoy using GCK Page 2 83 Tutorials Database Searching Page 2 84 Construct Window Overview Chapter 3 Construct Window Overview The Construct window is the heart of Gene Construction Kit The Construct window presents a graphical view of a DNA sequence allowing for direct visu alization of sequence features and rapid manipulation of sequence segments 600 lt Construct construct 5 selected segment window type file name L site markers BB A z o i i regions of interest D
142. en in the program and a specific file on disk You can never have open more than one window for any given file on disk nor can you have more than one file for any given open window Import File gt Import command G ctrl G was discussed in some detail inlmporting Sequences Into GCK page 3 38 and in Tutorial 12 Importing and Exporting Sequences and Other Information page 2 60 The dialog box is shown in Figure 7 3 page 7 3 The Import button imports DNA sequences from dif gt Import Es Look in J DNAsto Import 7 e E ck Ee Name Date modified Type Size dna text tet DNA GenBank gbk DNA ibi bd DNA NBRF PIR bt DNA pearson txt File name DNA gbk Open Files of type GenBank files bd gbk x Cancel C DNA Inspector C Text GenBank GCG Wisconsin C Intelligenetics C EMBL SwissProt FASTA C Staden C NBRF PIR C Gene Inspector Figure 7 3 Importing Sequences ferent file formats into the Gene Construction Kit Importing from all formats Page 7 3 Menu Items except TEXT will preserve the comments associated with the original files Importing a TEXT format file will simply read the file one character at a time and place the legal DNA characters into a GCK construct sequence Charac ters read in from all formats except Staden will be filtered to allow only valid DNA characters see Legal Nucleotide Characters page 8 1 Any U s in the sequence will be converted to T
143. en view the comments by choosing Construct gt Get Info In operational terms these comment indicators behave very similarly to regions However comment indicators and regions can be shown and hidden separately regions do not have to have comments and regions can represent protein sequences Show Hide Generations As the name suggests this menu item will toggle the display of generation indicators on or off Generations are part of the chronography feature of GCK This is discussed in detail in Chronography Tracking Construct His tory page 3 32 and in Tutorial 7 Chronography Tracking Cloning History page 2 30 If you are viewing a construct that is displaying multiple genera tions you can view indicators of which segments are being shown in each generation Given the possibility of displaying different segments in different generations it might become difficult to keep track of which generations are being displayed To address this problem GCK allows you to indicate the display of different generations using the Construct gt Display gt Show Hide Genera tions When you are showing generations you will get an extra set of lines on the outside of the construct for all segments not being displayed in the current generation as shown in Figure 3 35 page 3 37 Those segments being dis played in the current generation will not have an indicator line next to them The adjacent fragments are being displayed in previous g
144. enerations and therefore are indicated as such by the gray indicator around the outside of the circle b Once any segment is selected it can be displayed in any generation by using the Chro nography menu In this way it is possible to display different segments in different gener ations Page 7 63 Menu Items Display Sequence Graphic Any construct can be viewed as either a graphic representation of the sequence or as an actual sequence listing The two views are actually differ ent ways of displaying the same information Construct gt Display gt Display Sequence and Construct gt Display gt Display Graphic shift command shift ctrl will toggle between the two different views of the construct Insert Ns A string of generic nucleotides Ns can be inserted into a construct at any time Choosing Construct gt Insert Ns command H ctrl H from the Construct menu will present the dialog box shown in Figure 7 47 This is useful even in empty 00 Cc Insert Ns Number of Ns to insert 200 Cancel E ok Figure 7 47 Insert Ns Construct windows to generate restriction maps and figures for constructs that have not yet been sequenced Used in conjunction with the Place Sites option Place Sites page 7 52 complete figures can be made even if your information consists of only the construct size and the locations of some restriction sites Insert Typing Construct gt Insert Typing is availa
145. ent to a shared root Root name for constructs test EA Figure 2 83 Shotgun cloning setup 2 Open the construct pBluescript SK and mark the Hindlll site by using Construct gt Features gt Mark Sites You should end up with a single site marked in the blue striped region of the DNA Page 2 78 Tutorials Shotgun Cloning 3 Click on the Hindlll site marker text in pBluescript SK to select it This also sets the cursor in the DNA to the cut site for Hindll 4 Choose Tools gt Shotgun Cloning We will be taking all of the lambda Hindlll fragments and cloning them into the Hindlll site of the pBluescript SK vec tor In this case our target site is already selected in the pBluescript SK vector and the source of the DNA is lambda as shown in Figure 2 83 Note that you can choose a different enzyme in which case GCK3 will find all of the sites for you You can choose a folder for the output as done here or you can ask GCK3 to create one for you by checking the checkbox next to Create a folder to contain the constructs You also need to provide a root name for the constructs in this case the constructs will be named test O test 1 test 2 etc Once your window looks like this figure press the Generate Constructs button 5 You will see a confirmation dialog Figure 2 84 telling you what is about oc Confirm Shotgun Cloning A construct will be generated for each possible fragment of a completely digested source that can l
146. enzyme names Cancel Eo gt Figure 2 47 Marking sites for orientation analysis represent an hsp70 fragment cloned into a vector in two different orientations We will differentiate between the two orientations by gel electrophoresis in this tutorial 2 Bring the construct 6 window to the front by clicking on it or by choosing it from the Window menu Make sure nothing is selected in the DNA by click ing once in the DNA you should see a blinking insertion point Choose Con struct gt Features gt Mark Sites command M Mac ctrl M Windows Find Bfal in the list on the left and double click on it to move it to the list on the right Page 2 45 Tutorials Running Gels and Orientation Analysis Now find Bs HKA and move it to the list on the right Your dialog should look like Figure 2 47 Press OK once you have set up the search gt Construct construct 7 gcc kodas BsiHKAI BsiHKAI ampicillin resistance construct 7 gcc 5177 bp BamHI BsiHKAI BsiHKAI OPPE R BamHl 3781379 El Figure 2 48 Bfal sites marked in construct 6 3 You will see a number of sites marked in construct 6 Click someplace in the window background to deselect the sites that were just marked Double click on one of the Bfal sites Double clicking a site name will select all other sites having the same name Your window should look like Figure 2 48 800 New GCK Document Document Type Gel B New fil
147. equence and its associated marked sites and regions It is useful in helping you visualize the information more consistently and can clearly indi cate which amino acid sequence is related to which line of DNA sequence Frames are discussed in Tutorial 5 Modifying the Construct Appearance page 2 20 Frames provide a way to enclose part of a sequence display to Sacl 613 GGC CAG TGA ATT GTA ATA CGA CTC ACT ATA GGG CGA ATT GGA GCT 6844 2 Leu Ser Ase Tyr Tyr Ser Glu Ser Tyr Pro Ser Ase Ser Ser Sacll Eagl BstxIDsal Not 658 CCA CCG CGG TGG CGG CCG S34 Trp Arg Pro Pro Pro Arg Glu Leu Vel Leu Pro Asp Giy Pro Ser Figure 3 17 A Framed Segment highlight a specific feature A Framed segment is shown in Figure 3 17 page 3 20 To create a frame around a sequence first select the sequence you wish to frame and then choose Construct gt Features gt Make Frame A new frame will appear and will be selected as shown in Figure 2 19 page 2 20 When a frame is selected you can alter its appearance by choosing various items under the Format menu A frame can be made to include the DNA sequence marked sites and regions or any combination of these items by choosing Con struct gt Features gt Set Frame Contents see Figure 2 20 page 2 21 Page 3 20 Construct Window Inserting New Nucleotides by Typing Once a frame has been deselected you might need to select it again to mod ify its properties Just dragging the mouse in the DNA will sele
148. eration 0 Comments pair_explain considered 6 ok 6 leftiexplai pair_penal ty 1 643400 lef t_penal ty 1 401339 right_penal ty 0 242081 left_tm 58 598999 right_tm 59 757999 left_gc_percent 40 000000 right_gc percent 50 000000 left_self_any 3 0009009 right_self_any 3 000999 left_self_end 3 000090 right_self_end 0 000908 left_end_stabi Li ty 7 000009 right_end_stabi Li ty 6 400000 pair_comp l_any 3 000000 considered 535 low tm 276 high tm 59 ok 200 right_explain considered 1285 GC content failed 17 low tm 826 high tm 83 ok 359 CO Figure 2 82 Primer information Page 2 77 Tutorials Shotgun Cloning TUTORIAL 17 SHOTGUN CLONING There is often a need to fragment a piece of DNA with a restriction enzyme and then place each of those fragments into a vector This process called shotgun cloning can be conducted automatically for you by GCK3 1 Open the file lambda gcc and note that the Hindlll and EcoRI sites are already marked Shotgun Cloning Target Source Digest Output Bluescript KS gce 296411 y The source sequence will be digested using the enzymes IV Use target enzyme Select Enzymes he generated constructs will be saved in the location Co Users Administrator Desktop Select Location M Create a folder to contain the constructs Folder Name shotgun Names will be issued to the constructs by appending the index of the digest fragm
149. erns as detailed in Tutorial 9 Running Gels and Orientation Analy sis page 2 45 This demonstrates how easy it is to replace DNAs and to generate constructs with inserts in either orientation 16 Before ending this tutorial let s see how GCK behaves if you try to paste the BamH fragment into a site other than a BamH site The fragment is still on the clipboard so all you need to do is define a different insertion point in the construct to be the target for the pasting operation To do this click on any symbol in the construct to select that site 17 With the insertion point in the DNA at the selected site choose Edit gt Paste command V Mac ctrl V Windows This will bring up a ligation dialog as shown in Figure 2 28 Because the fragment ends are incompatible the Ligate Ends OD Ligate left ends AGCTCCTTCGGTCCTCCGAT TCGAGGAAGCCAGGAGGC YA ate GATCCTC TACGCCGGACGCA FASGAGATGCGGCCTGCGT ats O LO r Cancel Figure 2 28 Ligation Dialog selected site in construct BamH in clipboard GCK will not let you paste the fragments together ligate them The sequences shown in this dialog repre sent the junction shown in the top left corner in this case the left DNA sequence is the result of the se ected cut in the vector and the right DNA segment is the result of the BamH cut fragment in the clipboard The arrows indicate the actual cut sites and illustrate the staggered ends Note that the
150. es folder to see a real example of this You will learn about Illustrations in Tutorial 10 Making Illustrations page 2 50 16 This concludes this lengthy tutorial Thanks for sticking with it Close all the open files now but do not save any changes h Remember that this file is a Gel file so you need to press the Gel button in the open dialog in order to be able to select the file to open it See Figure 2 1 page 2 2 i Remember that this file is an Illustration file so you need to press the Illustration button in the open dialog in order to be able to select the file to open it See Figure 2 1 page 2 2 Page 2 49 Tutorials Making Illustrations TUTORIAL 10 MAKING ILLUSTRATIONS In the previous tutorials you worked with one file type at a time either a Construct window or a Gel window However when you are designing a clon ing strategy it is often desirable to include many different constructs and gels in the same document along with descriptive text This is the function of the Illustration window More details about the specific functions of the Illustration window can be found in Chapter 6 The Illustration Window This tutorial is designed to give you a general idea of what the Illustration window can be used for 1 Start GCK and open the file construct 5 which is in the tutorial files folder This is the vector we will use in our cloning project 2 Click in the construct and choose Edit gt Select A
151. etting the reduction scale to 1 0 The Illustration window will be drawn at full size Full Reduction Illustration gt Reduction gt Full Reduction is sometimes called Reduce to Fit in other applications It will reduce the size of the Illustration window to fit entirely on your monitor It provides a complete overview of the layout of your window Page 7 74 Menu Items Send To Back Bring To Front Illustration gt Send To Back command ctrl and Illustration gt Bring To Front command ctrl allow the manipulation of objects on the screen as shown in Figure 7 56 On the left the ellipse is selected and is in front of the rectangle Figure 7 56 Front Back Stacking of Objects Choosing Send To Back will move the ellipse to the back of the picture in this case behind the rectangle as shown on the right Any object that can be selected in the Illustration window can be manipulated with these two com mands Align Selection When one or more objects is selected in the Illustration window they can be aligned by choosing Illustration gt Align Selection which will bring up Figure 7 57 page 7 76 Separate control is provided for horizontal and vertical align ments By clicking on one of the radio buttons the triangle circle and square sample objects will align In the figure the Left horizontal alignment button was chosen so the left edges of all the objects are forced to align to the left most posit
152. every other site marker except the BamHI site Page 2 22 Tutorials Cloning a DNA Segment and Silent Mutations TUTORIAL 6 CLONING A DNA SEGMENT AND SILENT MUTATIONS Our goal in this tutorial will be to take the construct we have been working with in previous tutorials and use it to receive a new segment of DNA In doing this you will learn about copying and pasting segments of DNA and how to keep track of the history of your construct 1 Start GCK and open the file construct 5 that you saved in the previous tutorial If you do not have this file you can start with construct 5 from the tutorials folder provided 2 Open the file called hsp70 from the tutorials folder This file contains the genef we will be using as the source of the fragment being cloned Notice that there is a single region indicating the open reading frame We will be cloning a segment containing this region into the BamH site on construct 5 3 The first thing to do is mark the BamH sites in hsp70 Make sure that the window with hsp70 is in front and then choose Construct gt Features gt Mark Sites or press command M Mac ctrl M Windows Select BamH in the left hand list and press the Add gt button to add this enzyme to the Enzymes to mark list on the right see Figure 2 8 page 2 8 Select to display new sites as enzyme names Press OK to mark the sites You will see Figure 2 22 4 To cut out the segment we are interested in we need to address the pr
153. ew colors that you add can be defined using the color picker or by selecting the desired color from a visible window Color can apply to text construct segments marked sites regions and symbols in the Construct Window and to text lines arrows rectangles round rectangles and ellipses in the Illustration window By assigning meaningful names to colors when you create them and add them to the menu e g transcript or coding it is easy to maintain consistency among all constructs and illustrations Symbol Format gt Symbol submenu will display the graphical submenu shown in Figure 7 13 page 7 23 Selecting a symbol will change the currently selected marked site s in the Construct window to the selected symbol from this sub menu Note that symbols may be chosen even if the site is being displayed by name Be careful when changing symbols however because when you double click on a symbol in the Construct window all the sites showing that same symbol will be selected even if they represent different enzymes Similarly when double clicking on a site that is displayed by name all sites with that name will be selected Page 7 22 Menu Items x E oO E o o x amp amp Oo E O 9 gt A X B Q Omg oo A A ar og lea ens Figure 7 13 Symbol Menu Site Markers The Format gt Site Markers submenu provides access to specifying characteristics of how the site markers will be displayed In general a
154. ext in the left lt gt right horizontal direction Choosing Format gt Site Markers gt Attach at Left forces the line to connect to the left edge of the site marker text Choosing Format gt Site Markers gt Attach at Cen ter forces the line to connect to the horizontal center of the site marker text Choosing Format gt Site Markers gt Attach at Right forces the line to connect to the right edge of the site marker text Choosing Format gt Site Markers gt At Nearest Hori zontal allows GCK to choose the best location for the attachment for you This automatic attachment allows you to move the site marker around and still have the line connected to the marker text at an aesthetically pleasing loca tion Page 7 26 Menu Items Attach at Top Attach at Middle Attach at Bottom At Nearest Vertical These four items define how the line extending from the construct to the site marker will attach to the site marker text in the top lt gt bottom vertical direction Choosing Format gt Site Markers gt Attach at Top forces the line to connect to the top edge of the site marker text Choosing Format gt Site Markers gt Attach at Mid dle forces the line to connect to the vertical center of the site marker text Choosing Format gt Site Markers gt Attach at Bottom forces the line to connect to the bottom edge of the site marker text Choosing Format gt Site Markers gt At Nearest Ver tical allows GCK to choose the best lo
155. f formats see Appendix Import File For mats page 8 2 As shown in Figure 3 39 page 3 39 when you select this Page 3 39 Construct Window Importing Sequences Into GCK option you will be presented with the standard file selection dialog box that contains radio buttons for several different types of files Use the mouse to define the type of file you want to import in Figure 3 39 Text format is selected and then select the file from the scrollable list shown in the win dow When the Import button is pressed the file will be read in using the assumption that it is in the specified format If it is in another format results will be unpredictable as to the actual sequence read in All files except Sta den format files that are read in by this method will be checked for invalid characters as they are entered into the Gene Construction Kit and all Us will be converted to Ts All files to import except DNA Inspector and Gene Inspector files are stored on disk as TEXT ASCII files The only difference in the files is the precise way in which the sequence and comment information are organized within the file see Appendix Import File Formats page 8 2 Files of type TEXT extension of txt on Windows can be created by many programs including most word processors using an Export or Save As option so you should be careful to ensure that the file you are reading is really in the format you have chosen Any c
156. files to start with a comment Gene Inspector Gene Inspector is Textco BioSoftware s sequence analysis and molecular biologist s notebook program GCK can directly import any one GI sequence into a construct window If the GI file contains more than one sequence you Page 8 3 Appendix Comment Export Format can select the sequence you are interested in Only one sequence can be imported at a time Comment Export Format lt General gt gt Name constructName gt Date date gt General Info All General Info goes here until next marked line put NONE if no comments lt Generations gt gt Generation Int gt Name generationName Comments for above generation go here until next marked line lt Sites gt gt Name siteName gt Position longInt Comments for above site go here until next marked line gt Name siteName gt Position longInt Comments for above site go here until next marked line lt Segments gt gt Name segmentName gt Direction or gt or lt or lt gt gt Range longInt to longInt Comments for above segment go here until next marked line gt Name segmentName gt Direction or gt or lt or lt gt gt Range longInt to longInt Comments for above segment go here until next marked line Page 8 4 Appendix GCK Acknowledgements lt Regions of Interest gt gt Name regionName gt Direction or gt or lt or lt gt gt Range longInt to l
157. for the actin DNA that far into the past Click once in the DNA at the beginning of the actin fragment to deselect the entire construct 12 Choose Construct gt Display gt Display Sequence to view the construct as a sequence in generation 2 Notice how the gray from the actin fragment is also used to display the sequence itself You can use different generations to keep different sequence appearances just as you can keep different graphic appearances 13 You may find that in some complex construction projects you might accumulate a large number of generations and it might be difficult to navigate from one generation to the next by only one generation at a time In GCK you can jump to any generation by using the Format gt Chronography gt submenu Page 2 36 Tutorials Chronography Tracking Cloning History There will be a list of all generations at the bottom of this menu Select the Regions of Interest generation to go to that generation 14 Explore the different formats for this generation Change back to the graphical view now Construct gt Display gt Display Graphics Try selecting a segment and then changing the generation for that segment Note how it is possible to show different generations for different segments at the same time This pro vides a great deal of flexibility for displaying sequences and graphics in exactly the way you want This concludes the tutorial You will not need the construct you have just made so
158. format for long sequence listings Having the sequence displayed in groups of 10 makes it easy for the eye to follow sequence positions Insert Line Break Remove Line Breaks Format gt Grouping gt Insert Line Break will force the character immediately after the insertion point to begin a new line If you have selected a segment of the sequence and then choose Insert Line Break GCK will place the selected sequence in its own formatting segment This means that the selection will start on a new line and the end of the selection will be the end of a line the next formatting segment will start a new line Format gt Grouping gt Remove Line Breaks will remove line breaks from the selected segment of DNA If no seg Page 7 29 Menu Items ment is selected then all line breaks will be removed The Grouping submenu should be used in conjunction with the Display submenu of the Construct menu to precisely define the layout of the sequence Chronography The Format gt Chronography submenu provides you with access to GCK s lt gt New Generation E Generation Name Generation Comments Keep displayed segments Keep displayed regions Keep displayed site markers Cancel Figure 7 18 New Generation Dialog archiving feature that can track all the steps in the synthesis of a construct and present alternative views of the information in the construct The uses of Chronography were covered earlier
159. from Textco s web site lt http www textco com gt The lists are updated quarterly Page 3 15 Construct Window Listing Sites List Sites File alllenzymes B List only those enzymes with M blunt ends Y 5 overhang ends v 3 overhang ends BspVI a Add gt y Enzymes to list Bsri Add All gt List enzymes for which __ more than pp sites are found mM less than 2 sites are found List enzymes whose sites Are found in the selected sequence Cancel occur exclusively within the selection Occur exclusively outside of the selection ES Figure 3 14 List Sites Dialog boxes to see all of the sites If you do not check any of the boxes not sites will be shown e Clicking on an enzyme in the left list and then pressing the Add gt button will move that enzyme to Enzymes to list on the right All enzymes in the right list will be used to search the targeted DNA for corresponding sites The Add All gt button will add all of the enzymes in the left list to the right list If an enzyme is selected in the right list pressing the Remove button will remove that item from Enzymes to list The enzyme will still remain in the restriction enzyme file for use in other digests this item just removes it from the list of sites to search for e The List enzymes for which cluster allows you to specify a range of cut ting frequencies for which you would like to see sites actually listed
160. g File gt Export will give you the window shown in Figure 3 41 page 3 42 The Export es Save in ad Tutorial Files ex Edy Name Date modified Type Size No items match your search File name pBR322 jpg Save Save as type JPEG files jpo y Cancel C Construct C DNA Sequence as TEXT File C PICT File e JPEG File C GCG File C Comments as TEXT File Figure 3 41 Export Graphics Construct default condition that which appears when the dialog box first opens up is to save as a Construct This is the normal GCK format Choosing PICT will save the image of the construct in the currently active window as a Macintosh PICT file PICT files can be read by most Macintosh and Windows applica tions that deal with graphics If you want to work with the image in a Win dows program that does not open PICT files you can export the construct image as a JPEG This option will allow you to edit the construct graphics using sophisticated graphics programs for special effects Note that the PICT file will contain the image of the construct but will not contain any sequence information Selecting DNA Sequence as TEXT File will create a TEXT file txt on Windows containing the sequence of the construct This file can be opened by any text processor The TEXT file format is also called an ASCII file for mat and can be transferred to any other computer operating system that can deal with ASCII files including most mainframe compu
161. g Construct Ends and Redefining the Origin 3 44 List Window Opening List Files 2 00 sets cated beth es ev dete a beck Sb eck Pee Ys 4 2 TAE EISTWIRGOW o Soren a hie as Bind oe hanged ia 4 2 New List Entries 22 2434 did stl tha bid ibi sli 4 3 Defining a Cut Site 22 eee 4 4 Creating New ListS amirat a i ee ee teens 4 5 Alphabetical EIStS presde ret ee tigre Cope a ee 4 5 Exporting LISTS 2252 is OE aa Ss Ro i een eeu 4 6 Gel Window Viewing a Fragment Size Table 000 cee eee eee Creating and Rearranging Gel Lanes 0 cc cece een eee Partial Digests lt a Be es Exporting GEIS ico ia ad a ts Seu ed ee Met es The Illustration Window page 2 TABLE OF CONTENTS Selection vs Targeting 0 0 0 ccc ee eens 6 1 Using the Illustration WindoW 0 0 0 eee es 6 2 Tracking Complex Construction Projects ooooooomommoo o 6 5 Changing Magnification 000 cece eens 6 7 Exporting Illustrations 0 0 00 cee ee 6 8 Menu Items lle MGM Usa ne tear en nor steed rn caste Ser ope He 7 1 INGW dee dss Sut Pd peel a A a 7 1 O 7 2 IMPORTS tras o a aa li 73 CIOSE cti aa ais So itd A 7 4 SP AS 7 5 Saver AS iii ke Seah ea eal eal aie ee Sa ee ee 7 5 EXPONE doce A aeaii 7 6 Revert to Saved ose cio atico eve dee vee Davee di eee eee 7 8 Set PHNtUOPUONS ss ir A st Wee tales 7 8 Page SetUP iis os he Pelee Pea eee Pewee Pe ee De Ne 7 8 Pr bites reanna secu E To ciate oe
162. gt O EcoRI OE A Remove coRY e A Hindili middle BamHI construct 5 site by creating Acel 2964 bp O ilent Hincll a silen O Eco01091 mutation Apal a Kpnl BamHI BamHI _ _ gt E hsp70 Bam 5066 bp Figure 2 57 Illustration 5 18 There are many more steps to complete this project but you should get the flavor of the Illustration window by this time You can open the file clon ing project in the tutorial files folder to see what the final illustration might look like Feel free to explore the completed illustration to learn some other tricks Notice also that you can copy the gel lanes and paste them into the Illustration window to complement the other information in that window The Sample Files folder also contains some interesting examples This concludes this tutorial Close all the open windows but please don t save changes to any of the tutorial files provided with the program so that others can do the tutorials in the future Page 2 55 Tutorials Working With Generic Constructs TUTORIAL 11 WORKING WITH GENERIC CON STRUCTS There are times especially when you are just beginning to work with a piece of DNA when you might know the restriction map of a cloned fragment of DNA but you might not yet know the sequence Such generic constructs can be created in GCK and the segments manipulated just like any piece of DNA whose sequence is known 1 Start GCK You should see an untitled Construct win
163. gure 3 9 Mark Sites Dialog box you can mark sites in the construct using enzymes from many different lists and define your own parameters of the kinds and numbers of sites to actually be marked Here are the options in this dialog e The popup menu at the top of the dialog allows you to specify which enzymes will be displayed in the left side list in this dialog The enzyme lists that are in the GCK data folder are the only ones that will show up in the popup menu e The Mark only those enzymes with cluster contains three check boxes that allow you to show any combination of blunt ends 5 over hang ends and or 3 overhang ends Check all three of these b Note that you can always download the most recent lists from Textco s web site lt http www textco com gt The lists are updated quarterly Page 3 10 Construct Window Marking Sites boxes to see all of the sites If you do not check any of the boxes no sites will be shown e Clicking on an enzyme in the left list and then pressing the Add gt button will move that enzyme to the Enzymes to mark list on the right All enzymes in the right list will be used to search the targeted DNA for cor responding sites The Add All gt button will add all of the enzymes in the left list to the right list of enzymes to mark If an enzyme is selected in the right list pressing the Remove button will remove that item from the Enzymes to mark list the enzyme will s
164. h predefined line thicknesses predefined directions Size Arrowhead The Format gt Lines submenu provides control over the attributes of lines and arrows which are a special kind of line As shown in Figure 7 10 there are several parts to the Lines submenu This submenu is available when a line is selected in the Illustration window or a segment or region is selected in the Construct window Clicking on one of the predefined line thicknesses will change the selected line to the thickness of the line you clicked on You can specify a line size not present in the submenu by choosing Format gt Lines gt Pick a Width Clicking on the bottom part of the submenu will allow you to place arrowheads at one or both ends of the selected line Choosing a direction to the line that represents a translated region in a construct will specify the cod Page 7 19 Menu Items ing direction for protein sequences left to right or clockwise displays the protein coded for on the 5 to 3 top strand while right to left counterclock wise shows the protein coded for on the 3 to 5 bottom strand The size and shape of the arrowhead can be adjusted by choosing the Format gt Lines gt Size Arrowhead option This will present Figure 7 11 The arrowhead can be Set Arrow Size x Figure 7 11 Size Arrowhead altered by either dragging a corner of the arrowhead to the desired location or by clicking th
165. h to type in your own thickness Using the Format menu you can change the appearance of the selected object For now do not change anything else but feel free to explore the Format menu on your own when you finish this tutorial 6 This vector has T3 and T7 promoters and a polycloning site that we want to indicate The promoters are shown in green and the polycloning site is a striped blue Let s add directionality to the promoters Before you can add arrowheads to any segment of DNA it must first be selected The promoter segments are rather small and might be difficult to select at this magnification So click the mouse on one of the green segments between the blue and red segments to place the insertion point near what we are interested in and then choose Construct gt Magnification gt ZoomIn to enlarge the view of the con Page 2 4 Tutorials Working with Constructs struct ZoomIn again and then select the top green segment by double click ing You will see Figure 2 4 page 2 5 Nucleotides 626 645 will be lt Construct Bluescript KS gcc kodas Figure 2 4 Magnified View selected 7 Choose Construct gt Get Info to see the name of the segment and any com ments associated with that segment This is the T7 promoter as shown in Figure 2 5 Every segment of DNA can have a name and comments associ Segment Info Name T7 promoter First Pos 626 Last Pos 645 Generation 0 Comments In clockwise direction
166. he Illustration window SelectAll will select all the objects in the Illustration Show Hide Clipboard Edit gt Show Hide Clipboard will either show or hide a window showing the contents of the clipboard If you are having problems transferring information into or out of GCK from to other applications examining the clipboard contents can often help sort out where the problem lies Show Overview Edit gt Show Overview is active from the Construct and Illustration windows and will shrink the entire window to fit on the screen The cursor changes to a small magnifying glass Clicking the magnifying glass at a specific location in the overview window will cause the image to return to normal size and will center the image around the site that was clicked This action facilitates moving Page 7 14 Menu Items around large illustrations Show Selection Edit gt Show Selection is active in every window except the List window It will make visible any object that is selected This might be useful if you have highlighted a sequence in the sequence view of a construct but have scrolled to some other location of the sequence Choosing Show Selection will make the selected sequence visible Show Hide Page Breaks Edit gt Show Hide Page Breaks is functional in all windows It will show a line on the screen indicating the edges of a page It is particularly useful in the Construct and Illustration windows Page breaks are automatica
167. he current location of the cursor Some special situations pertain to cutting copying and pasting objects in the Gene Construction Kit To begin with it must be kept in mind that when a segment of a construct is selected it represents a double strand of DNA Depending on how the seg ment was selected and how the ends of the segment are defined this seg Page 7 11 Menu Items ment might have blunt ends or staggered ends Double clicking on a segment in either the graphical view or the sequence view will select the segment between the two nearest borders If no sites are marked the entire sequence will be selected between style changes In the sequence view dou ble clicking will select a segment of DNA between two marked sites unless there is a change in font color style size etc In these cases the selection will stop at the change This feature allows you to define and display seg ments of DNA in the sequence view such as a conserved sequence that you might not wish to have visible in the graphical view This facilitates creating informative illustrations of sequence features for presentation while also main taining the graphical view of the construct You can have a different formatted sequence listing for each generation of the construct There is one situation that has to be dealt with specially It arises from the enzyme 1 enzyme 2 ACGGTGCAG C TGCCACGTCTTAG Figure 7 8 Overlapping Enzyme Sites situation sho
168. he enzyme if you alter the cut site Find Sequence Construct gt Find Sequence command F ctrl F was discussed in detail in Finding a Sequence page 3 23 Using the standard letters for DNA see Legal Nucleotide Characters page 8 1 GCK will search through the construct and Page 7 65 Menu Items highlight any match with the search sequence The search starts from the current location of the cursor and continues clockwise for circular DNAs or in the 5 gt 3 direction for linear DNAs Once the end of a linear DNA is reached the searching will stop Searching can continue around a circular construct Set Beginning Position Redefine Origin In the graphical view of a construct either Construct gt Redefine Origin or Construct gt Set Beginning Position command 1 ctrl 1 will be available depending on whether you are working with a circular or linear construct For circular constructs Redefine Origin will rearrange the construct so that the current position of the insertion point will become the new origin for the construct This will rotate the construct on the screen to bring the origin to the top of the construct For lin ear constructs Set Beginning Position will allow you to define a different number for the starting nucleotide in the sequence using the dialog shown in Figure 7 50 This would be useful for example if the DNA you are working with Se Beginning Position Es Indicate start
169. ich contains an origin of replication is in the segment from 3 458 What we would like to do now is indicate the location of this particular segment of DNA but how do we define the locations in our graphical construct which Page 2 15 Tutorials Viewing the Construct as a Sequence does not have any markers at those locations The answer is to view the construct as a sequence rather than graphically Close the General Info win dow and then choose Construct gt Display gt Display Sequence This will bring up Fig ure 2 15 If your display does not look like this figure then scroll the 6008 lt Construct construct 2 GGARATTGTARACGTTAATATTTTGTTARAATTCGCGTTAAATTTTTGTTAAATCAGCTCATTTTT 4 TAACCAARTAGGCCGARATCGGCARAATCCCT TATARATCARARGAATAGACCGAGATAGGGTTGAG TGTTGTTCCAGTTTGGARCARGAGTCCACTAT TARAGAACGTGGACTCCARCGTCARAGGGCGARA AACCGTCTATCAGGGCGATGGCCCACTACGTGARCCATCACCCTAATCAAGTTTTTTGGGGTCGAG 4AspLeuLysLysProAspLeu GTGCCGTAAAGCACTAAATCGGARCCCTARAGGGAGCCCCCGATTTAGAGCT TGACGGGGARAGCC 4Hi sArgLeuA LaSerPheArgPheG lyLeuProLeu6 LyArgAsnLeuA lab LnArgProPheG ly GGCGAACGTGGCGAGARAGGARAGGGAAGARAGCGAAAGGAGCGGGCGCTAGGGCGCTGGCAAGTGT 4A LaPheThrA LaLeuPheSerProPhePheA LaPheProA LaProA LaLeuA LaSerA lLaLeuThr AGCGGTCACGCTGCGCGTAACCACCACACCCGCCGCGCTTAATGCGCCGCTACAGGGCGCGTCGCG 4AlaThrY alSerArgThrVa LValValG LyAlaA laSerLeuA lab LySerCysProf LaAspArg CCATTCGCCATTCAGGCTGCGCARCTGT TGGGAAGGGCGATCGGTGCGGGCCTCTTCGCTATTACG 4TrpG LuG LuAsnLeuSerArgLeuG LnG LnSerProArgAsp
170. ich is the fetal G gamma globin from Chimpanzee You could also open this file in any text editor to see what it contains You will see Figure 2 73 For more details on Deluxe Importing see G gamma globin gbk kodas Entries Features series Figure 2 73 Deluxe importing of G gamma globin Tutorial 13 Importing GenBank Sequence Files Using Deluxe Importing page 2 64 and Deluxe Import page 7 35 2 The middle section of this window contains a list of features in this DNA Exons introns and CDS coding sequences are of interest to us in this tuto rial Clicking on a feature will provide more information about that feature in the right hand text box Try exploring to see what is in this file Click on the CDS feature and note that the first line starts with join and then lists three pairs of numbers 108 199 322 544 and 1438 1566 This means that the coding sequence is comprised of nucleotides from 108 199 and 322 544 and 1438 1566 Note also that the exons also have ranges of nucleotides associ ated with them Click the button Convert To GCK 3 You will see the dialog window shown in Figure 2 74 This shows how each GenBank feature is converted into a GCK feature You want to have all Page 2 70 Tutorials Translating Across Introns Use Name ty Format La A 18 m ore orate 178 z anster Prefs Save Construct Figure 2 74 G Gamma globin features of the exon
171. igate into the target Number of constructs that will be generated 5 Cancel ex Figure 2 84 Shotgun cloning confirmation dialog to happen This dialog is provided so that if you accidentally are about to generate hundreds of constructs you will not be surprised by all of the files generated in this process Press the OK button 6 There are now 5 new constructs in the folder you designated each con taining a particular fragment of lambda DNA inserted into the Hindlll site of the vector The first such construct is shown in Figure 2 85 Notice that the inserted segment is already highlighted for you Page 2 79 Tutorials Shotgun Cloning test O 4991 bp Figure 2 85 A shotgunned construct Page 2 80 Tutorials Database Searching TUTORIAL 18 DATABASE SEARCHING 1 GCK facilitates your ability to search multiple web sites for matches with DNA sequences protein sequences or key words through its database searching tool To access the DB search choose Tools gt Database Search GCK will check with the database server that Textco BioSoftware has set up and will then show you a list of available databases that can be searched Figure 2 86 Database Search Lo J 3a Search for insulin Search Search type Keyword Search EN Use current selection for DNA Protein search Databases to search Database description lv GO a Select an item in database list to view description MV KEGG M EntrezGene
172. igure 2 29 All the chronography features are accessible in the Format gt Chronography submenu Each different view of the construct is referred to as a different generation Notice that at the bottom of the Chronography menu are three different named generations restrictions sites regions ofinterest and DNA sources These are the three different generations present in the pBR322 con struct The generation currently being shown is checked in the menu Choose Format gt Chronography gt Show Previous Generation This will bring up Figure 2 31 page 2 32 which is one generation in the past and is referred to as genera tion 1 the most recent generation is referred to as generation tO In this generation the coding regions are shown along with an origin of replication 4 Choose Construct gt Display gt Display Sequence You will see Figure 2 33 Note that the sequence is now grouped in threes and the translation of the tetracy cline resistance gene is shown This is not a different sequence it is just being displayed differently 5 Choose Construct gt Display gt Display Graphics and then choose Format gt Chronog Page 2 31 Tutorials Chronography Tracking Cloning History lt Construct pBR322 gcc Figure 2 31 pBR322 Generation 1 raphy gt Show Previous Generation again to see the most ancient generation for this construct This is Figure 2 32 page 2 32 This generation shows the three Construct pBR322 gcc o e
173. ill automatically become available when needed elsewhere in GCK e g see Find Open Reading Frames page 7 46 The new tables will be created in the GCK Data folder Choose Codon Table When GCK translates a DNA sequence or is asked to find ORFs Find Open Reading Frames page 7 46 it uses a codon table to do the trans lations The codon table to be used as the standard table can be set here A Set Codon Table Select a Codon Table Comments Homo sapiens human Escherichia coli Nicotiana tabacum chloro Zea mays chloroplast Homo sapiens1952 genes gt gt found in GenBank 63 l Produced by J Michael Cherry with the GCG program CodonFrequency Duplicates pseudogenes mutant and v Cancel o Figure 7 30 Selecting a Codon Table dialog like the one shown in Figure 7 30 will be shown To choose a default codon table select the table in the left list and press OK Pressing Cancel will close the dialog without changing your previous choice of default table Some of the supplied tables have comments associated with them If you decide to add your own table they can have comments as well Make Region Construct gt Features gt Make Region command R ctrl R will create a region corre sponding to the selected segment of the construct or sequence If no DNA segment is selected you will have to type in the end points of the region in the dialog box shown in Figure 7 31
174. in and galactosidase and not tetracycliine Figure 2 44 Searching Files 2 complex We are looking for files that contain ampicillin AND galactosidase but do NOT contain tetracycline You can try different combinations of the and or and contains doesn t contain popup menus these are some times referred to as Boolean operators to see how they work by looking at the search query box at the bottom of the window Set the query to match the figure and then press Search 9 You will see another list similar to the one shown in Figure 2 43 page 2 41 But what if someone did not enter all the comments that should have been entered or what if the files were simply imported sequences that had not been annotated contained no comments If comments were in fact incomplete the search results would not be that meaningful especially if you are looking for the absence of certain text items like tetracycline To address this issue GCK allows you to search using DNA sequence information Page 2 42 Tutorials Finding Comments and File Searching instead of comments Choose File gt Search Files again Now select the radio er File Search Criteria Search GCK constructs for text in feature names and comments or for DNA sequence that match the following criteria DNA J contains M CAACATTTCCGTOTC and 3 contains GCGGATAACAATTTC Add Remove Remove All Scan the directory Users bo
175. inate modify distribute sub license sell rent lease lend give or in any other way transfer by any means or in any medium including telecommunications the Software Licensee will use its best efforts and take all reasonable steps to protect the Software from unauthorized use copying or dissemination and will maintain all proprietary notices intact LIMITED WARRANTY Textco Biosoftware warrants the Software media to be free of defects in workmanship for a period of ninety 90 days from purchase During this period Textco Biosoft ware will replace at no cost any such media returned to Textco Biosoftware postage prepaid This service is Textco Biosoftware s sole liability under this warranty DISCLAIMER LICENSE FEES FOR THE SOFTWARE DO NOT INCLUDE ANY CONSIDER ATION FOR ASSUMPTION OF RISK BY TEXTCO BIOSOFTWARE AND TEXTCO BIO SOFTWARE DISCLAIMS ANY AND ALL LIABILITY FOR INCIDENTAL OR CONSEQUENTIAL DAMAGES ARISING OUT OF THE USE OR OPERATION OR INABIL ITY TO USE THE SOFTWARE OR ARISING FROM THE NEGLIGENCE OF TEXTCO BIO SOFTWARE OR ITS EMPLOYEES OFFICERS DIRECTORS CONSULTANTS OR DEALERS EVEN IF ANY OF THESE PARTIES HAVE BEEN ADVISED OF THE POSSIBIL ITY OF SUCH DAMAGES FURTHERMORE LICENSEE INDEMNIFIES AND AGREES TO HOLD TEXTCO BIOSOFTWARE HARMLESS FROM SUCH CLAIMS THE ENTIRE RISK AS TO THE RESULTS AND PERFORMANCE OF THE SOFTWARE IS ASSUMED BY THE LICENSEE THE WARRANTIES EXPRESSED IN THIS LICENSE ARE THE ONLY WAR RANTIES MADE BY
176. information about the selected enzyme in a non editable window Pressing Locate will present you with the subdialog box shown in Figure 7 39 The enzyme Ac was selected in this case and Locate Instances E Name instances ait 111 Sequence Figure 7 39 Defining Place Sites Locations as the figure shows the recognition sequence for Aci CCGC will be placed starting at nucleotides 100 and 485 The second location at 485 has been typed into the Starting at position box Pressing the Add button will add 485 to the Instances list at the right of the window To remove an item from the Instances list select the item and then press the Remove button After all locations have been defined for this enzyme press the Done button to return to the main dialog Figure 7 38 page 7 52 where the locations for placing sites for other enzymes can be defined Note that Place Sites actually changes the sequence of nucleotides in the con struct The construct sequence at the specified location s is replaced by the sequences representing the enzyme recognition sequences chosen Any nucleotides in the construct not just Ns will be replaced Be sure that this is what you want to do because it is not undoable Place Site Indicators At Construct gt Features gt Place site indicators at can be used to specify the placement Page 7 53 Menu Items of the site markers on the construct You will be presented with a dia
177. ing the shift key down when creating or editing an ellipse will constrain the shape to a circle Page 6 4 The Illustration Window Tracking Complex Construction Projects recognition sequence transcription start 0 Contact points Figure 6 4 An Illustration The Illustration window can be used to bring together graphics from other programs with constructs created in the Gene Construction Kit Any object can be pasted into an Illustration window from the clipboard and can be used to create sophisticated figures in conjunction with constructs created by the Gene Construction Kit In addition any Illustration can be saved as a PICT or JPG file to be used by other programs Tracking Complex Construction Projects The Illustration window has some rather remarkable features that make it ideal for tracking complex construction projects As shown in Figure 6 5 page 6 6 many constructs can be placed in the same Illustration and connected with lines and descriptions Illustrations are limited to 32 767 pixels on a side which is about 38 ft by 38 ft large enough for even the most ambi tious project This virtually unlimited size means that projects of extreme com plexity can be mapped out and tracked using the Illustration window of the Gene Construction Kit Just as TEXT objects in the Illustration window can be edited by double click ing on them gel construct and sequence objects can be edited after being double clicked This
178. ion of any of the selected objects Pressing the None button will leave the selected objects in their original position either vertically or hori Page 7 75 Menu Items pa Align Objects ex Horizontal alignment gecceccsey o Left Center Right None Vertical alignment Top Middle Bottom e None OD OK Cancel Figure 7 57 Alignment Dialog zontally By choosing different combinations of buttons and examining the sample object alignment you can easily determine how the objects you have selected in the Illustration window will be aligned The alignment of objects using Align Selection provides a convenient way to organize the various constructs gels and text which are displayed in the Illustration window Page 7 76 Menu Items List Menu The List menu allows you to manipulate the items in a list All list files are stored in the GCK Data Y Alphabetical List folder If a list file resides outside a GCK Data folder it will not be available from within the program List files were dis cussed in detail in Chapter 4 List Window In conjunction with the Cut Copy and Paste options under the Edit menu one or more list entries can be moved between lists or removed from a given list New List Entry 38 New List Entry New List Entry command E ctrl E was discussed on New List Entries page 4 3 It provides a blank entry form to enter the name sequence and comments
179. is Ye R galactosidase BamHl ampicillin resistance XK o o A o a O selection range ena a scale indicator construct 5 2964 bp Sa 3 458 v Figure 3 1 Construct Window Graphical View It is used for generating figures for publication as well as for direct selection Page 3 1 Construct Window Some Important Definitions and manipulation of DNA sequences A typical Construct window is shown in Figure 3 1 page 3 1 Many parts of this window are interactive and can be used to bring about changes in the display and to edit the DNA sequence of the construct The window s title bar shows the type of window Construct and the name of the current construct which also is the name of the corresponding file Site mark ers can be shown as text or as symbols regions of interest can be shown and the segments of DNA can be defined to have specific appearances The scale can be shown and set directly or the construct display can be allowed to fit to the size of the window changing as the window grows and shrinks The title and size of the construct can also be displayed in the center of the window The bottom left corner of the window shows the range of selected nucle otides Clicking with the mouse on this object will bring up Figure 3 2 By Show Mouse Position Show Selection Range Figure 3 2 Mouse Indicator using this popup menu GCK can be made to show the position of the mouse as it moves over the constr
180. is property for just one region If you are interested in having different regions displayed under different situations and do not want to dispose of any regions you can do this using Chronography see Chronography Tracking Construct History page 3 32 You can use a different chronography generation to display each set of regions you are interested in displaying Show Hide Frames As the name suggests this menu item will toggle the display of frames on or off It is a global setting so that all frames will be either shown or hidden Frames are features that adorn the display of the DNA sequence see Make Frame page 7 48 and Tutorial 5 Modifying the Construct Appearance page 2 20 You cannot set this property for just one frame If you are inter Page 7 61 Menu Items ested in having different frames displayed under different situations and do not want to dispose of any frames you can do this using Chronography see Chronography Tracking Construct History page 3 32 You can use a dif ferent chronography generation to display the sequence with a different set of frames Show Hide Sites As the name suggests this menu item will toggle the display of site markers on or off It is a global setting so that all site markers will be either shown or hidden Site markers are features that are not part of the actual DNA but represent additional information about the DNA see Marking Sites page 3 10
181. ist only those enzymes that have a recognition sequence within the selected DNA These enzymes might also have sites outside of the selected segment Choosing are found exclusively within the selection will list only those enzymes that have recognition sequences within the selected DNA and have no other sites elsewhere in the construct Choosing are Page 3 17 Construct Window Viewing the Construct as a Sequence found exclusively outside the selection will list only those enzymes that have no sites within the selection but do have sites outside the selec tion Using this cluster of choices together with the List enzymes for which cluster allow you to find exactly the right enzymes for the task you want to accomplish A typical output from the List Sites analysis is shown in Figure 3 15 page 3 17 The output has a header which names the sequence and the date on which the analysis was conducted If there were enzymes chosen that do not have any sites in the DNA they will be listed at the end of the output Viewing the Construct as a Sequence Any construct can be viewed and formatted as a sequence Most of the menu options under the Construct menu remain active a few new ones appear and some become inactive To view the construct as a sequence select Construct gt Display gt Display Sequence The graphical view of the construct will be replaced by a view of the sequence itself The menu item you just selected will
182. it into the Illustration Window however GCK realizes that you want it represented as an arc for part of an illustration and will draw it that way The Gene Construction Kit is also smart about the way it puts information in the clipboard it stores both the picture and textual information Properly behaving applications e g those that follow Apple s and Microsoft s guide lines will be able to extract the appropriate information from the clipboard If you have copied a segment from a graphics view of a construct and then paste it into a text processor you will paste in the DNA sequence On the other hand if you take the same information on the clipboard and paste it into a graphics application you will see an image of the selected segment and not the sequence For programs that can display both pictures and text the program receiving the information from the clipboard makes the decision of how to accept the GCK object A special case of copying and pasting deals with the copying of marked sites from the Construct window followed by pasting into either a Gel or Illustration window If you select and copy marked sites in a Construct window and then paste them into a Gel window GCK assumes that you are doing a restriction enzyme digest and will create a lane on the gel showing the fragments that would result from digesting the DNA with those enzymes If you select and copy marked sites in a Construct window and then paste them into an Il
183. ita dia del toads eetonbeucSeongieuacensess 7 73 Send toy BACK ica is 7 75 Set Construct Ocd A r A aa EN aS eean anA NnS 7 73 illustration WINDOW OVEFVIEW coccocconcncconcncncoccononcnoncnnnnnonnnnnoncnnnnnrnnnranennranennnanennnns 1 4 illustrations CONSTRUCT SCAlee a dianas 2 50 ellipsEto0 viii a tae 6 4 EXPOMIND tii A AA A A A A ee a 6 8 handles iii ii di 2 50 line TOO tidad inca 2 54 6 4 magnification naaa da la A id eee 6 7 A ad 2 50 ODE CS psi et 6 1 6 2 OVEIVO AA MAE td ed cancucanasseacGaaawsudecaneedeeeenetaeacanterseees 6 7 rectangle TOO a ee ee a es 6 4 reducida 6 7 round rectangle tool tc A nie 6 4 SEIECUOMN TOOL 2 sissies Sede Seca te teeae sb eden ewdees so ctwas se veccweges sede snssedad onuSs wieder deevadtesecdades 6 3 Selection VS targeting mirta td el cae ees Soe eed een tee 6 1 sidebar tekt ci cada 6 3 LM e o ee beech e 2 51 text Objects aiii 2 51 6 3 Index 7 3 text TOOL iii dd bdo abe sacw oie sacnte uses ieudad uaast xvas 2 51 6 3 tool Palette cita deh deste a aaa dit ceeded tied de tee atts 6 3 importing PUIG formats ve cccascdvascorsescantoccierecad a a E noteacseusuessded sues educaateducouse 8 2 GADES a A erence ree creer A errr a 3 41 Other Tile formats cidcid 7 4 SOQUEMCES ii A gest oieaae A did ct 2 60 3 38 Inserting NS cnn arica 2 56 7 64 inserting nucleotides Wicca da nahi ee 3 21 inserting TYPING cnn 7 64 installing GCK ii A AA ee 1 1 Intelligenetics cut cia 8
184. ix this you need to adjust the size of the text object you just created You are currently editing the text within the text object it is targeted but you want to be able to resize the text object as a whole This is similar to being in the mode of editing a construct as you just were and wanting to change the size of the construct What you need to do is deselect the text object by clicking in a blank area of the Illustration window and then select the text Page 2 51 Tutorials Making Illustrations 060608 lt Illustration cloning project construct 5 2964 bp Figure 2 53 Illustration 1 object by clicking once on it This will give you the eight handles around the object Use the top right handle to drag the right edge of the text object towards the right edge of the window You will end up with something like Figure 2 54 9 Open the file hsp70 which is in the tutorial files folder Mark all the BamHI sites as you did in Tutorial 2 Marking Sites page 2 8 there should be three sites 10 Click once in the hsp70 DNA and then press command A ctrl A or choose Edit gt Select All to select the entire construct Copy this construct to the clip board by pressing command C ctrl C or choose Edit gt Copy 11 Bring the Illustration window to the front by clicking on it or by using the Window menu Click the mouse to the right of construct 5 and paste Edit gt Paste This construct is much too large to fit on
185. l notice that when two segments are joined together a small marker consisting of a white j in a black circle is placed at the junction of the two segments This marker is called a junction marker and is placed at the location of the joining of the two fragments to preserve the boundary between the two joined segments as shown in Figure 3 24 Each time that two segments are joined together the program must decide Page 3 26 Construct Window Cutting Copying and Pasting Segments Figure 3 24 Junction Marker how to indicate the junction between the two segments This is important for archival purposes as well as to provide you with the ability to manipulate these segments in the future If the ends that are being joined are the results of restriction enzyme cuts and the recognition site is regenerated during the ligation the restriction enzyme marker s will be regenerated If however the ends are adjusted with the ligation dialog box and the original recognition sequences altered the original sites may no longer be appropriate In this case the program will generate a junction marker at the boundary to retain the information about the boundary Likewise if blunt ends are joined together no ligation dialog will be shown the program will create a junction marker There are two other situations in which a junction marker will be created First if a segment is removed from a construct by selecting and then cutting the two new en
186. ll alter the appearance of the selected site marker Font Color Style and Size of the site marker text can be changed using the Format Menu In addition if the site is being shown as a symbol the symbol can be changed using Format gt Symbol When a restriction enzyme site is marked on a sequence convention usually places the first letter of the enzyme name above the first letter of the recog nition sequence In the sequence view of a construct when an enzyme site is chosen you will see an indication of the actual cut site as a series of march ing ants as shown in Figure 3 10 In this case the Sa site is GTCGAC so the S of Sa lines up above the first G in the recognition sequence The cut is clearly indicated as occurring between the G T Page 3 13 Construct Window Site Markers Hindlll Pstl Sail BamHlSmal Sstl EcoRI GAATACAAGCTTGGGCTGCAGGTCGACTCTAGAGGATCCCCGGGCGAGCTCGAAT Figure 3 10 Selected Site Marker Because GCK relies on being able to cut DNAs at the actual cut site and not Om O oea Figure 3 11 Site Markers at Magnification of 1x the start of the recognition site but displays the markers by default at the rec ognition site sometimes confusing graphics can result For example Figure 3 11 shows the same piece of sequence a polycloning site from the vector pGEM 1 but viewed graphically with the sites marked as symbols rather than as text At the 1x magnification shown in Figure 3 11 everything l
187. ll and then choose Edit gt Copy to copy the entire construct to the clipboard 3 Choose File gt New and choose to create a new Illustration window by clicking the Illustration radio button see the dialog in Figure 2 49 page 2 46 Name the new window cloning project and press OK A new Illustra tion will be created 4 In the new window you should see a blinking cursor that represents the top left corner of whatever you choose to paste into the window Click the mouse about 3 cm from the top and 3 cm from the left and then choose Edit gt Paste This will paste construct 5 into the Illustration window You might want to make the window larger at this time to be able to see what is going on 5 Notice that the pasted construct now has 8 handles little square filled boxes around its edges indicating that you can drag it around the window and resize it Also notice there is now an Illustration menu in the menu bar because an Illustration window is the active window Choose Illustration gt Set Construct Scale and enter 300 into the dialog as shown in Figure 2 52 page 2 51 Press the OK button The set scale option in the Illustration window allows you to make sure that all of the constructs in any given Illustration are all drawn to the exact scale you desire This operation will make your con struct look a little ugly the title will be too big for the construct and the arrowheads and line thickness for the orange region in
188. ll generations of the construct and therefore can be used to search through all your notes about a construct By carefully doc umenting each step you perform this electronic notebook can not only con tain the same info as your regular lab notebook but the notes can be associated with specific features of the construct can be saved in chronolog ical order by taking advantage of the Chronography feature Chronography Tracking Construct History page 3 32 and can be rapidly searched Using these comments in conjunction with an illustration window to diagram the cloning strategy provides a very reliable way to document your project Finding a Sequence When viewing the construct as a sequence you can place the cursor any place in the construct and then search for the next occurrence of a sequence Page 3 23 Construct Window Cutting Copying and Pasting Segments This is accomplished by choosing Construct gt Find Sequence command F ctrl F You will see the dialog box shown in Figure 3 21 Type in the sequence to O Find Sequence Sequence Text ACGGd Cancel Search h Figure 3 21 Find Sequence Dialog find and press the Search button All valid DNA characters are accepted in the search sequence GCK will search the sequence starting from the cursor and will highlight the next occurrence of that sequence in the sequence listing itself Cutting Copying and Pasting Segments You can use the Gene Constructi
189. lly shown in the sequence view of a construct Set Gel Construct Margins Edit gt Set Gel Construct Margins will let you define the top left bottom and right margins for Gel and Construct windows and for Gels and Constructs within Illustrations Page 7 15 Menu Items Window Menu Stack Windows Window gt Stack Windows will organize the current set of open windows on the screen This is useful if you have so many windows open that you cannot locate a particular window Below the Stack Windows menu item will be a list ing of all open windows The list is organized alphabetically and by window type Selecting a window name from the list will bring that window to the front list of open windows All open windows in GCK will appear listed at the bottom of the Window menu The list will be alphabetical and will contain an icon indicating the type of window Page 7 16 Menu Items Format Menu The Format menu contains the tools needed to alter the display of information in the various Font gt Gene Construction Kit windows Because of the Style gt large number of choices available all of the items 128 gt in the Format menu are hierarchical in nature To olor gt view the options in the submenus of the Format Site Markers b menu simply hold the mouse down on a menu item and a submenu will appear giving you fur ther choices This is the most logical way to pro vide access to the large number
190. local server by pressing the Set Root URL button 2 Pressing Retrieve will contact your target database and retrieve the sequence for you Once the sequence is retrieved you will see a window very much like that shown in Figure 2 67 page 2 64 You can proceed from that point to finish importing the sequence into GCK using the same steps described in the previous tutorial Cloning a DNA Segment and Silent Muta tions page 2 23 3 You can also search GenBank using GCK Selecting File gt Deluxe Import gt Search GenBank will bring up Figure 2 71 which shows the search dialog for defining how you want to search GenBank Note that the popup menu allows Page 2 67 Tutorials Searching and Retrieving Sequence Files from GenBank Search GenBank es Search expression Search field Definition ZJ A Search field Accession aui i All Fields Author Name Definition N L EC RN Number Feature Key Filter Gene Name Max number of entries to retrieve Issue Journal Name Keyword Modification Date Organism Page Number Primary Accession Properties Protein Name Publication Date SeqID String Sequence Length Substance Name Text Word Title Word Uid Volume Literal Expression Figure 2 71 GenBank Searching Options you to define the database fields to be searched by your query Type in the search expression you wish to look for and then press the Search button A progress dialog informs you of pr
191. log that gives you a choice of placing the marker at the start of the recognition sequence or at the left of the actual cut site This will only make a noticeable difference when you are zoomed in to a high magnification in areas that are densely packed with restriction site markers The difference is shown in Fig ure 7 40 which is drawn at 3 6 nts cm In Figure 7 40A the markers are Figure 7 40 Site Markings placed at the recognition sequence Notice that the insertion point indicated by the arrow is not located where the Sma site intersects the construct DNA sequence The Sma marker text is at the start of the Sma recognition sequence while the insertion point where any new sequence would be pasted in is further downstream of the site In Figure 7 40B the Sma marker text is placed at the cut site Now it corresponds to the location of the insertion point Traditionally restriction enzyme names have been placed above DNA sequences such that the first letter of the restriction enzyme name is exactly over the first letter of the recognition sequence for that enzyme You can choose either method in GCK Page 7 54 Menu Items Insert Sites By Silent Mutation Silent mutations are changes in a DNA sequence that do not alter the coding information contained in the DNA Silent mutations are often used to create c113611 BstDS Alel fr421 Bstxl ciNI P Bsex3l open reading frame 2 Xbal AhiI BamHI Ama fr3l BspMaAl
192. lus tration window however GCK assumes that you want to create a legend These two pasting features provide you with an easy way to create gels and to provide legends for constructs in the Illustration Window Clear Edit gt Clear will delete whatever is selected It will not replace what is on the clipboard Clear is an undoable command Page 7 13 Menu Items Special Paste Edit gt Special Paste command U ctrl U was discussed earlier see discussion around Figure 3 23 page 3 26 and serves to provide special treatment of fragments before they are pasted Once selected you get the dialog box shown in Figure 3 23 Inverting the fragment before pasting will flip the segment around before pasting it into the target site In addition to inverting a fragment options are available to Trim Ends or Fill Ends of all fragments before pasting this is equivalent to S1 treatment and polymerase filling respectively The Leave Ends Alone option will not treat the ends in any special way you will see the ligation dialog box if any of the ends are incompatible Select All Edit gt Select All command A ctrl A will select all of the items of the type you have currently selected e g if you have selected a marked site Select All will select all the marked sites If nothing is selected in the Construct window Select All will select the entire construct In the Gel window SelectAll will select all the gel lanes In t
193. m of this transcript to amplify which we suspect has an important promoter element Double click on the arrow to select the corresponding DNA segment This will select nucle otides 1617 3677 as indicated in the bottom left corner of the construct win dow 3 Switch to sequence view Construct gt Display gt Display Sequence The same region is selected Using your mouse click and drag upstream starting at the first nucleotide before the coding sequence 1616 Drag approximately to j GCK uses Primer3 PCR code developed at the Whitehead Institute for Biomedical Research and used with permission This code is Copyright c 1996 1997 1998 1999 2000 2001 2004 Whitehead Institute for Biomedical Research All rights reserved The algorithm for this software is published Steve Rozen and Helen J Skaletsky 2000 Primer3 on the WWW for general users and for biologist programmers In Krawetz S Misener S eds Bioinformatics Methods and Protocols Methods in Molecular Biology Humana Press Totowa NJ pp 365 386 Page 2 74 Tutorials PCR Analysis 1317 and release the mouse button You can fine tune the selection by hold ing down the shift key while selecting a new starting point in the sequence Keep trying until you have selected nucleotides 1317 1616 Keep this selec tion and switch back to the graphics view Construct gt Display gt Display Graphics 4 Select Tools gt PCR Analysis to bring up the PCR dialog You will
194. me list for use as candidate enzymes to be chosen in Figure 7 42 page 7 56 commerciale7 has been chosen The next cluster of check boxes allows you to chose the kinds of cut sites to be considered in the search The enzyme list on the left shows all the enzymes in the currently selected list file Select one or more enzymes in the left list and then press the Add button to add them to the right list All enzymes in the right hand list will be candidates for the insertion of a silent mutation Pressing OK starts the process of examining the DNA sequence and locating sites in the DNA that could be altered by a point mutation to create a new enzyme site while not changing the coding of the DNA Pressing OK will bring up a dialog like that shown in Figure 7 43 In the figure the Cpo site is chosen at position 2405 in the DNA this position represents the start of the recognition site for Cpo The suggested change is to take place at nucleotide 2411 and will replace a T with a G Note that Csp and Asr sites will also be created in this particular instance because changing the T to a G will also create recognition sites for those enzymes If the Sap site at 2164 were chosen then only that one site would be cre ated the change of G to A at 2164 would not produce any other sites cor responding to any of the candidate enzyme recognition sequences The changed nucleotide will be converted to lower case to make it e
195. ment Info Name T7 promoter First Pos 626 Last Pos 645 Generation 0 Comments In clockwise direction Con 2 Figure 3 4 A Segment Get Info Dialog notes about where the particular piece of DNA came from the functionality of the sequence or any other information you wish to have associated with the a This prevents regions from unintentionally overwriting site markers Page 3 6 Construct Window Attaching Comments to Objects in Construct Window particular DNA segment see Figure 3 4 page 3 6 Comments can be reviewed and edited at any time using Construct gt Get Info and can be used as an electronic notebook to document the various steps used in generating the construct When a segment is pasted from one location to another even into a different construct the comments are pasted along with the DNA sequence itself Because it is not obvious from looking directly at a construct which parts of the construct have comments associated with them GCK can display an indicator of the location of comments by choosing Construct gt Display gt Show Com ments This will produce a display like Figure 3 5 page 3 7 The selected object is a comment indicator and indicates that there are comments associ ated with that particular segment of DNA You can view the comments by clicking once on the segment indicator to select it and then choosing Construct gt Get Info Alternatively you can double click on the comment indicator
196. n one printer page see Show Hide Page Breaks page 7 15 Line borders delin eate one sequence line from the next This may not seem necessary under most circumstances but in situations in which the DNA is being displayed as double stranded and both regions and marked sites are visible it can some times be confusing as to which DNA sequence line is related to which set of marked sites and regions Set Line Spacing The Construct gt Display gt Set Line Spacing menu item also available only in the sequence view will let you specify the minimum number of pixels between adjacent sequence lines The default value is zero leaving the line spacing between sequence lines equivalent to single spacing As you change the value from zero to a positive value each line of sequence will be moved apart by that many extra pixels Line spacing can be set in the default prefer ences One Three Letter Amino Acid Code This pair of menu items will only be available when the construct is being viewed as sequence Choosing Construct gt Display gt One Letter Amino Acid Code will display all translated sequences as single letter amino acid code Choosing Construct gt Display gt Three Letter Amino Acid Code will display all translated sequences as three letter amino acid codes This is a global setting so all protein sequences are affected by this change You cannot show different translations in the same construct using different length ami
197. n the properties of the enzyme recognition site Using Select Sites Y Select Blunt End Sites Y Select 5 Overhang End Sites Y Select 3 Overhang End Sites Cana 5 2 Figure 7 51 Sites By Kind Dialog the dialog box shown in Figure 7 51 you can specify which kind of site should be selected The results of this selection on pBR322 with all the unique sites indicated is shown in Figure 7 52 page 7 68 lt might be useful to change the color or font of all these sites so that they can be distinguished from 5 overhang and 3 overhang sites The 5 and 3 sites can also be selected and color coded to make recognition easier Having this kind of information available at a glance will facilitate cloning strategy design Page 7 67 Menu Items pBluescript KS 2384 bp Figure 7 52 Blunt End Sites Selected Get Info Get Info command 1 ctrl 1 will provide information on any selected object in the Construct Window You can Get Info on construct segments marked sites or regions Depending on the object selected you will get a different but sim ilar dialog box containing information relevant to the selected object Some of these have been discussed before A region get info box is shown in Figure 3 8 page 3 9 a site get info box is shown in Figure 3 7 page 3 9 and a segment get info box is shown in Figure 3 4 page 3 6 GetInfo also works when a construct is targeted in an Illustration window General
198. nd PCR Analysis ing Comments and File Searching page 2 38 DataBase Search File searching provides you with the ability to search Gene Construction Kit files on disk for matches with key words in comments or for matches with DNA sequences Please see the tutorial for details on how to use this option If you are conscientious about entering information with your constructs Search Files can be used to keep track of storage locations for different con structs For example if in the general comments associated with every con struct you include the storage location for that particular construct you could then use File Searching to locate all the actin constructs in freezer 2 There fore GCK can serve as a simple database management system for con structs providing both storage and sequence information Deluxe Import There are six submenus under this menu GCK has the ability to take each item in a GenBank features table and convert it to a specific GCK feature The menu items in this submenu facilitate that process Tutorial 13 Importing GenBank Sequence Files Using Deluxe Importing page 2 64 discusses the process in some detail Open Sequence s File If you already have a GenBank or EMBL file downloaded to your hard disk choosing this option will allow you to convert it to a GCK file When opening you will see the dialog shown in Figure 7 22 This particular file has five dif ferent sequences in it the first of
199. nd of the selection will become the new origin Page 3 45 Construct Window Editing Construct Ends and Redefining the Origin Page 3 46 List Window Chapter 4 List Window The List Window is the simplest window type in the Gene Construction Kit Lists are accessed by GCK when Construct gt Features gt Mark Sites is chosen All lists that are in the GCK Data folder will be available in a popup menu within the Mark Sites dialog as shown in Figure 4 1 In this case the Mark Sites File all_enzymes E Mark only all_enzymes_4 allenzymes_5 p M blun NC i all_enzymes_6 Aaal all_enzymes_7 E Aacl alllenzymes_8 Aael Aagi all_enzymes_with_comments Aag commercial Aari Aasi Aatl commercial_5 Aatll commercial_6 commercial_7 5 Mark enzi commercial_8 commercial_no_isoschizomers commercial_with_comments less Ran SZUUU Ses are TON Prey erawenzymesnanne S mon Cancel Figure 4 1 Lists Available in Mark Sites Dialog commercial_4 list is selected and will be the list that is shown in the scrolla ble area on the left of this dialog once the mouse button is released The lists you see might be different from those shown in this figure You can always obtain the most recent restriction enzyme lists from Textco BioSoftware s web site The lists are usually updated several times a year and will contain all known enzymes Page 4 1 List Window Opening List Files Opening List Files List files can be open
200. nd skip Page 2 72 Tutorials Translating Across Introns ping over the sequences in the introns Note that the codon spanning from exon 1 to exon 2 is actually broken into two pieces ag then g to make up agg 11 Switch back to a graphical view Construct gt Display gt Display Graphics You should see Figure 2 77 Notice that the introns are not displayed as part of polyA_site oa pm SA e Figure 2 77 G Gamma globin final construct the coding sequence 12 One final comment In the sequence view if you select an intron and then extend the selection e g by shift clicking you can actually redefine the intron by choosing Construct gt Features gt Expand Intron This will redefine the intron but it will not automatically update the translated protein You have to do this manually since there might be times when you do not want to lose the protein that already exists e g to illustrate alternative splicing situations Page 2 73 Tutorials PCR Analysis TUTORIAL 16 PCR ANALYSIS We will use the PCR analysis code to amplify a promoter region of a Droso phila hsp7O gene 1 Open the file Hsp7O protein found in the Tutorials folder You will see 00608 lt Construct hsp70 protein e a hsp70 protein 5066 bp n v Figure 2 78 hsp70 protein construct Figure 2 78 2 The arrow below the DNA is the actual transcript for this Drosophila heat shock gene We want to select the 300 nts upstrea
201. ndow Once selected objects can be moved around the window The TEXT tool allows you to type text anyplace in the window this ability is sometimes called sidebar text Click the mouse at the location you wish to place the text and then just type The text generated can be edited using standard cut and paste operations and attributes such as Color Font Style and Size available under the omnipresent Format menu To move typed text around the window as an object make it the selection Figure 6 1 page a Note that if the site markers are pasted into a Gel window the Gel window would inter pret the markers as fragment sizes and would create a new gel lane Page 6 3 The Illustration Window Using the Illustration Window 6 1 by clicking it with the selection tool and dragging it to the desired loca tion To edit the text after it has already been entered double click on the text itself to make it the target Figure 6 1 The targeted text object is now editable using all the options available in the Format Menu New text will always appear in the same font size style and color as the previously entered text unless it is the first text to be entered in the window in which case it will use the values set in the Preferences submenu see Preferences page 7 33 The line tool can be used to generate lines Select this tool and then drag the mouse within the Illustration window from the starting to the fin ishing lo
202. nennnnenos 3 1 constructs Index 1 arrowheads dni o eee Me cee 2 6 attaching COMMENTS aia i 3 6 auto arrange Site markers oocoonccconccononnccnnnennnnncnnnncnnnnnnnnnnnnnnnnnnnnrnnnnnnnns 2 9 3 13 chronograph 2 ceegeieeAvececeoueeedee Dart rr dad 3 32 circular VS INC li bed 7 69 dotible straided luisa o 3 4 3 19 editing construct ends inci A neds 3 44 exporting data oi ico de E ERa 3 41 finding a SEQUENCE ee ceeeeeeeeeee eee e cece ee eee eee ne ee ee ee ee ee aaea ee ee ee ee esas aeaa ee eeeeeeeeeeeee 3 23 fit COSWINGOW ssaa eeeiactt Ie E Dacge apt 2 7 OE E A A AAA A CETTE AAA A IR 2 20 ames nia 2 20 2 21 3 20 generalinio cece ren cg ici E A A edanseneeaccebueneeaccnweecteetensecte 2 15 3 8 e EE A EE a TO 2 56 A E E ace E A E T 2 5 GROUPING canne eee ela ghed AN ah 2 17 3 19 importing SEQUENCES eee cence ee eeee ce ee cece ee eee aeae ee eeeeeeae ee eeeeeeeaaeeseaeeeeeneeees 3 38 inserting NUCICOLIGES arririk cece eee eee ee eee ee ee ence ee ee ee aaa ee rr nn 3 21 line borders vicio eed shee ee dee one eee 3 20 WING DRC AKS a don 3 4 3 20 7 29 lne THICKNESS cocoa ra 2 4 JiStiNG SITES ees eee eke eee ct i ee ee ae 3 15 7 51 magnificatiOn idad 2 7 3 44 Making a TOO iaa Ai 2 18 manual site marker arrangement c cccooncccccnnonnncnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnes 3 13 A nee te R LE EA EE R E EIKER 7 15 Marking locations ia iio 3 15 7 51 Marking Site iii tii 2 8 3 10 7 50 OP
203. nformation available in the currently active window This could be a sequence of DNA or a table listing gel fragments If you are viewing a construct graphically you will see Figure 3 41 Export Graphics Construct page 3 42 If you are viewing the construct as a sequence instead of graphically you will see the dialog box shown in Figure 3 42 Export Sequence Construct page 3 43 One option in this dialog that is not present in the dialog box for the graphics view of a construct is to save a Formatted Listing as TEXT File This option will produce a TEXT file that contains a listing of the sequence as it is currently displayed in the Con struct window along with all the other textual information in the window This would include line numbers positions for both DNA and amino acid sequences if present and the names of marked sites Grouping would also be preserved It would not include any graphical information such as arrows Page 7 6 Menu Items that indicate regions of interest or dashed lines that indicate line borders This option can be useful for importing into a word processor later for inclusion in a manuscript The last option is selected by choosing Comments as TEXT File This option provides a mechanism to save all the comments associated with a construct Some constructs can be the result of many steps of manipulation involving DNA from many sources If you have comments associated with marked sites Regions of Interest and
204. ng ends Bamel Tia Add gt es Enzymes to try BamGl BamHl BamKI BamN BamNx Add All gt All gt Banl Banl Bani Get Info Get Info BanAl Y Click OK to view sites that can be removed by silent mutation Cancel Figure 2 23 Select Enzyme Sites to be Removed BamHI enzyme in the list on the left and press Add gt to bring it to the right list of Enzymes to try Click OK This will bring up Figure 2 24 Click on the BamHI name in the list to select it if there were more than one BamHI site you could choose any one or more of them Now press OK 6 This will bring up another dialog containing a list of the different possibil ities that could be used to remove the BamHI site without altering the coding information in the DNA This is shown in Figure 2 25 The original sequence is shown in the first column and the possible changes are shown in the sec Page 2 24 Tutorials Cloning a DNA Segment and Silent Mutations Sites to Remove eS Select sites to remove by silent mutation Site pos enzyme name Site is marked 2783 BamH yes Cancel x Figure 2 24 Selecting the Site To Remove ond column The actual changed nucleotide is shown in lower case Select the first item in the list as shown and then press the OK button 7 You should now see the hsp70 construct with the middle BamH site missing The actual nucleotide sequence has been changed as specified in Silent Mutation
205. ning from right to left and therefore corresponds to the bottom DNA strand not shown Choosing Construct gt Display gt Show Double Stranded will show the second DNA strand in addition to the one currently being shown You can modify the output format by choosing Format gt Grouping gt see also Grouping page 7 29 To change the grouping of a segment of DNA start Page 3 19 Construct Window Formatting A Sequence Listing by selecting a segment of DNA and then choose an item under Format gt Group ing gt to define the number of nucleotides to be placed between each space This option is particularly useful for displaying coding regions of DNA in groups of three while other regions of DNA might be in groups of ten as shown in Figure 3 16 or not grouped If your particular sequence has an octamer motif it might be best to display it in groups of eight Also available for formatting is Format gt Grouping gt Insert Line Break This item pro vides the ability to insert a line break anyplace in the sequence and therefore gives you complete flexibility to format the sequence in precisely the way you desire In addition the Construct gt Display gt Set Line Spacing item allows you to define the minimum number of pixels between each line of sequence The last sequence formatting option is Construct gt Display gt Show Line Borders This option will display a dashed line between each set of lines representing a DNA s
206. nnnnnnnnnnnrrnnnnnnnnns 2 15 Working with Constructs ceeeeeceeeeeeeeeeeeeeeeeeeeae cece eeeeeeeeeseaeaaaaeeeeeeeeeeaaaee 2 2 Working With Generic Constructs cccccccconcononnnonnnnnnncnnncnnnnnnnnnnnnnnnnnnnnnnnanannnnns 2 56 U Unique CU tin it ad dad 3 17 updatind GORA alii tada aaa 1 2 V valid nucleotide Characters ccecceccececsececeeceecececeeeueesaeegueeceeuceseeecauseeauaeeauees 8 1 Index 12 viewing the construct as a SEQUENCE coooocccccononnccnonnnnncnnnnnncnnnnnnncnnnnnnnnnnnnannnnnnns 2 15 Z zooming in Index 13 Z Index 14
207. no acid codes Show Hide Scale Legend When viewing a construct graphically Construct gt Display gt Show Hide Scale Legend is available Show Scale Legend will show a horizontal bar in the construct window indicating the scale at which the construct is drawn as shown in Figure 7 45 page 7 60 If the window is resized and the magnification is set to Fit to Window see Fit To Window page 7 43 the scale legend will be updated Page 7 59 Menu Items a l Dralll mnl Nael BsaHl acl Seal Bstk Dsal acll otl agl Xbal pel Bluescript KS BamHI 2964 bp mal Bpr Pstl Bsal coR cor Y Eam11051 indill DANA Clal WN Ace ine Il all a hol 111 co01091 H Fo All Apal pnl scale legend ntsicm Figure 7 45 Scale Legend to reflect the current scale for that window Double clicking on the scale legend will allow you to actually set the scale at which the construct is to be Drawn This will bring up the dialog box shown in Figure 7 28 page 7 42 The box allows you to define both the scale in nucleotides cm and the length of the scale indicator The program will create the scale as close to the desired value as possible Since there are only a fixed number of pixels per inch on the screen it is usually not possible to have the on screen scale exactly as specified However the Actual Scale on Screen value will define that scale precisely Once the scale is set using this dialog box GCK assumes that
208. ns lt iicopocri ia 2 50 Marker placement cocoonccconnncnonnnncnnnnonnncnnnrnnnnnnr ren cnn rre aaia rn recerca 7 53 marking locations ac 3 15 7 51 Marking RA iA E dau ecesnchusedtneeeeed tenuate nent eee ncees 2 8 3 10 7 50 MOUSE POSITION ia A eed ee ee eee ke 3 2 MOVING TEQGIONS dd ica adden 7 27 NBRE E EE AE hice A pcia 8 3 NewiliSt entes cece Gee wec8 Wee east dc tober dees id IAS 4 3 O one three letter AMINO acidS c occcccncconcconconnonnnonononnnonnnnoncnnnnnnncnnncnnnnnnnnnnnnnnnons 7 59 OPEN reading frames ccceecececeeeeeeeceeeeeeeeeeaaeeeeeeaaeeeeeeaaeeeeeeeaaees 2 11 3 36 7 46 Open Sequence S file scarsi a a a ran 7 35 Orientation analysis serna a E E 2 45 overlapping restriction sites oooooncconnncconnccnonnnccnnncnnnnnnnnnnnnnnncnnnnnnnnnrnnnnnnnnnnnnnnnnns 7 12 OVEIVIEW Of GGK nia id 1 1 Index 9 P P PAGE DreakS cnica bevdede ce bevdengs eveeseecveuveueceeeudeuee d E even 7 15 partial digests rrarena car orar cegecedegeceegacuspantect ondcadadteteeecenpacetvatecueact 5 4 7 72 pasing SEMEN o e one Geet eee dE 2 34 PER ENS 1 3 add PM csi as 2 75 generate Primers 2 cce ceeeecdesteevyees cede eceboeeduetelowp due scew ed ccavtwerves due KAR EARRA 2 75 multiple PHIMETS uta oras 2 75 PCR amaly SiS ol A 2 74 7 40 DIACINGSITOS ii A A ned oie ee eames 2 56 3 15 7 52 polymerase chain reaction eeceeceeeeeee cece ence cece eee eeee ee ee eeeeeeeeeeeaeeeeeeeeaeeeeenaes 7 40 P
209. o provide you with an overview of the capabilities and to give you a feel for how the program actually works you should go through the various tutorials in Chapter 2 If you read nothing else in this manual you should read and carry out the tutorials These tutorials are designed to help orient you and will greatly facilitate your understanding of the program and its fea tures while pointing out features you may not think to look for The time you spend in the tutorials will be repaid many times over in the future as you use GCK Page 1 4 Overview Running The Program GCK has a straightforward and intuitive interface with extensive undo capa bilities lt has what is called revealed complexity you can see as much detail as you choose You should not hesitate to try things for yourself Select menu options tool palettes etc to see what they do The FormatMenu in par ticular is available from many places within the program and will be useful in ways you might not expect Besides the tutorials one of the best ways to learn the capabilities of the Gene Construction Kit is to try new menu options or tools for yourself Page 1 5 Overview Running The Program Page 1 6 Tutorials Chapter 2 Tutorials This chapter contains a number of tutorials that introduce you to the Gene Construction Kit You should do as many of the tutorials as you can because they provide an overview of how the program works Doing the tu
210. oblem of the middle BamH site In the lab you could do partial enzyme digests and obtain the fragment containing the entire coding region by elution of the fragment from a gel You can also select this entire region in GCK by dragging with the mouse from the first left BamH site in the DNA to the third BamH site This fragment can be copied and pasted into the vector An alternative is to eliminate the middle BamH site through a silent mutation This mutation will eliminate the BamH site without interfering with the coding capacity of the DNA This is the approach we will take in this tutorial d Note that this sequence has been derived from an hsp7O gene from Drosophila The original sequence has been modified for use in this tutorial Do not use this sequence as a real hsp7O sequence Page 2 23 Tutorials Cloning a DNA Segment and Silent Mutations rc Construct hsp70 gcc ojo e BamHI BamHI BamHI __ _ hsp70 gcc 5066 bp Figure 2 22 BamHI sites marked on hsp70 5 To make a silent mutation you first need to specify the reading frame to which you are referring To do this select the single region in the hsp70 con struct by clicking on it once Now choose Construct gt Features gt Remove Sites by Silent Mutation You will see the familiar dialog shown in Figure 2 23 Select the Chjose Enzyme s File all_enzymes ey List only those enzymes with Mi bluntends M S overhang ends 4 3 overha
211. oci ated with each site that is marked on the construct More information about the list window is given in Chapter 4 page 4 1 The Gel Window is used to simulate gel electrophoresis patterns Any number of digests can be displayed in the Gel Window Partial digests can be viewed and lanes can be cut and pasted within and between gel windows In addition to a graphical view of the gel the digests can be viewed as tables of frag ment size information The Gel Window is discussed in Chapter 5 page 5 1 The Illustration Window is used to create documents for presentation or pub lication and can also be used to track complex construction projects Graph ics and text from Construct List and Gel Windows can be pasted into an Illustration Window and legends can be automatically generated Graphics and text generated in other programs can be copied and then pasted into a GCK Illustration Window Once pasted into an Illustration Window constructs are separate from their original file but can still be edited using all the tools normally available in the Construct Window The Illustration Window also con tains a comprehensive set of graphical drawing tools for enhancing illustra tions For more information on the Illustration Window see Chapter 6 page 6 1 Running The Program GCK is a comprehensive program with many capabilities The first time you run it the possibilities might seem so extensive that you are not sure of what to do first T
212. off different elements These options are available under the Format gt Dis play menu see page 7 58 for more discussion on these menu options Show Double Single Stranded Show Hide Positions nucleotide and amino acid position numbers Show Hide Breaks forced line breaks and Set Line Spacing extra spacing between sequence lines are available only when the construct is viewed as a sequence Show Hide Sites will either show or hide all the sites you have marked Show Hide Regions will either show or hide the Regions of Interest you have created Show Hide Comments will indicate or not those regions of the construct to which comments have been attached Show Hide Scale Legend will either show or hide the scale legend Show Hide Generations will either show or hide brackets that indicate any generation being displayed other than the cur rent generation see Chronography Tracking Construct History page 3 32 Using the Site Markers submenu provides the ability to change any one or more marked site s to be shown as either text or symbol and to define how Page 3 4 Construct Window Regions of Interest and Translating DNA the line from the construct will be attached to the site marker Regions of Interest and Translating DNA Regions of interest may be used to represent coding portions of the DNA exons introns promoters origins of replication etc A region of interest can be created by selecting the part of the construct tha
213. ogress and then you will get a list of items matching your query The list will be similar to see Figure 2 68 page 2 65 The sequences you are interested in are now on your hard disk and can be imported directly into GCK 4 If your DNA source file has entries in the features table that might be ambiguous you will see a button that says Location Prefs Pressing this button will bring up Figure 2 72 allowing you to define how you want the fea ture locations to be interpreted This window lists the possible ways in which various features are defined by NCBI for use in GenBank files Some of these are not directly translatable into GCK features so you can define how you Page 2 68 Tutorials Searching and Retrieving Sequence Files from GenBank OOO Feature Location Preferences Unary Operators Specialized Operators v lt end of span less than specified e g lt 1 8 v complement the feature is on the bottom strand Feature will be created with exact range specified e g 1 8 if creating a region or protein the direction will be reversed Y gt end of span greater than specified e g 3 6 gt O join join spans end to end in the indicated order Feature will be created with exact range specified e g 3 6 A separate feature will be created for each of the spans order spans are related and ordered Binary Operators A separate feature will be created for each of the spans O group
214. omments associated with the sequence will be read in as General Info to be saved with the entire construct If you press the TEXT button GCK simply will take every valid nucleotide character from the file and use it to construct a DNA sequence lt is a simple routine that reads characters one at a time from the disk file and will accept the character if it is a nucleotide and will not accept the character if it is not a nucleotide You could read in any information this way so once again be careful There are two non TEXT import options DNA Inspector and Gene Inspec tor files Selecting these radio buttons will only show you DNA Inspector or Gene Inspector files in the scrollable area and will import both the comments and the sequence and determine if the new construct should be linear or cir cular Since Gene Inspector files can contain multiple sequences you will be prompted to choose a specific sequence once you have selected a Gene Inspector file This is shown in Figure 3 40 The file selected in this case contained a number of rhodopsin sequences all of which are listed in the scrollable area on the left Clicking on an item in the list like Xenopus rhodop Page 3 40 Construct Window Exporting Data From GCK GI Sequence List Select a sequence to import Bovine rhodopsin Halobacterium archaerhodopsin Lamprey rhodopsin Octopus rhodopsin Xenopus rhodopsin Comments for the selected sequence LOCUS RELRHODOP 1684 bp
215. on page 7 55 you must first select a region for this menu item to be enabled Display The Display submenu has options pertaining to the display of the construct in both the sequence view and the graphics view Show as Double Single Stranded Construct gt Display gt Show as Double Single Stranded fl command D fl ctrl D pertains only to the sequence view of the construct As the menu name implies this option allows you to toggle between displaying the sequence as double stranded and single stranded Selection and cut copy paste operations func tion the same in the single stranded mode as in the double stranded mode The difference lies in the fact that both strands are highlighted in the double stranded mode Show Hide Positions Another menu that is available only in the sequence view is Construct gt Display gt Show Hide Positions M command K fl ctrl K Showing positions will place position numbers at the beginning of each line of sequence lt will display the nucle otide position of the first nucleotide in the line of DNA sequence and will dis play the leftmost amino acid position of the peptide line if a peptide is visible Show Hide Line Borders If the construct is being viewed as a sequence Construct gt Display gt Show Hide Line Page 7 58 Menu Items Borders fl command E fl ctrl E will be available Line borders serve a function analogous to page borders in a larger document that spans more tha
216. on Kit to graphically cut copy and paste segments of DNA Copying or cutting a fragment from one construct and pasting it into another is a three step process First select the segment by dragging with the mouse or by double clicking the fragment you wish to move cut or copy Once the desired fragment is selected choose Edit gt Cut com mand X ctrl X or Edit gt Copy command C ctrl C to place that segment in the clip board Second select the location into which you want to insert the fragment This can be an empty Construct Window or any marked site or end on any other construct or even a location between two nucleotides in the sequence view Third select Edit gt Paste command V ctrl V to place the segment from the clipboard into the selected site If you had selected a whole segment in your target construct rather than just having an insertion point in the target the selected segment will be replaced by the fragment in the clipboard This is just like replacing a selected word in a word processing program Page 3 24 Construct Window Cutting Copying and Pasting Segments When you copy segments of DNA all the attached sites chronography and regions are copied with the DNA Note that with regions however the entire region must be included within the DNA for it to be copied Copying a piece of DNA that includes only part of a region will not copy that region If you are pasting in a fragment with ends that are not compatibl
217. on becomes known for this construct you can use the real sequence to replace the Ns in this generic construct This concludes this tutorial You can close the open window don t save changes you will not need this file any more Page 2 58 Tutorials Working With Generic Constructs Construct untitled Lo JO JE Figure 2 62 Placed Sites Graphic View Page 2 59 Tutorials Importing and Exporting Sequences and Other Information TUTORIAL 12 IMPORTING AND EXPORTING SEQUENCES AND OTHER INFORMATION One often obtains sequences in other formats and would like to work with them in GCK This can be done by importing the sequences into GCK Most other formats really are just plain text files with the sequence information organized in a specific format Perhaps the most common of these formats is GenBank or GCG format Just a plain sequence file nothing but sequence is also fairly common and is often the form of the output you might get from a sequencing facility 1 Start GCK and choose File gt Import to begin the importing process You will see something like Figure 2 63 Use the popup menu above the list of files to NAAA All Importable Types E gl 1 3O Sequence Text GenBank Enable Intelligenetics lt m EMBL SwissProt B a j Staden z Pearson NBRF PIR I Gene Inspector T New Folder Cancel C Open Figure 2 63 Import Sequence Dialog navigate to the DNAs to import folder
218. ongInt Comments for above region go here until next marked line gt Name regionName gt Direction or gt or lt or lt gt gt Range longInt to longInt Comments for above region go here until next marked line this gets repeated for each generation GCK Acknowledgements National Center for Biotechnology Information NCBI Copyright Status Government information available from this site is within the public domain Public domain information on the National Library of Medicine NLM Web pages may be freely distributed and copied However it is requested that in any subsequent use of this work NLM be given appropriate acknowledg ment This site also contains resources such as PubMed Central Bookshelf OMIM and PubChem which incorporate material contributed or licensed by individu als companies or organizations that may be protected by U S and foreign copyright laws All persons reproducing redistributing or making commercial use of this information are expected to adhere to the terms and conditions asserted by the copyright holder Transmission or reproduction of protected items beyond that allowed by fair use as defined in the copyright laws Page 8 5 Appendix GCK Acknowledgements requires the written permission of the copyright owners Molecular Database Availability Databases of molecular data on the NCBI Web site include such examples as nucleotide sequences GenBank protein sequences macromol
219. ons 1 to provide a mechanism to allow you to maintain alternate views of a construct each having different sets of features displayed and Page 3 32 Construct Window Chronography Tracking Construct History 2 to provide a mechanism to archive the steps utilized in developing a con struct Keep in mind that the sequence of the DNA represented in the construct is not changed by any Chronography operations All Chronography does is change the appearance of what is visible on the screen Chronography allows you to define different generations or views of the construct Each generation represents a way of displaying different aspects of the construct without changing the DNA sequence in any way Using Chronography one view of a construct might be defined in which the different pieces of DNA e g vector promoter cDNA used to derive a con struct are indicated Another view might show the transcribed regions of the DNA along with initiation and polyadenylation site markers and yet another view might show some important restriction enzyme sites It would prove awk ward and distracting to show all these features at the same time in the same diagram lt would also be quite tedious to have to indicate each of the fea tures every time you wanted to display them By defining each of these views as a different generation you can show any attributes or combinations of attributes you desire while maintaining the capability to view the alterna
220. ons were discarded Place Sites Construct gt Features gt Place Sites command J ctrl was discussed in Tutorial 11 Working With Generic Constructs page 2 56 Place Sites provides the opportunity to insert recognition sequences into a construct at specific loca tions Using this feature you can assemble generic constructs with accurately placed restriction sites even though the sequence is not known You will see Define Sites File commercial_no_isoschizomers B EcoRI Ek Fall 1 Fall 2 A Fau Cancel FauNDI 0 A eerezctenccccccccrsene Fsel AA FSpAl v Add Sites to Place EcoRI Bami o Re Ran Info Show Symbols a Show Text Figure 7 38 Place Sites Dialog the dialog box shown in Figure 7 38 This dialog is the first step in placing the sites into the construct Select an enzyme from the top list whose recog nition sequence you want placed into the construct and then press the Add Page 7 52 Menu Items button you can also double click on the enzyme name in the top list to make it appear in the Sites to mark list In Figure 7 38 Aci has been chosen and added to the list on the bottom An item can be removed from the Sites to Place list by first selecting it and then pressing the Remove button When an item is selected in the bottom list the Info button and Locate but ton become enabled Info will present a simple Get Info type of dialog box indicating the cut site and other
221. ooks Figure 3 12 Markers at Recognition Sequence normal However if the view is magnified see Magnification and Construct Scale page 3 44 to 3 nts cm it appears that the insertion point in the actual construct does not agree with the selected site marker as shown in Figure 3 12 page 3 14 In fact the drawing is correct in that the symbol is placed above the first nucleotide of the recognition sequence while the inser tion point in the DNA is at the actual cut site o n T gt oT re Figure 3 13 Markers at Cut Site Using the Construct gt Features gt Place Site Indicators at provides you an option to specify exactly how markers will be placed along a construct as shown in Figure 3 13 Using the dialog that appears you can specify that the site Page 3 14 Construct Window Listing Sites maker be placed either the beginning of the recongnition site for the enzyme or just to the left of the actual cut site In some extreme magnifications these options might actually change the order of some closely spaced restriction site markers In addition to marking sites using Construct gt Features gt Mark Sites specific posi tions on the construct can be labeled by using the Construct gt Features gt Mark Loca tion Marking a location allows you to specify a precise location e g nucleotide 2377 at which a marker will be placed Since you can define the name for the marker this is an ideal way to label specifi
222. ose Construct gt Get Info to see what that feature is Page 2 66 Tutorials Searching and Retrieving Sequence Files from GenBank TUTORIAL 14 SEARCHING AND RETRIEVING SEQUENCE FILES FROM GENBANK The following steps will demonstrate how to search and retrieve sequences from GenBank and have them automatically imported into GCK 1 To perform the following you need to be connected to the Internet If you are not already on line please connect now Choose Tools gt Deluxe Import gt Retrieve Sequence to start the process You will see Figure 2 70 Enter 3 Retrieve Sequence Entry name or accession Explanation J00231 You may enter an accession number e g a URL 400231 or entry name e g BUM or a sequence version e g JOO231 1 http www ncbi nim nih gov entrez eutils The URL is the location from where the results esearch fcgi db nucleotide will be retrieved 7 NCBI Genbank O EMBL Set Root URL Retrieve Figure 2 70 Retrieve Sequence Dialog JOO231 or any other accession number or sequence name you might be interested in into the box in the top left corner As you enter the accession number or sequence name into this box you can see a URL being con structed in the bottom left box this is not editable but is shown for you to examine what GCK is actually doing for you This URL will be sent to the server that you have designated GenBank and EMBL are two default options but you can also specify a
223. ose name is Ci and it is located on a volume called Applications in the folder called GCK f Two buttons are available Pressing Don t Change will close the dialog and leave everything as it was Pressing Select new GCK Data folder will bring up Figure 7 7 Use the standard buttons and popup menus to navigate to the folder you are inter ested in assigning as the GCK Data folder The name in the button at the bottom of this window will change as you navigate to different folders on your disk Note that the highlighted folder in this figure is GCK Data but the button Page 7 9 Menu Items Browse for Folder Sc Choose a GCK Data folder de web sites jy 2007 2008 GCK25W PSF X Home PSF Y j E K Ga Mac PSF Z V Adobe FrameMaker 3 cancel Figure 7 7 Choosing a New GCK Data Folder on the bottom shows the name of the current directory being viewed in this list Pressing the Select GCK button in this dialog would tell GCK to use the folder named GCK as the new GCK Data folder This would mean that the program could not find enzyme tables and other data it might need To choose the folder named GCK Data in Figure 7 7 you would first have to press the Open button to change the list to show the GCK Data directory and then press the newly named button called Select GCK Data which would appear at the bottom of the new dialog Quit File gt Quit command Q ctrl Q will close all windo
224. ot figure out what you want you will be shown alert boxes like Figure 7 21 Show Most Recent Generation Format gt Chronography gt Show Most Recent Generation fl command A fl ctrl A will display the most recent generation for each selected segment Show Most Ancient Generation Format gt Chronography gt Show Most Ancient Generation ff command Z fl ctrl Z will display Page 7 32 Menu Items A Some segments within the current selection have no next generation Show next generation where available anyway o Cancel Figure 7 21 Ambiguous Generations a generation corresponding to the oldest generation in existence for the selected segment of the construct user defined generation names The last section of this menu will contain the names of the various genera tions that you have defined You can show the generation by selecting its name from this menu Preferences The Preferences Submenu allows you to set the default values to be used when new windows are created by GCK A Construct Illustration or Gel window can be opened from the Preferences submenu To set a default characteristic for any given window just define the attribute as you would in the normal window For example in the Construct preferences window to define the default segment color double click on the segment to select it then select the desired default color from the Format gt Color submenu To change the font for m
225. our Agreement e Licensee agrees that the Software will be used solely for Licensee s internal purposes and that at any one time the Software will be installed on a single computer only If the Software is installed on a computer connected to a file server or other system that physically allows shared access to the Software Licensee agrees to provide technical or procedural methods to prevent use of the Soft ware over the network A network license or additional copies of the Software must be purchased for multiple computers e One installation of the Software may be made for BACK UP PURPOSES ONLY This installa tion can be made on a second computer which is an off site back up used by the licensee of the Software Documentation in whole or part may not be copied e Use of the Software by any department agency or other entity of the U S Federal Government is limited by the terms of the attached Rider for U S Governmental Entity Users which is incorpo rated by reference into this License e Licensee may transfer its rights under this License PROVIDED that the party to whom such rights are transferred agrees to the terms and conditions of this License and written notice is pro vided to Textco BioSoftware Upon such transfer Licensee must transfer or destroy all copies of the Software Page 8 9 Appendix Textco BioSoftware Inc License Agreement e Except as expressly provided in this License Licensee may not use copy dissem
226. pe Al Files hd Cancel Figure 7 5 Save As mats as you do with File gt Export everything is saved in Gene Construction Kit Page 7 5 Menu Items format This option will create a new file of the same type as the original file that was used to create the window Construct Gel List or Illustration The Original file remains unchanged and the window title changes to the new name All editing subsequently done in the window is done under the new name It is always the case that the window title is the same as the name of the file being edited Export File gt Export will present different options depending on the type of window cur rently active This topic was discussed in some detail in Tutorial 12 Importing and Exporting Sequences and Other Information page 2 60 and in Exporting Data From GCK page 3 41 A number of different output formats are possi ble in addition to the standard Gene Construction Kit formats Exported files can be saved as JPEG files along with several other standard file types These files can be opened by almost any graphics drawing program and should allow you to edit the images you create with Gene Construction Kit Note that the exported graphics formats cannot be edited in other programs as a collection of objects e g site markers cannot be moved sequence information is lost etc These manipulations are only possible in GCK Copies created as TEXT files contain the textual i
227. point and set the font to Arial 9 point plain text using the Format menu Type in a description of the Illustration cloning project gci Ru x a An Important Cloning Project El hsp70 gcc 5088 bp E amHI BamHI BamHI BamHI i construct 5 gcc Remove the middle BamHI site by de creating a silent mutation BamHI BamHI hsp70 Bam gcc 5088 bp Figure 2 56 Illustration 4 step used to modify hsp70 15 Click on the arrow tool the third tool from the left in the bottom left cor ner of the Illustration window and draw a vertical arrow from top to bottom as shown in Figure 2 56 16 We now need to create a legend for the site marker symbols in con struct 5 Double click on construct 5 to make it the target Now click on one of the site markers and press command A ctrl A Edit gt Select All to select them all Hold down the shift key and click on the BamH marker to deselect it Choose command C ctrl C Edit gt Copy to copy all the sites to the clipboard Page 2 54 Tutorials Making Illustrations 17 Click in the Illustration window under construct 5 and paste the site markers into the window command V ctrl V Drag the legend you just created to the left of construct 5 making it look like Figure 2 57 06008 illustration cloning project An Important Cloning Project Bl Sacl m Not hsp70 E Eso 5066 bp e Xbal o Spel BamHl BamHI BamHI BamHI XxX BamHl Smal X X Pstl e
228. r that will be the home of the newly created files You can type the name for a new folder in the Folder Name field Finally the Root name for constructs field will allow you to specify the prefix that will be used for all of the files generated Each of the generated files will start with the prefix text and will be sequentially numbered Press Generate Constructs to com plete the process PCR Analysis PCR Analysis balads Target BOVNEURXIA gcc 2871 4019 Parameters Description tlt eg 7 allowable range 75 Primer sizes Optimum size Minimum size Maximum size Miscellaneous Salt concentration mM Iv iv Iv iv Y Iv Iv Alignment score options Max Ns allowed options Pairs returned options Max end stability octions Primer melting temps 2 ax 117 Figure 7 27 PCR Analysis Window Polymerase Chain Reaction PCR is a method used to amplify small DNA segments GCK uses code developed at the Whitehead Institute with their permission This code is called Primer 3 and is one of the more highly thought of PCR analysis codes You can see a practical application of how to use the PCR analysis in Tutorial 16 PCR Analysis page 2 74 Page 7 40 Menu Items When you initiate the PCR analysis you will see Figure 7 27 page 7 40 There are a number of parameters that you can define as listed in the Param eters list on the left side of the window Clicking on any item in the list will show
229. re 3 36 It is possible to discard any gener ation by selecting the name of the generation in this dialog and then pressing the OK button Note that this operation is not undoable and once discarded this information is lost forever Finding Open Reading Frames It is often desirable to find open reading frames that might exist within a cloned DNA You can do this using the Construct gt Features gt Find Open Reading Frames option This will bring up Figure 3 37 This dialog explains that GCK Page 3 36 Construct Window Finding Open Reading Frames pBR322 4497 bp Figure 3 35 Showing Generation Indicators r Remove Generations Select generations to discard restriction sites regions of interest DNA sources Warning this action cannot be undone Figure 3 36 Discard Generations Page 3 37 Construct Window Importing Sequences Into GCK will search the construct from positions 1 2964 for open reading frames start ing with ATG that will produce proteins of at least 100 amino acids In this case the check boxes at the bottom specify that both the top and bottom strands of the DNA will be examined The default of 100 amino acids for a lt Find Open Reading Frames Se This command will create regions corresponding to open reading frames found in the following selected segment Start offset 1 End offset 4253 The following codon table will be used for translations Codon table name
230. re all available within the Shotgun Cloning window The Target and Source popup menus will display any open constructs that Page 7 38 Menu Items 6006 Shotgun Cloning Target Bluescript KS gcc 719 720 Source hsp70 1 5066 HA Digest The source sequence will be digested using the enzymes Hindill Use target enzyme Select Enzymes Output The generated constructs will be saved in the location Users bobgross Desktop Select Location Y Create a folder to contain the constructs Folder Name shotgun Names will be issued to the constructs by appending the index of the digest fragment to a shared root Root name for constructs hsp70_fragments Figure 7 26 Shotgun Cloning window you have and if there are site markers selected they will be used as the default enzyme s If the construct file is not open you can choose Browse from the popup menu to select the construct you want GCK will automatically Page 7 39 Menu Items open any chosen file If Use Target Enzyme is checked the selected site marker in the target DNA will be used as the default enzyme If it is not checked you can choose any enzyme you wish by pressing the Select Enzymes button Note that the enzymes you choose need to have an end that is compatible with the target site Incompatible ends will not be ligated into the target site Select Location will allow you to choose a folder or create a folde
231. rmat menu Select the AT rich segment from nucleotides 10 33 by dragging with the mouse Now Choose Format gt Font gt Times and notice that even though Times is not a monospaced font GCK still spaces the characters so that each character occupies the same width along the line Now choose For mat gt Style gt Bold The bold characters are wider than the non bold characters so this part of the sequence becomes more spread out You can adjust for that by choosing Format gt Style gt Condense which condenses the spacing between characters You can change colors fonts and styles for any seg ment of the DNA to help indicate certain features Feel free to try some of these on this segment now 3 Another method can be used to illustrate certain features This is through the use of Frames To see how frames work select nucleotides 676 699 they are in the polycloning region Choose Construct gt Features gt Make Frame This will create a frame around the segment of DNA you selected and will include the region amino acid sequence and site markers It should look similar Figure 2 19 The frame is selected highlighted and encloses all infor Eagl Notl Xbal Spel BamHI Smal Pstl 36 CGG CCG ETC TAG AAC TAG TGG ATC CCC CGG PCT co Pro Arg blu Leu Val Leu Pro Asp Gly Pro Ber Figure 2 19 A Framed Sequence mation related to that particular segment of DNA 4 The appearance of the frame can be altered by using items in the Format menu as usu
232. ruct 7 window double click on a Bfa site to select all of those sites Choose Edit gt Copy to copy the selected sites to the clipboard 12 Go to the orientation analysis gel window use the Window menu if you cannot find it and click the mouse at the top of the gel between lanes one and two to place the blinking triangle insertion point at that location Choose Edit gt Paste to paste the site markers into the new lane 2 note that the con struct 6 BsiHKA digest is now lane 3 13 Finally go back to the construct 7 window select all the Bs HKA sites Page 2 48 Tutorials Running Gels and Orientation Analysis copy them and paste them into the right edge of the gel this becomes lane 4 You should have Figure 2 51C 14 If you would like to add a lane of standards you can open the file called standards gel in the tutorial files folder to see several standard marker digests Click on the lane that is of interest to you to select it it will become high lighted copy it and paste it into your orientation analysis gel just as you did for the digests If you would like to see what this looks like open the file called orientation analysis in the tutorial files folder 15 If you do the actual cloning experiment and run a gel you should be able to distinguish the orientation of the insert by comparing the real gel to the predicted gel pattern shown in Figure 2 51C Open the ustratior called real gel analysis in the Sample Fil
233. s page 3 Mark Sites File commercial_6 3 Mark only those enzymes with Y blunt ends Y 5 overhang ends Y 3 overhang ends Aati i Enzymes to mark Aatil a Ace 0 Accill 0 Acc161 Remove Acc36l Acc65I Add All gt AccB11 AccBSI Get Info Aci M M Mark enzymes for which Display new sites more than 0 sites are found K as symbols Y less than 2 sites are found as enzyme names Mark enzymes whose sites are found in the selected sequence 0 occur exclusively within the selection Cancel 7 occur exclusively outside of the selection TR Figure 7 36 Mark Sites Dialog 10 this dialog allows you to specify how the sites are to be marked on the construct You can select the enzymes to be used choose the kinds of cut sites you want to be marked blunt 5 3 define the number of sites an enzyme must have to be shown specify whether the site marker should be displayed as a symbol or as a text label and specify whether the enzymes should cut only in specific segments of the DNA See Marking Sites page 3 10 for details on each of these choices Page 7 50 Menu Items List Sites Construct gt Features gt List Sites command L ctrl L performs an operation similar to that of Construct gt Features gt Mark Sites Mark Sites page 7 50 Each choice will search a construct for locations that match a sequence specified in a list file While Mark Sites
234. s Site pos 2763 Enzyme name BamHI Select a silent mutation to remove this site Old pattern New pattern Nuc pos Cancel Cook Figure 2 25 Selecting a Silent Mutation Figure 2 25 with the changed nucleotide being indicated in lower case in the actual sequence Choose File gt Save As name the file hsp70_Bam and save it in your own folder please do not replace the tutorial files provided because others might want to use them later You will need this file again in Tutorial 10 Making Illustrations page 2 50 8 You are now ready to proceed with the cloning Click in the DNA seg Page 2 25 Tutorials Cloning a DNA Segment and Silent Mutations ment at the left BamH site and drag the mouse cursor to the right until you have selected all the DNA between the two BamH sites The entire segment should be highlighted 9 Choose Edit gt Copy or press command C Mac ctrl C Windows to copy this segment to the clipboard Make the construct 5 window the active win dow either by clicking in the window with the mouse or by selecting it from the Window menu 10 You now need to tell GCK where it is that you would like to paste the BamHI fragment that is now in the clipboard To do this you must position the insertion point at the BamH site in construct 5 The easiest way to do this is to click on the site marker text BamHI Do this now 11 You are finally ready to do the actual cloning step Choose Edit
235. s SR beet oe Deets ete eed Pee 7 77 New LISCENUV aia a Biol tench Se diia feted 7 77 Define Cut Site a o 7 17 Alphabetical List t tae n e e a a es 7 77 Appendix Legal Nucleotide CharacterS 00 cee cece eee eee eee 8 1 import FileFormat renias erect cee tal oli ee gee hie 8 2 Comment Export Format 0 00 cece eee eee eens 8 4 GCK Acknowledgements 0 0c eee e cece eee n eens 8 5 Textco BioSoftware Inc License Agreement 0 00e0 eee 8 8 Index page 5 TABLE OF CONTENTS page 6 Overview Installing Gene Construction Kit Chapter 1 Overview Installing Gene Construction Kite The initial GCK installation places all needed files in a single folder The installed files include the most recent restriction enzyme database tutorial sample and help files and a vector database All the files need to be installed on your hard disk from this CD On the Macintosh Here is the complete step by step installation process 1 Insert the GCK Installer CD and locate the GCK folder 2 Drag this folder to your hard disk Although not strictly necessary it is best to drag it into the Applications folder 3 With the CD still in the computer start up the GCK application you just installed Enter the personalization information The first time you run the soft ware GCK needs to verify itself by checking the CD For subsequent launches this is not necessary 4 You are finished installing the
236. s and introns checked along with the polyA_site Uncheck all the other items because they will just make the display confusing at this point When everything is set press the Save Construct button 4 A new window will open up that shows you the construct you just cre ated It will look similar to Figure 2 75 but may not be identical because the polyA_si te Figure 2 75 G Gamma globin imported conversion choices you have might be different from the ones used here Note that the three exons are shown as thick black lines while the introns show a pattern of black dots The thin horizontal lines below the construct indicate the presence of comments You can turn them off by choosing Con struct gt Display gt Hide Comments 5 Double click on the first intron 200 321 and assign it a color of green Format gt Color gt Green Do the same thing for the second intron 545 1437 Note that you can see the range of nucleotides selected in the very bottom left of the construct window This will make it easier to identify introns and exons when we switch to sequence view 6 Choose Construct gt Display gt Display Sequence to view the construct as a sequence Let s make it a little easier to read by first making the window Page 2 71 Tutorials Translating Across Introns larger whatever is comfortable on your screen Choose Construct gt Display gt Show Positions to place position numbers at the beginning of each line
237. s the query information appropriately for each site If the site changes how it wants new queries formatted the DB server will be updated negating the need to update individual applications This arrangement also means that we can update the DB server with new sites and remove obsolescent sites without necessitating updating all of the GCK clients If you have suggestions for new sites that you feel would be of general inter est please let us know about them by sending us an e mail at info tex tco com Page 7 41 Menu Items Construct Menu The Construct menu provides complete control over the appearance of a con struct You can choose to show or hide certain features of the display and you can add regions and marked sites as well Both the graphics and sequence views of the Construct window are con trolled from the Construct menu Essen tially all editing of constructs is done in the Construct window using the tools provided in the Construct and Format menus Magnification This menu will be available whenever a construct is being viewed graphically Set Scale Magnification gt Features b Display gt Insert Ns Edit Construct End HE Set Beginning Position 1 General Info Make Circular 61 Construct gt Magnification gt Set Scale allows you to precisely set the scale at which the construct will be drawn Selecting this menu item will bring up Figure les Set Scale Figure
238. sarri eearri rrak Erim an eee ees 7 41 Construct MENU s ss semissonan aa a 7 42 MAgnItICatiON ressons rran sd TE DOI EERDERE eee cere S 7 42 ECATUTOS ei tiie Sige ied Sins eval de eet day beste 7 44 DISPlA Vta ded ea ale 7 58 IMSert NS2 tas ia Skis 7 64 INSERTE a sh ent a a eee ke 7 64 Edit Construct End Edit Cut Site 2 eee 7 64 FINA SEQUENCE fee ati to ia ee ds Pes 7 65 Set Beginning Position 0 00 snurrar eee eens 7 66 Redefine Origin 0 ccc eee ees 7 66 Select Framo iia dis 7 67 Select Sites By Kind 0 cece eee eens 7 67 GENOA E N EE E EE EE 7 68 General Info saors vein ynin a n a ee 7 68 Search Comments er ia aE SEEE laa ae 7 69 Make Linear Make Circular ooooooccooocoomommommoooo 7 69 Gel MENU oia ona so 7 71 Show Hide Runoff Count 0 00 ccc eee eee eee 7 71 Show Hide Gel Legend 00 0 c cece eee eee eens 7 71 Show Hide Standard Sizes 1 eee 7 71 Show Full Digest idss 480d da dead eas 7 71 Show Partial Digeste camiones malta deleted jolie dc 7 72 TABLE OF CONTENTS Set ThreShold ocuooocorninaca riera a Yad byes 7 72 Display Table Display Graphics 000 cence eee 7 72 Illustration Menu eee 7 73 Set Construct Scales ae wiecu kaa a Ra ee a 7 73 REGUCHON cai a Bee aE eh Beene eRe Ze 7 73 Sendo Backs sack ste a et ea a os 7 75 Bring To Front uns titans ch da da a ET dt 7 75 Align Selections iveco dais ese ieee te ve Wee ds 7 75 LISEIMGNU dos OR iet
239. see some thing like Figure 2 79 If you click on an item in the Parameters list you will lt PCR Analysis fo S le Target hsp70 gcc 1317 1616 Parameters 5 allowable range 75 E 7 allowable range 75 mj Primer szes Optimum sze Minimum size Maximum size Miscellaneous Salt concentration Alignment score Max Ns allowed Pairs returned 197990 0 I A T K I 4 00 0 0 60m 80000 6 amp amp amp Max end stability iv Primer melting temps Generate Primers Figure 2 79 PCR setup panel see a description of that item on the right side of the window Feel free to explore the parameters that you are allowed to set Those parameters that say optional can be left as they are or you can fill in values for them For now set the 5 and 3 allowable ranges to 75 and press the Generate Primers button 5 This will bring up Figure 2 80 There are 5 possible primers that meet the criteria set in the original parameters The bottom of the window presents some statistics on how all possible primer pairs were filtered to generate the list shown in the window 6 Select the middle primer pair 1293 1312 1762 1781 and press the Add Primer button If you want to you can add multiple primers to the con struct but for now just add the one After you have added the primer press Page 2 75 Tutorials PCR Analysis en lt S Primer List Target hsp70 protein 1317 1616 GGTCATTTGTTTGGCAGAAAG 1293 1
240. selection in the DNA otherwise the choices do not make any sense If no DNA is selected the search will take place on the entire construct DNA Choosing are found in the selected sequence will mark only those enzymes that have a recognition sequence within the selected DNA These enzymes might also have sites outside of the selected segment Choosing are found exclusively within the selection will mark only those enzymes that have recognition sequences within the selected Page 3 11 Construct Window Site Markers DNA and have no other sites elsewhere in the construct Choosing are found exclusively outside the selection will mark only those enzymes that have no sites within the selection but do have sites outside the selection Using this cluster of choices together with the Mark enzymes for which cluster allow you to find exactly the right enzymes for the task you want to accomplish Site Markers If you choose to mark sites as symbols GCK will choose symbols from the symbol table see Symbol page 7 22 and will mark all sites for a given enzyme with the same symbol If there are more enzymes chosen than there are symbols in the table more than one enzyme will end up having the same symbol Note also as a result of how the symbols are chosen if you mark sites for a specific enzyme at different times the site marker symbols might end up different If you want to be sure that all the sites for a given en
241. so show fragments from complete digest check box draws the fragments that would be present in a complete digest as solid lines in addition to the partial digest fragments that are shown as dotted blue lines The show only partially digested fragments radio button will show only the partially digested fragments those containing internal sites while the show all fragments from partial digest will draw both partial and complete digest fragments from the digest as dotted lines You can change the partial digestion parameters for any lane by choosing Gel gt Show Partial Digest again Choosing Gel gt Show Full Digest from the Gel Menu will display the lane as a complete digest Exporting Gels Exporting from the Gel Window also provides similar choices Gel TEXT Page 5 5 Gel Window Exporting Gels and PICT TEXT format will save a list of all the cut sites and fragment sizes as if they were viewed in the Gel Window as a Table see page 5 3 Page 5 6 The Illustration Window Selection vs Targeting Chapter 6 The Illustration Window The Illustration window is designed to fill three needs 1 to facilitate creation of figures for papers or presentations 2 to keep track of complex construc tion projects and allow you the flexibility to change and update the project information easily and 3 to serve as a library of commonly needed con structs linkers adaptors polycloning regions gel standards etc
242. specify whether the search will examine the top and or the bottom strand of the DNA sequence Once the ORFs are found they are automatically marked and named in the Construct window If Show Region Names is on Show Region Names page 7 28 the names will be shown next to the regions them selves as shown in Figure 7 33 page 7 48 Page 7 47 Menu Items 00608 lt Construct Bluescript KS gcc open reading frame open reading frame 6 open reading framet4 n reading frame 3 open reading frame 5 open reading frame en reading frame 1 Figure 7 33 Open Reading Frames Make Frame Frames were discussed in some detail in Tutorial 5 Modifying the Construct Appearance page 2 20 Frames are boxes that can be placed around parts of a construct sequence listing Construct gt Features gt Make Frame will create a frame around any selected sequence An example is shown in Figure 7 34 Once a frame is created its appearance can be changed using the items in the Format menu as explained in Tutorial 5 In this figure the frame is a light gray and the fill pattern is striped This does not obscure the sequence listing Page 7 48 Menu Items Sacll Dsal Sac BstXI CGAATTGGAGCTCCACCGCGGTG SerAsnSerSerTrpArgProPr Figure 7 34 A Frame A frame can be selected in any of three ways e hold down the option key and click anywhere inside the frame e choose Construct gt SelectFrame Select Fram
243. struct pGEM1 which is shown in part D The Illustration window has some built in intelligence If you copy a part of a circular construct from a Construct window and then paste it into the Illustra tion window the segment will be displayed as an arc as shown in part C This makes it easy to display cloning strategies involving segments of circular constructs The last part of this Illustration is part E which is a legend to the sites shown in D for pGEM1 Legends like this can be created automatically in the Illustration window by selecting the site marker symbols in a Construct window copying them and then pasting into the Illustration window The built in intelligence of GCK will interpret the site markers being pasted into the Illustration window as a legend The Illustration window tool palette resides in the bottom left corner of the window border and is shown in Figure 6 3 Six tools are available The first TADO Figure 6 3 Illustration Tool Palette one the selection tool kj allows you to click once on any object with the mouse to select that object within the Illustration window You can select constructs gels sequences or any objects generated with the other tools in the Illustration Tool Palette You could also select any graphic objects pasted into the Illustration from outside the Gene Construction Kit By dragging with the selection tool you can select multiple objects in the Illustration wi
244. t The insertion point is where new sequence would be placed into the current construct by typing or pasting between nucleotides 625 and 626 in this window you might have a different location in your file Clicking with the mouse anyplace along the DNA will place the insertion point at the closest boundary between two seg ments 4 Double click on the red segment of DNA to select it This is similar to selections made in standard text editing programs where double clicking selects a word This will highlight the red segment as shown in Figure 2 3 page 2 4 Note how the indicator in the bottom left corner now shows the Page 2 3 Tutorials Working with Constructs 0008 lt Construct Bluescript KS gcc 792 625 v Figure 2 3 Selected Segment range of nucleotides selected The range is always shown in the clockwise orientation or from left to right for linear constructs You should see 792 625 selected The origin top of construct is defined as position 1 Clicking on this popup menu will also allow you to show the position of the cursor as you move it over the DNA or the size of the selected DNA segment 5 Once an object like a DNA segment is selected you can modify it Choose Format gt Lines gt and choose the second line down to change the width of the selected DNA segment to 2 pixels In the Lines menu you can set the width using the line thicknesses shown in the menu or you can choose Format gt Lines gt Pick a Widt
245. t double clicking on the amino acid sequence This is a built in feature of GCK to make it easier to select DNA segments that correspond to regions Double clicking on any region will select the cor responding segment of DNA So double click on the amino acid sequence corresponding to the f galactosidase gene it ranges from 244 846 Now choose Format gt Grouping gt Group by Threes 7 We now need to indicate our origin of replication Identifying origins of replication is something that you might like to do in all of your constructs and you would like an easy visual method of identifying those regions from amongst the many that you might end up marking You can do this by defin ing a specific color to represent an origin of replication Choose Format gt Color gt Add a Color You will see Figure 2 16 Type in origin of replication for the name of the color and then press OK Choose a color from your computer s standard Color Picker Now you have defined a new color called origin of replication This color should now appear in the Format gt Color menu The ability to define your own color and to name it provides an easy way for you to indi cate features of interest such as promoters enhancers and other sites on DNA If all your constructs are defined using your own standard colors it will be easy to recognize specific functions of constructs just by observing the colors 8 Let s take advantage of the new color we just crea
246. t overlaps the polycloning site Now choose Construct gt GetInfo to bring up Figure 2 13 page 2 13 This dialog contains information about the selected region You can change the direction of the region by clicking the Top Strand or Bottom Strand radio buttons Changing the numbers in the First Nucleotide or Last Nucleotide box will change the length of the region The Protein Sequence check box determines if the region is to be translated or not when viewed as an actual sequence see Tutorial 4 Viewing the Construct as a Sequence page 2 15 for more information 6 This region is the beta galactosidase region so type beta galactosidase into the Region Name text box You can also enter comments into the Region Comments text box Both the name and the comments can be searched by GCK later Tutorial 8 Finding Comments and File Searching page 2 38 In this case it might be reasonable to enter some comments about this vector Page 2 12 Tutorials Marking Open Reading Frames Region Info Name open reading frame 1 First Pos 244 Y Protein Sequence Read from Last Pos 816 J top strand Generation 0 bottom strand Comments Ls Figure 2 13 Region Get Info Dialog and how the polycloning site disrupts the f gal coding region Click OK to close this dialog box 7 With the region still selected choose Format gt Regions gt Show Region Names This will display the region name in the construct window
247. t will correspond to the region and then choosing Construct gt Features gt Make Region command R ctrl R If no segment of DNA is selected and Make Region is chosen you can simply type in the first and last nucleotides to be included in the region The create Region Info Region Name IV Protein Sequence myosin Region Comments These comments are about the myosin gens C lt Bottom Strand First Nucleotide 1976 Last Nucleotide 2833 Figure 3 3 Creating a Region region dialog box is shown in Figure 3 3 You can provide a name for the region and can enter any comments that you would like to keep stored with the region If the corresponding segment of DNA is copied and pasted into another construct all the comments associated with the region will be carried to the new construct as well By placing an x in the checkbox Protein Sequence the region could also be defined as a protein region In this case the corresponding DNA will be translated and the protein sequence shown whenever the construct is viewed in a sequence view of the Construct window This was illustrated in Tutorial 3 Marking Open Reading Frames page 2 11 Overlapping regions can be defined by choosing appropriate segments on the DNA that correspond to the desired region and then selecting Construct gt Fea tures gt Make Region Once a region is formed it can be selected by clicking once with the mouse The appearanc
248. tain a consis Page 6 6 The Illustration Window Changing Magnification tent illustration Because each construct and its associated Chronography can be copied from the Illustration into a new Construct window you can even use the Illustration as a sort of graphic interactive database for the constructs in a project Objects like adaptor sequences can be stored in the Illustration window for later retrieval when needed during another project Changing Magnification For large Illustrations that do not fit on the screen the entire image can be seen by choosing Edit gt Show Overview This option presents a miniature view of the entire Illustration The cursor will change to a magnifying glass Clicking the magnifying glass on a specific location will zoom to normal size with the clicked point centered on the screen Magnification can also be changed using the Illustration gt Reduction gt menu This menu only allows for the reduction of the view i e zooming out so that more of the illustration can be seen Illustration gt Reduction gt Reduce is available whenever part of the illustration is out of view Illustration gt Reduction gt Enlarge is available whenever the view has been previously reduced Illustration gt Reduction gt No Reduction returns the view to its maximum size and Illustration gt Reduction gt FullReduction reduces the entire illustration to fit in the current window size Reducing an illustration provides
249. tal design errors The backbone of the program is the construct which represents a DNA sequence and all associated sites regions of interest segments comments and history The construct can be manipulated and analyzed using four types of windows Each GCK window visible on the screen corresponds to a file on the disk The name of the window is the name of the file There are four kinds of GCK windows Construct List Gel and Illustration These are described briefly below and in their own chapters in this manual All manipulations of the actual DNA are carried out on the construct within the Construct Window Restriction enzyme and other sites can be marked regions of interest can be defined silent mutations generated PCR products generated and the appearance of the construct and its annotations can be edited within the Construct Window The construct can be displayed as linear or circular and either graphically or as a formatted DNA and protein sequence listing Construct Window details are discussed in Chapter 3 page 3 1 The List Window is used to create maintain and edit lists of sequences The list may contain restriction enzyme recognition sequences protein binding sites linkers promoters etc Cut sites can be defined for sequences in the Page 1 3 Overview Running The Program list and comments can be associated with any item in the list When the list items are used to mark sites in the construct the comments remain ass
250. te displays at any time One use for Chronography is to actually use generations to keep track of the different steps used in getting to the current stage of the construct For exam ple you decide that you want to place a polycloning sequence into pBR322 to give you a primitive expression vector for a number of other experiments You would like to define a new generation view of the construct which illus trates those parts of the construct that were derived from pBR322 in contrast to those that contain the promoter and the polycloning site Viewing the current generation of pBR322 see Figure 2 29 page 2 30 and choosing Format gt Chronography gt Start New Generation will bring up Figure 3 32 page 3 34 You can choose which properties of the current generation you wish to appear in the newly created generation by using this dialog The set tings shown in Figure 3 32 will lead to a new generation containing just the red circle of DNA and no sites or regions marked This new generation Page 3 33 Construct Window Chronography Tracking Construct History lt New Generation es Generation Name star trek Generation Comments V Keep displayed segments V Keep displayed regions V Keep displayed site markers Figure 3 32 Starting a New Generation becomes the current generation and like all current generations is referred to as generation O The view that was shown in Figure 2 29 page 2 30 what us
251. ted radio button In this case only construct files are shown As in the New dialog box the same command key equivalents function gt Open Gene Construction Kit Enable All GCK Document Types xs eT m L tutorial files IS Q 4 4 DNAs to import lt S actin DNA 4 GCH lt Bluescript KS gcc lt cloning project S constructitl S construct 2 L GCK Data I GCK vectors GCK3 construct 3 in ult 15 S constructit4 L KeyServ ertificate lt S construct 5 Jew j S construct 6 2 older versions s constructit7 S el eNot construct 22 ze 72KB tutorial files gt f r illustration v lt S hsp70 v Documents 4 ll lt hsn70 Ram ii t 3 24 97 tl va gt New Folder Cancel E Open Figure 7 2 Open Dialog Page 7 2 Menu Items as short cuts In addition command A ctrl A selects All Types The Eject but ton will eject the disk that is named above the buttons unless it is a hard disk or some other volume that cannot be unmounted The Drive button will show you the files on a different mounted drive Open will proceed to open the file selected in the list on the left and will create a window containing the infor mation from that file and Cancel closes this dialog box Once you open a file a new window will appear having the name of the file in the title bar of the window The type of file will also be indicated in the window title bar There is a direct correspondence between each window op
252. ted to identify the ori gin of replication for our construct Use the mouse to select nucleotides 3 Page 2 17 Tutorials Viewing the Construct as a Sequence Add Color To Menu Name of colorto add to menu promoter Use currently selected color e Choose color from palette Cancel OK Figure 2 16 Add a Color Dialog through 458 You can confirm that you have the correct nucleotides selected by looking in the lower left corner of the window Choose Construct gt Features gt Make Region You will see the dialog shown in Figure 2 17 Make sure you Region Info Name origin of replication First Pos _ Protein Sequence w Last Pos 458 Generation 0 Comments This corresponds to the origin of replication for phage ff PTY 4 Cancel OK gt Figure 2 17 Creating a New Region type in the correct name and put any comments you have into the comments area This is NOT a protein sequence so do not check the Protein sequence checkbox Confirm that the first and last nucleotides are 3 and 458 respectively Press OK 9 The newly created region will be selected so you can now alter its a If it is not selected then just click on it once to select it Page 2 18 Tutorials Viewing the Construct as a Sequence appearance Choose Format gt Lines and select the line having an arrowhead at both ends This will change the region to have two arrowheads 10 With the region still selected
253. ters This can serve as a means of transferring the sequence information generated in the GCK to other programs for analysis Selecting the GCG File button will save the Page 3 42 Construct Window Exporting Data From GCK sequence and associated comments for the current view of the construct as a Wisconsin Package GCG file This file format is a common format used by many programs to store information and is very useful for sharing sequence files with colleagues who might have different analysis programs The Comments as TEXT File option will save a complete list of all the comments associated with the current construct for all generations The list will be arranged by generation and by position from the origin or 5 end This provides a convenient way of archiving a hard copy of the information contained in all the objects from all the generations of the construct This comment file format is listed in the Appendix Comment Export Format page 8 4 When viewing the construct as sequence in the Construct Window choosing File gt Export will give you the window shown in Figure 3 42 page 3 43 In this O Save Gene Construction Kit Export As Save As pBR322 txt fal m0 new tutorials 3 A search a Name AR Date Modified Format PATAC TERT ee DNA Sequence As Text File ancl xe GCG File Comments As Text File Figure 3 42 Export Sequence Construct case there is an extra option called Formatted Listing as
254. the construct selected that particular segment This works the same way in the sequence view So double clicking anywhere in the DNA sequence will select that entire segment Try this by double click ing anywhere in the sequence to get a feel for how segments are defined You will notice that segment boundaries can be site markers or changes in color or text characteristics Page 2 16 Tutorials Viewing the Construct as a Sequence 5 With the insertion point mouse cursor anywhere in the DNA sequence choose Edit gt Select All command A Mac or ctrl A Windows This will select all of the DNA sequence Now choose Format gt Grouping gt Group by Tens This will arrange the sequence to be displayed in groups of tens Note that there is an option in the Format gt Grouping menu to define your own group size This can be useful for example if you are working with something like an octamer repeat You can define a groups size of 8 to display this repeat easily 6 Grouping by ten is good for viewing the sequence and identifying specific locations but does not look right for viewing those parts of the sequence that correspond to translated regions of the DNA We need to group the translated regions into groups of three corresponding to the codons This can be done in two ways You could select the DNA corresponding to the peptide by clicking and dragging the mouse over the correct region of DNA There is an easier way to do this however by jus
255. the dis play of any selected marked site s to either symbols or text You can change between these two formats at any time and can restrict the change to an individual site marker Show Name Only Show Position Only Show Name and Position Format gt Site Markers gt Show Name Only Format gt Site Markers gt Show Position Only and For mat gt Site Markers gt Show Name and Position allow you to specify the text to be shown when the site marker is viewed as text The position will be indicated in the site marker label as it is defined in Set Position Delimiters 9et Position Delimiters Format gt Site Markers gt Set Position Delimiters submenu item allows you to set the characters that will be used at the left and at the right of the position indicator Page 7 25 Menu Items lt gt Set Delimiters a Figure 7 16 Set Position Delimiters text Using the dialog box shown in Figure 7 16 you enter the text you want to be placed to the left and to the right of the actual position number In this case the site name will be followed by a space and a left parenthesis after the position number there will be a right parenthesis The site marker might look like HindIII 29 Attach at Left Attach at Center Attach at Right At Nearest Horizontal These four items define how the line extending from the construct to the site marker will attach to the site marker t
256. the middle will be too Page 2 50 Tutorials Making Illustrations IS Set Scale eS Figure 2 52 Set Construct Scale large They need to be fixed 6 One of the most powerful features of the Illustration window is that objects can be edited as if they were in their own windows To access the editing simply double click on the construct 5 this is called making the object a target or targeting an object Target construct 5 now Note that there is now a Construct menu in the menu bar in addition to the Illustration menu Click on the construct title and drag it below the circle Adjust the line thickness and arrowhead size for the orange region by using Format gt Lines gt If region names are shown hide them using Format gt Regions gt Hide Region Names You should try to get something that looks like Figure 2 53 page 2 52 7 Now let s put a title in the illustration Click on the T icon in the lower left corner of the Illustration window to activate the Text tool Click the mouse near the top left corner of the Illustration window You will see a blinking insertion point Before you type anything you need to set the font and font size Using the Format menu choose Arial as the font and set the font size to 24 Now type An Important Cloning Project Don t worry about the appear ance of the text for now we will fix it in the next step 8 What you will see is large letters of text overwriting the construct To f
257. the new GCK you will be asked to insert the original CD unless it is already in the CD drive This is the only time you will need to do this unless you reformat your hard disk Updating Gene Construction Kit Updates are available for GCK from our web site as they are needed You must have at least version 3 0 0 to update through the web Check lt http www textco com updates html gt to see if there is a newer version To run the newer version of the application download it from the web site remove the previous version of the application and put the new version into the GCK folder on your hard disk After checking that it works discard the older version of GCK Up to date instructions are always available at the web site Page 1 2 Overview Overview On the GCK CD we have included a demo version of Gene Inspector This is Textco s DNA and protein analysis program that complements GCK You can install the demo using the installer provided in the Gene Inspector Demo folder Please call us if you have any questions or problems We hope you enjoy your new software Overview The Gene Construction Kit has been designed to facilitate handling DNA in an innovative and intuitive way Over a decade of development by a team consisting of molecular biologists and programmers has lead to an interface and a set of functions in Gene Construction Kit GCK that will significantly enhance laboratory productivity and minimize experimen
258. tial fragment sizes from a digest to facilitate the selection of appropriate construction pathways The Gel Window shown in Figure 5 1 allows you to view predicted gel electro phoresis patterns for any construct s together on a single gel 0008 lt Gel orientation analysis 1 2 3 4 5 BRL DNA Stds 1 kb ladder construct 6 Bfal construct 7 Bfal construct 6 BsiHKAl ____ 5 construct 7 BsiHKAl 1900 4000 2000 akon 800 60g 400 200 3 Figure 5 1 A Gel Window The cursor changes into a horizontal I beam when it is over the gel and functions as a size indicator The lower left corner of the window itself pro Page 5 1 Gel Window Legend vides a constant readout of the size in nucleotides a fragment would be at the current location of the cursor lt provides a convenient way to see an approximate size for any band in the gel Legend The legend which is visible just to the right of the gel indicates which con struct and enzyme s were used to produce the banding patterns in each lane and in the case of partial digests specifies the extent of digestion e g see lane 4 which indicates that 7 out of 8 possible sites were cut The legend consists of lane numbers and the actual legend adjacent to the gel The legend can be made visible or not using Gel gt Show Hide Gel Legend At the bottom of each lane is an indication of the number of fragments
259. till remain in the restriction enzyme file for use in other digests this item just removes it from the list of sites to search for e The Mark enzymes for which cluster allows you to specify a range of cutting frequencies for which you would like to see sites actually marked If you leave these fields blank all sites are shown The top field More than n sites are found lets you define the minimum number of times an enzyme recognition site must be present in the target DNA in order for that enzyme to be marked To activate a minimum number make sure that the check box at the left of the text has an x in it The bottom field Less than n sites are found lets you define the maximum number of times an enzyme recognition site must be present in the target DNA in order for that enzyme to be marked By checking both check boxes you can specify a range of cut frequencies to be found For example if you want to see all enzymes that cut between 2 and 5 times you would put a 1 in the top box and a 6 in the bottom box e The Display new sites cluster allows you to specify how you would like to mark the new sites as symbols or as text Choose one of the radio buttons to make your choice e The Mark enzymes whose sites cluster allows you to define which parts of the construct are to be used as the target for the searching The only time the radio buttons are active in this cluster is when you actually have a
260. tion to occur Note that if you cut a segment out of a construct and that segment has differ ent sites on each end you will also get a ligation dialog since the program Page 3 25 Construct Window Cutting Copying and Pasting Segments needs to know how the two resulting ends should be joined together This feature forces you to accurately keep track of segment ends and maintain an accurate sequence just as you would have to do in the lab to recircularize the construct after removing a segment You can also paste fragments using the Edit gt Special Paste The Special Paste dialog is shown in Figure 3 23 Invert Sequence will invert the sequence Special Paste Y Invert Sequence gt Trim All Ends Fill All Ends a Leave Ends Alone Figure 3 23 Special Paste before pasting it into the new site Trim All Ends will trim any single stranded tails from all four DNA ends before pasting just like treating with S1 nuclease Fill All Ends will fill in all the complementary nucleotides on all four ends before pasting just like filling the ends with DNA polymerase but be careful not to fill the ends in the 3 to 5 direction unless you have figured out a way to do this biologically as well Leave Ends Alone will present you with a dialog box if the ends are incompatible as in the normal pasting of a segment Leave Ends Alone in the absence of inversion is equivalent to a normal pasting operation Sometimes you wil
261. tions of the sites for that chosen enzyme Select BamHI in the bottom list and then press the Locate button on the right This will bring up the locate sites dialog shown in Figure 2 60 Locate Instances Name Instances BamH Sequence GGATCC Starting at position Done Figure 2 60 Locate Sites Dialog This dialog gives information about the selected enzyme and then lets you define the site locations Type in 200 in the Starting at position text box and press the Add button to add this location to the list of sites to place it will appear in the list of instances at the right Next type in the position 1000 and add it to the list and then add 3456 You should have these three loca tions in the list on the right Once you have done this press the Done button because you are done entering locations for BamHI sites Page 2 57 Tutorials Working With Generic Constructs 5 Select EcoA in the list Figure 2 59 page 2 57 and then press the Locate button In the locate sites dialog that appears Figure 2 60 page 2 57 enter 2000 and 4000 as the Eco site locations You have now defined the enzymes and their sites so press the OK button to actually place those sites 4008 lt Construct untitled NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
262. to amp galactosidase construct 5 2964 bp ampicillin resistance Figure 3 5 A Comment Indicator select the corresponding segment of DNA and then view the comments by choosing Construct gt Get Info In operational terms these comment indicators behave very similarly to regions However comment indicators and regions can be shown and hidden separately regions do not have to have comments and regions can represent protein sequences Page 3 7 Construct Window Attaching Comments to Objects in Construct Window Construct gt General Info is another kind of information that is attached to a con struct A dialog showing general information is shown in Figure 3 6 page 3 8 This information is actually attached to the file whole construct and not an individual object in the Construct Window as are all of the other Get Info comments General Info may be used to store literature references or information about the location of the construct in the lab e g freezer in 318 shelf 4 If you select the entire construct copy it and paste it into an empty Construct Window the General Info will be preserved as General Info On the other hand if you paste into an existing construct the General Info will be converted to information attached to the resulting segment 000 Construct Info construct 5 Name construct 5 Size 2964 Comments This file was downloaded from the 12 87 VecBase by Keith A Johnson 4 on Dec 14 1989
263. to rials now will save you many hours in the future The Gene Construction Kit has a number of unique features you might not have seen in any other appli cation the tutorials provide a way for you to learn about these unique capa bilities In many locations in this chapter and throughout the manual you will be asked to select items in menus To make your choices as clear as possible all menu selections are indicated as hierarchical choices using this Menu font such as Edit gt SelectAll This particular case means to locate the Edit menu and then choose SelectAll under the Edit menu Page 2 1 Tutorials Working with Constructs TUTORIAL 1 WORKING WITH CONSTRUCTS Perhaps the most important window in GCK is the Construct Window This is the place where you will do the majority of your cloning manipulations and can precisely define how your construct will look In this tutorial you will learn how to modify the appearance of constructs Tutorial 2 Marking Sites page 2 8 shows how to mark restriction sites and other features in your construct Tutorial 7 Chronography Tracking Cloning History page 2 30 shows how GCK can automatically keep track of construct history for you Tutorial 4 Viewing the Construct as a Sequence page 2 15 discusses the sequence view of a construct 1 Start GCK 2 Open the file called Bluescript KS in the tutorial files folder by choosing File gt Open This will bring up Figure
264. truct pBR322 sep AH EcoRI ganill sp Hindili Ampicillin Resistance Tetracycline Resistance scan Aon BspLU111 BsaAl Pwull 150 ASPI BsmBl Pfol 127311274 v Figure 7 17 Region Names 7 17 page 7 28 This option is not available in the sequence view of a con struct Note that when a region graphic is selected the region name is also selected and vice versa This makes it easy to see which name corre sponds to which graphic when the names are moved around Reset Region Name Positions The Format gt Regions gt Reset Region Name Positions menu item will return a region Page 7 28 Menu Items name to its default position along the region to which it corresponds Grouping The Format gt Grouping submenu is only enabled when the sequence view of a Construct window is active It allows you to define precisely the way in which the DNA sequence is displayed and printed Grouping refers to the number of nucleotides that are placed adjacent to each other without any intervening spaces No Grouping Format gt Grouping gt No Grouping fl command ff ctrl will allow the sequence to wrap around based on the width of the window Group by Threes Format gt Grouping gt Group by Threes ft command F fl ctrl F is useful for displaying the DNA sequence above a translated amino acid sequence Group By Tens Format gt Grouping gt Group By Tens f command T ctrl provides a useful
265. truct pBR322 gcc son aA EcoRI Hindili BamHI Pvul Sall 850 PstI 161 4282 1 iat Figure 2 29 pBR322 as Graphic few restriction sites marked Note that the Sa site shows both the name and position for the marker This can be set in the Format gt Site Markers menu see Site Markers page 7 23 for more detail The bottom right corner of the window shows a scale marker indicating the scale of the drawing The scale marker can be shown or hidden by using the Construct gt Display gt Show Hide Sites 2 Choose Construct gt Display gt Display Sequence to bring up Figure 2 30 page 2 31 As you will see chronography can be used to store the appearance of a Page 2 30 Tutorials Chronography Tracking Cloning History 09e lt S Construct pBR322 HindIII z TTCTCATGTT TGACAGCTTA TCATCGATAA GCTTTAATGC GGTAGTTTAT CACAGTTARA 61 TTGCTAACGC AGTCAGGCAC CGTGTATGAA ATCTAACAAT GCGCTCATCG TCATCCTCGG 121 CACCGTCACC CTGGATGCTG TAGGCATAGG CTTGGTTATG CCGGTACTcC CGGGCCTCTT 181 GCGGGATATC GTCCATTCCG ACAGCATCGC CAGTCACTAT GGCGTGCTGC TAGCGCTATA 241 TGCGTTGATG CAATTTCTAT GCGCACCCGT TCTCGGAGCA CTGTCCGACC GCTTTGGCCG 381 CCGCCCAGTC CTGCTCGCTT CGCTACTTGG AGCCACTATC GACTACGCGA TCATGGCGAC BamHI 361 CACACCCGTC CTGTGGATCC TCTACGCCGG ACGCATCGTG GCCGGCATCA CCOGCGCCAC 421 AGGTGCGGTT GCTGGCGCCT ATATCGCCGA CATCACCGAT GGGGARGATC GGGCTCGCCA 481 CTTCGGGCTC ATGAGCGCTT GTTTCGGCGT GGGTATGGTG GCAGGCCCCG TGGCCGGGGG 541 ACTGTTGGGC GCCATCTCCT TGCATGCACC ATTCCTTGCG GC
266. uct instead of the range of selected nucle otides Parts of a construct can be selected and the appearance of that segment can be adjusted Once selected a segment can be copied or cut and then pasted into other Construct windows or elsewhere in the same construct Some Important Definitions e Segment A segment in a construct is a range of nucleotides that has a distinct appearance and spans between two borders In the sequence view all nucleotides in a segment must have the same font style size and color In the graphic view all locations nucleotides in a segment must have the same color fill pattern and line thickness e Region A region or region of interest is a feature that corresponds to a Page 3 2 Construct Window Selecting Segments range of nucleotides in the DNA Regions appear inside circular DNAs or below linear DNAs in the graphical view In the sequence view regions always appear below the sequence itself A region may have a direction because an arrowhead can be placed on one or both ends of the region indicator Regions with arrowheads at both ends or at neither end do not have a direction Regions may optionally be protein sequences in which case they must have a direction In the sequence view protein regions are created by translating the corresponding DNA sequence in the direc tion indicated by the arrowhead It is possible to have multiple overlap ping regions corresponding to a given range of
267. uction Kit to front when opening files Figure 7 24 Feature Transfer Preferences sequences from either GenBank or EMBL databases As shown in Figure 7 25 page 7 37 You can enter either an accession number or a keyword Retrieve Sequence Entry name or accession number Explanation Jod231 You may enter an accession number e g J00231 or URL entry name e g BUM or a sequence version e g J00231 1 http www ncbi nim nih govw entrez feutils esearch fegi do nucleotid The URL is the location from where the results will be esterm J002318retmax 18useh retrieved X NCBI Genbank C EMBL Set Root URL Retrieve Figure 7 25 Retrieve Sequence Dialog description for the sequence If you have a local database that is set up using the GenBank format you can choose to search that database by pressing the Set Root URL button This feature is useful if you are searching private databases Note that the target database must be in the same format as either GenBank or EMBL databases in order for the retrieval to work Search GenBank This option was discussed in Tutorial 13 Importing GenBank Sequence Files Using Deluxe Importing page 2 64 You can search GenBank by entering a keyword in any number of categories The categories are accessible using a Page 7 37 Menu Items popup menu as shown in Figure 2 71 page 2 68 Conversion Defaults The conversion defaults specify how each feature in the GenBank table will b
268. ust site markers Rather it is the construct DNA along with the positions of the marked sites This can be converted to fragments in the Gel window Page 2 47 Tutorials Running Gels and Orientation Analysis A B C 8008 SGel orientation analysis Q Q SGel orientation analysis QQ lt Cel orientation analysis 2 Fi 1 construct 6 Bfal E 1 construct 6 Bfal a 1 construct 6 Bfal 2000 2000 2 construct 6 BsiHKAl 2008 _ 2 construct 7 Bfal E z construct 6 BsiHKAl al 1000 1000 1eee 88 4 construct 7 EsiHKAl 509 500 soo pe 400 400 400 Il 300 300 3001 a 200 200 200 100 toe Ti AA Figure 2 51 Orientation analysis gels selected sites to the clipboard 8 Return to the Gel window make sure the triangle is on the right of the gel and choose Edit gt Paste to paste the site markers into lane 2 You should see Figure 2 51B These are the digests you would get from construct 6 having the hsp70 insert in the clockwise direction 9 In order to compare these digests with ones from construct 7 which has the hsp70 insert in the counter clockwise direction you need to do a similar series of steps on construct 7 So 10 Repeat the digests with Bfa and BsiHKA using construct 7 DNA by marking sites Construct gt Features gt Mark Sites you should see something like Figure 2 47 page 2 45 again 11 In the const
269. ved to prevent any confusing or ambiguous annotations from remaining Page 2 26 Tutorials Cloning a DNA Segment and Silent Mutations lt Construct construct 5 gcc N ampicillin resistance X OC Pr eocO h construct 5 gcc 5177 bp Figure 2 26 Pasted hsp70 Fragment memory and you have a segment of DNA selected pasting will replace the current selection with what we paste into the construct from the clipboard This is just like replacing selected text in a word processor with the contents of the clipboard You will see Figure 2 27 Check the Invert Sequence Special Paste Y Invert Sequence _ Trim All Ends Fill All Ends a Leave Ends Alone Figure 2 27 Special Paste check box and select the Leave Ends Alone radio button Press OK This Page 2 27 Tutorials Cloning a DNA Segment and Silent Mutations will replace the currently selected hsp70 segment with an inverse version of the same DNA i e it will be flipped over 15 Choose File gt Save As name the file construct 7 and save it in your own folder please do not replace the tutorial files provided because others might want to use them later Since cloning the hsp70 fragment into the BamHI site has an equally likely chance of occurring in either orientation these con structs construct 6 and construct 7 represent two possible outcomes in a real experiment You will be able to use these constructs and GCK to predict gel patt
270. vg Pro Pro a am 676 CGG CCG C ATC CC GCT GCA GGA ATT 494 Pro Arg Glu Leu Val Leu Pro Asp Giy Pro Ser Cys Ser Asn o A o O 712 CGA TAT CAA GCT TAT CGA TAC CGT CGA CCT CGA GGG GGG GCC B54Ser Ie Leu Ser lie Ser Vad Thy Ser Avg Ser Pro Pro Giy 754 CGG TAC CCA GCT TTT GTT CCC TTT AGT GAG GGT TAA TTC CGA 214 Pro Val Trp Ser Lys Asn Giy Lys Thr Leu Thr Leu Glu Ser 796 GCT TGG CGT AAT CAT GGT CAT AGCTGTTTCC TGTGTGAAAT P4Ser Pro Thr Ie Met Thr Met 837 TGTTATCCGC TCACAATTCC ACACAACATA CGAGCCGGAA GCATAAAGTG 887 TAAAGCCTGG GGTGCCTAAT GAGTGAGCTA ACTCACATTA ATTGCGTTGC 937 GCTCACTGCC CGCTTTCCAG TCGGGAAACC TGTCGTGCCA GCTGCATTAA 987 TGAATCGGCC AACGCGCGGG GAGAGGCGGT TTGCGTATTG GGCGCTCTTC 1037 CGCTTCCTCG CTCACTGACT CGCTGCGCTC GGTCGTTCGG CTGCGGCGAG 1087 CGGTATCAGC TCACTCARAG GCGGTAATAC GGTTATCCAC AGAATCAGGG 1137 GATAACGCAG GARAGAACAT GTGAGCARAA GGCCAGCARA AGGCCAGGAA v 6891690 v Figure 3 16 Sequence View of Construct illustrates a number of features The nucleotide and amino acid positions are indicated at the start of each line in the sequence view of the construct These position indicators can be hid den by choosing Construct gt Display gt Hide Positions The numbers shown reflect the position for the character at the left end of each line the A at the top of the window is nucleotide 637 the 70 just below the 637 is the 70 amino acid Ser The triangles at the end of the amino acid sequence indicate that the coding region is run
271. which is selected The Location Prefs button allows you to define how different locations specified in the GenBank file are to be converted into GCK locations The choices are shown in Figure 7 23 page 7 36 Using this dialog you can specify exactly which options Page 7 35 Menu Items 60868 gbmam_sample gbk Entries Features Source BOVNEURXIA source 4 Locus BOYNEURXIA 6349 bp mRNA MAM 9 AUG 1995 BTBAINHL sig_peptide DEFINITION Bos taurus neurexin alpha mRNA complete cds TRBINHI COS ACCESSION L14855 lt NID g388560 CATCDAN mat_peptide VERSION L14855 1 GI 388560 CHUL7694 repeat_region KEYWORDS neurexin alpha SOURCE Bos taurus brain apace art ORGANISM Bos taurus repeat_unit Eukaryota Metazoa Chordata Craniata Vertebrata Mammalia misc_feature Eutheria Cetartiodactyla Ruminantia Pecora Bovoidea Bovidae repeat_untt Bovinae Bos misc_feature REFERENCE 1 bases 1 to 6349 repeat_region AUTHORS Ullrich B Ushkaryow Y A and Sudhof T C ES TITLE Cartography of neurexins more than 1000 isoforms generated by repeat_unit alternative splicing and expressed in distinct subsets of repeat_unit neurons Aedo JOURNAL Neuron 14 3 497 507 1995 an MEDLINE 95209856 misc_feature FEATURES Location Quali fiers repeat_region source 1 6349 forganism Bos taurus pepe saree dh xref taynn 29913 repeat_unit i jee all Location Prefs Transfer Prefs misc feature Figure 7 22 Convert File Dialog you want
272. which strands to search Y Search Top Strand Y Search Bottom Strand E ok gt Figure 2 11 Finding Open Reading Frames Cancel how the program will look for ORFs The minimum ORF length text field tells the program to only display those ORFs containing 100 or more amino acids As explained in Finding Open Reading Frames page 3 36 you can select the codon table to be used and specify whether to search one or both strands of DNA If you are looking for ORFs in exons you might want to turn off the Start at ATG check box the program will then find any open reading frame not just those starting with ATG After you ve adjusted the dialog to look like the one shown here press the OK button to find the ORFs 4 After running the ORF search you will see two new objects in the con struct window arrows representing the two different ORFs found by this Page 2 11 Tutorials Marking Open Reading Frames search as shown in Figure 2 12 Both ORFs are highlighted These ORFs Construct construct 2 gec tolas construct 2 gcc 23984 bp Figure 2 12 ORFs are Marked represent regions of interest or regions In addition to site markers and DNA segments regions are a third kind of object that can appear in the construct window Regions can be formatted using the Format gt Regions gt submenu 5 Click somewhere in the window to deselect the regions just created Now click once on the region on the right side tha
273. wn in Figure 7 8 In this unusual case two enzymes have recog nition sites near each other and their cut sites overlap If you select this seg ment by double clicking or by dragging from cut 1 to cut 2 on the top strand the top strand will be selected but nothing will be selected on the bot tom strand You can still make font and color changes to the selected top sequence but no changes will be made to the bottom strand If you now attempt to copy or cut this segment GCK will not let you do so and will present you with an alert box saying that this operation is not possible The situation is not possible biologically either since as soon as one enzyme makes its cut the second enzyme recognition site will be gone When pasting segments of DNA into sites on other constructs or elsewhere in the same construct the ends of the segment are examined to see if they are compatible with the site into which the fragment is being pasted If they are not you will see the ligation dialog box shown in Figure 3 22 page 3 25 and Page 7 12 Menu Items be asked to adjust the ends so that the ligation can be done This parallels what you need to do in the lab If you have copied a segment of a circular construct to the clipboard and then paste it into a new Construct window you will get a linear construct containing that stretch of DNA again just as if you did the experiment in the lab If you take that same segment of a circular construct and paste
274. ws and exit the Gene Construc tion Kit If changes have been made to any of the windows since the last time that window was saved you will be given the option to save the changes or to discard them see Figure 7 4 page 7 5 Page 7 10 Menu Items Edit Menu Undo Edit gt Undo command Z ctrl Z provides the ability to revert to the state the window was in just prior to your last action as you are probably familiar with from other appli cations The last action can be a cut a paste or a mouse click followed by typing The action to be undone will be stated in place of the simple Undo e g undo paste undo style change undo typing etc Cut Removes the selected item from the docu ment and places it on the clipboard 8 Undo Insert Ns 3 Z Cut EX Copy C Clear Select All HA Show Clipboard Show Overview Show Selection Show Page Breaks Set Construct Margins Makes a copy of the selected item and places it on the clipboard Paste Edit gt Cut command X ctrl X Edit gt Copy command C ctrl C and Edit gt Paste command V ctrl V function as they do in other applications Cut will remove the selected item s from the window and place it in a temporary holding area the clip board Copy functions similarly to the Cut option but only places a copy of the selected item s in the clipboard it does not remove anything Paste will take whatever is in the clipboard and try to place it at t
275. you want the construct to stay at that scale Therefore resizing the window will not change the scale To have the con struct resize as the window is resized you should select Construct gt Magnification gt FitTo Window see Fit To Window page 7 43 Page 7 60 Menu Items Show Hide Construct Title The construct title is text that can be displayed in the center of a circular con struct or centered below a linear construct This text has the title of the file as its first line and the length of the construct as its second line of text You can select each line of text and change the text attributes using the Format menu Construct gt Display gt Show Construct Title and Hide ConstructTitle toggle between making the title visible or not Center Construct Title You can select the construct title and move it to any location in the window Sometimes it is desirable to return the title to its original location Construct gt Display gt Center Construct Title will return the title to the center of a circular con struct or centered below a linear construct Show Hide Regions As the name suggests this menu item will toggle the display of regions on or off It is a global setting so that all regions will be either shown or hidden Regions are features that are not part of the actual DNA but represent addi tional information about the DNA see Regions of Interest and Translating DNA page 3 5 You cannot set th
276. zomers of the selected enzyme and sometimes contains possible sources for the enzyme Note that if you mark sites with this enzyme list all of the enzyme comments will be saved for each site marked in the construct New List Entries Choosing List gt New List Entry will provide a blank entry form to enter the name sequence and comments to be associated with your new entry in the list It will also create a new list entry temporarily indicated by a bullet with an ellipses in the list at the left Fill in the name of the new entry the sequence you want this entry to represent and any comments to be associ ated with sites on the construct when that entry is used to mark sites This is illustrated in Figure 4 4 Page 4 3 List Window Defining a Cut Site List commercial_with_comments gcl o 51 Ee Number of Items 603 Name Aarl a pam E new enzyme entry Aati Sequence Aatll Acel JAAATTT Acell Acclll Comments pa this is not a real enzymg aj Acces AccBtl AcoB7I y Figure 4 4 Creating a New Entry Defining a Cut Site The list entry does not have to represent a restriction enzyme but can repre Locate Cut E Indicate a cut site Figure 4 5 Defining a Cut Site sent a linker a PCR primer or other sequence to which you want ready access lf the new entry represents a restriction site you must also define the cut site for the enzyme This is done by choosing List gt Define Cut Sit
277. zyme have the same symbol you should 1 first make sure that no sites are marked for that enzyme and then 2 mark sites for the particular enzyme using symbols i e there will only be one enzyme in the right list in Figure 3 9 page 3 10 and mark the sites as symbols should be chosen Once sites are marked on a construct you can select any site by clicking on it once If you double click on a site marker GCK will select all other sites that are marked in the same way For example if you double click on a site marked EcoA all other sites labeled exactly as EcoRP will be selected no sites marked as symbols will be selected and no sites marked as text having different text will be selected On the other hand if you double click on a site marked as all sites having that exact symbol in that exact size will be selected sites with different symbols the same symbol in a different size or sites marked as text will not be selected Once a site is marked changing the label display can be accomplished using the Format gt Site Markers submenu Format gt Site Markers gt Show Site As Text will force c The only way for GCK to avoid this inconsistency would be to define a different symbol for each enzyme in the list and then maintain that symbol as the list grows and enzyme names change This would be an impractical task Page 3 12 Construct Window Site Markers any selected site markers to be displayed as text Format

tutorial 1 - Textco BioSoftware

Contents

Download Pdf Manuals

Related Search

Related Contents