Home
XMIR/AXMIR XMIRXpress Protocol and User Manual
Contents
1. EXOSOME GENERATING Exosome Pa CELLS and secretion ra TARGET CELLS Analysis of target regulation and other phenotypic effects Fig 1 How XMIR AXMIR exosome RNA packaging works 888 266 5066 Toll Free 650 968 2200 outside US Page 3 System Biosciences SBI User Manual XMIR and AXMIR RNA Oligo Kits A List of Materials XMIR and AXMIR Kits cat XMIR xxx or AXMIR xxx e XMIR AXMIR RNA oligo at 10 uM 400 ul 10 reactions per well for 6 well dish Optional Positive Control Texas Red conjugated RNA oligo with XMotif at 10 uM 60 ul cat XMIR POS 10 reactions per well for 6 well dish XMIRXPress Lentivectors cat XMIRXP xxx or XMIRXP Vect e XMIRXpress pre made miRNA expression lentivector construct 10 ug plasmid DNA Or e XMIRXpress cloning lentivector pre linearized cat XMIRXP Vect 10 cloning reactions ExoQuick TC and Exo FBS are not provided in the XMIR AXMIR kits and can be purchased separately The following ExoQuick TC products are recommended for exosome concentration prior to addition to target cells Description Size Catalog ExoQuick TC for Tissue Culture Media 10 EXOTC10A 1 and Urine 10 ml reactions ExoQuick TC for Tissue Culture Media 50 and Urine 50 ml reactions EXOTCS0A 1 Exosome depleted FBS Media 50 mL EXO FBS Supplement 50A 1 IMPORTANT NOTE Be sure to culture your exosome producer cell lines in media that does not contain standard FBS There a
2. a final concentration of 1 uM each oligo Heat at 95 C for two minutes then allow to cool to room temperature for 20 minutes Ligate of annealed oligo into XMIRXpress lentivector Combine 1 uL of linearized vector with 1 uL of annealed oligos Add ligation buffer and DNA ligase of choice and ligate as per the conditions required by your ligase Transform ligation reaction into competent cells shake in 1 mL LB ampicillin at 37 C for 1 hour then plate 250 uL onto an LB ampicillin plate and grow overnight at 37 C Page 20 ver 4 150115 www systembio com XMIR AXMIR amp XMIRExpress Cat s XMIR xx AXMIR xx XMIRXP xx 4 To confirm the sequence of XMIRXpress clones use the H1 forward primer for sequencing your XMIR expression cassette H1 fwd 5 T CATGTCGCTATGTGTTCTGGGA 3 The XMIRXpress lentivectors can be used in transfection experiments with cells to test the exosomal loading of the XMIR and can also be packaged into lentivirus to easily create stable XMIR producer cell lines constitutively secreting exosomes Secreted exosomes packed with XMIRs packaged with miRNAs XMIR Exosome Producer Cell Ty sO j Factories Qao To create stable cell lines stably expressing XMIRs that will be loaded into secreted exosomes package the XMIRXpress lt lentivector plasmid into virus using PRODUCER CELL LINES SBI s lentivirus packaging systems Visit www systembio com lenti for product information on the kits to perform viru
3. and resuspend exosome containing pellet in 100 uL PBS Measure exosome yield using A280 on Nanodrop Adjust concentration to 1 ug uL Add exosomes to cell culture dish containing target cells For an assay in a 6 well plate format 50 ug exosomes is sufficient to see effects of both XMIRs and AXMIRs on native protein targets see sample data Figure 3 The Page 6 ver 4 150115 www systembio com XMIR AXMIR amp XMIRExpress Cat s XMIR xx AXMIR xx XMIRXP xx number of exosomes required in culture dishes of other size can be scaled up or down proportionally to the difference in total cell number relative to one well of a 6 well plate For more details see frequently asked questions 7 Perform desired assay in target cells to analyze effects of exosome mediated delivery of miRNA or anti miRNA Validation of target cell delivery using positive control cat XMIR POS The inclusion of the positive control oligo allows for confirmation of target cell delivery in two ways 1 visualization of target cells on a fluorescent microscope or 2 qPCR 1 Visualization of target cells on a fluorescence microscope As quickly as 2 hours after exosomes are added to target cells delivery can be visualized using a standard RFP filter set on fluorescence microscope see sample data Figure 4 for fluorescence analysis of target cell delivery 2 qPCR 24 hours post transfection after exosomes are added to target cells RNA can be extrac
4. cloning of miRNAs of interest into the XMIRXpress scaffold cassette The 888 266 5066 Toll Free 650 968 2200 outside US Page 17 System Biosciences SBI User Manual NNNNNNN sequence corresponds to the miRNA hairpin which is typically is about 70 nucleotides in length B An example of cloning hsa miR 29b 1 MI0000105 is shown below First look up miRNA of interest using miRBase www miRBase org and identify what miRNA sequence you want to express as an XMIR XMotif fusion B If desired miRNA is a 3p in the hairpin Stem loop sequence hsa mir 29b 1 ieee 10000105 eee item hsa mir t02 7 1 hsa mir 102 2 hsa mir 29b 2 SLETE HGNC MIR2Of ei Homo sapiens miR 29b 1 stem loop Serie MIPFO000009 mir 29 i 1 Stem oo ercane susug Gi 24357 reads 6 196 09 reads per mion 77 experiments Deep H LTC REO IC ANARA IAKA KA A Page 18 ver 4 150115 www systembio com XMIR AXMIR amp XMIRExpress Cat s XMIR xx AXMIR xx XMIRXP xx f Example hsa miR 29b 1 MI0000105 oligo cloning design into XMIR scaffold hsa miR 29b 5 CUUCAGGAAGCUGGUUUCAUAUGGUGGUUUA GAUUUAAAUAGUGAUUGUCUAGCACCAUUUGA AAUCAGUGUUCUUGGGGG 3 Convert U residues to T residues Place on top strand and reverse complement sequence for bottom strand XMIR 29b top 5 gatccNNNNNNNNNNNNNNNNNNNC 3 MR a bat 5 ctaggNNNNNNNNNNNNNNNNNNNg 3 4 C If desired miRNA is a 5p in the hairpin An example of cloning hsa miR 15
5. feature an EF1a GFP Puro selection cassette and a downstream H1 promoter expressing the XMIR XMotif cassette Page 14 ver 4 150115 www systembio com XMIR AXMIR amp XMIRExpress Cat s XMIR xx AXMIR xx XMIRXP xx RSV S LTR AmpR 4 XMIRXpress Lentivectors pUC ORI XMIR XMotif Scaffold SV40 T2A peptide poly A 3 ALTR Puro Fig 6 Lentivector plasmid map of pre made XMIRXpress miRNA constructs The XMIRXpress lentivectors feature an upstream EF1a GFP Puro selection cassette for easy stable cell line generation using packaged lentivirus from the construct The XMIR XMotif cassette is expressed form the downstream H1 promoter For the data in Fig 7 the premade XMIR 29b lentivector construct was transfected into HEK293 cells cultured in DMEM media with SBI s Exosome depleted FBS Media Supplement in place of standard FBS because standard FBS contains high levels of cow exosomes The exosomes were collected after 48 hours The exosomal RNA was purified and converted into qPCR compatible cDNA as described in Section C Relative amounts of XMIR 29b packaged into exosomes was quantitated by qPCR and miR 16 888 266 5066 Toll Free 650 968 2200 outside US Page 15 System Biosciences SBI User Manual used as a reference exosome control signal The delta delta Ct calculation for XMIR 1 is shown in the bar graph XMIRXpress XMIRXP 29b Loading into Exosomes 900 soo _MiR 29b levels pack
6. in this Licensing and Warranty Statement Use of the Product for any use other than described expressly herein may be covered by patents or subject to rights other than those mentioned SBI disclaims any and all responsibility for injury or damage which may be caused by the failure of the buyer or any other person to use the Product in accordance with the terms and conditions outlined herein Page 28 ver 4 150115 www systembio com XMIR AXMIR amp XMIRExpress Cat s XMIR xx AXMIR xx XMIRXP xx Limited Warranty SBI warrants that the Product meets the specifications described in this manual If it is proven to the satisfaction of SBI that the Product fails to meet these specifications SBI will replace the Product or provide the purchaser with a credit This limited warranty shall not extend to anyone other than the original purchaser of the Product Notice of nonconforming products must be made to SBI within 30 days of receipt of the Product SBI s liability is expressly limited to replacement of Product or a credit limited to the actual purchase price SBI s liability does not extend to any damages arising from use or improper use of the Product or losses associated with the use of additional materials or reagents This limited warranty is the sole and exclusive warranty SBI does not provide any other warranties of any kind expressed or implied including the merchantability or fitness of the Product for a particular purpose
7. 1 00 i i 0 00 Untreated HEK 293 HEK 293 HEK 293 HEK 293 NTExos XMIR AXMIR 21 Exas 21 Exos Fig 3 A western blot analysis of PDCD4 and GAPDH from HEK293 cells treated with XMIR 21 or AXMIR 21 loaded exosomes B Quantitative analysis of band intensities from the Western blot shown in Panel A Addition of exosomes from cells transfected with XMIR 21 resulted in down regulation of endogenous levels of PDCD4 and addition of exosomes from cells transfected with AXMIR 21 resulted in increased levels of PDCD4 These results confirm that XMIRs act on endogenous targets and that AXMIRs effectively act as miRNA inhibitors in cells when delivered via exosomes Notably exosomes from cells transfected with 20 nM XMIR 21 oligo caused maximum PDCD4 down regulation whereas exosomes from cells transfected with 100 nM AXMIR 21 increased PDCD4 levels illustrating the need to optimize conditions for each XMIR AXMIR oligo PDCD4 PDCD4 band Intensity rel GAPDH Page 12 ver 4 150115 www systembio com XMIR AXMIR amp XMIRExpress Cat s XMIR xx AXMIR xx XMIRXP xx antibody obtained from Cell Signaling Technologies catalog 9535 and GAPDH antibody obtained from Abcam catalog ab9485 Positive control is delivered to target cells HEK 293 cells were transfected with the positive control oligo 24 hours later exosomes were isolated using ExoQuick TC and added to naive HEK293 target cells After 4 hours cells were imaged on a Leica
8. 5 5p MI0000681 is shown below First look up the miRNA of interest using miRBase www miRBase org and identify what miRNA sequence you want to express as an XMIR XMotif fusion If the mature miRNA to be tagged for exosome packaging is on the 5p side of the miRNA precursor like miR 155 the stem loop needs to be switched such that it now is placed on the 3p side for optimal XMIR motif tagging The original miR 155 5p is shown in red and then its placement for the Arm switched version for XMIR tagging is shown below the original miRNA precursor The loop and adjacent sequences shown in black remain unchanged 888 266 5066 Toll Free 650 968 2200 outside US Page 19 System Biosciences SBI User Manual Stem loop sequence hsa mir 155 ieee MIOOO06S1 Bom HGNC MIRISS Tsai Homo sapiens miR 155 stem loop omnia MIPF0000157 mir 155 e a a gx Ippgyvu uug E PUPEGDEDEGTEDD IA NN hil INO cece en tceenuh sar uccucsg sso u 2 55243 reads 2 94 03 reads per million 62 experiments Deep sequencing RENE LOT Le ET PT gt hsa mir 155 MI0000681 CUGUUAAUGCUAAUCGUGAUAGGGGUUUUUGCCUCCAACUGACUCCUAC AUAUUAGCAUUAACAG gt Arm switched hsa mir 155 MI0000681 GACUCCUACAUAUUAGCAUUAACAGUUUGCCUCCAACUCUGUUAAUGCU AAUCGUGAUAGGGGUU Oligo Annealing and Ligation Instructions 1 Anneal the two single stranded DNA oligos Dilute each oligo to a concentration of 20 uM Combine 1 uL of each with 18 uL of TE buffer to achieve
9. 7 SBI System Biosciences XMIR Exosome RNA Packaging Cat s XMIR AXMIR XMIRXPIxxx User Manual Store at 20 C upon arrival A limited use label license covers this product By use of this product you accept the terms and conditions outlined in the Licensing and Warranty Statement contained in this user manual XMIR AXMIR amp XMIRExpress Cat s XMIR xx AXMIR xx XMIRXP xx Contents L IMTPODUCTION eiaeiiio iiaeiai eiiiai 2 A Exosome Overview ccececececeeeee cent eeeaeeeeeeeseaeeetaaeeteneeeeaes 2 B Uses of XMIRs and AXMIR RNA OligoS 0cceseeeeees 2 Il XMIR and AXMIR RNA Oligo Kits 00 2 0 e ceecceeseeeeeeeeeeseeeeee 4 A List of Materials 2 0 cc eee ceeeeeceneeeeee scence iaa 4 B XMIR and AXMIR Transfection Protocol eseeeees 5 C Sample XMIR and AXMIR Data 7 D XMIRXpress LentivectOrs 2 0 0 eeeeeeeeeeeeeeeeeeeeeeeeeeeeees 14 E Additional Materials Required ececeeeeeeeeeeeeeeeeeneeees 24 F Related Products nearer eth este eevee ide seer ee eel ed 24 F Shipping and Storage Conditions for Kit cesceeeseees 24 Ill Frequently Asked Questions 0 cceeeceeeteeeseteeeeneeeteeeeees 25 IV FREPEKEAGES E E E E A 26 V Technical SUP POM israe aiina ie tea ad 27 VII Licensing and Warranty information cccceseeeeees 28 888 266 5066 Toll Free 650 968 2200 outside US Page 1 System Biosciences SBI User Manual Introducti
10. DMI300B fluorescence microscope using a standard RFP filter set to visualize the Texas Red signal conjugated to the XMIR positive control oligo Fig 4 Cells transfected with positive control XMIR oligo miRNA are loaded into exosomes and their cargo is delivered to target cells as visualized by fluorescence microscopy HEK 293 cells were subsequently lysed and total cellular RNA was extracted cDNA synthesis performed and qPCR analysis using SBI s QuantiMir kit catalog RA420A 1 on an Applied Biosystems 7900HT qPCR machine using the spike in forward primer to detect abundance of the positive control oligo Abundance was normalized to endogenous reference miR 16 levels and calculated using the delta delta Ct method 888 266 5066 Toll Free 650 968 2200 outside US Page 13 System Biosciences SBI User Manual Peep ee cot bees Peet XMIR positive control Fig 5 miRNA cargo of exosomes from cells transfected with positive control oligo is delivered to target cells as quantitated by qPCR D XMIRXpress Lentivectors The XMIRXpress lentivectors are based on the same XMotif exosomal targeting RNA tag utilized in the XMIR AXMIR synthetic oligos There are a number of pre made XMIR Express miRNA expression constructs available and SBI will design and build a custom XMIRXpress lentivector construct for any particular miRNA or anti miRNA of your choice for the same list price as the pre made constructs The lentivectors all
11. SBI is committed to providing our customers with high quality products If you should have any questions or concerns about any SBI products please contact us at 888 266 5066 2015 System Biosciences SBI All Rights Reserved 888 266 5066 Toll Free 650 968 2200 outside US Page 29
12. aged 300 a ol eeeeetsacepeemcny ll NT Minus Plus XMotif XMotif Relative miR 29b Abundance Fig 7 Relative levels of XMIRXpress cat XMIRXP 29b lentivector expression and packaging into secreted exosomes SBI also provides a cloning and expression XMIRXpress lentivector plasmid cat XMIRXP VECT to allow you to clone any miRNA or anti miRNA of your choice simply and it will automatically be fused to the XMotif sequence upon ligation The XMIRXP VECT plasmid is provided in a linearized form for rapid cloning Simply design two DNA oligos for the top and bottom strand of the miRNA hairpin as detailed below anneal the top and bottom oligos and ligate directly into the XMIRXP VECT plasmid Page 16 ver 4 150115 www systembio com XMIR AXMIR amp XMIRExpress Cat s XMIR xx AXMIR xx XMIRXP xx A RSV S LTR XMIRXpress cat XMIRXP Vect XMIR XMotif Scaffold General oligo cloning design XMIR top 5 gatcCNNNNNNNNNNNNNNNNNNNNc 3 XMIR bot 5 ctaggNNNNNNNNNNNNNNNNNNNNg 3 Fig 8 A Lentivector plasmid map of XMIRXpress miRNA cloning lentivector and how to design oligos to clone into XMIR scaffold The XMIRXpress lentivectors feature an upstream EF1a GFP Puro selection cassette for easy stable cell line generation using packaged lentivirus from the construct The XMIR XMotif cassette is expressed form the downstream H1 promoter The cat XMIRXP VECT plasmid is provided in linear form for direct
13. and expression lentivectors B Uses of XMIR and AXMIR RNA Oligos The XMIR and AXMIR kits allow for cell mediated generation of ready to use exosomes packed with a miRNA XMIR or anti miRNA AXMIR of choice These exosomes can then be used to efficiently knock down native targets in recipient cells or be used to study biological pathways by which functional exosomal miRNA cargo is delivered to target cells This technology is especially attractive as a means to study the efficacy of exosome mediated delivery of potential therapeutic miRNAs or anti miRNAs to Page 2 ver 4 150115 www systembio com XMIR AXMIR amp XMIRExpress Cat s XMIR xx AXMIR xx XMIRXP xx disease cells Recent studies into miRNA populations within exosomes and the use of exosomes as shuttles to deliver miRNAs and anti miRNAs can be found in the reference section To generate XMIRs and AXMIRS an oligo is designed to fuse the XMotif sequence to a miRNA or anti miRNA sequence which results in exosomal loading of the RNA oligo The oligo is first transfected into a culture of the exosome generating cell type of choice After 24 hours exosomes packed with the XMIR or AXMIR are precipitated using ExoQuick TC After resuspension in PBS the XMIR or AXMIR loaded exosomes are ready to be added to target cells Any miRNA anti miRNA or even siRNA sequence can also be used in a transfection ready oligo for use in the XMIR AXMIR system Transfected XMIR AXMIR oligo wer
14. ative Medicine Tissue Eng Part B Rev 2014 Jul 24 Momen Heravi F Bala S Bukong T Szabo G Exosome mediated delivery of functionally active miRNA 155_ inhibitor to macrophages Nanomedicine 2014 Mar 29 pii S1549 9634 14 00132 4 van den Boorn JG Dassler J Coch C Schlee M Hartmann G Exosomes as nucleic acid nanocarriers Adv Drug Deliv Rev 2013 Mar 65 3 331 5 doi 10 1016 j addr 2012 06 011 Lindner K Haier J Wang Z Watson DI Hussey DJ Hummel R Circulating microRNAs emerging biomarkers for diagnosis and Page 26 ver 4 150115 www systembio com XMIR AXMIR amp XMIRExpress Cat s XMIR xx AXMIR xx XMIRXP xx prognosis in patients with gastrointestinal cancers Clin Sci Lond 2015 Jan 1 128 1 1 15 Goldie BJ Dun MD Lin M Smith ND Verrills NM Dayas CV Cairns MJ Activity associated miRNA are packaged in Map1b enriched exosomes released from depolarized neurons Nucleic Acids Res 2014 Oct 1 42 14 9195 208 Taverna S Amodeo V Saieva L Russo A Giallombardo M De Leo G Alessandro R Exosomal shuttling of miR 126 in endothelial cells modulates adhesive and migratory abilities of chronic myelogenous leukemia cells Mol Cancer 2014 Jul 11 13 169 V Technical Support For more information about SBI products and to download manuals in PDF format please visit our web site hitp www systembio com For additional information or technical assistance please call or email us at System Bioscien
15. ces SBI 265 North Whisman Rd Mountain View CA 94043 Phone 650 968 2200 f SBI 888 266 5066 Toll Free Fax 650 968 2277 E mails General Information info systembio com Technical Support tech systembio com Ordering Information orders systembio com 888 266 5066 Toll Free 650 968 2200 outside US Page 27 Vil System Biosciences SBI User Manual Licensing and Warranty information Limited Use License Use of the XMIR AXMIR and XMIRXpress Kits e the Product is subject to the following terms and conditions If the terms and conditions are not acceptable return all components of the Product to System Biosciences SBI within 7 calendar days Purchase and use of any part of the Product constitutes acceptance of the above terms The purchaser of the Product is granted a limited license to use the Product under the following terms and conditions e The Product shall be used by the purchaser for internal research purposes only The Product is expressly not designed intended or warranted for use in humans or for therapeutic or diagnostic use e The Product may not be resold modified for resale or used to manufacture commercial products without prior written consent of SBI e This Product should be used in accordance with the NIH guidelines developed for recombinant DNA and genetic research Purchase of the product does not grant any rights or license for use other than those explicitly listed
16. he first time a particular exosome generating cell and or XMIR or AXMIR oligo is used For more details on optimizing oligo concentrations see frequently asked questions a An example transfection setup using SBI s PureFection cat LV750A 1 in a 6 well plate of cells at about 70 80 confluency 5 ul PureFection reagent 30 ul XMIR AXMIR RNA oligo 10uM 200 ul serum free media 888 266 5066 Toll Free 650 968 2200 outside US Page 5 System Biosciences SBI User Manual b Mix together by brief vortexing incubate at room temperature for 15 minutes c Add entire volume to 6 well of cells in a total volume of 3 ml media this makes the final concentration of XMIR AXMIR RNA oligo in the media at 100 nM d The XMIR AXMIR RNA oligo amount can be scaled up or down as appropriate for your experimental conditions Return cells to incubator and allow for exosome production for 24 hours Plate target cells in culture dish of choice to be at an appropriate confluency for downstream phenotypic assay in 24 hours Isolation of XMIR AXMIR Exosomes and Addition to Target Cells 1 24 hours post transfection remove cell culture media and place in 15 mL or 50 mL centrifuge tube Add ExoQuick TC at 1 5 the volume of cell culture media Mix by inversion and incubate at 4 C overnight Spin centrifuge tubes at 3 000 x g for 30 minutes at room temperature or 4 C temperature does not affect exosome yield Discard supernatant
17. ile by qPCR with SeraMir e Discover novel exoRNA_ biomarkers with Next Gen sequencing services F Shipping and Storage Conditions for Kit The XMIR AXMIR kits are shipped on dry ice the XMIRXpress constructs and cloning lentivectors are shipped on blue ice 20 C and all products should be stored at 20 C upon arrival Avoid freeze thawing the reagents Shelf life of the product is 1 year after receipt if stored in 20 C Page 24 ver 4 150115 www systembio com XMIR AXMIR amp XMIRExpress Cat s XMIR xx AXMIR xx XMIRXP xx lll Frequently Asked Questions Q How do optimize amount of XMIR AXMIR oligo to use The first time an XMIR or AXMIR oligo is used we recommend transfecting at 20 nM 50 nM and 100 nM final concentration then adding each isolated exosome population independently to target cells to assay for bioactivity The concentration of XMIR or AXMIR resulting in the desired level of downstream effects should be used in all subsequent experiments Q How long and in what condition should store exosomes after isolation from exosome generating cell line After exosomes are isolated with Exo QuickTC the pellet can be stored at 80 C for 1 year After resuspension in PBS it can be stored at 4 C for 2 weeks or 20 C for 3 months Q How many exosomes should I add to my target cells 50 ug of exosomes as determined by A280 on NanoDrop is sufficient to see effects of both XMIRs and AXMIRs on native protei
18. into 293TN packaging 4 cell line 293TN Producer Cells E Wait 48 72 hours collect supernatant and ae combine with PEG it virus concentration Medium Containing solution Next day remove supernatant and Viral Particles 5x PEG it resuspend pellet in sterile PBS Solution AEV amp Pseudoviral Particles Concentrate Virus O Check Titer using Global UltraRapid Titer Kit using standard cell line ex 293 cells Global Titering Kit Measure Titer by qPCR Ch Combine the appropriate amount of virus with TransDux and infect your target cells Animal Models Primary Cells Mouse Carotid Human Primary Phase contrast GFP Artery GFP Neurons GFP 888 266 5066 Toll Free 650 968 2200 outside US Page 23 System Biosciences SBI User Manual E Additional Materials Required 1 ExoQuick TC Cat EXOTC10A 1 to isolate exosomes 2 Exosome generating cells in culture and target cell lines 3 Exo FBS exosome depleted FBS supplement Cat EXO FBS 50A 1 4 Transfection reagent of choice for RNAs or plasmids 5 Lentivirus packaging concentration and transduction reagents for XMIRXpress lentivector constructs F Related Products SBI offers a number of exosome research products You can review them here http www systembio com exosomes ExoQuick exosome isolation reagents e Exo FBS exosome depleted media supplement Detect and quantitate exosomes with Antibodies and ELISAs e Purify exosome RNA and prof
19. n targets see Figure 3 The number of exosomes required in culture dishes of other size can be scaled up or down proportionally to the difference in total cell number relative to one well of a 6 well plate Example HEK 293 cells 6 well seeding density 400 000 cells 24 well seeding density 100 000 cells 100 000 400 000 number of cells 50 ug exosomes x 1 4 12 5 ug exosomes for use in 24 well plate format 888 266 5066 Toll Free 650 968 2200 outside US Page 25 System Biosciences SBI User Manual IV References Ikeda S He A Kong SW et al MicroRNA 1 negatively regulates expression of the hypertrophy associated calmodulin and Mef2a genes Mol Cell Bio 2009 Apr 29 8 2193 204 Julich H Willms A Lukacs Kornek V Kornek M Extracellular vesicle profiling and their use as potential disease specific biomarker Front Immunol 2014 Sep 1 5 413 Pegtel DM Peferoen L Amor S Extracellular vesicles as modulators of cell to cell communication in the healthy and diseased brain Philos Trans R Soc Lond B Biol Sci 2014 Sep 26 369 1652 Salido Guadarrama I Romero Cordoba S Peralta Zaragoza O Hidalgo Miranda A Rodriguez Dorantes M MicroRNAs transported by exosomes in body fluids as mediators of intercellular communication in cancer Onco Targets Ther 2014 Jul 21 7 1327 38 Lamichhane TN Sokic S Schardt JS Raiker RS Lin JW Jay SM Emerging Roles for Extracellular Vesicles in Tissue Engineering and Regener
20. nus XMotif XMotif XMotif Xmotif Fig 3 A How miRNAs influence Luciferase 3 UTR reporters in cells B Addition of exosomes from cells transfected with indicated X Motif or non X Motif oligos to target cells expressing a luciferase reporter linked to a specific 3 UTR either RIMS1 for miR 122 or MEF2A for miR 1 resulted in down regulation of luciferase expression Plasmids and luciferase reagents were obtained from Switch Gear Genomics catalog numbers 8810945 S807542 and LS010 XMIRs and AXMIRs affect endogenous protein levels Exosomes from HEK 293 cells transfected with a miRNA 21 XMIR oligo XMIR 21 or an anti miRNA 21 AXMIR oligo AXMIR 21 and then were added to naive HEK 293 cells in culture After 24 hours total cell lysates were taken and Western blots for PDCD4 a known miR 21 target were performed GAPDH protein levels Page 10 ver 4 150115 www systembio com XMIR AXMIR amp XMIRExpress Cat s XMIR xx AXMIR xx XMIRXP xx detected in the Westerns were used as a loading control and reference signal for band intensity quantitation analysis Western blot analysis of PDCD4 levels in HEK 293 Cells treated with XMIR AXMIR loaded exosomes Figure 3A Western blot image g af a x o Ra E DE PE S g w gt Ww A9 s re N Oj PDCD4 GAPDH 888 266 5066 Toll Free 650 968 2200 outside US Page 11 System Biosciences SBI User Manual Figure 3B Densitometric analysis of western blot 2 50 2 00
21. on A Exosome Overview Exosomes are nanosized membrane vesicles secreted by most cell types in vivo and in vitro They are produced by the inward budding of multivesicular bodies MVBs and subsequently released from the cell into the microenvironment following the fusion of MVBs with the plasma membrane Exosomes are extracellular nanoshuttles that facilitate communication between cells and organs and are found in various biofluids including blood urine amniotic fluid breast milk malignant ascites fluid and cerebrospinal fluid CSF Exosomes contain distinct subsets of RNAs and proteins depending upon the cell type from which they are secreted making them useful for biomarker discovery Additionally their natural function as cell to cell communication vehicles makes them attractive for use as therapeutic shuttles to deliver biological molecules or drugs to target disease cells The RNA content varies depending upon the cell from which the exosomes was secreted The mechanism of how specific RNA sequences are selectively packaged into exosomes is an intensive area of investigation SBI has evaluated numerous exosome Next Generation Sequencing NGS data sets and has identified a specific RNA sequence tag that targets a small RNA to be packaged into exosomes for secretion The XMotif RNA sequence tag has been incorporated into the miRNA and anti miRNA oligos for the XMIR AXMIR products and has been built into the XMIRXpress cloning
22. r HEK 293 cells previously transfected with a luciferase gene linked to the 3 UTR for MEF2A a known miR 1 target or RIMS1 a known miR 122 target respectively After 24 hours luciferase assays were performed to determine bioactivity of the XMIR miRNAs delivered to target cells via exosomes Notably exosomes from cells transfected with 20 nM miR 1 oligo caused maximum luciferase down regulation whereas exosomes from Page 8 ver 4 150115 www systembio com XMIR AXMIR amp XMIRExpress Cat s XMIR xx AXMIR xx XMIRXP xx cells transfected with 100 nM miR 122 caused maximum luciferase down regulation illustrating the need to optimize conditions for each XMIR AXMIR oligo The degree of knockdown XMIR 1 exosomes displayed on the MEF2A luciferase reporter is similar to that seen for transfections of miRNA oligos using a similar reporter assay see reference 1 indicating that exosome mediated delivery of miRNAs occurs at maximal efficiency A _ No miRNA binding Successful miRNA binding high luciferase levels lowered luciferase levels No Interaction apes Normal Luc GFP Lower Luc GFP S Transiation Translation 888 266 5066 Toll Free 650 968 2200 outside US Page 9 System Biosciences SBI User Manual Luciferase Activity in Target Cells L1 1 1 0 9 0 9 0 8 0 8 RIMS1 3 UTR MEF2A 3 UTR ae reporter K reporter 0 6 0 6 0 5 0 5 04 0 4 03 0 3 0 2 0 2 miR 122 miR 122 Plus miR 1 Minus miR 1 Plus Mi
23. re high levels of cow exosomes present in FBS Instead use SBI s Exo FBS Exosome depleted FBS Media Supplement cat EXO FBS 50A 1 in place of standard FBS media supplements Page 4 ver 4 150115 www systembio com XMIR AXMIR amp XMIRExpress Cat s XMIR xx AXMIR xx XMIRXP xx B XMIR and AXMIR Transfection Protocol Transfection of Exosome Generating Cells 1 Seed exosome generating cells in culture dish of choice to reach 60 70 confluency after 24 hours using media compatible with the cells and be sure to use SBI s Exosome depleted FBS Media Supplement in place of standard FBS because standard FBS contains high levels of cow exosomes Return cells to incubator 24 hours later mix XMIR or AXMIR oligo with transfection reagent of choice and follow appropriate protocol to achieve transfection of target cells The positive control oligo can be used in a co transfection experiment at a final concentration of 20 nM Target cell delivery can be visualized_and quantified using fluorescence microscopy and qPCR respectively more details below as follows 1 The final concentration of XMIR or AXMIR oligo should fall somewhere within the range of 20 nM 100 nM Because the number of exosomes generated differs between cell lines and the amount of delivered miRNA or anti miRNA required to see an effect in target cells varies we recommend testing a series of oligo concentrations for exosomal loading and target cell effects t
24. s packaging Please refer to SBI s official Guide to Lentiviral Packaging for details on making high titer virus preparations SBI also offers custom lentivirus packaging as a service Lentivirus packaging concentration titering and transduction reagents from SBI LentiStarter Kit New to Lentiviral Technology Try SBI s LentiStarter 2 0 Kit that enables optimal lentiviral Packaging Concentration and Transduction in one convenient starter sample kit pDPACKH1 PEG it and TransDux 888 266 5066 Toll Free 650 968 2200 outside US Page 21 System Biosciences SBI User Manual LentiSuite Complete system that enables optimal lentiviral Packaging Concentration and Titering in one convenient toolset Virus Packaging Systems pPACK packaging plasmid mix for optimized lentivirus production Producer Cell Line SBI s 293TN cell line produces high titer lentivirus Virus Concentration and Transduction Easily concentrate Lentiviruses with PEG it virus precipitation solution Efficiently transduce your target cells with TransDux Page 22 ver 4 150115 www systembio com XMIR AXMIR amp XMIRExpress Cat s XMIR xx AXMIR xx XMIRXP xx How to Make High Titer Lentivirus 4 Your oO Make Your Lentivector Clone Lentivector cDNA shRNA reporter microRNA etc Construct ACK Cafona arna Mix B To make lentivirus co transfect your lentivector plus pPACK packaging mix oo using PureFection
25. ted from the cell lysate and analyzed by qRT PCR using our SeraMir kit catalog RA820A 1 see sample data Figure 5 for qPCR analysis of target cell delivery Our positive control oligo can be detected using the spike in forward primer and your XMIR or AXMIR can be detected using a forward primer specific to its sequence C Sample XMIR and AXMIR Data XMIRs are packaged into exosomes 888 266 5066 Toll Free 650 968 2200 outside US Page 7 System Biosciences SBI User Manual XMIR oligos for miR 1 and miR 122 were transfected at a 20 nM final concentration to test exosomal loading in HEK 293 cells Transfection was accomplished using PureFection catalog LV750A 1 and exosomes were purified 24 hours later using ExoQuick TC RNA was extracted from exosomes cDNA was synthesized and qPCR was performed using the SeraMir kit catalog RA820A 1 Data were analyzed using an Applied Biosystems 7900HT qPCR instrument and relative exosome abundance levels were calculated using the delta delta Ct method using exosomal miR 16 as a reference control Exosomal Fold Enrichment miR 1 Exosomal Fold Enrichment miR 122 1500 rovo w 100 10 16 A DEN miR 1 Minus miR 1 Plus miR 122 Minus miR 122 Plus XMotif XMotif XMotif XMotif Fig 2 Addition of XMotif to miRNA sequences results in a 1000 fold increase in exosomal loading XMIRs delivered to cells by exosomes are bioactive The XMIR 1 and XMIR 122 loaded exosomes were added to reporte
Download Pdf Manuals
Related Search
Related Contents
Analog Way SMS100 Smart Scaler User Manual w SSZ140421 Series - HvacPartsShop.com Samsung Forno 3Oven NV70H7786BS User Manual Télécharger MEDIA PLAYER XS HDMI Data Magician 1.5 Documentation 6 Inch Speed Dome Installation Manual LG Electronics 42LD340H Flat Panel Television User Manual Systèmes HemoCue Glucose 201 RT et 201 DM RT Copyright © All rights reserved.
Failed to retrieve file