Home

pBAD/Thio His TOPO manual - Thermo Fisher Scientific

1. For the highest transfection efficiency we recommend performing the transfection in Grace s Insect Cell Culture Medium Unsupplemented see page ix for ordering information Note that the Grace s Insect Cell Culture Medium should not contain supplements or fetal bovine serum FBS as the supplements and the proteins in the FBS will interfere with the Cellfectin II Reagent inhibiting the transfection TM Note If you are culturing Sf9 or Sf21 cells in Sf 900 II SEM or Sf 900 III SFM you can perform the transfection in unsupplemented Grace s Medium and then easily switch back to Sf 900 II SEM or Sf 900 III SFM after transfection Continued on next page 19 Transfecting Insect Cells continued Positive Control Materials Needed a 7 N D L1 Y NE o a Transfection Conditions 20 If you have generated a recombinant bacmid from the pFastBac Gus control y 8 P plasmid we recommend including this positive control in your transfection and expression experiments to help you evaluate your results In this bacmid the gene encoding glucuronidase Gus will be expressed under the control of the strong polyhedrin Py promoter After transfection expression of B glucuronidase may be assayed as appropriate e Purified recombinant bacmid DNA from your pFastBac construct 500 ng pl in TE Buffer pH 8 0 e Purified recombinant bacmid DNA from the pFastBac Gus control construct if desired
2. Recombinant bacmid DNA is degraded e Check the quality of your recombinant DNA by agarose gel electrophoresis prior to transfection e Prepare bacmid DNA using Invitrogen s PureLink HiPure Miniprep or Maxiprep Kit see page viii for ordering information e Store purified bacmid at 4 C do not freeze at 80 C as it decreases transfection efficiency Bacmid DNA is not pure i e contains recombinant bacmid and empty bacmid e Screen other DH10Bac transformants and choose one that contains only recombinant bacmid e Perform plaque purification to isolate recombinant baculovirus Continued on next page Troubleshooting continued Expressing Your Protein The table below lists some potential problems and possible solutions that may help you troubleshoot your expression experiments Problem Reason Solution Low protein expression Viral stock contains a mixture of recombinant and non recombinant baculovirus Perform plaque purification to isolate recombinant baculovirus Baculovirus not recombinant e Verify transposition by PCR analysis of bacmid DNA using the pUC M13 Forward and Reverse primers e Re transfect insect cells with new recombinant bacmid DNA Used too low or too high viral titer Optimize infection conditions by varying the MOI Time of cell harvest not optimal Perform a time course of expression to determine the optimal ti
3. baculoviral stocks we generally obtain titers ranging from e 1x 10 to 1x 10 pfu ml for P1 viral stocks e 1x10 to 1 x 10 pfu ml for P2 viral stocks Note If the titer of your baculoviral stock is less than 1 x 10 pfu ml or 1 x 10 pfu ml for a P1 or P2 viral stock respectively we recommend producing a new baculoviral stock For tips and guidelines to optimize your viral yield see Factors Affecting Viral Titer page 26 and the Troubleshooting section page 40 Continued on next page 31 Performing a Viral Plaque Assay continued Plaque Purification 32 You may generate a viral stock from a single viral clone by plaque purifying your baculovirus if desired Use a protocol of your choice or the procedure below Materials Needed e Plate containing well spaced viral plaques from Plaque Assay Procedure Step 11 page 29 do not stain plates with Neutral Red e Log phase Sf9 or Sf21 cells at greater than 95 viability e Sterile Pasteur pipette and bulb Procedure 1 Follow Steps 1 3 in the Plaque Assay Procedure page 29 to seed Sf9 or Sf21 cells 2 Using a sterile Pasteur pipette and bulb carefully pick a clear plaque and transfer the agarose plug containing virus to a 1 5 ml microcentrifuge tube containing 500 ul of complete growth medium Mix well by vortexing Add 100 ul of the agarose plug solution to each well Incubate the cells in a 27 C humidified incubator for 72 hours 5 Colle
4. Generating High If you have stored your viral master stock at 80 C we recommend amplifying Titer Stocks From _ this stock to generate another high titer stock for use in expression experiments Frozen Master Viral titers generally decrease over time when virus is stored at 80 C Follow the Stock guidelines and amplification procedure detailed in this section 25 Performing a Viral Plaque Assay Introduction BaculoTiter Assay Kit Experimental Outline Factors Affecting Viral Titer 26 We recommend you perform a plaque assay to determine the titer of your viral stock You may also perform a plaque assay to purify a single viral clone if desired In this procedure you will infect cells with dilutions of your viral stock and identify focal points of infection plaques on an agarose overlay You may also titer your viral stock by the end point dilution method described in O Reilly et al 1992 We recommend using the BaculoTiter Assay Kit available separately from Invitrogen to determine the titer of your baculoviral stock The BaculoTiter Assay Kit rapidly determines the titer of an unknown baculovirus sample with minimal handling steps providing both accuracy and convenience in an easy to use kit format in two days as opposed to ten days with the serial dilution assays See page ix for ordering information For more information refer to our website at www invitrogen com or contact Technical Support page
5. 500 ng ul in TE Buffer pH 8 0 e Sf9 or Sf21 cells cultured in the appropriate medium e Cellfectin II Reagent store at 4 C until use e Grace s Insect Cell Medium Unsupplemented see page ix media should not contain supplements FBS or antibiotics e 6 well tissue culture plates and other tissue culture supplies e 1 5 ml sterile microcentrifuge tubes e Complete growth medium for culturing insect cells e g Sf 900 IT SFM Sf 900 TI SFM TNM FH Grace s Supplemented Insect Cell Culture Medium or other suitable medium Calculate the number of Sf9 or Sf21 cells that you will need for your transfection experiment and expand cells accordingly Make sure your cells are healthy with greater than 95 viability and are growing in the logarithmic phase with a density of 1 5 2 5 x 10 cells ml before proceeding to transfection We generally produce baculoviral stocks in Sf9 or Sf21 cells using the following transfection conditions Note that these conditions should be used as a starting point for your transfection To obtain the highest transfection efficiency and low non specific effects you may optimize transfection conditions by varying DNA and Cellfectin II Reagent concentrations and cell density Condition Amount Tissue culture plate size 6 well 35 mm plate one well bacmid Number of Sf9 or Sf21 cells to transfect 8 x 10 cells Amount of bacmid DNA 1 ug can vary from 1 to 2 ug Amo
6. T1 E coli strain is genetically modified to carry the lacZAM15 hsdR lacX74 recA endA tonA genotype As a condition of sale this product must be in accordance with all applicable local legislation and guidelines including EC Directive 90 219 EEC on the contained use of genetically modified organisms The parental strain of Mach1 T1 E coli is the non K 12 wild type W strain ATCC 9637 S A Waksman Although the parental strain is generally classified as Biosafety Level 1 BL 1 we recommend that you consult the safety department of your institution to verify the Biosafety Level TM The DH10Bac strain is genetically modified and carries the pBR322 derived plasmid pMON7124 bom tra mob As a condition of sale this product must be in accordance with all applicable local legislation and guidelines including EC Directive 90 219 EEC on the contained use of genetically modified organisms 49 References Barry G F 1988 A Broad Host Range Shuttle System for Gene Insertion into the Chromosomes of Gram negative Bacteria Gene 71 75 84 Ciccarone V C Polayes D and Luckow V A 1997 Generation of Recombinant Baculovirus DNA in E coli Using Baculovirus Shuttle Vector Methods in Molecular Medicine Reischt U Ed 13 Humana Press Inc Totowa NJ King L A and Possee R D 1992 The Baculovirus Expression System A Laboratory Guide Chapman and Hall New York NY Lindner P Bauer K
7. 47 Alternatively you may follow the guidelines and instructions provided below to e Determine the titer of your baculoviral stock e Plaque purify the virus optional To determine the titer of a baculoviral stock you will 1 Plate Sf9 or Sf21 cells in 6 well plates 2 Prepare 10 fold serial dilutions of your baculoviral stock 3 Add the different dilutions of baculovirus to Sf9 cells and infect cells for 1 hour Remove the virus and overlay the cell monolayer with Plaquing Medium Incubate the cells for 7 10 days stain if desired and count the number of plaques in each dilution A number of factors can influence viral titers including e The size of your gene of interest Titers will generally decrease as the size of the insert increases e The transfection efficiency For the highest transfection efficiency we recommend transfecting Sf9 or Sf21 cells using Cellfectin II Reagent Prepare DNA lipid complexes in Grace s Insect Medium Unsupplemented see pages 19 21 for details e The age of your baculoviral stock Viral titers may decrease with long term storage at 4 C or 80 C If your baculoviral stock has been stored for 6 months to 1 year we recommend titering or re titering your baculoviral stock prior to use in an expression experiment Number of freeze thaw cycles If you are storing your viral stock at 80 C viral titers can decrease as much as 10 with each freeze thaw cycle e Improper
8. Colonies with Recombinant Bacmid Grow overnight culture and isolate recombinant bacmid DNA Recombinant Bacmid DNA Transfect insect cells using Cellfectin Il Reagent P1 Recombinant Baculovirus Stock gt 108 pfu ml Infect insect cells to amplify virus P2 Recombinant Baculovirus Stock gt 107 pfu ml Titer and infect insect cells Protein Expression Methods Culturing Insect Cells General Guidelines Introduction Using Serum Free Medium Insect Cell Culture Reference Guide We recommend using Spodoptera frugiperda Sf9 or Sf21 insect cells as the host for your baculovirus transfer vector Before you start your transfection and expression experiments be sure to have cultures of Sf9 or Sf21 cells growing and have frozen master stocks available Sf9 and Sf21 cells and cell culture reagents are available separately from Invitrogen see page ix for ordering information Note High Five and Mimic Sf9 insect cells are suitable for use for expression only Insect cells may be cultured under serum free conditions We recommend using Sf 900 II SFM or Sf 900 III SFM available from Invitrogen see page ix Both Sf 900 II SFM and Sf 900 III SFM are protein free media optimized for the growth and maintenance of Sf9 and Sf21 cells as well as for the large scale production of recombinant proteins expressed using the Bac to Bac TOPO Expression System For
9. Krebber A Nieba L Kremmer E Krebber C Honegger A Klinger B Mocikat R and Pluckthun A 1997 Specific Detection of His tagged Proteins With Recombinant Anti His Tag scFv Phosphatase or scFv Phage Fusions BioTechniques 22 140 149 Luckow V A 1991 in Recombinant DNA Technology and Applications Prokop A Bajpai R K and Ho C eds McGraw Hill New York Luckow V A Lee C S Barry G F and Olins P O 1993 Efficient Generation of Infectious Recombinant Baculoviruses by Site Specific Transposon Mediated Insertion of Foreign Genes into a Baculovirus Genome Propagated in Escherichia coli J Virol 67 4566 4579 Luckow V A and Summers M D 1988 Signals Important for High Level Expression of Foreign Genes in Autographa californica Nuclear Polyhedrosis Virus Expression Vectors Virology 167 56 71 O Reilly D R Miller L K and Luckow V A 1992 Baculovirus Expression Vectors A Laboratory Manual W H Freeman and Company New York N Y 2008 Invitrogen Corporation All rights reserved For research use only Not intended for any animal or human therapeutic or diagnostic use 50 invitrogen Corporate Headquarters Invitrogen Corporation 5791 Van Allen Way Carlsbad CA 92008 T 1 760 603 7200 F 1 760 602 6500 E tech_support invitrogen com For country specific contact information visit our web site at www invitrogen com
10. fresh LB agar plates containing 50 ug ml kanamycin 7 ug ml gentamicin 10 ug ml tetracycline 100 ug ml Bluo gal and 40 ug ml IPTG Incubate the plates overnight at 37 C 2 Froma single colony confirmed to have a white phenotype on restreaked plates containing Bluo gal and IPTG inoculate a liquid culture containing 50 pg ml kanamycin 7 ug ml gentamicin and 10 ug ml tetracycline 3 Isolate recombinant bacmid DNA using the procedure provided on the next page for analysis You may also use the procedure for the PureLink HiPure Plasmid Maxiprep Kit provided in the Appendix page 44 for increased recombinant bacmid yield 4 Analyze the recombinant bacmid DNA to verify successful transposition to the bacmid We recommend using PCR to analyze your bacmid DNA see Analyzing Recombinant Bacmid DNA by PCR page 16 Note It is possible to verify successful transposition to the bacmid by using agarose gel electrophoresis to look for the presence of high molecular weight DNA This method is less reliable than performing PCR analysis as high molecular weight DNA can be difficult to visualize You may also use other methods to prepare purified recombinant bacmid DNA for analysis and transfection However bacmid DNA must be clean and free from phenol and sodium chloride as contaminants may kill the insect cells and salt will interfere with lipid complexing decreasing the transfection efficiency TM The PureLink HiPure Plasmid Prep
11. of 2 Serum proteins act as substrates for proteases For long term storage store an aliquot of the viral stock at 80 C for later reamplification Do not store routinely used viral stocks at temperatures below 4 C Repeated freeze thaw cycles can result in a 10 to 100 fold decrease in virus titer Once you have obtained your clarified P1 baculoviral stock you may Amplify the viral stock see the next section for details This procedure is recommended to obtain the highest viral titers and optimal results in your expression studies Determine the titer of your viral stock see Performing a Viral Plaque Assay page Error Bookmark not defined Plaque purify your recombinant baculovirus if desired see Performing a Viral Plaque Assay page 26 Use the P1 viral stock to infect your Sf9 or Sf21 cells for preliminary expression experiments see below If you wish to perform small scale or preliminary expression experiments it is possible to proceed directly to expression studies by using the P1 viral stock to infect your Sf9 or Sf21 cells Note that the amount of viral stock is limited and expression conditions may not be reproducible i e MOI is unknown if titer is not determined 23 Amplifying Your Baculoviral Stock Introduction Materials Needed Important Multiplicity of Infection MOI Example 24 The P1 viral stock is a small scale low titer stock You may use this stock to infect ce
12. store your purified bacmid DNA at 20 C aliquot into separate tubes in TE Buffer pH 8 0 to avoid more than one freeze thaw cycle and do not store ina frost free freezer You may also store the purified bacmid DNA for up to 2 weeks at 4 C in TE Buffer pH 8 0 TM You may prepare glycerol stocks of DH10Bac E coli containing the bacmid DNA from mid logarithmic phase culture grown from white colonies picked during the blue white screening and store at 80 C for future bacmid DNA isolation Technical Support Web Resources Visit the Invitrogen website at www invitrogen com for e Technical resources including manuals vector maps and sequences application notes MSDSs FAQs formulations citations handbooks etc e Complete technical support contact information e Access to the Invitrogen Online Catalog e Additional product information and special offers Contact Us For more information or technical assistance call write fax or email Additional international offices are listed on our website www invitrogen com Corporate Headquarters Japanese Headquarters European Headquarters Invitrogen Corporation Invitrogen Japan Invitrogen Ltd 5791 Van Allen Way LOOP X Bldg 6F Inchinnan Business Park Carlsbad CA 92008 USA 3 9 15 Kaigan 3 Fountain Drive Tel 1 760 603 7200 Minato ku Tokyo 108 0022 Paisley PA4 9RF UK Tel Toll Free 1 800 955 6288 Tel 81 3 5730 6509 Tel 44 0 141 814 6100 Fax 1 760 602
13. the pellet and resuspend the cells until homogeneous Transfer cell suspension to a centrifuge tube 3 Add 0 4 ml Lysis Buffer L7 Mix gently by inverting the capped tube five times Do not vortex Incubate at room temperature for 5 minutes 4 Add 0 4 ml Precipitation Buffer N3 and mix immediately by inverting the capped tube until the mixture is homogeneous Do not vortex 5 Centrifuge the mixture at gt 15 000 x g at room temperature for 10 minutes Note If the pellet does not adhere to the bottom of the tube incubate the tube at room temperature for 5 minutes to allow the separation of the lysate and gelatinous pellet Pipette the clear lysate into a sterile tube and centrifuge at gt 15 000 x g for 5 minutes at room temperature to remove any remaining cellular debris 1 Load the supernatant from Step 5 see above onto the equilibrated column Allow the solution in the column to drain by gravity flow 2 Wash the column twice with 2 5 ml Wash Buffer W8 Allow the solution in the column to drain by gravity flow after each wash Discard the flow through Continued on next page Isolating Recombinant Bacmid DNA continued Eluting and 1 Place a sterile centrifuge tube elution tube under the column Precipitating DNA gt Add 0 9 ml Elution Buffer E4 to the column to elute DNA Allow the solution to drain by gravity flow Do not force out any remaining solution The elution tube contains the purified DNA Di
14. to infect insect cells for large scale expression of the recombinant protein of interest For a schematic representation of the Bac to Bac TOPO Expression System see the diagram on page 5 Continued on next page The Bac to Bac TOPO Expression System continued Baculovirus Shuttle Vector Helper Plasmid The baculovirus shuttle vector bacmid DMON14272 136 kb present in DH10Bac E coli contains e Alow copy number mini F replicon e Kanamycin resistance marker e Asegment of DNA encoding the LacZa peptide from a pUC based cloning vector into which the attachment site for the bacterial transposon Tn7 mini attTn7 has been inserted Insertion of the mini attTn7 attachment site does not disrupt the reading frame of the LacZa peptide The bacmid propagates in E coli DH10Bac as a large plasmid that confers resistance to kanamycin and can complement a lacZ deletion present on the chromosome to form colonies that are blue Lac in the presence of a chromogenic substrate such as Bluo gal or X gal and the inducer IPTG Recombinant bacmids composite bacmids are generated by transposing a mini Tn7 element from a pFastBac donor plasmid to the mini attTn7 attachment site on the bacmid The Tn7 transposition functions are provided by a helper plasmid see below DH10Bac E coli also contain the helper plasmid PMON7124 13 2 kb which encodes the transposase and confers resistance to tetracycline The help
15. well as other products suitable for use with the Bac to Bac TOPO Expression System are available separately from Invitrogen Ordering information for these reagents is provided below Item Quantity Cat no Water distilled cell culture grade 500 ml 15230 162 BaculoTiter Assay Kit 30 titers K1270 4 Agarose gel optimal for insect cell 40 ml 18300 012 growth Fetal Bovine Serum FBS Qualified Heat 100 ml 16140 063 Activated A variety of insect cell lines and GIBCO cell culture products are available from Invitrogen to facilitate baculovirus mediated expression of your recombinant protein in insect cells For more information about the insect cell lines and GIBCO TM cell culture products refer to our website at www invitrogen com or contact Technical Support see page 47 Note Reagents are also available in other sizes Item Quantity Cat no Sf9 Cells SFM Adapted 1 5 x 107 cells 11496 015 Sf21 Cells SFM Adapted 1 5 x 107 cells 11497 013 High Five Cells 3 x 10 cells B855 02 Mimic Sf9 Insect Cells 1 x 10 cells 12552 014 Sf 900 IT SFM 500 ml 10902 096 Sf 900 III SEM 500 ml 12658 019 Sf 900 Medium 1 3X 100 ml 10967 032 Express Five SFM 11 10486 025 Grace s Insect Cell Culture Medium 500 ml 11595 030 Unsupplemented Grace s Insect Cell Culture Medium 500 ml 11605 094 Supplemented Grace s Insect Cell Culture Medi
16. 0Bac Competent E coli Box 3 have a transformation efficiency of 1 x 10 cfu ug DNA Store at 80 C 0 5 mM EDTA pH 8 0 Item Composition Amount MAX Efficiency DH10Bac 4 kits Competent E coli 4 x 5 reactions pUC19 Control DNA 10 pg ul in 5 mM Tris HCl 100 pl F mcrA A mrr hsdRMS mcrBC 80lacZAM15 AlacX74 recA1 endA1 araD139 A ara leu 7697 galU galK rpsL nupG bMON14272 pMON7124 Cellfectin II Reagent is a proprietary cationic lipid formulation that offers the highest transfection efficiencies and protein expression levels on the widest variety of adherent and suspension insect cell lines Amount supplied 1 ml Composition 1 mg ml transfection reagent in membrane filtered water Storage conditions 4 C do not freeze vil Accessory Products Introduction Additional Products viii The products listed in this section may be used with the Bac to Bac C His and N His TOPO Expression Systems For more information refer to our website at www invitrogen com or contact Technical Support see page 47 All of the reagents supplied in the Bac to Bac TOPO Expression System as well as other products suitable for use with the Bac to Bac TOPO Expression System are available separately from Invitrogen Ordering information for these reagents is provided below Item Quantity Cat no Ba
17. 12 and inoculate 4 ml of LB medium containing 50 ug ml kanamycin 7 ug ml gentamicin and 10 ug ml tetracycline Alternatively you can thaw glycerol stocks of DH10Bac cells harboring your verified recombinant bacmid and use 100 ul to inoculation e Incubate the culture at 37 C in a shaking water bath at 250 rpm overnight Day 2 e Transfer the entire 4 ml of overnight culture into 50 ml of fresh LB medium with antibiotics as above and incubate at 37 C in a shaking water bath at 250 rpm overnight Day 3 e Transfer the entire 50 ml of overnight culture into 500 ml of fresh LB medium with antibiotics as above and incubate at 37 C in a shaking water bath at 250 rpm overnight TM On Day 4 proceed with the PureLink as described on the next page HiPure bacmid DNA isolation procedure Continued on next page PureLink HiPure Bacmid DNA Isolation continued Before Starting Equilibrating the Column Preparing the Cell Lysate Binding and Washing the DNA Before beginning verify that RNase A has been added to the Resuspension Buffer R3 and that no precipitate has formed in the Lysis Buffer L7 TM TM Place the PureLink HiPure Maxi column on the PureLink Nucleic Acid Purification Rack see the manual supplied with the rack for more details Apply 30 ml Equilibration Buffer EQ1 to the column Allow the solution in the column to drain by gravity flow Proceed to Preparing the Cell Lysate next
18. 6500 Fax 81 35730 6519 Tech Fax 44 0 141 814 6117 E mail techsupport invitrogen com E mail jpinfo invitrogen com MSDS Certificate of Analysis Limited Warranty E mail eurotech invitrogen com Material Safety Data Sheets MSDSs are available on our website at www invitrogen com msds The Certificate of Analysis CofA provides detailed quality control information for each product and is searchable by product lot number which is printed on each box CofAs are available on our website at www invitrogen com support Invitrogen is committed to providing our customers with high quality goods and services Our goal is to ensure that every customer is 100 satisfied with our products and our service If you should have any questions or concerns about an Invitrogen product or service contact our Technical Support Representatives Invitrogen warrants that all of its products will perform according to specifications stated on the certificate of analysis The company will replace free of charge any product that does not meet those specifications This warranty limits Invitrogen Corporation s liability only to the cost of the product No warranty is granted for products beyond their listed expiration date No warranty is applicable unless all product components are stored in accordance with instructions Invitrogen reserves the right to select the method s used to analyze a product unless Invitrogen agrees to a specified metho
19. 9 supplied with the MAX Efficiency DH10Bac E coli use as a control for transformation if desired e LB agar plates containing kanamycin gentamicin tetracycline Bluo gal and IPTG 3 freshly prepared plates for each transformation see recommendation below e LB agar plate containing 100 ug ml ampicillin for plating pUC19 transformation control e S O C Medium see page ix for ordering information e 15 mlround bottom polypropylene tubes e 42 C water bath e 37 C shaking and non shaking incubator Continued on next page 10 Transforming DH10Bac E coli continued N END 7 Oo 0U QE Nous Preparing for Transformation You will need to prepare LB agar plates containing 50 ug ml kanamycin 7 ug ml gentamicin 10 ug ml tetracycline 100 ug ml Bluo gal and 40 ug ml IPTG to select for TE Buffer pH 8 0 See page viii to order antibiotics Bluo gal and IPTG and page 43 for instructions to prepare plates If you are preparing LB plates using a pre mixed formulation we recommend using Luria Broth Base see page ix instead of Lennox L LB Using Lennox L plates will reduce the color intensity and may reduce the number of colonies obtained Note Use Bluo gal instead of X gal for blue white selection Bluo gal generally produces a darker blue color than X gal For each transformation you will need one vial of competent cells and three selective plates e Equilibrate a water bath
20. Kits available separately from Invitrogen are ideally suited for bacmid purification see page viii for ordering information 13 Isolating Recombinant Bacmid DNA Introduction Before Starting Equilibrating the Column Preparing the Cell Lysate Binding and Washing the DNA 14 The PureLink HiPure Plasmid DNA Miniprep Kit allows you to purify high quality Bacmid DNA from DH10Bac E coli see page viii for ordering information The isolated bacmid DNA is suitable for use in insect cell transfections Note We do not recommend the PureLink HiPure Precipitator Module or the PureLink HiPure Plasmid Filter Mini Midi Maxiprep Kits for isolating bacmid DNA e Inoculate a single white bacterial colony into 2 ml LB medium with 50 ug ml kanamycin 7 ug ml gentamicin and 10 ug ml tetracycline Incubate the culture at 37 C in a shaking water bath at 250 rpm overnight e Verify that RNase A is added to the Resuspension Buffer R3 and that the Lysis Buffer L7 contains no precipitates TM TM Place the PureLink HiPure Mini column on the PureLink Nucleic Acid Purification Rack see the manual supplied with the rack for more details Apply 2 ml Equilibration Buffer EQ1 to the column Allow the solution in the column to drain by gravity flow 1 Harvest 1 5 ml bacterial cells by centrifuging at 9 000 x g for 15 minutes Remove all medium 2 Add 0 4 ml Resuspension Buffer R3 containing RNase A to
21. Medium 28 Plaquing medium consists of a mixture of culture medium and agarose and will be used to immobilize the infected cells for the plaque assay Prepare plaquing medium immediately before use following the procedure below If you are culturing the Sf9 cells in Sf 900 II SFM or Sf 900 III SFM prepare Sf 900 Plaquing Medium If you are culturing cells in TNM FH prepare Grace s Plaquing Medium Note Other Plaquing Media are suitable 1 Melt the 4 Agarose Gel by placing the bottle in a 70 C water bath for 20 to 30 minutes or heating the agarose in a microwave oven While the 4 agarose gel is melting place the following in the 40 C water bath e Empty sterile 100 ml bottle e Sf 900 Medium 1 3X or Grace s Insect Cell Culture Medium 2X as appropriate Once the 4 agarose gel has liquefied move the agarose gel medium and empty 100 ml bottle to a sterile hood Working quickly prepare the plaquing medium as follows Sf 900 Plaquing Medium Combine 30 ml of Sf 900 Medium 1 3X and 10 ml of the melted 4 Agarose Gel in the empty 100 ml bottle and mix gently Grace s Plaquing Medium Add 20 ml of heat inactivated FBS to the 100 ml bottle of Grace s Insect Medium 2X and mix Combine 25 ml of the Grace s Insect Medium 2X containing serum with 12 5 ml of cell culture grade sterile distilled water and 12 5 ml of the melted 4 Agarose Gel in the empty 100 ml bottle and mix gently 4 Return the bottl
22. NA Important 46 1 Place a sterile 30 ml centrifuge tube elution tube under the column 2 Add 15 ml Elution Buffer E4 to the column to elute DNA Allow the solution to drain by gravity flow Do not force out any remaining solution The elution tube contains the purified DNA Discard the column Add 10 5 ml isopropanol to the elution tube Mix well Centrifuge the mixture at gt 15 000 x g at 4 C for 30 minutes Carefully remove and discard the supernatant 5 Add 1 ml 70 ethanol to the pellet in the 30 ml elution tube displace the pellet from the side of the tube and transfer all the pellet fragments into a 1 5 ml microcentrifuge tube 6 Centrifuge at gt 15 000 x g at 4 C for 10 minutes Carefully remove and discard the supernatant 7 Add another 1 ml fresh 70 ethanol to the pellet in the microcentrifuge tube and centrifuge at gt 15 000 x g at 4 C for another 10 minutes second wash Carefully remove and discard the supernatant 8 Air dry the pellet at room temperature until the appearance of the pellet changes from white opaque to translucent and crystalline 9 Resuspend the DNA pellet in 200 500 ul TE Buffer pH 8 0 by vortexing 10 Measure the concentration of the purified bacmid DNA The concentration should be in range of 150 300 ng ml 11 Store the tube at 4 C You may store your bacmid DNA at 20 C if you avoid frequent freeze thaw cycles as it decreases the transfection efficiency To
23. OPO Cloning Kit Y Bac to Bac N His TOPO Cloning Kit Y One Shot Mach1 T1 Chemically Competent E coli Y Y MAX Efficiency DH10Bac Competent E coli Y Y Cellfectin II Reagent Y Y Bac to Bac TOPO Cloning Kit Manual Y Y Bac to Bac TOPO Expression System Manual Y Y The Bac to Bac C His or N His TOPO Expression System is shipped in four boxes as described below Upon receipt store each box as detailed below All reagents are guaranteed for six months if stored properly Box Item Shipping Storage 1 Bac to Bac C His TOPO or Dry ice 20 C Bac to Bac N His TOPO Cloning Kit 2 One Shot Mach1 T1 Chemically Competent Dry ice 80 C E coli MAX Efficiency DH10Bac Competent E coli Dry ice 80 C Cellfectin II Reagent Gel ice 4 C Continued on next page Kit Contents and Storage continued Bac to Bac TOPO The cloning reagents for the Bac to Bac N His and C His TOPO Cloning Kits Cloning Kits vi Box 1 are listed below Store the contents of Box 1 at 20 C Item Concentration Amount pFastBac NT TOPO 20 ul at 10 ng pl in 20 pl es A11101 RICO i 50 mM Tris HCl pH 7 4 at 25 C pFastBac CT TOPO ee vector 2 mM DTT Cat no A11100 0 1 Triton X 100 100 pg ml BSA 30 uM bromophenol blue 10X PCR Buffer 100 mM Tris HCl pH 8 3 at 42 C 100 pl 500 mM KCI 25 mM MgCl 0 01
24. Use the following formula to calculate how much viral stock to add to obtain a specific MOI MOI pfu cell x number of cells Inoculum required ml titer of viral stock pfu ml Note If you have not determined the titer of your P1 viral stock you may assume that the titer ranges from 1 x 10 to 1 x 10 pfu ml We wish to infect a 10 ml culture at 2 x 10 cells ml using an MOI 0 1 We assume that the titer of our P1 viral stock is 5 x 10 pfu ml 0 1 pfu cell x 2x107 cells Inoculum required ml 5x10 pfu ml Inoculum required ml 0 4 ml Continued on next page Amplifying Your Baculoviral Stock continued Important For successful amplification of your baculovirus you should pay attention to considerations several key points e Use Sf9 or Sf21 cells that are in excellent health low passage 5 20 log phase growth and have gt 95 viability e Use sterile Pl baculoviral stock that is free of contaminants e Use a low MOI between 0 05 0 1 as higher MOI will reduce baculovirus quality e Harvest the virus when 70 80 of cells are dead e You cannot amplify the baculovirus indefinitely as they acquire deleterious mutations with each passage Usually P3 is highest usable passage Amplification Follow the guidelines below to amplify your P1 viral stock in a 6 well plate Procedure 1 On the day of infection prepare your Sf9 or Sf21 cell suspension and plate cells at 2 x 10 cells we
25. aining your gene of interest into MAX Efficiency DH10Bac competent E coli to generate recombinant bacmid 2 Transfect the recombinant bacmid DNA into the insect cell line of choice to produce recombinant baculovirus particles 3 Amplify and titer the baculoviral stock and use this stock to infect insect cells to express your recombinant protein Detailed instructions for cloning your gene of interest into the pFastBac TOPO vector of choice pFastBac CT TOPO or pFastBac NT TOPO are provided in the Bac to Bac TOPO Cloning Kit manual part no A10605 supplied with the Bac to Bac TOPO Expression System The Bac to Bac TOPO Cloning Kit manual is also available on our website at www invitrogen com or from Technical Support see page 47 The Bac to Bac TOPO Expression System is designed to help you create a recombinant baculovirus for high level expression of your gene of interest in insect cells Although the system has been designed to help you to easily produce recombinant baculovirus and express your protein of interest use of the system is geared towards those users who are familiar with baculovirus biology and insect cell culture We highly recommend that users possess a working knowledge of viral and tissue culture techniques For more information about baculovirus biology refer to published reference sources King amp Possee 1992 Luckow 1991 O Reilly et al 1992 For more information about
26. aks a e e E aeo a aR doo aaae Ea A STRESE 22 Amplifying Your Baculoviral Stock c cccccsesccsssseseecsceceneesesescsneesesesescsnsnsnssesescseecseeeesesssssesesesnananeseseseeees 24 Performing a Viral Plaque Assa yonsin eree e ea aeni eRe EE eaae EEEE A EEO EARS 26 Expressing Your Recombinant Protein ccccccsesessesssesesesceceseeesesesesnenenesesesesesceceeesesesesesesesnasnasesssesees 33 Analyzing Recombinant Proteiinia e ineei aeara eaea eia aA eE E SE ESEE 35 FFOUBDICSHOOUING icisiisci 37 Ae a 42 Recipes iaa dali 42 Bacmid DNA Isolation Using PureLink HiPure Maxiprep Kit esesnsensnensensenensennensenenn 44 Technical Supports lt csacseac an cobcecaves Mises Sead E NEIN SR tdci 47 P rch serNotihcation rare nenn era di beis 48 References A RN ON A NS NAO EEEIEE 50 111 1V Kit Contents and Storage Types of Products This manual is supplied with the products listed below For a list of the reagents supplied with each catalog number see below and the next page Kit Components Shipping Storage Product Quantity Cat no Bac to Bac C His TOPO Expression System 1 kit A11100 Bac to Bac N His TOPO Expression System 1 kit A11101 Each Bac to Bac TOPO Expression System contains the components listed below See the next page for a detailed description of other reagents supplied with each system Component po no Cat no 11100 A11101 Bac to Bac C His T
27. ate a recombinant baculovirus The expression of the gene of interest is controlled by the Autographa californica multiple nuclear polyhedrosis virus AcMNPV polyhedrin Py promoter for high level expression in insect cells This expression cassette is flanked by the left and right arms of Tn7 and also contains a gentamicin resistance gene and an SV40 polyadenylation signal to form a mini Tn7 The second major component of the System is the DH10Bac E coli strain that is used as the host for your pFastBac construct containing your gene of interest DH10Bac cells contain a baculovirus shuttle vector bacmid with a mini attTn7 target site and a helper plasmid see the next page for details Once the pFastBac expression plasmid the donor plasmid is transformed into DH10Bac cells transposition occurs between the mini Tn7 element on the pFastBac vector and the mini attTn7 target site on the bacmid to generate a recombinant bacmid This transposition reaction occurs in the presence of transposition proteins supplied by the helper plasmid Once you have performed the transposition reaction you will isolate the high molecular weight recombinant bacmid DNA and transfect the bacmid DNA into insect cells using the Cellfectin II reagent to generate a recombinant baculovirus that can be used for preliminary expression experiments After the baculoviral stock is amplified and titered this high titer stock can be used
28. ation reaction into DH10Bac cells 3 Pick colonies isolate plasmid DNA and screen for insert directionality by sequencing expression clones with the primers provided in the kit For detailed instructions refer to the Bac to Bac TOPO Cloning Kit manual part no A10605 supplied with this kit The Bac to Bac TOPO Cloning Kit manual is also available at www invitrogen com or from Technical Support see page 47 When generating the recombinant plasmid containing your gene of interest for use in the Bac to Bac TOPO Expression System you must follow certain design parameters for your PCR insert and the recommendations for the transformation procedure outlined in the Bac to Bac TOPO Cloning Kit manual To ensure proper expression of your recombinant protein it is imperative that you read the sections on generating the blunt end PCR product blunt end TOPO cloning transformation of One Shot Mach1 T1 Chemically Competent E coli and analysis of transformants in the Bac to Bac TOPO Cloning Kit manual before beginning For the features and vector maps of pFastBac CT TOPO and pFastBac NT TOPOS refer to the Bac to Bac TOPO Cloning Kit manual part no A10605 supplied with this kit and also available on our website www invitrogen com or by contacting Technical Support see page 47 Generating the Recombinant Bacmid Transforming DH10Bac E coli Introduction Once you have generated you
29. c to Bac C His TOPO Cloning Kit 1 kit A10636 Bac to Bac N His TOPO Cloning Kit 1 kit A10637 MAX Efficiency DH10Bac Competent E coli 5 x 100 ul 10361 012 One Shot Mach1 T1 Chemically Competent 21 x 50 pl C8620 03 E coli Cellfectin II Reagent 1ml 10362 100 Platinum Pfx DNA Polymerase 100 units 11708 013 AccuPrime Pfx DNA Polymerase 200 reactions 12344 024 Pfx50 DNA Polymerase 100 reactions 12355 012 Platinum Tag DNA Polymerase High Fidelity 100 reactions 11304 011 PureLink PCR Purification Kit 50 preps K3100 01 PureLink Quick Gel Extraction System 1 kit K2100 12 PureLink HiPure Plasmid Miniprep Kit 25 preps K2100 02 100 preps K2100 03 PureLink HiPure Plasmid Midiprep Kit 25 preps K2100 04 50 preps K2100 05 PureLink HiPure Plasmid Maxiprep Kit 10 preps K2100 06 25 preps K2100 07 Ampicillin Sodium Salt irradiated 200 mg 11593 027 Kanamycin Sulfate 58 11815 024 25g 11815 032 Kanamycin Sulfate 100X liquid 100 ml 15160 054 Gentamicin Reagent Solution liquid 50 mg ml 10 ml 15750 060 10 x 10 ml 15750 078 Bluo gal 1g 15519 028 Isopropylthio B galactoside IPTG 1g 15529 019 S O C Medium 10 x 10 ml 15544 034 Miller s LB Broth Base Luria Broth Base 500 g 12795 027 powder Continued on next page Accessory Products continued Additional Products continued Insect Cell Culture Products All of the reagents supplied in the Bac to Bac TOPO Expression System as
30. chelating Resin 50 ml R801 01 150 ml R801 15 ProBond Purification System 6 purifications K850 01 Ni NTA Agarose 10 ml R901 01 25 ml R901 15 100 ml R901 10 Ni NTA Purification System 6 purifications K950 01 Purification Columns 50 columns R640 50 10 ml polypropylene columns ACTEV Protease 1 000 Units 12575 015 10 000 Units 12575 023 Overview Introduction Advantages of the Bac to Bac System Introduction The Bac to Bac TOPO Expression System provides a rapid and highly effective method to generate recombinant baculoviruses by combining the ease of blunt end TOPO cloning with the efficiency of site specific transposition technology of the Bac to Bac System The major components of the Bac to Bac Baculovirus Expression System include A choice of pFastBac CT TOPO or pFastBac NT TOPO donor plasmids that allow rapid generation of an expression construct containing the gene of interest under the control of a baculovirus specific strong polyhedrin Px promoter One Shot Mach1 T1 Chemically Competent E coli that enable same day isolation of recombinant pFastBac expression construct from the transformation mix An E coli host strain DH10Bac that contains a baculovirus shuttle vector bacmid and a helper plasmid and allows generation of a recombinant TM bacmid following transposition of the pFastBac expression construct Cellfectin II Reagent for faster and
31. ct the medium containing virus from each well 2 ml and transfer to sterile 15 ml snap cap tubes Centrifuge the tubes at 500 x g for 5 minutes to remove cells and large debris 6 Transfer the clarified supernatant to fresh 15 ml snap cap tubes This is your plaque purified viral stock 7 Proceed to Amplifying Your Baculoviral Stock page 24 Expressing Your Recombinant Protein Introduction Positive Control Guidelines for Expression TM Once you have generated a pFastBac baculoviral stock with a suitable titer e g 1 x 10 pfu ml you are ready to use the baculoviral stock to infect insect cells and assay for expression of your recombinant protein Guidelines for infection and expression are provided below TM If you have generated a high titer viral stock from the pFastBac Gus control plasmid you may want to include this recombinant baculovirus in your experiments for use as an expression control Once you have infected cells with the FastBac Gus control virus the gene encoding glucuronidase Gus will be constitutively expressed and can be easily assayed see page 35 General guidelines are provided below to infect insect cells with the recombinant baculovirus to express your protein of interest e Cell line Depending on your application and gene of interest you may use any insect cell line including Sf9 Sf21 High Five or Mimic Sf9 for expression You may grow your cells either
32. d in writing prior to acceptance of the order Invitrogen makes every effort to ensure the accuracy of its publications but realizes that the occasional typographical or other error is inevitable Therefore Invitrogen makes no warranty of any kind regarding the contents of any publications or documentation If you discover an error in any of our publications please report it to our Technical Support Representatives Invitrogen assumes no responsibility or liability for any special incidental indirect or consequential loss or damage whatsoever The above limited warranty is sole and exclusive No other warranty is made whether expressed or implied including any warranty of merchantability or fitness for a particular purpose 47 Purchaser Notification Introduction Limited Use Label License No 5 Invitrogen Technology Limited Use Label License No 21 Bac to Bac and Bac to Bac HT Limited Use Label License No 22 Vectors and Clones Encoding Histidine Hexamer 48 Use of the Bac to Bac TOPO Expression System and the pFastBac TOPO vectors is covered under the licenses detailed below The purchase of this product conveys to the buyer the non transferable right to use the purchased amount of the product and components of the product in research conducted by the buyer whether the buyer is an academic or for profit entity The buyer cannot sell or otherwise transfer a this product b its compo
33. e of plaquing medium to the 40 C water bath until use Continued on next page Performing a Viral Plaque Assay continued Plaque Assay Procedure Use the procedure below to perform a plaque assay in 6 well plate format to determine the titer of your pFastBac baculoviral stock If you have generated a baculoviral stock of the pFastBac expression control pFastBac Gus we recommend titering this stock as well Remember to include a negative control no virus in your experiment Note The amounts provided in this procedure are suitable to titer one baculoviral stock two 6 well plates per viral stock If you wish to titer more than one baculoviral stock scale up the reagent quantities accordingly 1 On the day of infection harvest Sf9 or Sf21 cells and prepare a 30 ml cell suspension at 5 x 10 cells ml in Sf 900 II SFM or other complete growth medium Aliquot 2 ml of cell suspension into each well of two 6 well plates If you are including a negative control you will need another 6 well plate 2 Allow the cells to settle to the bottom of the plate and incubate covered at room temperature for 1 hour 3 Following the 1 hour incubation observe the cell monolayers using an inverted microscope Sf9 cells should be attached and at 50 confluence 4 Prepare an 8 log serial dilution 107 to 107 of the clarified baculoviral stock in Sf 900 II SFM or Grace s Insect Cell Culture Medium Supplemented without FBS as ap
34. er plasmid provides the Tn7 transposition function in trans Barry 1988 Continued on next page Experimental Outline Diagram of the Bac to Bac System System pFastBac TOPO donor plasmid Clone Gene of Interest Gene fe Interest Tn7R A Tn7L Transformation Antibiotic Recombinant Donor Plasmid Bacmid Competent DH10Bac E coli Cells Transposition The figure below depicts the generation of recombinant baculovirus and the expression of your gene of interest using the Bac to Bac TOPO Expression Foreign Ppy Gene Selection Bacmid E coli LacZ Containing Recombinant Bacmid Mini prep of High Molecular Weight DNA Y Determine NA Q B E Viral Titer by Transfection of Plaque Assay 3 A 7 Insect Cells dm with Cellfection II 0000000000 Reagent Recombinant Baculovirus Particles 0000000000 y Recombinant Gene Expression or Viral Amplification Recombinant Bacmid DNA Experimental Outline continued Flow Chart The figure below illustrates the general steps required to express your gene of interest using the Bac to Bac TOPO Expression System pFastBac TOPO Donor Plasmid Y Clone gene of interest Recombinant pFastBac Construct Transform into MAX Efficiency DH10Bac Cells containing bacmid and helper E coli Colonies with Recombinant Bacmid y Restreak Verified E coli
35. f its components was used in the manufacture of such product If the purchaser is not willing to accept the limitations of this limited use statement Invitrogen is willing to accept return of the product with a full refund For information on purchasing a license to this product for purposes other than research contact Licensing Department Invitrogen Corporation 5791 Van Allen Way Carlsbad California 92008 Phone 760 603 7200 Fax 760 602 6500 Email outlicensing invitrogen com This product is the subject of U S Patent No 5 348 886 This product is sold under patent license from Monsanto for research purposes only and no license for commercial use is included Requests for licenses for commercial manufacture or use should be directed to Director Monsanto Corporate Research 800 N Lindbergh St Louis Missouri 63167 This product is licensed under U S Patent Nos 5 284 933 and 5 310 663 and foreign equivalents from Hoffmann LaRoche Inc Nutley NJ and or Hoffmann LaRoche Ltd Basel Switzerland and is provided only for use in research Information about licenses for commercial use is available from QIAGEN GmbH Max Volmer Str 4 D 40724 Hilden Germany Continued on next page Purchaser Notification continued Information for European Customers Using Mach1 T1F Cells Information for All Non U S Customers Using Mach1 T1 Cells Information for European Customers Using DH10Bac cells The Mach1
36. gelatin dNTP Mix 12 5 mM each dATP dCTP dGTP 10 ul and dTTP neutralized at pH 8 0 in water Salt Solution 1 2 M NaCl 50 pl 0 06 M MgCl Sterile Water 1ml Control PCR template 50 ng ul in TE buffer pH 8 0 10 ul Control PCR primers 100 ng pl each in TE buffer pH 8 0 10 ul Polyhedrin forward 100 ng ul in TE buffer pH 8 0 20 ul sequencing primer SV40 polyA reverse 100 ng ulin TE buffer pH 8 0 20 ul sequencing primer pFastBac Gus 0 2 ng pl in TE buffer pH 8 0 20 ul TE buffer pH 8 0 10 mM Tris HCl 1 mM EDTA pH 8 0 Continued on next page Kit Contents and Storage continued One Shot Machi The following reagents are included in the One Shot Mach1 T1 Chemically Competent E coli kit Box 2 Transformation efficiency of One Shot Mach1 T1 E coli cells is gt 1 x 10 cfu ng DNA Store cells at 80 C T1 Competent E coli Genotype of Mach1 T1P MAX Efficiency DH10Bac Competent E coli Genotype of DH10Bac Cellfectin II Transfection Reagent Reagent Composition Amount One Shot Mach1 T18 21x 50 ul Chemically Competent E coli 5 0 C Medium 2 tryptone 6 ml may be stored at room 0 5 yeast extract temperature or 4 C 10 mM NaCl 2 5 mM KCl 10 mM MgCl 10 mM MgSO 20 mM glucose pUC19 Control DNA 10 pg ul in 5 mM Tris HCl 50 ul 0 5 mM EDTA pH 8 0 F p80 lacZ AM15 AlacX74 hsdR rxmx ArecA1398 endA1 tonA MAX Efficiency DH1
37. h and recombinant protein expression Active or controlled oxygenated systems require dissolved oxygen at 10 to 50 of air saturation Shear Forces Suspension culture generates mechanical shear forces Growing insect cells in serum containing media 10 to 20 FBS generally provides adequate protection from cellular shear forces If you are growing insect cells in serum free conditions supplementation with a shear force protectant such as PLURONIC F 68 may be required Note Growing cells in Sf 900 II SFM or Sf 900 III SFM does not require addition of shear force protectants Cells for You will need log phase Sf9 or Sf21 cells with gt 95 viability to perform a Transfection successful transfection Refer to page 20 to determine how many cells you will need for transfection Generating the Recombinant pFastBac Vector Introduction Important pFastBac TOPO vectors To generate a recombinant plasmid containing your gene of interest for use in the Bac to Bac TOPO Expression System you will perform the following steps 1 Generate a blunt end PCR product containing your gene of interest with a thermostable proofreading DNA polymerase such as the Platinum Pfx or the AccuPrime Pfx DNA Polymerase 2 TOPO Clone your blunt end PCR product into the pFastBac CT TOPO or pFastBac NT TOPO vector and use the reaction to transform One Shot Mach1 T1 Chemically Competent E coli Do not transform the lig
38. h occasional gentle tapping of the bottom of the tube Poor yield Used incorrect antibiotic Grow transformed DH10Bac cells in concentrations LB medium containing 50 ug ml kanamycin 7 ug ml gentamicin and 10 pg ml tetracycline Bacmid DNA contains a Picked a colony that was gray or Analyze more white DH10Bac mixture of recombinant dark in the center transformants and choose one that bacmid and empty contains recombinant bacmid DNA bacmid only Continued on next page 39 Troubleshooting continued Transfecting Insect Cells 40 The table below lists some potential problems and possible solutions that may help you troubleshoot insect cell transfection Problem Reason Solution Low yield of virus Low transfection efficiency e Use Invitrogen s Cellfectin II Reagent for transfection e Perform transfection in unsupplemented Grace s Medium make sure that no supplements FBS or antibiotics are present during transfection e Harvest viral supernatant when signs of infection are visible i e gt 72 hours post transfection Cells plated too sparsely Plate insect cells at the recommended cell density Used too much or too little Cellfectin II or other lipid reagent Optimize the amount of Cellfectin II or other lipid reagent used Time of incubation with DNA lipid complexes too short or too long Optimize the incubation time e g 3 to 8 hours
39. ify using the following cycling parameters Step Time Temperature Cycles Initial Denaturation 3 minutes 94 C 1X Denaturation 45 seconds 94 C Annealing 45 seconds 55 C 25 35X Extension 5 minutes 72 C Final Extension 7 minutes 722 1X 4 Remove 5 10 ul from the reaction and analyze by agarose gel electrophoresis Continued on next page 17 Analyzing Recombinant Bacmid DNA by PCR continued What You Should See 18 If transposition has occurred and you have used the pUC M13 Forward and Reverse primers for amplification you should see a PCR product of the following size on the agarose gel Bacmid transposed with Size of PCR Product Bacmid alone 350 bp pFastBac CT TOPO 2420 bp size of your insert pFastBac NT TOPO 2440 bp size of your insert pFastBac Gus 4220 bp If you have used a combination of the pUC M13 Forward or Reverse primer and a gene specific primer for amplification you will need to determine the expected size of your PCR product Refer to the diagram on page 16 to help you calculate the expected size of your PCR product Producing Recombinant Baculovirus Transfecting Insect Cells Introduction Plasmid Preparation Transfection Method Cellfectin II Reagent Insect Cell Lines Media for Transfection Once you have confirmed that your recombinant bacmid contains the gene of interest you are ready t
40. imal Use the following procedure for harvesting recombinant baculovirus infected insect cells to analyze expression of your recombinant protein of interest This procedure is adapted from Luckow and Summers and is designed to allow expression analysis in a 24 well format from cells harvested 24 to 96 hours post infection Other protocols are also suitable 1 Seed 6 x 10 Sf9 or Sf21 cells per well in a 24 well plate Let cells attach for at least 30 minutes Remove the media and rinse the cells once with fresh growth media Replace with 300 ul of fresh media Add the pFastBac baculoviral stock to each well at the desired MOI Include the appropriate controls e g mock infected uninfected cells pFastBac positive control baculovirus previously characterized recombinant baculoviruses Incubate cells in a 27 C humidified incubator Harvest cells or media if the recombinant protein is secreted at the appropriate time i e 24 48 72 96 hours post infection If harvesting cells remove the media and rinse the cells once with serum free medium Lyse the cells with 400 ul of 1X SDS PAGE Buffer 62 5 mM Tris HCl pH 6 8 2 SDS Freeze samples at 20 C or boil samples for at least 3 minutes and separate proteins by SDS PAGE Analyzing Recombinant Protein Detecting Recombinant Protein You may use any method of choice to detect your recombinant protein of interest including functional analysis or wes
41. in adherent or suspension culture using your culture vessel of choice Note If you are expressing a secreted protein you may improve expression by using High Five cells e Culture Conditions We generally culture cells in serum free conditions using Sf 900 II SEM Sf 900 III SFM or Express Five SFM see page ix for ordering information as appropriate Depending on your application and the protein of interest note that it may be necessary to supplement the culture post infection with 0 1 to 0 5 FBS or BSA to protect the recombinant protein from proteolysis Protein based protease inhibitors are generally less expensive and more effective than many synthetic protease inhibitors e Infection Conditions We recommend infecting cultures while cells are in the mid logarithmic phase of growth at a density of 1 x 10 to 2 x 10 cells ml Make sure that the culture is not rate limited by nutritional i e amino acid or carbohydrate utilization or environmental factors i e pH dissolved O or temperature during infection e MOI Optimal MOI will vary between cell lines and the relative infection kinetics of the virus isolate or clone used Establish a dose for each virus medium reactor and cell line employed to determine the optimal infection parameters to use for protein expression As a starting point infect cells using an MOT of 5 to 10 e Time course We recommend performing a time course to determine the expression ki
42. insect cell culture refer to the Guide to Baculovirus Expression Vector Systems BEVS and Insect Cell Culture Techniques available from Invitrogen at http tools invitrogen com content sfs manuals bevtest pdf or by contacting Technical Support see page 47 The Bac to Bac TOPO Expression System Components of the Bac to Bac TOPO Expression System pFastBac TOPO vector DH10Bac E coli The Bac to Bac TOPO Expression System facilitates rapid and efficient generation of recombinant baculoviruses Ciccarone et al 1997 by combining the ease of TOPO cloning with the efficiency of the Bac to Bac System Based on a method developed by Luckow et al Luckow et al 1993 the Bac to Bac TOPO Expression System takes advantage of the site specific transposition properties of the Tn7 transposon to simplify and enhance the process of generating recombinant bacmid DNA The major components of the system are described below The first major component of the System is a pFastBac TOPO vector into which your gene of interest will be cloned Once you amplify your gene of interest using a proofreading polymerase and clone it into the pFastBac TOPO vector as a blunt end PCR product and transform One Shot Mach1 T1 Chemically Competent E coli You will select and analyze transformants for the correct insertion of your blunt end PCR products and use the recombinant vector as a donor plasmid to gener
43. invitrogen Bac to Bac TOPO Expression System An efficient cloning and site specific transposition system to generate recombinant baculovirus for high level protein expression Catalog nos A11101 A11100 Version A 15 December 2008 A10606 ii Table of Contents Kit Contents and Storage hiyi ee eaae E E Ea aE E a E RESE AEE AREE On v NS A aan iii au e EEE E a E E Ep e HG E iTe viii Introduction ii fhdviseatldusastaudessoustdaavacanduaenses 1 COVER VIS W eset ie REES REN EIER teeth Eee LE Rn E ie 1 The Bac to Bac TOPO Expression System een aa td Stunssiae etna ine tia aeeaaate 3 Experimental Outlime es ae ea nebenan beten 5 Methods 7 Culturitig Insect Cels y oia eee ca ee eta 7 Gener l GUI Els Gi ann re DEREN RI Erlen 7 Generating the Recombinant pFastBac Vector nunansununnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn 9 Generating the Recombinant Bacmid ccccsseeecseseeeeeeeseeneeeeeeeeeneseeneeeneeseseeeeeeeeeseeeeeeeeas 10 Transforming DH TOBA E fo na ERS ee 10 Isolating Recombinant Bacmid DNA nensssnenensnsnnsesenenennnnnnnnnnennnnnnnnnnnnsnsnnnnannnn 14 Analyzing Recombinant Bacmid DNA by PCR cocococononenonononocnnncnconnnennanananannnnnonnnnonanannrnrnnnnnnnnrararananannanos 16 Producing Recombinant Baculovirus uneessnnnnnnnannnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnennnnnn nenn 19 Transtectine Insect CellS coca alado tested 19 Isolating Pl Viral Stock airsean gere ies Lenses
44. is not in this range or the cell culture contains antibiotics follow steps 2b 2c a Add 2 ml of Grace s Insect Medium Unsupplemented without antibiotics and serum in each well Seed 8 x 10 Sf9 or Sf21 cells from Step 1 per well Do not change medium or wash the cells The medium carried over will enhance the transfection efficiency Allow cells to attach for 15 minutes at room temperature in the hood Proceed to step 3 b Prepare 10ml plating medium by mixing 1 5 ml Supplemented Grace s Insect Medium containing 10 FBS without antibiotics and 8 5 ml Grace s Insect Medium Unsupplemented without FBS and antibiotics c Plate 8 x 10 Sf9 or Sf21 cells from Step 1 per well Allow cells to attach for 15 minutes at room temperature in the hood Remove the medium Add 2 5 ml plating medium from step 2b per well Proceed to step 3 For each transfection sample prepare complexes as follows a Mix Cellfectin II before use and dilute 8 ul in 100 ul Grace s Medium Unsupplemented without antibiotics and serum Vortex briefly to mix Note you may leave this mixture at room temperature for up to 30 minutes b Dilute 1 pl baculovirus DNA in 100 pl Grace s Medium Unsupplemented without antibiotics and serum Mix gently c Combine the diluted DNA with diluted Cellfectin II total volume 210 ul Mix gently and incubate for 15 30 minutes at room temperature Add 210 ul DNA lipid mixture or transfection mixture Step 3c dr
45. ll Incubate cells at room temperature for 1 hour to allow attachment After 1 hour inspect cells under an inverted microscope to verify attachment Add the appropriate amount of P1 viral stock to each well Incubate the cells for 48 hours in a 27 C humidified incubator SES A 3 48 hours post infection collect 2 ml of medium containing virus from each well and transfer to sterile 15 ml snap cap tubes Centrifuge the tubes at 500 x g for 5 minutes to remove cells and large debris and to obtain clarified baculoviral stock Note It is possible to harvest virus at later times after infection e g 72 hours Optimal harvest times can vary and should be determined for each baculoviral construct Remember that culture viability will decrease over time as cells lyse 6 Transfer the supernatant to fresh 15 ml snap cap tubes This is the P2 viral stock Store at 4 C protected from light For long term storage you may store an aliquot of the P2 stock at 80 C protected from light See page 23 for storage guidelines 7 Proceed to the next section to determine the titer of your P2 viral stock Scaling Up the Once you have generated a high titer P2 baculoviral stock you may scale up the Amplification amplification procedure to any volume of your choice To produce this high titer Procedure P3 stock scale up the amount of cells and volume of virus used appropriately and follow the guidelines and procedure outlined in this section
46. ll containing plaquing overlay Once the agarose has hardened return plates to a 27 C humidified incubator until plaques are ready to count Plaques will appear as clear spots on a red monolayer Preparing a Neutral Red Stain for use on Day 7 10 prior to counting plaques 1 Prepare a 1 mg ml Neutral Red solution in cell culture grade distilled water 2 Add 0 5 ml of Neutral Red solution to each well containing plaquing overlay Incubate for 1 to 2 hours at room temperature 3 Gently remove excess stain with a pipet or blotter and count the plaques Plaques will appear as clear spots in a nearly clear gel against a red background Continued on next page Performing a Viral Plaque Assay continued Calculating the Titer Example What You Should See Count the number of plaques present in each dilution then use the following formula to calculate the titer plaque forming units pfu ml of your viral stock Note that the optimal range to count is 3 to 20 plaques per well of a 6 well plate ml of inoculum well 1 titer pfu ml number of plaques x dilution factor x ______ ml of inoculum well In this example we add 1 ml of inoculum and observe 20 plaques in the well containing the 10 viral dilution Using the formula above the titer of this viral stock is 1 1 ml of inoculum well titer pfu ml 20 plaques x 10 x titer pfu ml 2 x 10 pfu ml When titering pFastBac
47. lls Late 24 72 hours Cessation of cell growth Cells appear to stop growing when compared to a cell only control Granular appearance Signs of viral budding vesicular appearance to cells Detachment Cells release from the plate or flask Very Late gt 72 hours Cell lysis Cells appear lysed and show signs of clearing in the monolayer Preparing the P1 Viral Stock 22 1 Once the transfected cells from Step 6 previous page demonstrate signs of late stage infection e g 72 hours post transfection collect the medium containing the virus from each well 2 ml and transfer to sterile 15 ml snap cap tubes Centrifuge the tubes at 500 x g for 5 minutes to remove cells and large debris 2 Transfer the clarified supernatant to fresh 15 ml snap cap tubes This is the P1 viral stock Store at 4 C protected from light See the next page for additional storage information Note If you wish to concentrate your viral stock to obtain a higher titer you may filter your viral supernatant through a 0 2 um low protein binding filter after the low speed centrifugation step if desired Continued on next page Isolating P1 Viral Stock continued Storing Viral Stocks The Next Step Note Store viral stocks as follows Store viral stock at 4 C protected from light If medium is serum free e g Sf 900 II SFM Sf 900 II SFM add fetal bovine serum to a final concentration
48. lls to generate a high titer P2 stock The titer of the initial viral stock obtained from transfecting Sf9 or Sf21 cells generally ranges from 1 x 10 to 1 x 107 plaque forming units pfu ml Amplification allows production of a P2 viral stock with a titer ranging from 1 x 10 to 1 x 10 pfu ml and is generally recommended Guidelines and protocols are provided in this section to amplify the recombinant baculovirus to prepare a P2 viral stock e Sf9 or Sf21 cells cultured in the appropriate growth medium e P1 baculoviral stock e Any appropriate tissue culture vessel see Important Note below e Tissue culture reagents e 27 C humidified incubator To amplify your P1 viral stock you may infect Sf9 or Sf21 cells growing in suspension or monolayer culture Depending on your needs you may amplify your P1 viral stock at any scale but remember that you may be limited by the amount of P1 viral stock available We generally amplify our P1 viral stock ina 10 ml suspension culture at 2 x 10 cells ml or in 6 well tissue culture plates at 2 x 10 cells well Calculate the number of Sf9 or Sf21 cells that you will need for infection and expand cells accordingly Make sure that the cells are healthy of low passage 5 20 and have gt 95 viability before proceeding to infection To amplify your viral stock infect cells at a multiplicity of infection MOI ranging from 0 05 to 0 1 MOI is defined as the number of virus particles per cell
49. me to obtain maximal protein expression Cell growth conditions and medium not optimal e Optimize culture conditions based on the size of your culture vessel and expression conditions e Culture cells in Sf 900 IT SEM or Sf 900 TIL SFM for optimal cell growth and protein expression Cell line not optimal Try other insect cell lines Protein expression is not optimal Optimize protein expression by varying such parameters as incubation temperature and oxygenation 41 Recipes Appendix Antibiotic Stock Antibiotics can be ordered in either dry powdered form or as a stabilized sterile Solutions IPTG Bluo gal 42 premixed solution Store these solutions according to the manufacturer s recommendations For the antibiotics below prepare and store the stock solutions as directed Antibiotic Stock Solution Concentration Storage Ampicillin 50 mg ml in water filter sterilize 20 C protected from light Kanamycin 10 mg ml in water filter sterilize 20 C protected from light Tetracycline 10 mg ml in 100 ethanol filter 20 C protected from light sterilize Gentamicin 7 mg ml in water filter sterilize 20 C protected from light Follow the procedure below to prepare a 200 mg ml stock solution of IPTG 1 Dissolve 2 g of IPTG in 8 ml of sterile water Adjust the volume of the solution to 10 ml with sterile water Filter sterilize through a 0 22
50. micron filter Dispense the stock solution into 1 ml aliquots 2 3 4 5 Store at 20 C Follow the guidelines below to prepare a 20 mg ml stock solution of Bluo gal 1 Dissolve the Bluo gal in dimethylformamide or dimethylsulfoxide DMSO to make a 20 mg ml stock solution Use a glass or polypropylene tube Important Exercise caution when working with dimethylformamide Dispense solutions in a vented chemical hood only Do not filter the stock solution Store at 20 C protected from light Continued on next page Recipes continued LB Luria Bertani Medium LB Luria Bertani Plates Composition 1 0 Tryptone casein peptone 0 5 Yeast Extract 1 0 NaCl pH 7 0 1 For 1 liter dissolve 10 g tryptone 5 g yeast extract and 10 g NaCl in 950 ml deionized water 2 Adjust the pH of the solution to 7 0 with NaOH and bring the volume up to 1 liter 3 Autoclave on liquid cycle for 20 minutes Allow solution to cool to 55 C and add antibiotic if needed 4 Store at room temperature or at 4 C Follow the procedure below to prepare LB agar plates 1 2 3 4 Prepare LB medium as above but add 15 g L agar before autoclaving Autoclave on liquid cycle for 20 minutes After autoclaving cool to 55 C add antibiotic s and pour into 10 cm plates Let harden then invert and store at 4 C in the dark Plates containing antibiotics are stable for up to 4 weeks TM LB agar selective
51. more efficient transfection of insect cells to generate recombinant baculovirus particles A control expression plasmid containing the Gus gene that allows production of a recombinant baculovirus which when used to infect insect cells expresses the Arabidopsis thaliana P glucuronidase Using the Bac to Bac TOPO Expression System to generate a recombinant baculovirus provides the following advantages over the traditional method using TOPO Expression homologous recombination Enables the cloning of the gene of interest as a blunt end PCR product in a highly efficient one step reaction thus allowing the use of proofreading polymerases in the PCR amplification step Requires less than 2 weeks to identify and purify a recombinant baculovirus as compared to the 4 6 weeks required to generate a recombinant baculovirus using homologous recombination Reduces the need for multiple rounds of plaque purification as the recombinant virus DNA isolated from selected colonies is not mixed with parental non recombinant virus Permits rapid and simultaneous isolation of multiple recombinant baculoviruses and is suited for the expression of protein variants for structure function studies Continued on next page Overview continued Purpose of This Manual Important This manual provides an overview of the Bac to Bac TOPO Expression System and provides instructions and guidelines to 1 Transform the pFastBac construct cont
52. more information refer to www invitrogen com or contact Technical Support see page 47 Troubleshooting Cloning into the For troubleshooting any problems you may encounter when generating your pFastBac TOPO pFastBac TOPO construct refer to the Bac to Bac TOPO Cloning Kit manual Vectors part no A10605 supplied with this kit The Bac to Bac TOPO Cloning Kit manual is also available on our website www invitrogen com or by contacting Technical Support see page 47 Generating The table below lists some potential problems that you may encounter when Recombinant generating the recombinant bacmid following transformation into DH10Bac Bacmid DNA E coli Possible solutions that may help you troubleshoot the transposition reaction are provided Problem Reason Solution No blue colonies non recombinant obtained i e all colonies are white Note Although you will pick white colonies you should expect to see some blue colonies Blue colonies contain non recombinant bacmids Insufficient time for color development Wait at least 48 hours before identifying colony phenotypes Used X gal instead of Bluo gal in agar plates Use Bluo gal in selective plates to increase the contrast between blue and white colonies Insufficient growth after transposition Grow transformed cells in S O C Medium for a minimum of 4 hours before plating Bluo gal and IPTG omitted from pla
53. more information refer to www invitrogen com or contact Technical Support see page 47 For guidelines and detailed information on insect cell culture refer to the Guide to Baculovirus Expression Vector Systems BEVS and Insect Cell Culture Techniques available for downloading from our website at http tools invitrogen com content sfs manuals bevtest pdf or by contacting Technical Support see page 47 and contains information on e Maintaining and passaging insect cells in adherent and suspension culture e Freezing cells e Using serum free medium includes protocols to adapt cells to serum free medium e Scaling up cell culture Continued on next page General Guidelines continued General Insect cells are very sensitive to environmental factors In addition to chemical and Guidelines nutritional culture factors physical factors can also affect insect cell growth therefore optimization is required to maximize cell growth Consider the following when culturing insect cells Temperature The optimal range to grow and infect cultured insect cells is 27 C to 28 C pH A range of 6 1 to 6 4 works well for most culture systems Sf 900 II SFM will maintain a pH in this range under conditions of normal air and open capped culture systems Osmolality The optimal osmolality of medium for use with lepidopteran cell lines is 345 to 380 mOsm kg Aeration Insect cells require passive oxygen diffusion for optimal growt
54. nents or c materials made using this product or its components to a third party or otherwise use this product or its components or materials made using this product or its components for Commercial Purposes The buyer may transfer information or materials made through the use of this product to a scientific collaborator provided that such transfer is not for any Commercial Purpose and that such collaborator agrees in writing a not to transfer such materials to any third party and b to use such transferred materials and or information solely for research and not for Commercial Purposes Commercial Purposes means any activity by a party for consideration and may include but is not limited to 1 use of the product or its components in manufacturing 2 use of the product or its components to provide a service information or data 3 use of the product or its components for therapeutic diagnostic or prophylactic purposes or 4 resale of the product or its components whether or not such product or its components are resold for use in research Invitrogen Corporation will not assert a claim against the buyer of infringement of patents owned or controlled by Invitrogen Corporation which cover this product based upon the manufacture use or sale of a therapeutic clinical diagnostic vaccine or prophylactic product developed in research by the buyer in which this product or its components was employed provided that neither this product nor any o
55. netics for your recombinant protein as many proteins may be degraded by cellular proteases released in cell culture Note Maximum expression of secreted proteins is generally observed between 30 and 72 hours and non secreted proteins between 48 and 96 hours post infection Continued on next page 33 Expressing Your Recombinant Protein continued Optimizing Expression Harvesting Baculovirus Infected Insect Cells 34 A number of factors can influence determination of optimal expression conditions including the cell line MOL your application of interest and the nature of your gene of interest You may follow the following guidelines to determine the optimal conditions to use for expressing your recombinant protein of interest Cell line Infect Sf9 Sf21 High Five or Mimic Sf9 cells at a constant MOI Assay for recombinant protein expression at different times post infection e g 24 48 72 96 hours post infection Choose the cell line that provides the optimal level of recombinant protein expression MOI Infect a population of cells at varying MOIs e g 1 2 5 10 20 and assay for protein expression Use the MOI that provides the optimal level of recombinant protein expression Time course Infect cells at a constant MOI and assay for recombinant protein expression at different time points post infection e g 24 48 72 96 hours Choose the time point at which the recombinant protein expression is opt
56. o transfect insect cells to produce recombinant baculovirus Guidelines and instructions to transfect insect cells are provided in this section You may use any method to prepare purified recombinant bacmid DNA for transfection Bacmid DNA must be clean and free from phenol and sodium chloride as contaminants may kill the cells and salt will interfere with lipid complexing decreasing transfection efficiency We recommend isolating bacmid DNA using the PureLink HiPure Plasmid Miniprep Kit available separately from Invitrogen see page viii for ordering information following the procedure provided on page 14 We recommend using a cationic lipid such as Cellfectin II Reagent for transfection Cellfectin II Reagent is supplied with the Bac to Bac TOPO Expression System and is also available separately from Invitrogen See page viii for ordering information Cellfectin II Reagent is a proprietary cationic lipid formulation that offers the highest transfection efficiencies and protein expression levels on the widest variety of adherent and suspension insect cell lines including Sf9 and Sf21 cells We recommend using Sf9 or Sf21 cells for transfection and identification of recombinant plaques High Five and Mimic Sf9 cells are not recommended because they generally transfect less efficiently However once you have generated your baculovirus stock you may use High Five or Mimic Sf9 cells for expression studies
57. on Shake tube at 37 C at 225 rpm for 1 hour 9 For each pFastBac transformation Prepare 10 fold serial dilutions of the cells 1071 10 10 with S O C Medium Plate 100 ul of each dilution on an LB agar plate containing 50 ug ml kanamycin 7 ug ml gentamicin 10 ug ml tetracycline 100 ug ml Bluo gal and 40 ug ml IPTG For the pUC19 transformation Dilute the cells 1 100 with S O C Medium Plate 100 ul of the dilution on an LB agar plate containing 100 ug ml ampicillin 10 Incubate plates for 48 hours at 37 C Pick white colonies for analysis see the next page for recommendations Note We do not recommend picking colonies earlier than 48 hours as it may be difficult to distinguish between white and blue colonies Insertions of the mini Tn7 into the mini attTn7 attachment site on the bacmid disrupt the expression of the LacZa peptide so colonies containing the recombinant bacmid are white in a background of blue colonies that harbor the unaltered bacmid Select white colonies for analysis True white colonies tend to be large therefore to avoid selecting false positives choose the largest most isolated white colonies Avoid picking colonies that appear gray or are darker in the center as they can contain a mixture of cells with empty bacmid and recombinant bacmid Continued on next page Transforming DH10Bac E coli continued Verifying the Phenotype Note 1 Pick 10 white colonies and restreak them on
58. opwise onto the cells from Step 2a or 2c Incubate cells at 27 C for 3 5 hours Remove the transfection mixture and replace with 2 ml of complete growth medium e g Grace s Insect Medium Supplemented and 10 FBS Using antibiotics is optional Incubate cells at 27 C for 72 hours or until you see signs of viral infection 21 Isolating P1 Viral Stock Introduction Characteristics of Infected Cells Budded virus should be released into the medium 72 hours after transfection However if your transfection efficiency was not optimal cells may not show all of the signs of viral infection until 4 or 5 days post transfection Beginning at 72 hours after transfection you should visually inspect the cells daily for signs of infection see below Once the cells appear infected i e demonstrate characteristics typical of late to very late infection harvest the virus from the cell culture medium using the procedure below Insect cells infected with baculovirus typically display the following characteristics when visually observed using an inverted phase microscope at 250 400X magnification The time points provided below assume that the transfection was successful i e transfection efficiency was high Signs of Infection Phenotype Description Early first 24 hours Increased cell diameter A 25 50 increase in cell diameter may be seen Increased size of cell nuclei Nuclei may appear to fill the ce
59. ours at 30 C Poor blue white colony differentiation Agar not at correct pH Adjust pH of LB agar to 7 0 Intensity of the blue color too weak e Use Bluo gal not X gal e Increase the concentration of Bluo gal to 300 pg ml e Use dark and light backgrounds to view plates Too many or too few colonies on plate Adjust the serial dilutions of cells to obtain an optimal number of colonies Incubation period too short or temperature too low e Do not pick colonies until 48 hours after plating e Incubate plates at 37 C IPTG concentration not optimal Optimize the IPTG concentration A range of 20 60 ug ml IPTG generally gives optimal color development Continued on next page Troubleshooting continued Isolating Bacmid The table below lists some potential problems and possible solutions to help you DNA troubleshoot recombinant bacmid DNA isolation Problem Reason Solution Bacmid DNA is DNA stored improperly e Store purified bacmid DNA in degraded aliquots at 4 C for no more than 2 weeks e Do not freeze thaw the bacmid DNA e For long term storage of bacmid DNA prepare glycerol stocks of DH10Bac E coli containing the verified bacmid DNA High molecular weight bacmid e When isolating bacmid DNA do DNA handled improperly not vortex the DNA solution Do not resuspend DNA pellets mechanically allow the solution to sit in the tube wit
60. pUC M13 Forward 5 CCCAGTCACGACGTTGTAAAACG 3 pUC M13 Reverse 5 AGCGGATAACAATTTCACACAGG 3 You may use any DNA polymerase of your choice for PCR including Platinum Tag DNA Polymerase If the expected PCR product is gt 4 kb we recommend using a polymerase mixture such as Platinum Tag DNA Polymerase High Fidelity for best results See page viii for ordering information Continued on next page Analyzing Recombinant Bacmid DNA by PCR continued Generating the PCR Product Use the procedure below to amplify your recombinant bacmid DNA using the pUC M13 Forward and Reverse primers and Platinum Taq polymerase If you are using a combination of the pUC M13 Forward or Reverse primers primer and a primer specific for your gene you will need to determine the amplification conditions to use If you are using another polymerase follow the manufacturer s recommendations for the polymerase you are using Note Amplification conditions may need to be optimized if your insert is gt 4 kb 1 For each sample set up the following 50 ul PCR reaction in a 0 5 ml microcentrifuge tube Recombinant bacmid DNA 100 ng 10X PCR Buffer appropriate for enzyme 10 mM dNTP Mix 50 mM MgCl 1 5 ul PCR Primers 1 25 ul each 10 uM stock 2 5 ul Sterile Water 38 5 pl Platinum Tag polymerase 5 units ul 0 5 ul Total Volume 50 ul 2 Overlay with 50 ul 1 drop of mineral or silicone oil if necessary 3 Ampl
61. page while the column is equilibrating Harvest 250 500 ml of the overnight culture by centrifuging at 4 000 x g for 10 minutes in a bucket Remove all medium Add 20 ml Resuspension Buffer R3 with RNase A to the pellet and resuspend the cells until homogeneous Transfer cell suspension to a 50 ml centrifuge tube Add 20 ml Lysis Buffer L7 Mix gently by inverting the capped tube five times Do not vortex Incubate at room temperature for 5 minutes Note Do not allow lysis to proceed for more than 5 minutes Add 20 ml Precipitation Buffer N3 and mix immediately by inverting the capped tube until the mixture is homogeneous Do not vortex Centrifuge the mixture at gt 12 000 x g at room temperature for 10 minutes Note If the pellet does not adhere to the bottom of the tube incubate the tube at room temperature for 5 minutes to allow the separation of the lysate and gelatinous pellet Pipette the clear lysate into another tube and centrifuge at gt 15 000 x g for 5 minutes at room temperature to remove any remaining cellular debris Load the supernatant from Step 5 see above onto the equilibrated column Allow the solution in the column to drain by gravity flow Wash the column with 60 ml Wash Buffer W8 Allow the solution in the column to drain by gravity flow after each wash Discard the flow through Continued on next page 45 PureLink HiPure Bacmid DNA Isolation continued Eluting and Precipitating the D
62. plaques on agarose plates containing the chromogenic indicator X glucuronide e To assess B glucuronidase expression in a rapid but qualitative manner mix a small amount of media from the infected cells with X glucuronide and observe development of blue color Briefly mix 5 ul of a20 mg ml X glucuronide solution in DMSO or dimethylformamide with 50 ul of cell free medium Monitor for development of blue color within 2 hours Continued on next page 35 Analyzing Recombinant Protein continued Purifying Recombinant Protein Removing the 6xHis Tag Using AcTEV Protease 36 The presence of the C and N terminal 6xHis tag in the pFastBac CT TOPO and pFastBac NT TOPO vectors respectively allows the purification of your recombinant protein with a metal chelating resin such as ProBond and Ni NTA available from Invitrogen see page x for ordering information Refer to the manual included with each product for guidelines to purify your fusion protein These manuals are available for downloading at www invitrogen com or by contacting Technical Support see page 47 pFastBac CT TOPO and pFastBac NT TOPO vectors contain a Tobacco Etch Virus TEV recognition site that allows the removal of the 6xHis tag from your recombinant fusion protein using AcTEV Protease available separately from Invitrogen see page viii for ordering information Instructions for digestion are included with the product For
63. plates for DH10Bac transformation 1 2 Follow Steps 1 2 in the procedure above After autoclaving cool to 55 C and add the following e 50 ug ml kanamycin e 7 ug ml gentamicin e 10 ug ml tetracycline e 100 ug ml Bluo gal e 40 ug ml IPTG Let harden then invert and store at 4 C in the dark Tetracycline and Bluo gal are light sensitive so make sure that plates are stored protected from light 43 Bacmid DNA Isolation Using PureLink HiPure Maxiprep Kit Introduction Growing bacmid DNA stock 44 After you have transformed your pFastBac TOPO construct containing your gene of interest into DH10Bac E coli and performed the transposition reaction use the PureLink HiPure Plasmid Maxiprep Kit to purify recombinant bacmid DNA from DH10Bac transformants see page viii for ordering information Bacmid DNA purified by this method is suitable for use in PCR analysis or insect cell transfections Note We do not recommend the PureLink HiPure Precipitator Module or the PureLink HiPure Plasmid Filter Mini Midi Maxiprep Kits for isolating bacmid DNA For more information on PureLink HiPure purification products visit our website at www invitrogen com or contact Technical Support see page 47 TM Growing bacmid DNA stock from DH10Bac transformants in LB medium requires three days Day 1 e Pick a single white bacterial colony from among the DH10Bac transformants see page
64. propriate To do this sequentially dilute 0 5 ml of the baculoviral stock or previous dilution in 4 5 ml of medium in 12 ml disposable tubes You should finish with 8 tubes of diluted viral stock i e 10 10 10 10 107 10 107 103 You will use the dilutions 10 to 10 in your assay 5 Move the 6 well plates containing Sf9 cells and the tubes of diluted virus to the sterile hood Label the plates in columns of 2 1 sample well plus 1 duplicate as follows no virus negative control 10 10 10 107 10 6 Remove the medium from each well discard and immediately replace with 1 ml of the appropriate virus dilution As a negative control add the appropriate medium without virus 7 Incubate cells with virus for 1 hour at room temperature 8 Following the 1 hour incubation move the cells and the bottle of plaquing medium from the 40 C water bath Step 4 previous page to a sterile hood 9 Sequentially starting from the highest dilution 10 to the lowest dilution 10 remove the medium containing virus from the wells and replace with 2 ml of plaquing medium Work quickly to avoid desiccation of the cell monolayer 10 Allow agarose overlay to harden for 1 hour at room temperature before moving the plates 11 Incubate the cells in a 27 C humidified incubator for 7 10 days until plaques are visible and ready to count If you wish to stain plaques to facilitate counting see the next page To calculate the tite
65. r see page 31 Continued on next page 29 Performing a Viral Plaque Assay continued Note Neutral Red Staining Procedure 30 To improve the visualization of plaques stain the plates using Neutral Red Crystalline Blue and other plaque staining dyes containing organic solvents are not recommended because they kill the host cells To stain plaques you may do one of the following e Prepare an agarose solution containing Neutral Red and overlay this solution on the plates 4 days post infection Count plaques 7 10 days post infection or e Prepare a Neutral Red solution and add to plates for 1 2 hours just prior to counting plaques 7 10 days post infection Important If you plan to plaque purify your baculovirus you should not stain plaques as Neutral Red is a known mutagen that can alter your recombinant virus Preparing a Neutral Red Agarose Overlay for use on Day 4 1 Prepare a 1 mg ml Neutral Red solution in Sf 900 IT SEM or other appropriate complete growth medium Filter sterilize 2 Combine the reagents below in a 50 ml tube and place in a 40 C water bath 1 mg ml Neutral Red solution 1 5 ml Sf 900 II SFM 16 5 ml 3 Microwave 4 Agarose Gel until melted then place in a 40 C water bath for 5 minutes 4 Move the 50 ml tube of Neutral Red solution and the 4 agarose gel to a sterile hood Add 6 ml of 4 agarose gel to the Neutral Red solution 5 Add 1 ml of the Neutral Red overlay to each we
66. r pFastBac construct containing your gene of interest in the correct orientation you are ready to transform purified plasmid DNA into DH10Bac E coli for transposition into the bacmid You will use blue white selection to identify colonies containing the recombinant bacmid MAX Efficiency DH10Bac chemically competent cells are supplied with the Bac to Bac TOPO Expression System but are also available separately from Invitrogen see page viii Guidelines and instructions to transform DH10Bac cells are provided in this section Positive Control Both the pFastBac CT TOPO and the pFastBac NT TOPO vectors are supplied with the control plasmid pFastBac Gus for use as a positive transfection and expression control We recommend including the control plasmid in your DH10Bac transformation experiments For a map and a description of the features of the control plasmid refer to the Bac to Bac TOPO Cloning Kit manual part no A10605 supplied with this kit also available for downloading at www invitrogen com or by contacting Technical Support see page 47 Materials Needed e Your purified pFastBac construct 200 pg ulin TE pH 8 0 e Positive expression control i e pFastBac Gus use as a control for transposition e MAX Efficiency DH10Bac chemically competent cells supplied with the Bac to Bac TOPO Expression System use 1 tube of competent cells for every transformation e pUC1
67. scard the column Add 0 63 ml isopropanol to the elution tube Mix and place on ice for 10 minutes 5 Centrifuge the mixture at gt 15 000 x g at 4 C for 20 minutes Carefully remove and discard the supernatant Resuspend the DNA pellet in 1 ml 70 ethanol 7 Centrifuge at gt 15 000 x g at 4 C for 5 minutes Carefully remove and discard the supernatant Air dry the pellet for 10 minutes Resuspend the DNA pellet in 40 ul TE Buffer TE Allow pellet to dissolve for at least 10 minutes on ice To avoid shearing the DNA pipette only 1 2 times to resuspend 10 Store the bacmid DNA at 4 C You may store your bacmid DNA at 20 C if you avoid frequent freeze thaw Important cycles as it decreases the transfection efficiency To store your purified bacmid DNA at 20 C aliquot into separate tubes in TE Buffer pH 8 0 to avoid more than one freeze thaw cycle and do not store in a frost free freezer You may also store the purified bacmid DNA for up to 2 weeks at 4 C in TE Buffer pH 8 0 TM You may prepare glycerol stocks of DH10Bac E coli containing the bacmid DNA from mid logarithmic phase culture grown from white colonies picked during the blue white screening and store at 80 C for future bacmid DNA isolation TM You may also use the procedure for PureLink HiPure Plasmid Maxiprep Kit Note provided in the Appendix page 44 for increased recombinant bacmid yield TM The PureLink HiPure Plasmid Prep Ki
68. storage of your baculoviral stock For routine use baculoviral stocks should be aliquoted and stored at 4 C protected from light Continued on next page Performing a Viral Plaque Assay continued Materials Needed Note Your clarified baculoviral stock store at 4 C until use Sf9 or Sf21 cells cultured in the appropriate medium 30 ml of log phase cells at 5 x 10 cells ml for each baculoviral stock to be titered Sf 900 II SFM Sf 900 III SFM or other appropriate complete growth medium see Note below Sf 900 Medium 1 3X 100 ml or other appropriate plaquing medium see Note below 4 Agarose Gel specifically formulated for optimal insect cell growth Sterile cell culture grade distilled water 100 ml sterile glass bottle 6 well tissue culture plates 2 plates for each viral stock to be titered Sterile hood Waters baths at 40 C and 70 C Microwave oven optional 27 C humidified incubator Neutral Red Sigma Cat no N7005 See page ix for ordering information If you are culturing your Sf9 or Sf21 cells in serum supplemented media i e complete TNM FH you should have the following reagents on hand Grace s Insect Cell Culture Medium Supplemented Grace s Insect Cell Culture Medium 2X Fetal Bovine Serum FBS Qualified Heat Inactivated See page ix for ordering information Continued on next page 27 Performing a Viral Plaque Assay continued Preparing the Plaquing
69. tern blot If you perform western blot analysis you will need to have an antibody to your protein of interest The pFastBac CT TOPO and pFastBac NT TOPO vectors included in the Bac to Bac C His and N His TOPO Expression Systems respectively allow the expression of your recombinant protein of interest as a 6xHis fusion You can use the antibodies listed below available separately from Invitrogen to detect your recombinant protein See page x for ordering information For use with Product Epitope pFastBac CT TOPO Anti His C term Antibody Detects the C terminal Anti His C term HRP Antibody Polybistiine 0079 tag Anti His C term AP Antibody requires the free carboxyl group for detection pFastBac CT TOPO Penta His mouse IgG1 Detects both C and pFastBac NT TOPO monoclonal Antibody N terminal polyhistidine 6xHis tag Note Assay for glucuronidase If you are using polyacrylamide gel electrophoresis to detect your recombinant protein you should note that the presence of the C or N terminal 6xHis tag and Tobacco Etch Virus TEV recognition site will increase the size of your protein by at least 3 kDa TM If you include the baculoviral control created using the pFastBac Gus control construct in your expression experiment you may assay for B glucuronidase expression using the following methods Other methods are also suitable e Identify blue
70. tes Prepare fresh selective plates containing 50 ug ml kanamycin 7 ug ml gentamicin 10 ug ml tetracycline 100 pg ml Bluo gal and 40 ug ml IPTG Too many colonies on the plate e Serially dilute the transformation mixture and plate to give well separated colonies e Adjust the serial dilutions of cells 10 to 10 to obtain well spaced colonies Plates too old or stored in light e Donot use plates that are more than 4 weeks old e Store plates protected from light Incubation period too short or temperature too low Wait at least 48 hours before picking colonies Incubate plates at 37 C Continued on next page 37 Troubleshooting continued Generating Recombinant Bacmid DNA continued 38 Problem Reason Solution All colonies are blue DNA from your pFastBac TOPO construct used for transformation was of poor quality e Use purified plasmid DNA for transformation e Check the quality of your plasmid DNA make sure that the DNA is not degraded Gentamicin omitted from plates Prepare fresh selective plates containing 50 ug ml kanamycin 7 ug ml gentamicin 10 ug ml tetracycline 100 ug ml Bluo gal and 40 ug ml IPTG Few colonies obtained Used LB medium for recovery expression period Use S O C Medium for the 4 hours growth time Recovery expression time too short Increase the recovery time to gt 4 hours at 37 C or 6 h
71. to 42 C e Warm selective plates at 37 C for 30 minutes e Warm the S O C Medium to room temperature e Pre chill one 15 ml round bottom polypropylene tube for each transformation Continued on next page 11 Transforming DH10Bac E coli continued Transformation Procedure Important 12 Follow the procedure below to transform MAX Efficiency DH10Bac chemically competent E coli cells with your recombinant pFastBac construct We recommend including the positive controls for transposition i e pFastBac Gus expression plasmid and transformation i e pUC19 in your experiment to help you evaluate your results 1 Thaw on ice one vial of MAX Efficiency DH10Bac competent E coli cells for each transformation 2 For each transformation gently mix and transfer 100 ul of the DH10Bac cells into a pre chilled 15 ml round bottom polypropylene tube 3 Add the appropriate amount of plasmid DNA to the cells and mix gently Do not pipet up and down to mix e Your recombinant pFastBac construct 1 ng 5 pl e pFastBac Gus control plasmid Ing e pUC19 control 50 pg 5 ul Incubate cells on ice for 30 minutes Heat shock the cells for 45 seconds at 42 C without shaking Immediately transfer the tubes to ice and chill for 2 minutes Add 900 ul of room temperature S O C Medium Qo NO e For pFastBac transformations Shake tubes at 37 C at 225 rpm for 4 hours For pUC19 transformati
72. ts available separately from Invitrogen allow the purification of all types and sizes of plasmid DNA including BAC bacmids and ssM13 DNAs and are ideally suited for bacmid purification see page viii for ordering information 15 Analyzing Recombinant Bacmid DNA by PCR Introduction PCR Analysis with pUC M13 Primers DNA Polymerase 16 Recombinant bacmid DNA is greater than 135 kb in size Since restriction analysis is difficult to perform with DNA of this size we recommend using PCR analysis to verify the presence of your gene of interest in the recombinant bacmid Use the pUC M13 Forward and Reverse primers sequences given below that hybridize to sites flanking the mini atfTn7 site within the lacZa complementation region to facilitate PCR analysis see figure below Guidelines and instructions are provided in this section to perform PCR using the pUC M13 Forward and Reverse primers Transposed pFastBac Gene of interest sequence Bacmid DNA mini attTn7 pUC M13 pUC M13 Forward Reverse To verify the presence of your gene of interest in the recombinant bacmid using PCR you may e Use the pUC M13 Forward and Reverse primers see sequences below e Use a combination of the pUC M13 Forward or Reverse primer and a primer that hybridizes within your insert Invitrogen does not supply the pUC M13 Forward and Reverse primers you must have these primers custom synthesized Primer Sequence
73. um 2X 100 ml 11667 037 Penicillin Streptomycin 100 ml 15070 063 PLURONIC F 68 10 100X 100 ml 24040 032 PLURONIC is a registered trademark of BASF Corporation Continued on next page 1X Accessory Products continued Detecting If you have cloned your gene of interest in frame with the N or C terminal Recombinant polyhistidine tag you may detect expression of your recombinant fusion protein Fusion Protein using an antibody to the appropriate epitope The amount of antibody supplied is sufficient for 25 western blots Product Epitope Cat no Anti His C term Antibody Detects the C terminal R930 25 Anti His C term HRP Antibody Polyhistidine 6xHis tag R931 25 a a HHHHHH COOH requires Anti His C term AP Antibody the free carboxyl group for R932 25 detection Lindner et al 1997 Penta His mouse IgG1 Detects both N and P21315 monoclonal Antibody C terminal polyhistidine 6xHis tag Purifying If you express your gene of interest as a fusion with the polyhistidine tag from the Recombinant pFastBac CT TOPO and pFastBac NT TOPO vectors supplied with the Fusion Proteins Bac to Bac C His and N His TOPO Expression Systems respectively you may use Invitrogen s ProBond or Ni NTA resins to purify your recombinant fusion protein See the table below for ordering information Item Quantity Cat no ProBond Nickel
74. unt of Cellfectin II Reagent 8 ul can vary from 1 5 to 9 ul Note This procedure is for insect cells in a 6 well format All amounts and volumes are given on a per well basis Continued on next page Transfecting Insect Cells continued Important Guidelines for Transfection Transfection Procedure Use Grace s Insect Cell Culture Medium Unsupplemented to seed all cells in plate for Sf9 and Sf21 cells grown in Grace s Insect Cell Culture Medium Supplemented with 10 FBS With Cellfectin II you do not have to remove the medium from cells and wash cells prior to adding the DNA lipid complex to cells The DNA lipid complex formation time is shorter 15 30 minutes when using Cellfectin II as compared to Cellfectin reagent Do not add antibiotics during transfection as this causes cell death For Sf9 or Sf21 insect cells cultured in Supplemented Grace s Insect Medium containing 10 FBS use the following protocol to prepare your cells for transfection in a 6 well format All amounts and volumes are given on a per well basis If you wish to transfect cells in other tissue culture formats you will need to determine the optimal conditions to use 1 Verify that the Sf9 or Sf21 cells are in the log phase 1 5 2 5 x 10 cells ml with greater than 95 viability If the cell density is in range of 1 5 2 5 x 10 cells ml and the culture is without antibiotics proceed to step 2a If the cell density

pBAD/Thio His TOPO manual - Thermo Fisher Scientific

Contents

Download Pdf Manuals

Related Search

Related Contents