Home

Blixem User Manual

image

Contents

1. Select this option to turn HSP High Scoring Pair mode off Select this option to view HSPs in grey scale mode In this mode the HSPs High Scoring Pairs are drawn in a shade of grey that is determined by their score The greyramp tool can be used to adjust the thresholds and contrast of the HSP image This mode replaces the standard dot plot image Select this option to view all HSPs as red lines This mode can be used in conjunction with the standard dot plot image HSPs are drawn over the top Select this option to view HSPs as solid lines whose colour depends on their score This mode can be used in conjunction with the standard dot plot image HSPs are drawn over the top Expand the transcript display so that exons do not overlap 15 Help menu FE m SF S m Ti Help Ctrl H 7 About Figure 11 Help menu Help Show the Help dialog About Show the About dialog Settings The settings dialog can be accessed by selecting the Settings option on the Edit menu or by pressing the Ctrl S shortcut key 06980 x Dotter Settings Parameters Zoom Horizontal range 143364 144170 Vertical range fo sw o Sliding window size fan Display C Show breaklines Show horizontal sequence labels Show vertical sequence labels cme Figure 12 The Settings dialog Zoom Specify the zoom factor The factor is an inverse a zoom factor of 3 will zoom out by a fa
2. the Alignment tool option under the View menu AAA X Dotter Alignment Tool 121130 chr4 04 210623 364887 1 ACAG TGAGTGTGCGGGG CGTCCCAAGGC CD654571 1 CAGC ETE CGT TGTGGCCATAC 125 iy ae chr4 04 210623 364887 1 ACCTCCTCAGCCTTGGGACGCCCTGCCCCGCACACTCACCATTTCCCCACTTCTGAAGTATTCGGGAGTCTTAGCTACCAATCATCCAATACCCGCAGGTCACAGAGCGACGGAGGC CD654571 1 CAGCCTCAGCCTCCGTCGCTCTG GGGTATTGGATGATTGGTAGCTAAGAC s CTTCAGAAGTGGGG GGAACTCTTAAC GGGATGTGGCCATAC 125 Figure 3 Alignment tool nucleotide gt nucleotide mode AAA X Dotter Alignment Tool 127065 chr4 04_210623 364887 1 ARLRLKKKKKKKKELCPLIYLYFQ D EDNFNT FLIFLRALFYSFEEFLLGTFMFYLYINLLFS ANLSPSL VS chr4 04_210623 364887 2 RDSVSKKKKKKKKN YVP YICIFRNS HSGMWP NSLQKSGNAWTLTSRICIEM CWRTTGTWSPWVRITSIHNS FFSELYFIPLKNFSWELLCFIFT TFSFLELI VLHSRLVA chr4 04_210623 364887 3 ETPSQKKKKKKKR TMSLDIFVFSGTLN IQGCGHR ILSRRVEMPGP PAEFV RCDVGELQEPGLPG G LQYIIPNFSQSFILFL RISPGNFYVLSLHKPSLFLS FESFTLG W Q8IYB9 1 M E AAEE E EM UME e DLSPVQGIED 40 Figure 4 Alignment tool nucleotide gt protein mode Alignment tool menu Right clicking in the alignment tool brings up a context menu with the following options Copy horizontal coord Copy the current horizontal sequence coordinate to the clipboard Copy vertical coord Copy the current vertical sequence coordinate to the clipboard Close tool Close the alignment tool window it can be re opened with Ctrl A Print
3. Dotter User Manual Written by Gemma Barson lt gb 10Osanger ac uk gt Wellcome Trust Sanger Institute 18 January 2011 Revision History Revision Date Author First revision Dotter v4 1 5 18 01 11 Gemma Barson Updated for Dotter v4 1 9 10 02 11 Gemma Barson Updated for Dotter v4 1 13 25 03 11 Gemma Barson Updated for Dotter v4 1 14 04 04 11 Gemma Barson Updated for Dotter v4 7 02 12 11 Gemma Barson Contents REVISION HIESTOFY masniosonrinincanisnni ne de Ni egu o p eer ee ene aa ae GOtting Starte Dusan eaten a O Rui Dota aia 5 De quedes Versus USC oratoria o e o PO OU one tne taal TAE EO A N A E E 6 The Dotter WINdOWS sisas Y TNS Ot OE WOW smile 9 Bi e 0 Son II A A E N 10 20010 I II Cala DO ose 10 Th Al Uae LOO atasca 10 AAA y II enon oorores 11 AMARME FOO SNOU iii 12 Ei E E EEA E E E 12 A th A A reise cet a nea a deceives os A 13 A e A 14 A A aL od 15 e Pe e iO O EE 16 SOLO Sii VO cis edi 16 POT AMA AA AA 16 VETA CA TACO A Aa 17 LUOT ASS A 17 SR e PP O III 17 Show honzo tal scguc ce LADOS tot AE ai 17 SHOW venical Sequence JAD ati I7 Keyboard SHO FECUE Siurana 10 Introduction This manual explains how to configure run and use Dotter Dotter is a graphical dot plot program for detailed comparison of two sequences Every residue in one sequence is compared to every residue in the other sequence The first sequence runs a
4. Print the alignment tool window Set alignment Left Control how long a portion of the sequences should be shown in the alignment tool Copy horizontal coord Copy vertical coord Close tool Print Set alignment length Figure 5 Alignment tool menu 11 Alignment tool shortcuts The keyboard shortcuts for moving the cross hair also apply in the alignment too window Greyramp tool This tool controls the threshold and contrast of the the dot plot image To improve visualization little peaks noise can be nullified by a minimum cut off Similarly significant peaks above a certain score can be saturated by a maximum cut off Drag the square handle and the arrows to change the threshold and contrast The Swap button swaps the positions of the top and bottom arrows inverting the colours The Undo button undoes the effect of the last drag If closed or hidden the greyramp tool can be shown with the Ctrl G shortcut or by selecting the Greyramp tool option under the View menu 4 l al PR FU FEK FSA PA Pp X Dotter Greyramp Tool F Clase Swap Undo Ewie 100 Figure 6 Greyramp tool 12 Main menu The main menu can be accessed via the menu bar at the top of the dot plot window or by right clicking in the dot plot window Note that menus with a dotted line at the top can be torn off by clicking on the dotted line A torn off menu will stay visible on top
5. age information Sequence versus itself Dotter can be run on a sequence versus itself This can be useful to analyse internal repeats You can also look for overlaps between many sequences by making a dot plot of all of the sequences versus themselves To run Dotter on many sequences at once concatenate the FASTA files for all of the sequences and then run Dotter on the concatenated sequence file against itself If you re comparing a sequence against itself you ll notice that the main diagonal scores maximally since it s the 100 perfect self match Partitioning break lines will appear between the sequences if there were multiple sequences in the input file O xi Dotter nfs users nfs_g gb10 Work BlixemFiles exblx Current TwoSeqs vs nfs users nfs_g gb10 File Edit View Help infs users nfs_g gb10 Work Blixem Files exblx Current TwoSeqs 61500 62000 62500 9 2009571 DA224896 ua a i ue E Y iL E Q 2 o o ua a i E i a S r E q el Pal E uA pa i uA Pal 9 2009571 2146429 DA224896 1 Figure 1 Multiple sequences vs themselves Input files The sequence input files are in FASTA format Comparisons are allowed between two nucleotide sequences two protein sequences or one nucleotide and one protein sequence note that when comparing a nucleotide and a protein sequence the nucleotide sequence must be passed first i e as the horizontal sequence Additiona
6. ctor of 3 i e the window will shrink to 1 3 of its full size A zoom factor of 1 will show the window at full size A factor of less than 1 e g 0 5 can be set in order to zoom in but this will result in a stretched dot plot so is not recommended Horizontal range Set the range of the horizontal sequence The maximum range possible is the range that was originally passed to Dotter the range you enter will be trimmed if you enter out of range values 16 Note that this causes the matrix to be recalculated so if it took a long time to calculate in the first place stay away from this menu item Vertical range Set the range of the vertical sequence The maximum range possible is the range that was originally passed to Dotter the range you enter will be trimmed if you enter out of range values Note that this causes the matrix to be recalculated so if it took a long time to calculate in the first place stay away from this menu item Sliding window size To make the score matrix more intelligible the pairwise scores are averaged over a sliding window that runs diagonally This option allows you to edit the size of the sliding window There s normally no need to change this Note that this causes the matrix to be recalculated so if it took a long time to calculate in the first place stay away from this menu item Show break lines Tick this option to display break lines between different sequences when Dottering multiple s
7. equences i e where there are multiple sequences in the same FASTA input file This option will be greyed out if there is only one sequence per input file Show horizontal sequence labels When break lines are enabled tick this option show show labels for each break line for the horizontal sequence Show vertical sequence labels When break lines are enabled tick this option show show labels for each break line for the vertical sequence 17 Keyboard shortcuts Left arrow Right arrow Shift Left Shift Right Up arrow Down arrow Shift Up Shift Down lt gt Ctrl W Ctrl Q Ctrl S Ctrl P Ctrl H Ctrl A Ctrl G Ctrl D Move the cross hair one dot left right along the horizontal sequence The same as Left Right but for protein sequences this moves by a single nucleotide coordinate rather than a whole dot amino acid Move the cross hair one dot up down along the vertical sequence The same as Up Down but for protein sequences this moves by a single nucleotide coordinate rather than a whole dot amino acid Move diagonally up left or down right Useful for moving along an alignment Move diagonally up left or down right but for protein sequences move by a single nucleotide coordinate rather than a whole amino acid Move diagonally down left or up right Useful for moving along an alignment Move diagonally down left or up right but for protein sequences move by a single nucleotide coordinate rathe
8. l features can be passed to Dotter in a GFF file using the argument Relevant features include alignments which can be viewed using Dotter s HSP mode and transcripts which are shown at the bottom of the Dotter window FASTA file A FASTA file has a header line that starts with gt and contains the sequence name The next line contains the start of the sequence data The sequence data can be on a single line or separated by newlines it is usually separated by newlines every 50 characters to aid readability gt chr4 04 tettgtttetgtaggagaggecatetecatecagetataactadaadada acaaaaaactectetttttgacaagtttgtaaagectgtecatetagagte tataataatcctccaggccecctatgccactcctcectttattcagccagttca GFF file Dotter uses the GFF version 3 file format In this section we give a very brief description of this file format see http www sequenceontology org gff3 shtml for a full description The GFF file should start with the following two comment lines Additional comments can be included but may be ignored gff version 3 Sequence region chr4 04 44144 154265 Each subsequent line defines a feature A feature line must have the following 8 tab separated columns reference_sequence_name source type start end score strand phase An optional 9 column defines any tags separated by semi colons Dotter supports the following GFF tags Additional tags can be supplied but may be ignored Target required for alignments Gap required for gap
9. long the x axis and the second sequence along the y axis In regions where the two sequences are similar to each other a row of high scores will run diagonally across the dot matrix Pairwise scores are averaged over a sliding window to make the score matrix more intelligible The averaged score matrix forms a three dimensional landscape with the two sequences in two dimensions and the height of the peaks in the third This landscape is projected onto two dimensions using a grey scale image the darker grey of a peak the higher the score is The contrast and threshold of the grey scale image can be adjusted and a tool is provided to examine the sequence alignment that the grey scale image represents Dotter is maintained by the Wellcome Trust Sanger Institute and is available as part of the SeqTools package The software can be downloaded from the Sanger Institute s website http www sanger ac uk Getting Started Running Dotter As a minimum Dotter takes the following required arguments dotter lt horizontal_sequence gt lt vertical_sequence gt where lt horizontal_sequence gt and lt vertical_sequence gt are the path names of FASTA files containing the two input sequences Dotter will assume that the sequences both start at coordinate 1 unless you use the q and s arguments to set an offset for the query horizontal and subject vertical sequences respectively Run dotter without any arguments to see further us
10. ng along an alignment lt Move diagonally up left or down right but for protein sequences gt move by a single nucleotide coordinate rather than a whole amino acid Move diagonally down left or up right Useful for moving along an alignment Move diagonally down left or up right but for protein sequences move by a single nucleotide coordinate rather than a whole amino acid Zoom in with a child Dotter You can open a new child Dotter on a particular region from the current Dotter window Middle click and drag the mouse to select the region to open the new Dotter on The alignment tool The alignment tool shows the portions of the two sequences at the current cross hair position The sequences will move to remain centred on the cross hair coordinates when the cross hair is moved The same shortcut keys for moving the cross hair can be used in this window Aligning matches are highlighted and colour coded according to whether they are an exact or conserved match cyan for exact violet for conserved In nucleotide gt nucleotide mode both strands of the horizontal sequence are shown in the alignment tool In nucleotide gt protein mode all three reading frames of the horizontal sequence are shown and the best match out of the three frames 10 determines the highlight colour for the bases in the vertical sequence If closed or hidden the alignment tool can be shown with the Ctrl A shortcut or by selecting
11. of the Dotter window and can be repositioned by dragging its header bar Click the dotted line again to get rid of it file Edit AGUA Help 61200 Greyramp tool Alignment tool lt Crosshair 100 Y Crosshair label lt Crosshair fullscreen J 200 Pixelmap E Gridlines 100 X View _ AAA 300 e HSPs off Greyramp tool a Draw HSPs greyramp Alignment tool Draw HSPs red lines 400 Draw HSPs color f score id A Y Crosshair label 500 x Crosshair fullscreen Pixelmap Gridlines HSPs off Draw HSPs greyramp Draw HSFs red lines Draw HSPs color fiscore Figure 7 Tear off menus File menu ln Save plot Ctrl S Export plot 2 Print Ctrl P Lise print colors a Close this dotter Ctrlt w el Quit all dotters ctrI Q Figure 8 File menu 13 Save plot Export plot Print Use print colours Close Quit Edit menu Save the current dot plot It can be re loaded by calling Dotter from the command line using the l argument Note that you will need to call Dotter with the same portion of each sequence that was originally passed to Dotter in order for the alignment tool to function correctly when you load the dot plot Export the plot to PDF format Note that other formats are also available from the Print menu by selecting Print to File from the print dialog Print the current dot plot Change to a colour scheme that is more suitable for printing Close the current Dotter wind
12. ow Also closes the associated alignment and greyramp tool but does not close any other Dotter windows Close the current Dotter window and all associated Dotters as well including any child or parent Dotters If you just wish to close the current Dotter then use the Close menu option instead Copy horizontal coord Copy vertical coord Settings Ctrl s Figure 9 Edit menu Copy horizontal coord Copy the current horizontal sequence coordinate to the clipboard Copy vertical coord Copy the current vertical sequence coordinate to the clipboard Settings Show the Settings dialog 14 View menu Greyramp tool Alignment tool Crosshair Crosshair label Crosshair fullscreen Pixelmap Gridlines HSPs off Draw HSPs greyramp Draw HSPs red lines Draw HSPs color f score Bump exons Greyramp too Ctrl G Alignment tool Ctri A Y Crosshair Y Crosshair label Crosshair fullscreen Y Pixelmap Gridlines e HSPs off Draw HSPs greyramp Draw HSPs red lines Draw HSPs color f score Bump exons Figure 10 View menu Show the greyramp tool Show the alignment tool Toggle visibility of the cross hair Toggle visibility of the cross hair label only has an effect if the cross hair is visible Toggle whether the cross hair is shown to its full extents or is clipped to just the dot plot area Toggle visibility of the grey scale dot plot image Toggle visibility of gridlines
13. ped alignments ID required for parent features Name required for transcripts and SNPs Parent required for child features Transcripts Note that exons should have a Parent transcript defined and the Name tag should be set in the parent rather than the child exons Note that Dotter will recognise exons that do not have a Parent tag if they have a Name tag instead but they may not get grouped correctly with other exons from the same transcript Typically one defines the parent transcript the exons and the CDS regions Dotter will then calculate the missing components in this case the UTR regions and the introns Dotter will recognise other combinations of inputs and will always calculate the missing components as long as enough information is provided Sample GFF file A sample GFF file may look like this denotes that text has been omitted gff version 3 Sequence region chr4 04 44144 154265 chr4 04 EST Human nucleotide_match 79195 79311 95 000000 Target DA692754 1 287 403 percentID 90 6 sequence GATCTGGC chr4 04 EST Human nucleotide_match 19195 79323 121 000000 Target AI095103 1 326 454 percentID 96 9 sequence TTTAAATT chr4 04 ensembl_variation deletion 80798 80799 Name rs60725655 url http 3A 2F 2Fwww ensembl org 2FHomo_sapiens 2FVariation 2FSummary 3Fv 3Drs60725655 variant_sequence AA chr4 04 Augustus mRNA 119534 119941 ID transcript21 Name AUGUSTUS00000051712 chr4 04 Aug
14. r than a whole amino acid Close the current window If this is a dot plot window it also closes the associated alignment and greyramp tool Quit Dotter Also quits any associated Dotters i e any child or parent Dotters Open the Settings dialog Print the Dotter window Open the Help dialog Show the alignment tool Show the greyramp tool Show the main dot plot window Bump exons 18
15. ustus exon 119534 119941 Parent transcript21 chr4 04 Augustus CDS 119534 119941 0 Parent transcript21 The Dotter Windows The dot plot window The main Dotter window contains the dot matrix plot It also shows any exons for the sequences along the bottom of the window for the horizontal sequence or along the right hand side for the vertical sequence ANA IN Dotter chr4 04 vs DA730641 1 File Edit View Help chr4 04 247000 247200 247400 247600 247800 248000 T ro r LO an or Pa ef a Figure 2 The main window Note that the narrow red shaded border around the edge of the plot indicates the region where the dot plot cannot be calculated due to the sliding window averaging method that is used to calculate the scores Cross hair The blue cross hair shows the coordinates at a particular position It can be moved by clicking dragging with the left mouse button or by using the following keyboard shortcuts Left arrow Move one dot left right along the horizontal sequence Right arrow Shift Left The same as Left Right but for protein sequences this moves by a Shift Right single nucleotide coordinate rather than a whole dot amino acid Up arrow Move one dot up down along the vertical sequence Down arrow Shift Up The same as Up Down but for protein sequences this moves by a Shift Down single nucleotide coordinate rather than a whole dot amino acid j Move diagonally up left or down right Useful for movi

Download Pdf Manuals

image

Related Search

Related Contents

Sennheiser HD 25-1 Hifi-Stereo-Headset  S1100 User Manual.book  Viper VE 17 HD P User's Manual    Oklahoma State Fair September 12  昇 降 式 移 動 足 場 『アップスタ−36SA』取扱説明書  MySQL Enterprise Backup User`s Guide (Version 4.0.0)  MAPC-10 取扱説明書  MANUALE DI INSTALLAZIONE, USO E MANUTENZIONE  Service Audi A3 1997  

Copyright © All rights reserved.
Failed to retrieve file