Home

CloneMiner cDNA Library Construction Kit

1. Item Quantity Catalog no SuperScript II Reverse Transcriptase 2000 units 18064 022 10 000 units 18064 014 4 x 10 000 units 18064 071 BP Clonase Enzyme Mix 20 reactions 11789 013 100 reactions 11789 021 LR Clonase Enzyme Mix 20 reactions 11791 019 100 reactions 11791 043 ElectroMAX DH10B T1 Phage 5x100 ul 12033 015 Resistant Cells cDNA Size Fractionation Columns 3 columns 18092 015 E coli DNA Ligase 100 units 18052 019 E coli DNA Polymerase I 250 units 18010 017 T4 DNA Polymerase 50 units 18005 017 T4 DNA Ligase 100 units 15224 017 DEPC treated Water 4x125ml 10813 012 FastTrack 2 0 mRNA Isolation Kit 6 reactions K1593 02 Micro FastTrack 2 0 mRNA Isolation Kit 20 reactions K1520 02 S N A P MiniPrep Kit 100 reactions K1900 01 S N A P MidiPrep Kit 20 reactions K1910 01 Kanamycin Sulfate 100 ml 10 mg ml 15160 054 RNase Away Reagent 250 ml 10328 011 5X Second Strand Buffer 0 5 ml 10812 014 A large selection of Gateway destination vectors is available from Invitrogen to facilitate expression of your cDNA library in virtually any protein expression system For more information about the vectors available and their features refer to our Web site www invitrogen com or contact Technical Service page 77 xi Xii Overview Introduction Features of the CloneMiner cDNA Library Construction Kit Advantages of the CloneMiner cDNA Library Construction Kit Introduction TM The C
2. 10 12 1 Fraction Dilution Column Chromatography Fractions Dilutions of Pooled Fractions continued on next page 55 Performing the Plate Spotting Assay continued Guidelines DNA Spotting Assay Staining Plates with SYBR Gold 56 Consider the following points before performing the DNA plate spotting assay Warm plates to room temperature before using Do not reuse plates Spot DNA standards and cDNA samples within 10 minutes of each other Onto a prewarmed plate spot 1 ul of each pEXP7 tet control DNA dilution Avoid touching the agarose with the pipette tip When the 1 ul aliquot is released capillary action will pull the small volume from the pipette tip onto the plate surface Avoid formation of bubbles Once the DNA standards are spotted spot 1 ul of each cDNA sample in a similar fashion Allow spots to dry at room temperature for 5 15 minutes If you are staining your samples with SYBR Gold proceed to Staining Plates with SYBR Gold below If you are staining your samples with ethidium bromide proceed to the next step Remove the lid and visualize the plate under UV light and photograph Note that the labels and samples will be in the reverse order Using the known concentration of the DNA standards estimate the amount of cDNA in each sample Refer to page 72 for a sample plate Add 5 ul of SYBR Gold to 50 ml of TAE buffer to make a 1x stain Th
3. 1 Precipitate the entire eluate with 0 4 volumes of the 30 PEG Mg solution Mix well by pipetting 2 Centrifuge at room temperature for 15 minutes at 13 000 rpm Carefully remove the supernatant 3 Dry the pellet at room temperature for 10 minutes Resuspend the pellet in 50 ul of TE buffer If you started with less than 5 x 10 clones resuspend the pellet in less TE buffer 4 Determine the DNA yield see Determining DNA Yield below 5 Dilute the DNA to 25 ng ul You will need 50 ng of DNA for one LR recombination reaction You should have enough DNA to perform several LR recombination reactions if desired see page 60s 1 Dilute 5 10 ul of the plasmid DNA sample and read the O D using a spectrophotometer at 260 nm 2 Determine the concentration using the equation below DNA A260 0 05 mg ml dilution factor 3 Determine the total yield by multiplying the concentration by the volume of DNA 4 Dilute the DNA to 25 ng ul If you have a positive control plasmid for the LR recombination reaction we recommend including it in your experiment to help you evaluate your results 1 Add the following components to a sterile 1 5 ml microcentrifuge tube at room temperature and mix Component Sample Negative Positive Control Control cDNA entry library 25 ng yl 2 ul Positive control plasmid 25 ng ul ES 2 pl Destination vector 150 ng tl 3 pl 3 pl 3 pl 5X LR Cl
4. The CloneMiner cDNA Library Construction Kit is shipped on dry ice Upon receipt store the components as detailed below All components are guaranteed for six months if stored properly Item Storage Components for cDNA Library Construction BP Clonase Enzyme Mix 80 C All other components 20 C ElectroMAX DH10B T1 Phage 80 C Resistant Cells cDNA Size Fractionation Columns 4 C TM The CloneMiner cDNA Library Construction Kit provides enough reagents to construct five cDNA libraries While some reagents are supplied in excess you may need additional reagents and materials if you wish to perform more than 5 reactions You may also need additional electrocompetent E coli cells if you perform control reactions each time you construct a cDNA library See page xi for ordering information The components for cDNA library construction are listed below Store the BP Clonase enzyme mix at 80 C Store all other components at 20 C Item Composition Amount 2 3 kb RNA control 0 5 ug ul in 15 ul 10 mM HEPES 2 mM EDTA pH 7 2 DEPC treated Water Sterile DEPC treated water 1 ml Biotin attB2 Oligo dT Primer 30 pmol l in DEPC treated water 8 ul 10 mM each dNTP 10 mM dATP 20 ul 10 mM dGTP 10 mM dCTP 10 mM dTTP in 1 mM Tris HCl pH 7 5 5X First Strand Buffer 250 mM Tris HCI pH 8 3 1ml 375 mM KCI 15 mM MgCl 0 1 M Dithiothreitol DTT in DEPC treated water
5. 300 500 ng of plasmid DNA and 250 ng of supercoiled pDONR 222 were digested with BsrG I and run on a 1 agarose gel stained with ethidium bromide Results are shown below Note that pDONR 222 lane C gives a digestion pattern of 2 5 kb 1 4 kb and 790 bp when digested with BsrG I L 1 Kb DNA Plus Ladder from Invitrogen C Digested pDONR 222 L123456789 101112 C 1314 15 16 17 18 19 2021 222324 L Clone Band Size kb Insert Size kb Clone Band Size kb Insert Size kb 1 1 5 1 5 13 0 9 0 9 2 0 5 4 2 5 3 0 14 0 7 0 7 3 2 0 2 0 15 0 25 0 25 4 1 9 1 9 16 0 2 0 2 5 1 8 1 8 17 0 85 1 6 2 3 4 75 6 3 9 3 9 18 2 0 2 0 7 0 35 1 1 1 45 19 1 6 1 6 8 0 76 0 76 20 0 1 0 7 0 8 9 1 6 1 6 21 0 9 0 9 10 0 254 2 5 2 75 22 1 9 1 9 11 1015 1 2 1 35 23 1 5 1 5 12 12 419 3 1 24 0 9 1 1 2 0 Number of Clones Analyzed 24 Number of Clones Containing Inserts 24 Percent Recombinants 100 Average Insert Size kb 1 8 Insert Size Range kb 0 2 4 75 Upon further electrophoresis the 2 5 kb band was shown to be a double band consisting of the 2 5 kb vector backbone band and a 2 5 kb band resulting from BsrG I digestion of the insert 70 5000 bp 2000 bp 1650 bp 1000 bp 850bp 650 bp Sample Size Fractionation with Non Radiolabeled cDNA Size Fractionation A sample plate and work
6. 4 36 306 15 5 36 342 213 4 9 0 136 6 34 376 1136 26 1 0 77 7 35 411 2628 60 3 1 72 8 36 447 4114 94 5 2 625 9 36 483 4427 101 6 2 82 10 33 516 3614 83 0 2 52 11 36 552 2947 67 7 1 88 12 36 588 2139 49 1 1 36 13 36 624 1761 40 4 1 12 14 36 15 36 16 35 17 36 18 36 19 36 20 36 continued on next page 67 Sample cDNA Library continued Selecting and Fractions 5 6 and part of fraction 7 were pooled together for a total of 61 1 ng of Pooling Fractions cDNA see table below Fraction Pooled Volume Concentration of Amount of cDNA ul cDNA ng ul ng 36 0 136 4 9 34 0 77 26 1 17 5 1 72 30 1 Total Pooled cDNA ng 61 1 Calculating the After ethanol precipitation the pooled cDNA gave a Cerenkov count of 1538 cpm cDNA Yield cDNA yield was determined using the count value the specific activity already calculated in the first strand analysis and the equation below Asch SDN aS Cerenkov cpm x 2x 4 pmol dNTP pmol dCTP x 1 000ng ug ds cDNA SA cpm pmol dCTP x 1515pmol dNTP ug ds cDNA Cerenkov cpm x 8 SAx 1 515 _ _ 1538 x8 230x 1 515 353 ng cDNA BP Recombination The entire 4 ul cDNA sample containing a total of 35 3 ng of cDNA was used in Reaction the BP recombination reaction All other components were added according to the specifications on page 32 BP reactions were divided and transformed into six
7. Chromatography Tube 5 was the first tube to give Cerenkov counts above background Using the data for tube 5 we demonstrate below how the worksheet was filled out Tube 5 Example The volume in tube 5 was measured to be 36 ul column A Adding this volume to the previous cumulative volume i e 306 ul gave a total volume of 342 ul column B The Cerenkov count was 213 cpm column C The double strand cDNA yield was determined using the count value from column C the specific activity already calculated in the first strand analysis and the equation below Cerenkov cpm x 2x 4 pmol dNTP pmol dCTP x 1 000ng ug ds cDNA Amount of ds cDNA ng mounbordocE ine SA cpm pmol dCTP x 1515pmol dNTP ug ds cDNA Cerenkov cpm x 8 SAx 1 515 213x8 230x 1 515 4 9 ng cDNA column D continued on next page 66 Sample cDNA Library continued Size Fractionation The concentration of cDNA was determined using the calculated cDNA yield by Column and the value in column A t of cDNA Chromatography Concentration of cDNA ng ul E EE ng continued fraction volume ul column D column A 49ng 36ul 0 136 ng ul column E Sample cDNA Library Worksheet A B C D E Fraction Total Cerenkov Amount of Concentration Volume Volume Counts cDNA of cDNA Tube ul ul cpm ng ng ul 1 151 151 22 zZ 2 85 236 14 3 34 270 25 a
8. General Guidelines Sequencing Using BigDye Chemistry You may sequence entry clones generated by BP recombination using dye labeled terminator chemistries including DYEnamic energy transfer or BigDye reaction chemistries To sequence inserts in entry clones derived from BP recombination with TM pDONR 222 we recommend using the following sequencing primers Refer to the following page for the location of the primer binding sites Forward primer M13 Forward 20 5 GTAAAACGACGGCCAG 3 proximal to attL1 Reverse primer M13 Reverse 5 CAGGAAACAGCTATGAC 3 proximal to attL2 The M13 Forward 20 and M13 Reverse Primers Catalog nos N520 02 and N530 02 respectively are available separately from Invitrogen For other primers Invitrogen offers a custom primer synthesis service For more information visit our Web site www invitrogen com or contact Technical Service page 77 Note If you experience difficulty using the M13 Reverse Primer to sequence entry clones we recommend using an alternative reverse primer that hybridizes to the poly A tail of your cDNA insert Design your reverse primer such that it is 5 T 23N 3 where N is A C or G The AT rich attL sites in the entry clones may decrease the efficiency of the sequencing reactions To optimize your sequencing reactions we recommend the following e Plasmid DNA sample should be of good quality and purity OD260 OD 250 1 7 1 99
9. a P dCTP Essential reagent accidentally not added or not working Perform the 2 3 kb RNA control reaction to verify that the correct reagents have been added and are working properly Inaccurate incubation temperatures or temperature fluctuations Perform the first strand reaction at 45 C Keep reactions at 45 C when TM adding SuperScript II RT TM SuperScript II RT stored incorrectly Store SuperScript II RT at 20 C ina frost free freezer Low cDNA yield after size fractionation by column Faulty columns Check each column to verify that it is working properly See page 27 for with pUC19 transformation control working properly chromatography column specifications Samples run too quickly over Let columns drain completely before columns adding additional buffer Low cDNA library titer cDNA of poor quality Make sure the first strand reaction shows gt 15 percent incorporation of o P dCTP radiolabeling method only Insufficient ligation of attBl Adapter Perform the 2 3 kb RNA control reactions to verify the ligation step worked properly Incorrect ratio of cDNA to PDONR 222 Refer to page 31 for the recommended ratio of CDNA to pDONR 222 for the BP reaction continued on next page 61 Troubleshooting continued Problem Cause Solution Low cDNA library titer with pUC19 transformation control working properly cont
10. cDNA Library Construction Kit is covered under the licenses detailed below The purchase of this product conveys to the buyer the non transferable right to use the purchased amount of the product and components of the product in research conducted by the buyer whether the buyer is an academic or for profit entity The buyer cannot sell or otherwise transfer a this product b its components or c materials made using this product or its components to a third party or otherwise use this product or its components or materials made using this product or its components for Commercial Purposes The buyer may transfer information or materials made through the use of this product to a scientific collaborator provided that such transfer is not for any Commercial Purpose and that such collaborator agrees in writing a not to transfer such materials to any third party and b to use such transferred materials and or information solely for research and not for Commercial Purposes Commercial Purposes means any activity by a party for consideration and may include but is not limited to 1 use of the product or its components in manufacturing 2 use of the product or its components to provide a service information or data 3 use of the product or its components for therapeutic diagnostic or prophylactic purposes or 4 resale of the product or its components whether or not such product or its components are resold for use in research For pro
11. synthesizes the second strand of cDNA using the first cDNA strand as a template attB1 Adapter is ligated to the 5 end of the cDNA Biotin prevents ligation of the attB1 Adapter to the 3 end of the cDNA cDNA is size fractionated to eliminate residual adapters The Gateway Technology Gateway is a universal cloning technology based on the site specific recombination properties of bacteriophage lambda Landy 1989 The Gateway Technology provides a rapid and highly efficient way to move DNA sequences into multiple vector systems for functional analysis and protein expression For more information on the Gateway Technology see the next page cDNA Library Yeast Gene entry library Your vector Gene Two hybrid Baculovirus Gene Gene Mammalian Gene The Gateway Technology The Basis of Gateway Recombination Components Characteristics of Recombination Reactions The Gateway Technology is based on the bacteriophage lambda site specific recombination system which facilitates the integration of lambda into the F coli chromosome and the switch between the lytic and lysogenic pathways Ptashne 1992 In the Gateway Technology the components of the lambda recombination system are modified to improve the specificity and efficiency of the system Bushman et al 1985 This section provides a brief overview of the Gateway Technology For detail
12. 100 ng of cDNA as measured by comparison to the DNA standard continued on next page 49 Size Fractionating Non Radiolabeled cDNA by Column Chromatography continued Selecting cDNA Fractions Pooling cDNA Fractions Ethanol Precipitation Preparing Aliquots for the Plate Spotting Assay 50 The first fractions containing detectable cDNA by the plate spotting assay contain the purest and largest pieces of cDNA in the population You will want to use cDNA from these fractions for the BP recombination reaction We recommend that you also include the fraction preceding the first fraction with detectable cDNA This fraction may contain large pieces of cDNA in quantities that are not visible using the plate spotting assay You will need to pool fractions together to obtain approximately 150 ng of cDNA Start with the fraction preceding the first fraction containing detectable cDNA Add cDNA from subsequent fractions until the desired amount of cDNA is reached Note The first 150 ng of cDNA from a column will make a library with a larger average insert size compared to a library made from the first 300 ng of cDNA Use the values in column C to calculate the smallest volume needed from the next fraction to obtain the desired amount of cDNA for cloning 1 Tothe tube of pooled cDNA add reagents in the following order Glycogen 20 ug ul 1g 7 5M NH OAc 0 5 volume i e 0 5 x volume of cDNA 100 ethanol 2 5 volumes
13. 250 ul continued on next page vii Kit Contents and Storage continued Components for cDNA Library Construction continued viii Item Composition Amount TM SuperScript II Reverse Transcriptase 200 U ul in 20 mM Tris HCl pH 7 5 1 mM EDTA 100 mM NaCl 0 01 NP 40 v v 1 mM DTT 50 Glycerol v v 50 ul 5X Second Strand Buffer 100 mM Tris HCl pH 6 9 450 mM KCI 23 mM MgCl 0 75 mM B NAD 50 mM NHsgz SO 500 ul E coli DNA Ligase 10 U ul in 10 mM Tris HCl pH 7 4 50 mM KCl 0 1 mM EDTA 1 mM DTT 0 2 mg ml BSA 50 Glycerol v v 0 1 Triton X 100 w v 10 ul TM UltraPure Glycogen 20 ug ul in RNase free water 45 ul E coli DNA Polymerase I 10 U ul in 50 mM Potassium Phosphate pH 7 0 100 mM KCI 1mMDTT 50 Glycerol v v 50 ul E coli RNase H 2 U pl in 20 mM Tris HCI pH 7 5 100 mM KCI 10 mM MgCl 0 1 mM EDTA 0 1 mM DTT 50 ug ml BSA 50 Glycerol v v 20 ul continued on next page Kit Contents and Storage continued Components for cDNA Library Construction continued Biotin attB2 Oligo dT Primer Sequence Item Composition Amount T4 DNA Polymerase 5 U pl in 100 mM Potassium Phosphate pH 6 5 10 mM mercaptoethanol 50 Glycerol v v 15 ul attBl Adapter 1 ug ulin 10 mM Tris HCl pH 7 5 1 mM EDTA 0 1 M NaCI 70 ul 5
14. 4045 4718 c complementary strand continued on next page 73 Map and Features of pDONR 222 continued Features of the Vector 74 pDONR 222 4718 bp contains the following elements All features have been functionally tested Feature Benefit rrnB T1 and T2 transcription terminators Protects the cloned gene from expression by vector encoded promoters thereby reducing possible toxicity Orosz et al 1991 M13 forward 20 priming site Allows sequencing in the sense orientation attP1 and attP2 sites Bacteriophage A derived DNA recombination sequences that permit recombinational cloning of attB containing cDNA Landy 1989 BsrG I restriction sites Allows detection and size determination of cDNA inserts by restriction enzyme analysis ccdB gene Allows negative selection of the plasmid Chloramphenicol resistance gene Allows counterselection of the plasmid M13 reverse priming site Allows sequencing in the anti sense orientation Kanamycin resistance gene Allows selection of the plasmid in E coli pUC origin Allows high copy replication and maintenance of the plasmid in E coli Experimental Worksheet for the Radiolabeling Method Introduction A worksheet is provided to help you with your record keeping and calculations Before you record any data we suggest you make several copies of this worksheet for use with addi
15. Checking the mRNA Quality To check total RNA integrity analyze 1 ug of your RNA by agarose ethidium bromide gel electrophoresis You should see the following on a denaturing agarose gel e 285 rRNA band 4 5 kb and 18S rRNA band 1 9 kb for mammalian species e 285 band should be twice the intensity of the 185 band mRNA will appear as a smear from 0 5 to 12 kb rRNA bands may still be faintly visible If you do not detect a smear or if the smear is running significantly smaller than 12 kb you will need to repeat the RNA isolation Be sure to follow the recommendations listed on the previous page to prevent RNase contamination 11 Advance Preparation Introduction Note Materials Required for the Radiolabeling Method Materials Required for the Non Radiolabeling Method Number of Reactions 12 Some of the reagents and materials required to use the CloneMiner cDNA Library Construction Kit are not supplied with the kit and may not be common lab stock Refer to the lists below to help you prepare or acquire these materials in advance Refer to the section entitled Before Starting at the beginning of each procedure for a complete list of required reagents You should have the following materials on hand before performing the radiolabeling method e a P dCTP 10 wCi ul Amersham Biosciences Catalog no PB 10205 e Glass fiber filters GF C 21 mm circles Whatman Catalog no 1822 021 e Solvent
16. For a map and a description of the features of pDONR 222 see pages 73 74 TM Propagating If you wish to propagate and maintain pDONR 222 we recommend using 10 ng pDONR 222 of the vector to transform One Shot ccdB Survival 2 T1 Chemically Competent Cells Catalog no A10460 from Invitrogen The ccdB Survival 2 T1 E coli strain is resistant to CcdB effects and can support the propagation of plasmids containing the ccdB gene To maintain the integrity of the vector select for transformants in media containing 50 ug ml kanamycin and 30 ug ml chloramphenicol Note DO NOT use general E coli cloning strains including TOP10 or DH5a for propagation and maintenance as these strains are sensitive to CcdB effects DO NOT use the ElectroMAX DH10B competent cells provided with this kit Positive Control pEXP7 tet control DNA is included with this kit for use as a positive control for the BP reaction pEXP7 tet contains an approximately 1 4 kb fragment consisting of the tetracycline resistance gene and its promoter Tc flanked by attB sites Using the pEXP7 tet fragment in a BP reaction with a donor vector results in entry clones that express the tetracycline resistance gene Before Starting You should have the following materials on hand before beginning Keep all reagents on ice until needed Supplied with kit e pDONR 222 150 ng ul e pEXP7 tet positive control 50 ng ul e 5X BP Clonase Reaction Buffer e BP
17. Reaction with sse 52 Non Radiolabeled cDNA taie ederet te ete e eda a tpe gto ias 52 Performing the Plate Spotting ASSay eee eere iier tert eee Tore HERREN Rn 54 Performing the LR Library Transfer Reaction nennen 57 Troubleshooting ocn apa m pee e prebende p ova 61 Recipes 64 Sample cDNA Library s uie eene eerte e spiel andhaves dy eie e esie eo neges eedem 65 Sample Size Fractionation with Non Radiolabeled cDNA eee 71 Map and Features of PDONR 222 eese eene a EEEE o EE trennen nete trennen nene 73 Experimental Worksheet for the Radiolabeling Method sse 75 Experimental Worksheet for the Non Radiolabeling Method sss 76 Technical S tyvice seo uere eee eee date lude e ee etel diede eee HN 77 P rchaser Notification aate oin neu teeth E b ti e e SHIRE teo eR RH ebore kn 79 R f rences ashesetaeciieieeeiibee iei dne am og ober qim Saabs e rete o an e dedii 81 Acknowledgements Invitrogen extends its sincere appreciation to Dr Osamu Ohara of the Kazusa DNA Research Institute Department of Human Gene Research Kisarazu Chiba Japan for Dr Ohara s collaborative contribution TM to development of the CloneMiner cDNA Library Construction Kit vi Kit Contents and Storage Shipping Storage Number of Reactions Components for cDNA Library Construction TM
18. Recombination Reaction 32 You should have the following materials on hand before beginning Keep all reagents on ice until needed Supplied with kit e pDONR 22 150 ng ul e pEXP7 tet control DNA 50 ng ul e 5X BP Clonase Reaction Buffer e BP Clonase enzyme mix keep at 80 C until immediately before use Supplied by user e attB flanked cDNA 30 40 ng e TE buffer pH 8 0 10 mM Tris HCl pH 8 0 1 mM EDTA e 25 C incubator The following protocol uses 30 40 ng of cDNA and 250 ng of pDONR 222 ina 10 ul BP reaction Use 30 ng of your 2 3 kb RNA control cDNA for the BP reaction If the attB flanked cDNA sample is greater than 4 yl see the next page for necessary modifications 1 Add the following components to a sterile 1 5 ml microcentrifuge tube at room temperature and mix 2 3 kb BP BP cDNA RNA Negative Positive Component Sample Control Control Control attB flanked cDNA 30 40 ng X ul X ul pDONR 222 150 ng ul 1 67 ul 1 67 ul 1 67 ul 1 67 ul pEXP7 tet positive control 50 ng ul 0 5 ul 5X BP Clonase Reaction Buffer 2 ul 2 ul 2 ul 2 ul TE buffer pH 8 0 to7ul to7ul to7 pl to7 ul 2 Remove the BP Clonase enzyme mix from 80 C and thaw on ice 2 minutes Vortex the BP Clonase enzyme mix briefly twice 2 seconds each time Add 3 pl of BP Clonase enzyme mix to each sample Mix the contents gently by pipetting and centr
19. aliquots of ElectroMAX DH10B T1 Phage Resistant Cells continued on next page 68 Sample cDNA Library continued Determining the The results of the plating assay are listed below cDNA Library Titer Dilution Amount Plated Colonies Per ul Plate 10 100 ul 654 10 100 ul 54 10 100 ul 7 The titer for each plate was determined using the results of the plating assay and the equation below For the 10 dilution colonies on plate x dilution factor cfu ml volume plated ml 654colonies x 100 0 10ml 6 54 x 10 cfu ml The titer for each plate was used to calculate the average titer of the cDNA library The total colony forming units was determined by multiplying the average titer by the total volume of the cDNA library In this experiment 6 electroporations were performed to result in a total volume of 12 ml The calculated titers and total number of colony forming units are shown below Dilution Amount Colonies Per Titer cfu ml Average Titer Total Volume Total CFUs Plated ul Plate cfu ml ml cfu 10 100 ul 654 6 54 x 10 10 100 ul 54 5 4 x 10 6 31 x 10 12 7 6 x 10 10 100 ul 7 7x 10 continued on next page 69 Sample cDNA Library continued Qualifying the cDNA Library 5000bp 2000bp 1650bp 1000bp 850 bp 650 bp Plasmid DNA was isolated from 24 colonies using the S N A P MiniPrep Kit from Invitrogen
20. e During plasmid preparation elute plasmid using deionized water instead of TE buffer To sequence entry clones using the BigDye chemistry we recommend the following e Dilute plasmid DNA with deionized water to a final concentration of 100 ng ul e Use at least 700 ng of DNA e Use 3 2 pmoles of primers e Follow PCR conditions as specified in the BigDye sequencing kit continued on next page 45 Sequencing Entry Clones continued Recombination Region 46 321 381 440 2696 2755 2815 flanked cDNA is shown below Features of the Recombination Region TM The recombination region of the entry library resulting from pDONR 222 x attB e Restriction sites are labeled to indicate the actual cleavage site e Shaded regions correspond to those DNA sequences transferred from the attB flanked cDNA into the pDONR 222 vector by recombination Non TM shaded regions are derived from the pDONR 222 vector e Bases 441 and 2686 of the pDONR 222 sequence are marked M13 Forward 20 priming site GACGTTGTAA AACGACGGCC AGTCTTAAGC TCGGGCCCCA AGCCCGGGGT AATAATGATT TTATTTTGAC TTATTACTAA AATAAAACTG TGATAGTGAC CTGTTCGTTG CAACAAATTG ATGAGCAATG ACTATCACTG GACAAGCAAC GTTGTTTAAC TACTCGTTAC CTTTTTTATA ATG CCA ACT GAAAAAATAT TAC GGT TCA attL1 4 1 BsrGI Q GONUBESUESONGEIONA A TTE e m Gao AAC ATG TTT SG Oe Lolo NIG CCN j l 2686 BsrG ACT TTC TTG TAC AAA TGA ARCHARCH
21. each new 100 ul aliquot of TEN buffer 5 Beginning with the next 100 ul aliquot of TEN buffer collect single drop fractions into individual tubes starting with tube 3 Continue to add 100 ul aliquots of TEN buffer until all 18 tubes tubes 3 20 contain a single drop continued on next page 27 Size Fractionating Radiolabeled cDNA by Column Chromatography continued Filling Out the Worksheet Columns A B and C Filling Out the Worksheet Columns D and E Calculating the Double Strand A worksheet is provided to help you with your data recording see page 75 Refer to page 67 for a sample worksheet to help you with your calculations 1 Using a pipet measure the volume in each tube Use a fresh tip for each fraction to avoid cross contamination Record this value in column A of the worksheet 2 Calculate the cumulative elution volume with the addition of each fraction and record this value in column B 3 Identify the first fraction that exceeds a total volume of 600 ul in column B Do not use this fraction or any subsequent fractions for your cDNA library Important These fractions corresponding to fractions 14 through 20 in the sample worksheet page 67 contain increasing amounts of the attBl Adapter which will interfere with cloning reactions and will contaminate the library We recommend discarding these tubes to avoid accidentally using them in the remainder of the protocol 4 Place each remaining ca
22. half of your sample during the ethanol precipitation procedure we recommend that you pool a minimum of 60 ng of cDNA from your fractions See below for guidelines on selecting and pooling cDNA fractions The first fraction with detectable cDNA above background level contains the purest and largest cDNAs in the population Because this fraction often does not contain enough cDNA for cloning you may need to pool several fractions to reach a minimum of 60 ng of cDNA 1 Using the worksheet determine the cDNA yield in the first fraction containing detectable cDNA above background level 2 Ifthe cDNA yield in this fraction is less than 60 ng add cDNA from subsequent fractions until 60 ng of cDNA is reached Note The first 60 ng of cDNA from a column will make a library with a larger average insert size compared to a library made from the first 100 ng of cDNA Use the values in column E to calculate the smallest volume needed from the next fraction to obtain the desired amount of cDNA for cloning 1 Tothe tube of pooled cDNA add reagents in the following order Glycogen 20 ug ul 1g 75 M NH IOAc 0 5 volume i e 0 5 x volume of cDNA 100 ethanol 2 5 volumes i e 2 5 x volume of cDNA NH4OAc Note You may stop at this point and store the tube at 20 C overnight if necessary 2 Place the tube in dry ice or at 80 C for 10 minutes Centrifuge the sample at 4 C for 25 minutes at 14 000 rpm 3 Carefully remove the supernata
23. in this section to ligate the attB1 Adapter to the 5 end of your double stranded cDNA You should have the following materials on hand before beginning Keep all reagents on ice until needed Supplied with kit e 5X Adapter Buffer e attB1 Adapter 1 ug ul e 0 1MDTT e T4DNA Ligase 1 U ul Supplied by user e Ice bucket e Thermocycler recommended or water bath at 16 C 1 Keep the tube containing 18 ul of your double stranded blunt ended cDNA from step 6 page 19 on ice and add the following reagents 5X Adapter Buffer 10 ul attBl Adapter 1 ug ul 10 pl 0 1 M DTT 7 ul T4 DNA Ligase 1 U ul 5 wl Total volume 50 ul 2 Mix the contents gently by pipetting Incubate at 16 C for 16 24 hours continued on next page 23 Ligating the attB1 Adapter continued The Next Step After you have ligated the attB1 Adapter to the 5 end of your double stranded cDNA you will need to size fractionate the cDNA The protocol you will be performing depends on if your cDNA is radiolabeled and which fractionation protocol you will be performing For more information on choosing a size fractionation protocol see page 6 A flow chart is provided below to direct you to the next section Radiolabeled cDNA Size Fractionation by Column Chromatography Size Fractionation by Gel Electrophoresis Refer to the Web Appendix Proceed to page 26 Non Radiolabeled cDNA Size Fractionation by Column Chromatograph
24. recombination reaction see pages 73 74 for a map and list of features Using CloneMiner cDNA Library Construction Kit offers the following advantages e Produces high yields of quality double stranded cDNA Eliminates use of restriction enzyme digestion and ligation allowing cloning of undigested cDNA e Highly efficient recombinational cloning of cDNA into a donor vector results in a higher number of primary clones compared to standard cDNA library construction methods Ohara and Temple 2001 e Reduces number of chimeric clones and reduces size bias compared to standard cDNA library construction methods Ohara and Temple 2001 e Enables highly efficient transfer of your cDNA library into multiple destination vectors for protein expression and functional analysis continued on next page Overview continued Experimental Summary CloneMiner cDNA Library Construction Kit mRNA A T 20 attB2 Biotin An First Strand Synthesis N og attB2 Biotin attB2 Biotin E 1 Wh attB1 attB2 Biotin Gateway BP recombination reaction Second Strand Synthesis attB1 Adapter Ligation cDNA Size Fractionation The following diagram summarizes the cDNA synthesis process of the Biotin atfB2 Oligo dT Primer hybridizes to the mRNA poly A tail SuperScript II Reverse Transcriptase synthesizes the first strand of CDNA using the mRNA as a template E coli DNA Polymerase
25. resistant marker Fisher Scientific Catalog no 14 905 30 e 10 trichloroacetic acid 1 sodium pyrophosphate see page 63 for a recipe e 5 trichloroacetic acid see page 63 for a recipe You should have the following on hand before performing the non radiolabeling method e SYBR Gold Nucleic Acid Gel Stain recommended Molecular Probes Catalog no S 11494 Other stains are suitable See page 54 for more information This kit provides enough reagents to construct five cDNA libraries While some reagents are supplied in excess you may need additional reagents and materials if you wish to perform more than 5 reactions You may also need additional electrocompetent F coli cells if you will be performing control reactions 2 3 kb RNA control pEXP7 tet control BP negative control and pUC 19 transformation control each time you construct a cDNA library Day 1 Synthesizing cDNA with Flanking attB Sites i Analyze First Strand Synthesize First Strand Radiolabeling Method Day 1 Synthesize Second Strand Ligate attB1 Adapter Synthesizing the First Strand Introduction Important Starting mRNA 2 3 kb RNA Control Guidelines Hot Start Reverse Transcription 14 This section provides detailed guidelines for synthesizing the first strand of cDNA from your isolated mRNA The reaction conditions for first strand synthesis catalyzed by SuperScript II RT have been optimized for yield and size
26. sample The total volume in the tube should now correspond to the following table ug of starting mRNA lt 1 2 3 4 5 Control Total Volume 19ul 18ul 17 pl l6ul 15 ul 18 ul Incubate the tube at 45 C for 2 minutes With the tube remaining in the thermocycler or water bath carefully add SuperScript II RT according to the following table Note that this step may be difficult ug of starting mRNA lt 1 2 3 4 5 Control SuperScript II RT 200 U pl 1d 2ul Sul 4u Spl 2ul The total volume should now be 20 ul regardless of the amount of starting mRNA With the tube remaining in the thermocycler or water bath mix the contents gently by pipetting Be careful to not introduce bubbles Incubate at 45 C for 60 minutes If you are constructing a radiolabeled cDNA library proceed to First Strand Reaction Sample below If you are constructing a non radiolabeled cDNA library proceed to Synthesizing the Second Strand page 18 Follow the steps below to generate a sample for first strand analysis We recommend analyzing the sample during an incubation step in the second strand reaction 1 After the first strand reaction has incubated at 45 C for 60 minutes step 6 above mix the contents gently by tapping and centrifuge for 2 seconds to collect the sample Add 1 ul of the first strand reaction to a separate tube containing 24 ul of 2
27. take approximately 1 hour 1 Withthe column attached to a support stand remove the top cap first followed by the bottom cap Allow the ethanol to drain completely by gravity 2 Oncethe column stops dripping pipette 0 8 ml of TEN buffer into the column and let it drain completely Refer to the important note below for column specifications 3 Repeatthe wash step three more times for a total of four washes and 3 2 ml of TEN buffer Let the column drain until dry Proceed to Collecting Fractions below If the flow rate is noticeably slower than 30 40 seconds per drop do not use the column If the drop size from the column is not approximately 25 to 35 ul do not use the column The integrity and resolution of the cDNA may be compromised if the column does not meet these specifications When collecting fractions we recommend wearing gloves that have been rinsed with ethanol to reduce static 1 Label 20 sterile 1 5 ml tubes from 1 to 20 Place them in a rack 1 to 2 cm from the bottom of the column with tube 1 under the outlet of the column 2 Add 100 ul of TEN buffer to the 50 ul heat inactivated cDNA adapter ligation reaction from step 1 previous page Mix gently by pipetting and centrifuge for 2 seconds to collect the sample 3 Add the entire sample to the column and let it drain into the resin bed Collect the effluent into tube 1 4 Move tube 2 under the column outlet and add 100 ul of TEN buffer to the column Coll
28. the Plating Assay ts Determine cDNA Library Titer Days 4 5 Qualify cDNA Library Day 3 If you are performing the radiolabeling method we recommend that you follow the timeline outlined above Radiochemical effects induced by P decay in the cDNA can reduce transformation efficiencies over time If you cannot follow the recommended timeline you may stop the procedure during any ethanol precipitation step These steps occur during second strand synthesis and size fractionation and are noted as optional stopping points When stopping at these points always store the cDNA as the uncentrifuged ethanol precipitate at 20 C to maximize cDNA stability Experimental Overview Introduction The experimental steps necessary to synthesize attB flanked cDNA and to generate an entry library are outlined below Once you have isolated your mRNA you will need a minimum of 3 days to construct a cDNA library For more details on each step refer to the indicated pages for your specific method Non Radiolabeling Radiolabeling Method Method Day Step Action Page Page 1 1 Synthesize the first strand of cDNA from your 14 14 isolated mRNA using the Biotin attB2 Oligo dT Primer and SuperScript II RT 2 Synthesize the second strand of cDNA using thefirst 18 18 strand cDNA as a template 3 Analyze the first strand reaction for cDNA yield and 20 perce
29. ul of your 1 10 dilution and 1 ul of your 1 20 dilution onto a prewarmed plate 2 Estimate the cDNA concentration of the diluted sample Multiply this concentration by the dilution factor to get the cDNA concentration of your size fractionated cDNA 3 Determine the final cDNA yield by multiplying the cDNA concentration by the total volume in the tube 4 You may need to prepare additional dilutions of your samples for the plate spotting assay if your spots appear saturated see Important Note on page 54 You should have a final cDNA yield of approximately 75 100 ng to perform the BP recombination reaction Using approximately 75 100 ng of cDNA in the BP reaction should produce a library containing 5 10 million clones If your cDNA yield is less than 75 ng you may pool additional fractions and ethanol precipitate the cDNA Resuspend any additional cDNA pellets using the cDNA sample from step 6 previous page Once you have the desired amount of cDNA proceed to Performing the BP Recombination Reaction with Non Radiolabeled cDNA next page 51 Performing the BP Recombination Reaction with Non Radiolabeled cDNA Introduction General guidelines are provided below to perform a BP recombination reaction between your attB flanked cDNA and pDONR 222 to generate a Gateway entry library We recommend that you include a positive control and a negative control no attB substrate in your experiment to help you evaluate your results
30. 0 mM EDTA pH 8 0 Mix gently by pipetting and place on ice until you are ready to analyze the first strand reaction see Analyzing the First Strand Reaction page 20 Take the remaining 19 ul first strand reaction and proceed immediately to Synthesizing the Second Strand next page 17 Synthesizing the Second Strand Introduction This section provides guidelines for synthesizing the second strand of cDNA Perform all steps quickly to prevent the temperature from rising above 16 C Before Starting You should have the following materials on hand before beginning Keep all reagents on ice until needed Supplied with kit e DEPC treated water e 5XSecond Strand Buffer e 10mM each dNTPs e E coli DNA Ligase 10 U l e E coli DNA Polymerase I 10 U ul e E coli RNase H 2 U ul e T4 DNA Polymerase 5 U ul e Glycogen 20 ug ul Supplied by user e Ice bucket e Thermocycler recommended or water bath at 16 C e 0 5M EDTA pH 8 0 e Phenol chloroform isoamyl alcohol 25 24 1 e 75M NH OAc ammonium acetate e 100 ethanol e Dry ice ora 80 C freezer e 70 ethanol Second Strand Perform all steps quickly to prevent the temperature from rising above 16 C If Reaction you radiolabeled your cDNA we recommend that you perform the first strand analysis during the two hour incubation in step 2 of this protocol 1 Place the first strand reaction tube containing 19 ul of cDNA radiolabeling method or 20 ul of cDNA non rad
31. BTX ECM 630 on page 38 or optimize your own electroporator to achieve a transformation efficiency of gt 1 x 10 cfu ug DNA Loss of transformation efficiency due to arcing See recommendations on page 39 to reduce chances of arcing 62 continued on next page Troubleshooting continued Problem Cause Solution Low average insert size cDNA of poor quality Make sure the first strand reaction shows gt 15 percent incorporation of o P dCTP radiolabeling method only Column fractions pooled beyond 600 ul Do not include these fractions as they will contaminate your cDNA library with attB1 Adapter Too much cDNA pooled from fractions Make sure to pull only the minimum required amount of cDNA from the earliest column fractions For recommendations on selecting and pooling cDNA fractions see page 29 radiolabeling method or page 50 non radiolabeling method Low percentage of recombinants cDNA of poor quality Make sure the first strand reaction shows gt 15 percent incorporation of o P dCTP radiolabeling method only Insufficient amount of cDNA used in the BP recombination reaction Use the minimum amount of cDNA required for the BP recombination reaction Refer to page 29 for the radiolabeling method and page 49 for the non radiolabeling method Unable to distinguish spots for the plate spotting assay non radiolabeling method onl
32. Clonase enzyme mix keep at 80 C until immediately before use Supplied by user e ttB flanked cDNA 75 100 ng e TE buffer pH 8 0 10 mM Tris HCl pH 8 0 1 mM EDTA e 25 C incubator continued on next page 52 Performing the BP Recombination Reaction with Non Radiolabeled cDNA continued BP Recombination The following protocol uses 75 100 ng of cDNA and 250 ng of pDONR 222 ina Reaction 10 ul BP reaction If the attB flanked cDNA sample is greater than 4 ul see below for necessary modifications 1 Add the following components to a sterile 1 5 ml microcentrifuge tube at room temperature and mix 2 3 kb BP BP cDNA RNA Negative Positive Component Sample Control Control Control attB flanked cDNA 75 100 ng X pl X pl z pDONR 222 150 ng ul 1 67 ul 11 67 ul 11 67 ul 1 67 ul pEXP7 tet positive control 50 ng pl e 0 5 ul 5X BP Clonase Reaction Buffer 2 ul 2 ul 2 ul 2 ul TE buffer pH 8 0 to7ul to7ul to7 ul to7 ul 2 Remove the BP Clonase enzyme mix from 80 C and thaw on ice 2 minutes Vortex the BP Clonase enzyme mix briefly twice 2 seconds each time Add 3 ul of BP Clonase enzyme mix to each sample Mix the contents gently by pipetting and centrifuge for 2 seconds to collect the sample The total volume in each tube should now be 10 ul Reminder Return BP Clonase enzyme mix to 80 C immediately after use 5 Incubate rea
33. E buffer continued on next page Performing the Plate Spotting Assay continued rm Prepare a 100 ml solution of 1 agarose in 1X TAE buffer Heat until agarose dissolves and let cool for a few minutes Preparing Plates If you will be staining your cDNA with ethidium bromide proceed to step 2 If you will not be using ethidium bromide skip to step 3 2 Add 10 ul of ethidium bromide 10 mg ml to the agarose solution for a final concentration of 1 ug ml Swirl the solution to mix 3 Pour the agarose solution into a petri dish just until the bottom is covered This will be approximately 15 ml for a 100 x 15 mm plate 4 Allow agarose to solidify at room temperature keep plates in the dark if you are using ethidium bromide Plates can be stored at 4 C for up to one month Warm plates to room temperature before use Preparing pEXP7 Serially dilute pEXP7 tet control DNA in TE buffer to final concentrations of tet Control DNA 25 ng ul 10 ng ul 5ng ul 1ng ul DNA standards can be stored at 20 C for up to 1 month Labeling Plates Using a marker label plates on the bottom side of the petri dish and indicate where the DNA standards and samples will be spotted see below Sample Plates for cDNA Size Fractionation by Column Chromatography 5 10 25 50 ng ul Ing ul ng ul ng ul 2 3 4 s e 7 al e 1 pEXP7 tet ng ul 1 5 10 25 50 pEXP7 tet ng ul Ing ul ng ul ng ul ng ul
34. FTE TTT GTT GGC ATT ATAAGAAAGC ATTGCTTATC AATTTGTTGC AACGAACAGG TCACTATCAG CAA CCG TAA TATTCTTTCG TAACGAATAG TTAAACAACG TTGCTTGTCC AGTGATAGTC attL2 TCAAAATAAA ATCATTATTT GCCATCCAGC TGATATCCCC AGTTTTATTT TAGTAATAAA CGGTAGGTCG M13 Reverse priming site i 1 GGTCATAGCT GTTTCCTGGC AGCTCTGGCC CGTGTCTCAA TATAGTGAGT CGTATTACAT AATCTCTGAT GTTACATTGC Appendix Size Fractionating Non Radiolabeled cDNA by Column Chromatography Introduction amp P7 NOMENO 7 8 v _ o je E How the Columns Work Important Before Starting Stopping the Ligation Reaction Column chromatography optimizes size fractionation of the cDNA and makes the cloning of larger inserts more probable Follow instructions closely using the columns supplied with the kit to produce the highest quality library possible Because your cDNA is not labeled with a P dCTP you will need to estimate your cDNA yields using a plate spotting assay You will be performing this assay throughout the size fractionation procedure We recommend that you read the section entitled Performing the Plate Spotting Assay page 54 before size fractionating your cDNA Each column provided with the kit contains 1 ml of Sephacryl S 500 HR resin This porous resin traps residual adapters and or small cDNAs 500 bp and prevents them from contaminating the library Larger molecules bypass the resin and elute quickly while smaller molecules are retaine
35. Invitrogen CloneMiner cDNA Library Construction Kit High quality cDNA libraries without the use of restriction enzyme cloning techniques Catalog no 18249 029 Rev date 31 October 2010 Part no 25 0608 MANDO000349 Table of Contents Table of Contents x ase ere Reto Ce ER EE the dete tee En iii Acknowledgeme nts 4 in neenon eet pm nire Hr tto b rete rare o rie Peter ids v Kit Contents and Storage cassis ninri aa E a urea ig epi eii irre Ee vii Accessory Products doe e he iet tee ette tee ee ur iles en xi INELO LU CE ON ENERO TE E 1 OVerVIew iiiiceteii neenon i niei oe been on e De eene re Hape 1 TIh Gateway Technology irre teo ted pec HA EIER EH oH gU Ree roe etie 3 Choosing a Library Construction Method sse nnne 5 Working with Radioactive Material sse eene tnter 7 Experimerital I imelinie ete teretes 8 Experimental Overview sucast oett mr ie tutt e m RE tette tei 9 Lupe rl ARRRERERESEPEFRREREHETRPETETTPERLEERLTEELTERLTTTEFERLEETLORTLTERLTETEFEFLELSERROETFEETELSLERLFRPEEFERTEEFTEFERPERFERERR 10 Before USING the Kit incerti ttt three A RRR REN RRRERIIERRRR REIR A 10 Isolating mRNA nier mien eoi D Dee Dedi bs ein a e EH ooo sess iri e eder ob ike 10 AdyancePreparation ucc eet qute ine ede RO E do det ec uer eext erue etus 12 Day 1 Synthesizing cDNA with Flanking atiB Sites eeeeeeeneen 13 Synthesizing the First Strand cree ere te ted
36. X Adapter Buffer 330 mM Tris HCI pH 7 6 50 mM MgCl 5 mM ATP 70 ul T4 DNA Ligase 1 U ul in 100 mM Potassium Phosphate pH 6 5 10 mM mercaptoethanol 50 Glycerol v v 50 ul pDONR 222 Vector 150 ng yl vector in 10 mM Tris HCl 1 mM EDTA pH 8 0 40 ul BP Clonase Enzyme Mix Proprietary 80 ul 5X BP Clonase Reaction Buffer Proprietary 200 ul Proteinase K 2 ug l in 10 mM Tris HCl pH 75 20 mM CaCl 50 Glycerol v v 40 ul pEXP7 tet Control DNA 50 ng ul in TE Buffer pH 8 0 2x20 ul 30 PEG Mg solution 30 PEG 8000 30 mM MgCl 2x1ml The Biotin attB2 Oligo dT Primer is biotinylated to block blunt end ligation of the attB1 Adapter to the 3 end of the cDNA during the adapter ligation step The primer sequence is provided below with the attB2 sequence in bold 5 Biotin GGCGGCCGCACAACTTTGTACAAGAAAGTTGGGT T 3 continued on next page Kit Contents and Storage continued attB1 Adapter Sequences DH10B T1 Phage Resistant Cells Genotype of DH10B T1 Phage Resistant Cells cDNA Size Fractionation Columns The double stranded adapter is made by denaturation and slow annealing of the two oligonucleotides in annealing buffer The attBl Adapter is supplied at 1 ug ul The sequence is provided below with the attB1 sequence in bold 5 TCGTCGGGGACAACTTTGTACAAAAAAGTTGG 3 3 CCCCTGTTGAAACATGTTTTTTCAACCp 5 Four box
37. ahashi Y Kitajima S Saga Y and Koseki H 2002 Characterization of Size Fractionated cDNA Libraries Generated by the in vitro Recombination Assisted Method DNA Res 9 47 57 Ohara O and Temple G 2001 Directional cDNA Library Construction Assisted by the in vitro Recombination Reaction Nucleic Acids Res 29 e22 Okayama H and Berg P 1982 High Efficiency Cloning of Full Length cDNA Mol Cell Biol 2 161 170 Orosz A Boros L and Venetianer P 1991 Analysis of the Complex Transcription Termination Region of the Escherichia coli rrnB Gene Eur J Biochem 201 653 659 Ptashne M 1992 A Genetic Switch Phage Lambda and Higher Organisms Cambridge MA Cell Press Sambrook J Fritsch E F and Maniatis T 1989 Molecular Cloning A Laboratory Manual Second Edition Plainview New York Cold Spring Harbor Laboratory Press Weisberg R A and Landy A 1983 Site Specific Recombination in Phage Lambda In Lambda II R A Weisberg ed Cold Spring Harbor NY Cold Spring Harbor Press pp 211 250 2003 2009 2010 Invitrogen Corporation All rights reserved For research use only Not intended for any animal or human therapeutic or diagnostic use Sephacryl and DYEnamic are registered trademarks of Amersham Biosciences SpeedVac is a registered trademark of Thermo Savant Inc BigDye is a registered trademark of Perkin Elmer Corporation Gene Pulse II is a registered tra
38. ama and Berg 1982 cDNA library construction using the A att recombination system see Ohara and Temple 2001 and Ohara et al 2002 e mRNA handling techniques see Chomczynski and Sacchi 1987 Working with Radioactive Material Introduction General Guidelines Important Read the following section if you will be constructing your cDNA library using a radiolabeled isotope This section provides general guidelines and safety tips for working with radioactive material For more information and specific requirements contact the safety department of your institution Use extreme caution when working with radioactive material Follow all federal and state regulations regarding radiation safety For general guidelines when working with radioactive material see below Follow these general guidelines when working with radioactive material e Do not work with radioactive materials until you have been properly trained e Wear protective clothing gloves and eyewear and use a radiation monitor e Use appropriate shielding when performing experiments e Work in areas with equipment and instruments that are designated for radioactive use e Plan ahead to ensure that all the necessary equipment and reagents are available and to minimize exposure to radioactive materials e Monitor work area continuously for radiation contamination e Dispose of radioactive waste properly e After you have completed your experiments monit
39. bove to a cold 0 1 cm cuvette Distribute the contents evenly by gently tapping each side of the cuvette Be careful to not introduce bubbles into your sample 3 Electroporate the sample using your optimized setting see Electroporator Settings previous page If your sample arcs discard the sample immediately and repeat the electroporation with another aliquot You will need to electroporate a minimum of 2 aliquots for the 2 3 kb RNA BP negative and BP positive controls and 1 aliquot for the pUC19 control 4 Add1mlofS O C medium to the cuvette containing electroporated cells Using a pipette transfer the entire solution to a labeled 15 ml snap cap tube Repeat steps 1 4 for all sample aliquots Shake electroporated cells for at least 1 hour at 37 C at 225 250 rpm to allow expression of the kanamycin resistance marker 7 After the one hour incubation at 37 C pool all cells representing one library into a 15 ml snap cap tube 8 Determine the volume for all cDNA libraries and controls and add an equal volume of sterile freezing media 60 S O C medium 40 glycerol Note Do not add freezing media to the pUC19 control Mix by vortexing Keep on ice This is the final cDNA library 9 Remove a 200 ul sample from each library and controls and place in 1 5 ml tubes for titer determination Keep on ice 10 Store cDNA libraries at 80 C You may divide your library into multiple tubes to reduce the number of freeze thaw cycle
40. ch protein If the purchaser is not willing to accept the limitations of this limited use statement Life Technologies is willing to accept return of the product with a full refund For information on purchasing a license to use this product for purposes other than those permitted above contact Licensing Department Life Technologies Corporation 5791 Van Allen Way Carlsbad California 92008 Phone 760 603 7200 References Ausubel F M Brent R Kingston R E Moore D D Seidman J G Smith J A and Struhl K 1994 Current Protocols in Molecular Biology New York Greene Publishing Associates and Wiley Interscience Bernard P and Couturier M 1992 Cell Killing by the F Plasmid CcdB Protein Involves Poisoning of DNA Topoisomerase II Complexes J Mol Biol 226 735 745 Bushman W Thompson J F Vargas L and Landy A 1985 Control of Directionality in Lambda Site Specific Recombination Science 230 906 911 Chomczynski P and Sacchi N 1987 Single Step Method of RNA Isolation by Acid Guanidinium Thiocyanate Phenol Chloroform Extraction Anal Biochem 162 156 159 Gubler U and Hoffman B J 1983 A Simple and Very Efficient Method for Generating cDNA Libraries Gene 25 263 269 Landy A 1989 Dynamic Structural and Regulatory Aspects of Lambda Site specific Recombination Annu Rev Biochem 58 913 949 Ohara O Nagase T Mitsui G Kohga H Kikuno R Hiraoka S Tak
41. cloning strains including TOP10 or DH5a for propagation and maintenance as these strains are sensitive to CcdB effects DO NOT use the ElectroMAX DH10B competent cells provided with this kit Positive Control pEXP7 tet control DNA is included with this kit for use as a positive control for the BP reaction pEXP7 tet contains an approximately 1 4 kb fragment consisting of the tetracycline resistance gene and its promoter Tc flanked by attB sites Using the pEXP7 tet fragment in a BP reaction with a donor vector results in entry clones that express the tetracycline resistance gene Recommended For optimal results we recommend using 30 40 ng of cDNA and 250 ng of cDNA pDONR 222 pDONR 222ina 10 ul BP recombination reaction If the amount of cDNA you Ratio will be using is out of this range make the following changes to the protocol on the next page TM e Adjust the amount of pDONR 222 such that there is an approximately 1 7 mass ratio of CDNA to pDONR 222 e If you will be using less than 250 ng of pDONR 222 dilute an aliquot of the vector in order to have a large enough volume to accurately pipette TM e Adjust the amount of TE buffer pH 8 0 to reach a final volume of 7 ul e If you will be using more than 4 ul of cDNA increase the BP reaction to a final volume of 20 ul see page 33 continued on next page 31 Performing the BP Recombination Reaction with Radiolabeled cDNA continued Before Starting BP
42. ction contains guidelines to help you determine the overall yield of your first strand cDNA and the percent incorporation of a P dCTP We recommend performing the following protocol and calculations during the second strand reaction incubation step 2 page 19 This procedure can only be performed with radiolabeled cDNA libraries You should have the following materials on hand before beginning Supplied by user e Glass fiber filters GF C 21 mm circles Whatman Catalog no 1822 021 e Solvent resistant marker Fisher Scientific Catalog no 14 905 30 e Heat lamp optional e Scintillation vials e Scintillation fluid e Beaker or plastic container e 10 TCA trichloroacetic acid 1 sodium pyrophosphate NaPPi on ice see page 63 for a recipe e 5 TCA trichloroacetic acid on ice see page 63 for a recipe e 100 ethanol e Lab shaker e Scintillation counter You will need two glass fiber filters for each first strand reaction sample 1 Using a solvent resistant marker label filters to distinguish which one will be washed For example label the filters for the first sample as 1 and 1 W where W stands for washed 2 Mixthe contents of the first strand reaction sample from step 2 page 17 by tapping the tube and centrifuge for 2 seconds to collect the sample 3 Spot 10 ul aliquots onto each of the two glass fiber filters i e on 1 and 1 W Repeat for all samples if you are constructing more t
43. ctions at 25 C for 16 20 hours Proceed to Day 3 Transforming Competent Cells page 34 Performing a 20 ul If you will be using more than 4 ul of cDNA you may increase the total BP BP Reaction reaction volume to 20 ul You will need to make the following changes to the above protocol e Add an additional 2 ul of 5X BP Clonase Reaction Buffer 4 ul total e Add the appropriate amount of TE buffer to reach a final volume of 14 ul e Add 6 ul of BP Clonase enzyme mix 53 Performing the Plate Spotting Assay Introduction Important Choosing a Nucleic Acid Stain Using the pEXP7 tet Positive Control Number of Plates Needed Before Starting 54 If you are constructing a non radioactive cDNA library you will be estimating your cDNA yields using a plate spotting assay Samples will be spotted on agarose and compared under UV light to spots containing known quantities of DNA Guidelines are provided below to prepare the plates and to perform the assay The plate spotting assay is an assay to qualitatively determine the concentration and yield of your cDNA samples Comparison of samples to the DNA standard is subjective and may vary from person to person In addition the plate spotting assay is limited in its range of cDNA detection While you can detect as little as 1 ng of cDNA using SYBR Gold Nucleic Acid Gel Stain see Choosing a Nucleic Acid Stain below the assay cannot resolve an unlimited amo
44. d RNase free microcentrifuge tubes e Wear latex gloves while handling all reagents and mRNA samples to prevent RNase contamination from the surface of the skin e Always use proper microbiological aseptic technique when working with mRNA You may use RNase Away Reagent a non toxic solution available from Invitrogen see page xi for ordering information to remove RNase contamination from surfaces For further information on controlling RNase contamination see Current Protocols in Molecular Biology Ausubel et al 1994 or Molecular Cloning A Laboratory Manual Sambrook et al 1989 mRNA can be isolated from tissue cells or total RNA using the method of choice We recommend isolating mRNA using the Micro FastTrack 2 0 or FastTrack 2 0 mRNA Isolation Kits available from Invitrogen see page xi for ordering information Generally 1 to 5 ug of mRNA will be sufficient to construct a cDNA library containing 10 to 107 primary clones in E coli Resuspend isolated mRNA in DEPC treated water and check the quality of your preparation see next page Store your mRNA preparation at 80 C We recommend aliquoting your mRNA into multiple tubes to reduce the number of freeze thaw cycles Itis very important to use the highest quality mRNA possible to ensure success Check the integrity and purity of your mRNA before starting see next page continued on next page Isolating mRNA continued Checking the Total RNA Quality
45. d within the resin and elute more slowly Thus earlier eluted fractions contain larger cDNA fragments than later fractions If you are constructing more than one cDNA library only add one cDNA adapter ligation reaction per column You should have the following materials on hand before beginning Supplied with kit e cDNA Size Fractionation Columns e Glycogen 20 ug ul Supplied by user e TEN buffer 10 mM Tris HCl pH 7 5 0 1 mM EDTA 25 mM NaCl e 100 ethanol e 75M NH OAc ammonium acetate e Dry ice or 80 C freezer e 70 ethanol e TE buffer 10 mM Tris HCl pH 8 0 1 mM EDTA 1 Incubate the tube from step 2 page 23 at 70 C for 10 minutes to inactivate the ligase 2 Place the tube on ice continued on next page 47 Size Fractionating Non Radiolabeled cDNA by Column Chromatography continued Setting Up the Column Washing the Column Important Collecting Fractions 48 Keep the following points in mind when setting up a fractionation column e Anchor the column securely in a support stand e Place a rack containing 1 5 ml tubes below the column e The outlet of the column should be 1 to 2 cm above the 1 5 ml tubes e You will need to be able to freely move the rack under the column cDNA size fractionation columns are packed in 2076 ethanol which must be completely removed before adding your cDNA sample Follow the steps below to remove the ethanol from the columns The washing steps will
46. demark of BioRad Laboratories BTX ECM 630 is a registered trademark of Genetronics Inc 81 Notes 82 invitrogen Corporate Headquarters Invitrogen Corporation 5791 Van Allen Way Carlsbad CA 92008 T 1 760 603 7200 F 1 760 602 6500 E tech supportainvitrogen com For country specific contact information visit our web site at www invitrogen com
47. ducts are warranted to perform according to specifications stated on the certificate of analysis The Company will replace free of charge any product that does not meet those specifications This warranty limits the Company s liability to only the price of the product No warranty is granted for products beyond their listed expiration date No warranty is applicable unless all product components are stored in accordance with instructions The Company reserves the right to select the method s used to analyze a product unless the Company agrees to a specified method in writing prior to acceptance of the order Invitrogen makes every effort to ensure the accuracy of its publications but realizes that the occasional typographical or other error is inevitable Therefore the Company makes no warranty of any kind regarding the contents of any publications or documentation If you discover an error in any of our publications please report it to our Technical Support Representatives Life Technologies Corporation shall have no responsibility or liability for any special incidental indirect or consequential loss or damage whatsoever The above limited warranty is sole and exclusive No other warranty is made whether expressed or implied including any warranty of merchantability or fitness for a particular purpose Purchaser Notification Introduction Limited Use Label License No 5 Invitrogen Technology TM Use of the CloneMiner
48. ducts that are subject to multiple limited use label licenses the terms of the most restrictive limited use label license shall control Life Technologies Corporation will not assert a claim against the buyer of infringement of patents owned or controlled by Life Technologies Corporation which cover this product based upon the manufacture use or sale of a therapeutic clinical diagnostic vaccine or prophylactic product developed in research by the buyer in which this product or its components was employed provided that neither this product nor any of its components was used in the manufacture of such product If the purchaser is not willing to accept the limitations of this limited use statement Life Technologies is willing to accept return of the product with a full refund For information about purchasing a license to use this product or the technology embedded in it for any use other than for research use please contact Out Licensing Life Technologies 5791 Van Allen Way Carlsbad California 92008 Phone 760 603 7200 or e mail outlicensing lifetech com continued on next page 79 Purchaser Notification continued Limited Use Label License No 19 Gateway Cloning Products 80 The purchase of this product conveys to the buyer the non transferable right to use the purchased amount of the product and components of the product in research conducted by the buyer whether the buyer is an academic or for profit entity The purchas
49. e ee etn eere dee dei 14 Synthesizing the Second Strand nei eoe ep eet te edi e e qs 18 Analyzing the First Strand Reaction 2 ne etienne pe err ree rie EEE iv 20 Ligatitig the attBl Ad pter eee sos teeneun hee heme abi Rte cess te Eee EIE 23 Day 2 Size Fractionating cDNA by Column Chromatography and Performing the BP Recombination Reaction uuesuursssnsnnnnnnunnnnnnnnnnnunnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn 25 Size Fractionating Radiolabeled cDNA by Column Chromatography sss 26 Performing the BP Recombination Reaction with Radiolabeled cDNA sss 31 Day 3 Transforming Competent Cells esee nennen nnne nnn nnn nnn nennen 34 Preparing for Transformation n on ee nip pee einen tre cous dre e Port e ERR ERE aS 35 Pertorm ng the Plating ASSay s iubet evi tr idee Rt d degener gen Ha 40 Days 4 5 Analyzing the cDNA Library eeeeeeeeeeeeeeneneree nnne nennen nnne nnne nennen nnn nnns 41 Determining the cDNA Library Titer cde ote tetendit iet eee det ene ERR 42 Qualifying the cDNA Libraty a2 ott e eemper i ene e eim P e e bein 43 Sequencing Entry Clones eie trahere mg obrera pe i hn piden 45 21010121 410 cCu 47 Size Fractionating Non Radiolabeled cDNA by Column Chromatography s 47 Performing the BP Recombination
50. e of this product does not convey a license under any method claims in the foregoing patents or patent applications or to use this product with any recombination sites other than those purchased from Life Technologies Corporation or its authorized distributor The right to use methods claimed in the foregoing patents or patent applications with this product for research purposes only can only be acquired by the use of ClonaseTM purchased from Life Technologies Corporation or its authorized distributors The buyer cannot modify the recombination sequence s contained in this product for any purpose The buyer cannot sell or otherwise transfer a this product b its components or c materials made by the employment of this product or its components to a third party or otherwise use this product or its components or materials made by the employment of this product or its components for Commercial Purposes The buyer may transfer information or materials made through the employment of this product to a scientific collaborator provided that such transfer is not for any Commercial Purpose and that such collaborator agrees in writing a not to transfer such materials to any third party and b to use such transferred materials and or information solely for research and not for Commercial Purposes Notwithstanding the preceding any buyer who is employed in an academic or government institution may transfer materials made with this product to a third party
51. ect the effluent into tube 2 Let the column drain completely Note It is important to make sure all of the effluent has drained from the column before adding each new 100 ul aliquot of TEN buffer 5 Beginning with the next 100 ul aliquot of TEN buffer collect single drop fractions into individual tubes starting with tube 3 Continue to add 100 ul aliquots of TEN buffer until all 18 tubes tubes 3 20 contain a single drop continued on next page Size Fractionating Non Radiolabeled cDNA by Column Chromatography continued Filling Out the Worksheet Columns Aand B Filling Out the Worksheet Columns C and D Required cDNA Yield Note A worksheet is provided to help you with your data recording see page 76 Refer to page 71 for a sample worksheet to help you with your calculations 1 Using a pipet measure the volume in each tube Use a fresh tip for each fraction to avoid cross contamination Record this value in column A of the worksheet 2 Calculate the cumulative elution volume with the addition of each fraction and record this value in column B 3 Identify the first fraction that exceeds a total volume of 600 ul in column B Do not use this fraction or any subsequent fractions for your cDNA library Important These fractions corresponding to fractions 14 through 20 in the sample worksheet page 71 contain increasing amounts of the attBl Adapter which will interfere with cloning reactions and will conta
52. ed information refer to the Gateway Technology manual This manual is available from our Web site www invitrogen com or by contacting Technical Service page 77 Lambda based recombination involves two major components e The DNA recombination sequences att sites and e The proteins that mediate the recombination reaction i e Clonase enzyme mix These components are discussed below Lambda integration into the E coli chromosome occurs via intermolecular DNA recombination that is mediated by a mixture of lambda and E coli encoded recombination proteins i e Clonase enzyme mix The hallmarks of lambda recombination are listed below e Recombination occurs between specific att sites on the interacting DNA molecules e Recombination is conservative i e there is no net gain or loss of nucleotides and does not require DNA synthesis The DNA segments flanking the recombination sites are switched such that after recombination the att sites are hybrid sequences comprised of sequences donated by each parental vector For example attL sites are comprised of sequences from attB and attP sites e Strand exchange occurs within a core region that is common to all att sites see next page For more detailed information about lambda recombination see published references and reviews Landy 1989 Ptashne 1992 continued on next page The Gateway Technology continued att Sites Lambda recombination occurs b
53. es of ElectroMAX DH10B T1 Phage Resistant Cells are provided with the kit Transformation efficiency is gt 1 x 10 cfu ug DNA Each box includes the following items Store at 80 C Item Composition Amount ElectroMAX DH10B T1 Phage 5x100 ul Resistant Cells pUC19 Control DNA 10 pg ul in 50 ul 5 mM Tris HCl 0 5 mM EDTA pH 8 S O C Medium 2 Tryptone 2x6ml may be stored at room temperature 0 576 Yeast Extract or 4 C 10 mM NaCl 2 5 mM KCl 10 mM MgCl 10 mM MgSO 20 mM Glucose F mer A A mrr hsdRMS mcrBC 80lacZAM15 AlacX74 recA1 end A1 araA139 A ara leu 7697 galU galK X rpsL nupG tonA Two boxes containing three disposable columns each are provided with the kit for a total of six columns Each column contains 1 ml of Sephacryl S 500 HR prepacked in 20 ethanol Store columns at 4 C Accessory Products Introduction Additional Products Gateway Destination Vectors The products listed in this section may be used with the CloneMiner cDNA Library Construction Kit For more information refer to our Web site www invitrogen com or contact Technical Service page 77 Many of the reagents supplied with the CloneMiner cDNA Library Construction TM Kit as well as other products suitable for use with the kit are available separately from Invitrogen Ordering information is provided below
54. etween site specific attachment att sites attB on the E coli chromosome and attP on the lambda chromosome The att sites serve as the binding site for recombination proteins and have been well characterized Weisberg and Landy 1983 Upon lambda integration recombination occurs between attB and attP sites to give rise to attL and attR sites The actual crossover occurs between homologous 15 bp core regions on the two sites but surrounding sequences are required as they contain the binding sites for the recombination proteins Landy 1989 In the CloneMiner cDNA Library Construction Kit the wild type attB sites encoded by the attB1 Adapter and Biotin attB2 Oligo dT Primer and the wild type attP1 and attP2 sites encoded by pDONR 222 have been modified to improve the efficiency and specificity of the Gateway BP recombination reaction ccdB Gene The presence of the ccdB gene in pDONR 222 allows negative selection of the donor vector in E coli following recombination and transformation The CcdB protein interferes with E coli DNA gyrase Bernard and Couturier 1992 thereby inhibiting growth of most E coli strains e g DH5a TOP10 When recombination occurs between pDONR 222 and the attB flanked cDNA the ccdB gene is replaced by the cDNA insert Cells that take up nonrecombined pDONR 222 carrying the ccdB gene or by product molecules retaining the ccdB gene will fail to grow This allows high efficiency recovery of the desired clone
55. for Transformation continued Aliquoting Samples 1 Label six 1 5 ml tubes for each cDNA library sample For example if you are constructing multiple libraries label tubes for library A Al A2 A3 etc 2 Label two 1 5 ml tubes for each of the cDNA library controls 2 3 kb mRNA BP positive and BP negative controls For the pUC19 transformation control label one 1 5 ml tube 3 Foreach 1 5 ml tube from steps 1 and 2 label a duplicate 15 ml snap cap tube e g Falcon tube 4 Aliquot cDNA library samples and controls into the appropriate tubes according to the table below Place tubes on ice 2 3 kb BP BP cDNA RNA Negative Positive pUC 19 Library Control Control Control Control Number of 6 2 2 2 1 1 5 ml Tubes Aliquot in 1 5 ul 1 5 pl 1 5 ul 1 5 ul 1 0 pl Each Tube 5 Proceed to Transforming ElectroMAX DH10B T1 Phage Resistant Cells next page 37 Transforming ElectroMAX DH10B T1 Phage Resistant Cells Note Before Starting Electroporator Settings 38 Each box of ElectroMAX DH10B T1 Phage Resistant Cells consists of 5 tubes containing 100 ul of competent cells each Each tube contains enough competent cells to perform 2 transformations using 50 ul of cells per transformation Once you have thawed a tube of competent cells discard any unused cells Do not re freeze cells as repeated freezing thawing of cells may result in loss of transformation efficie
56. g cDNA Yield the plate spotting assay Refer to Labeling Plates page 55 to see how plates were labeled Note that samples are in the reverse order Serial dilutions of PEXP7 tet control DNA and two dilutions of ethanol precipitated cDNA were spotted and stained with SYBR Gold as described on page 54 1 10 Dilution 1 20 Dilution cDNA Concentration of Diluted 5 2 5 Sample ng ul Final cDNA concentration ng ul 50 50 Volume of cDNA ul 4 4 Total cDNA Yield ng 200 200 BP Recombination 3 ul of the cDNA sample containing a total of 150 ng of cDNA was used in the BP Reaction recombination reaction 72 Map and Features of pDONR 222 pDONR 222 Map The map below shows the elements of pDONR 222 The complete sequence of pDONR 222 is available from our Web site www invitrogen com or by contacting Technical Service page 77 BsrG BsrG BsrG M13 M13 R Forward ccdB everse Comments for ppONR 222 4718 nucleotides rrnB T2 transcription termination sequence bases 58 85 c rrnB T1 transcription termination sequence bases 217 260 c M13 Forward 20 priming site bases 327 342 attP1 bases 360 591 BsrG restriction sites bases 442 1232 2689 ccdB gene bases 987 1292 c Chloramphenicol resistance gene bases 1612 2295 c attP2 bases 2543 2774 c M13 Reverse priming site bases 2816 2832 Kanamycin resistance gene bases 2899 3714 c pUC origin bases
57. han one library 4 Dry filters under a heat lamp for 3 minutes or at room temperature for 10 15 minutes 5 Place the non washed filter i e labeled 1 directly into a labeled scintillation vial and add the appropriate volume of scintillation fluid Mix well Repeat for all non washed filters continued on next page Analyzing the First Strand Reaction continued Washing Filters Use the following protocol to wash filters labeled with a W Use a beaker or plastic container that is large enough to hold 200 ml of reagent with adequate shaking Multiple filters can be washed together in one container 1 Place the container on top of a shaker and add the first reagent in the table below Submerge filters using forceps and shake for the time indicated Continue the wash steps according to the table below Properly discard the washing solution each time before performing the next wash Wash Reagent Amount Time 1 10 TCA 1 NaPPi 200 ml 10 min 2 5 TCA 200 ml 10 min 3 5 TCA 200 ml 5 min 4 100 ethanol 200 ml 2 min 2 Dry washed filters under a heat lamp for 3 minutes or at room temperature for 10 15 minutes 3 Place washed filters into individual labeled scintillation vials and add the appropriate volume of scintillation fluid Mix well 4 Count both the washed and unwashed filters using a standard P scintillation program 5 Proceed to Overview of Calculations below O
58. i e 2 5 x volume of CDNA NH4OAc Note You may stop at this point and store the tube at 20 C overnight if necessary 2 Place the tube in dry ice or at 80 C for 10 minutes Centrifuge the sample at 4 C for 25 minutes at 14 000 rpm 3 Carefully remove the supernatant while trying not to disturb the cDNA pellet Add 150 ul of 70 ethanol 4 Centrifuge the sample at 4 C for 2 minutes at 14 000 rpm Carefully remove the supernatant Repeat the 70 ethanol wash Remove as much of the remaining ethanol as possible 5 Dry the cDNA pellet in a SpeedVac for 2 3 minutes or at room temperature for 5 10 minutes 6 Resuspend the cDNA pellet in 4 5 ul of TE buffer by pipetting up and down 30 40 times Transfer the sample to a fresh tube 1 Remove 0 5 ul of your cDNA sample from step 6 above and add to 4 5 ul of TE buffer to make a 1 10 dilution 2 Remove 2 5 ul of the 1 10 dilution and add to 2 5 ul of TE buffer to make a 1 20 dilution Proceed to Estimating the cDNA Yield next page continued on next page Size Fractionating Non Radiolabeled cDNA by Column Chromatography continued Estimating the cDNA Yield What You Should See You will be estimating the concentration and yield of your cDNA sample using the plate spotting assay Refer to Performing the Plate Spotting Assay page 54 for detailed guidelines on preparing the plates and staining the DNA 1 Using the DNA Spotting Assay protocol on page 56 spot 1
59. ifuge for 2 seconds to collect the sample The total volume in each tube should now be 10 ul Reminder Return BP Clonase enzyme mix to 80 C immediately after use 5 Incubate reactions at 25 C for 16 20 hours Proceed to Day 3 Transforming Competent Cells page 34 continued on next page Performing the BP Recombination Reaction with Radiolabeled cDNA continued Performing a 20 ul If you will be using more than 4 ul of cDNA you may increase the total BP BP Reaction reaction volume to 20 ul You will need to make the following changes to the protocol on the previous page TM e Add the appropriate amount of pDONR 222 according to the recommended ratio see Recommended cDNA pDONR 222 Ratio page 31 e Add an additional 2 ul of 5X BP Clonase Reaction Buffer 4 ul total e Add the appropriate amount of TE buffer to reach a final volume of 14 ul e Add 6 ul of BP Clonase enzyme mix 33 34 Day 3 Day 3 Transforming Competent Cells Prepare for Transformation Transform Competent Cells Perform the Plating Assay Preparing for Transformation Introduction Transformation Control Before Starting Stopping the BP Recombination Reaction Once you have performed the BP recombination reaction you will inactivate the reaction with proteinase K ethanol precipitate the cDNA and transform it into competent E coli The ElectroMAX DH10B T1 Phage Resistant Cells provided with the kit have a high
60. ill depend on the concentration of your starting mRNA e We recommend using a thermocycler rather than a water bath both for ease and for accurate temperatures and incubation times e Tubes should remain in the thermocycler or water bath when adding SuperScript II RT to minimize temperature fluctuations see Hot Start Reverse Transcription below Components of the first strand reaction are pre incubated at 45 C before the addition of SuperScript II RT Incubation at this temperature inhibits nonspecific binding of primer to template and reduces internal cDNA synthesis and extension by SuperScript II RT For this reason it is important to keep all TM reactions as close to 45 C as possible when adding SuperScript II RT continued on next page Synthesizing the First Strand continued MAMENO NE _s vo If you are constructing multiple libraries we recommend making a cocktail of a IS reagents to add to each tube rather than adding reagents individually This will reduce the time required for the step and will also reduce the chance of error Preparing If you will be labeling your first strand with a P dCTP 10 uCi ul dilute an o P dCTP aliquot with DEPC treated water to a final concentration of 1 uCi ul Use once and properly discard any unused portion as radioactive waste Using the Non If you prefer to construct a non radiolabeled cDNA library perform the following Radiolabeling protocol
61. inued Insufficient amount of cDNA used in the BP recombination reaction Use the minimum amount of cDNA required for the BP recombination reaction Refer to page 29 for the radiolabeling method and page 49 for the non radiolabeling method BP Clonase enzyme mix is inactive or suggested amount was not used e Perform the pEXP7 tet positive control reactions to verify that BP TM Clonase enzyme mix is active e Test another aliquot of the BP Clonase enzyme mix e Make sure that you store the BP Clonase enzyme mix at 80 e Do not freeze thaw the BP Clonase enzyme mix more than 10 times e Use the recommended amount of BP Clonase enzyme mix see page 32 Recombination reactions were not treated with proteinase K Treat reactions with proteinase K before transformation Few or no colonies obtained from the pUC19 transformation control ElectroMAX DHIOB competent cells stored incorrectly Store competent cells at 80 C Loss of transformation efficiency due to repeated freeze thawing Once you have thawed a tube of competent cells discard any unused cells Transformation performed incorrectly Closely follow the electroporation protocol for ElectroMAX DH10B competent cells on page 39 If you are using another E coli strain follow the manufacturer s instructions Electroporator parameters not optimized Follow recommended settings for BioRad Gene Pulser II and
62. iolabeling method on ice Keep the tube on ice while adding the following reagents DEPC treated water 92 ul 5X Second Strand Buffer 30 ul 10 mM each dNTPs 3 ul E coli DNA Ligase 10 U l 1 ul E coli DNA Polymerase I 10 U ul 94 pl E coli RNase H 2 U ul 1ul Total volume 150 ul radiolabeling method 151 ul non radiolabeling method continued on next page 18 Synthesizing the Second Strand continued Second Strand Reaction continued Phenol Chloroform Extraction Ethanol Precipitation Mix the contents gently by pipetting and centrifuge for 2 seconds to collect the sample Incubate at 16 C for 2 hours During this 2 hour incubation step perform the first strand analysis if you are using the radiolabeling method see Analyzing the First Strand Reaction page 20 Add 2 ul of T4 DNA Polymerase to create blunt ended cDNA Mix the contents gently by pipetting and centrifuge for 2 seconds to collect the sample Incubate at 16 C for 5 minutes Add 10 ul of 0 5 M EDTA pH 8 0 to stop the reaction Proceed to Phenol Chloroform Extraction below Add 160 ul of phenol chloroform isoamyl alcohol 25 24 1 and shake by hand thoroughly for approximately 30 seconds Centrifuge at room temperature for 5 minutes at 14 000 rpm Carefully remove the upper aqueous phase to a fresh 1 5 ml tube Proceed to Ethanol Precipitation below To the aqueous phase add reagents in the following order Glycogen 20
63. ionating your cDNA by column chromatography or by gel electrophoresis We recommend radiolabeling your cDNA and size fractionating your cDNA by column chromatography This section provides information to help you choose the library construction method that best suits your needs The table below outlines the advantages and disadvantages of the radiolabeling and non radiolabeling methods Use this information to choose one method to construct your cDNA library Radiolabeling Method Non Radiolabeling Method Analyzing First Strand Synthesis Direct measure of cDNA yield and overall quality of the first strand No knowledge of cDNA yield or quality until the library is constructed counter Determining cDNA Reliable quantitative method using Qualitative subjective method using Yields for Cloning scintillation counter agarose plate spotting assay Sensitivity of cDNA Very sensitive to a wide range of Sensitive in detecting 1 10 ng of Detection cDNA amounts using scintillation cDNA per spot see Performing the Plate Spotting Assay page 54 Limited resolution for cDNA yields greater than 10 ng per spot see Performing the Plate Spotting Assay page 54 Experimental Time Time consuming filter washes counting samples performing calculations DNA standards and plates for the plate spotting assay can be prepared in advance for several experiments limited calculations Preparation Requires exten
64. is solution can be stored in the dark per manufacturer s instructions Remove the plate lid and pour the SYBR Gold solution over the agarose until the entire plate is covered approximately 15 ml Place the plate in a box and wrap in foil to protect the solution from light Shake the plate on a lab shaker for 20 minutes Discard the stain in the appropriate waste Air dry the plate Remove the lid and visualize the plate under UV light and photograph Note that the labels and samples will be in the reverse order Using the known concentration of the DNA standards estimate the amount of cDNA in each sample Refer to page 72 for a sample plate Performing the LR Library Transfer Reaction Introduction Once you have qualified your cDNA library and analyzed entry clones you can perform the LR recombination reaction to transfer your cDNA library into any Gateway destination vector of choice If you will be creating an expression library you will need to follow the guidelines provided in this section for preparing DNA and for performing the LR recombination reaction Alternatively you may screen your cDNA library to identify a specific entry clone and use this entry clone in an LR recombination reaction with a destination vector to generate an expression clone Refer to the Gateway Technology manual to perform a standard LR recombination reaction using a single entry clone Before Starting You should have the following materials
65. ize fractionate cDNA Use the column chromatography method to generate a cDNA library with an average cDNA insert size of approximately 1 5 kb if you start with high quality mRNA Columns are provided with the kit Protocols to size fractionate radiolabeled or non radiolabeled cDNA by column chromatography are provided in this manual Use the gel electrophoresis method to generate a cDNA library with a larger average insert size 22 0 kb or to select cDNA of a particular size Protocols to size fractionate radiolabeled or non radiolabeled cDNA by gel electrophoresis are provided in the CloneMiner cDNA Construction Kit Web Appendix Because you will need to have additional reagents on hand we recommend reading the Web Appendix before beginning This manual is available from our Web site www invitrogen com or by contacting Technical Service page 77 TM The CloneMiner cDNA Library Construction Kit is designed to help you construct a cDNA library without the use of traditional restriction enzyme cloning methods Use of this kit is geared towards those users who have some familiarity with cDNA library construction We highly recommend that users possess a working knowledge of mRNA isolation and library construction techniques before using this kit For more information about these topics refer to the following published reviews cDNA library construction using restriction enzyme cloning see Gubler and Hoffman 1983 and Okay
66. l kanamycin for each cDNA library 2 3 kb RNA control BP negative control and BP positive control You will need two prewarmed LB plates containing 100 ug ml ampicillin for the pUC19 transformation control 3 Plate 100 ul of each dilution onto prewarmed LB plates containing the appropriate antibiotic Incubate plates overnight at 37 C 5 Proceed to Days 4 5 Analyzing the cDNA Library next page cDNA 23 kb RNA BP Negative BP Positive pUC 19 Library Control Control Control Control Dilutions 10 10 undiluted 10 10 10 10 107 10 10 10 10 10 Amount to Plate 2x 100 ul 2x 100 ul 2x 100 ul 2x 100 ul 2x 100 ul of Each Dilution Total Number of 6 6 6 6 B LB Kan Plates Total Number of 2 LB Amp Plates 40 Days 4 5 Analyzing the cDNA Library Determine cDNA Library Titer Days 4 5 l Qualify cDNA Library 41 Determining the cDNA Library Titer Introduction Calculations Expected Total CFUs What You Should See 42 Guidelines are provided below to determine the titer of your cDNA library Refer to page 69 for a sample titer calculation 1 Using the results from the plating assay page 40 and the equation below calculate the titer for each plate colonies on plate x dilution factor volume plated ml cfu ml 2 Use the titer for each plate to calculate the average titer for the entire cDNA library 3 Use the average tite
67. loneMiner cDNA Library Construction Kit is designed to construct high quality cDNA libraries without the use of traditional restriction enzyme cloning methods This novel technology combines the performance of SuperScript II Reverse Transcriptase with the Gateway Technology Single stranded mRNA is converted into double stranded cDNA containing attB sequences on each end Through site specific recombination attB flanked cDNA is cloned directly into an attP containing donor vector without the use of restriction digestion or ligation The resulting Gateway entry cDNA library can be screened with a probe to identify a specific entry clone This clone can be transferred into the Gateway destination vector of choice for gene expression and functional analysis Alternatively the entire entry cDNA library can be shuttled into a Gateway destination vector to generate an expression library For more information on the Gateway Technology see page 3 TM Features of the CloneMiner cDNA Library Construction Kit include e SuperScript II reverse transcriptase for efficient conversion of mRNA into cDNA Biotin attB2 Oligo dT Primer for poly A mRNA binding and incorporation of the attB2 sequence to the 3 end of cDNA e attB1 Adapter for ligation of the attB1 sequence to the 5 end of double stranded cDNA e attP containing vector pDONR 222 for recombination with attB flanked cDNA to produce an entry library through the Gateway BP
68. m Catalog no 12263 018 if you will be analyzing multiple libraries at a time 3 Digest 300 500 ng of plasmid DNA with BsrG I following the manufacturer s instructions Also digest 250 ng of supercoiled pDONR 222 with BsrG I as a control 4 Electrophorese samples using a 1 agarose gel Include a DNA ladder to help estimate the size of your inserts continued on next page 43 Qualifying the cDNA Library continued Expected Digestion Patterns Determining Average Insert Size and Recombinants What You Should See The Next Step 44 Use the following guidelines to determine the size of the cDNA inserts Refer to page 70 for a sample electrophoresis e The pDONR 222 control will show a digestion pattern of 3 bands of the following lengths 2 5 kb 1 4 kb 790 bp e Each cDNA entry clone should have a vector backbone band of 2 5 kb and additional insert bands e Make sure to digest enough plasmid DNA to be able to visualize smaller insert bands 300 bp e Make sure to run the gel long enough to distinguish bands representing insert sizes of approximately 2 5 kb from the 2 5 kb vector backbone band Identify clones containing inserts using the guidelines outlined above 2 Forclones containing inserts use the DNA ladder to estimate band sizes If there are multiple bands for a single cDNA entry clone add all band sizes to calculate the insert size Do not include the 2 5 kb vector backbone band in y
69. mbination reaction Using approximately 30 40 ng of cDNA in the BP reaction should produce a library containing 5 10 million clones If your cDNA yield is less than 30 ng you may pool additional fractions and ethanol precipitate the cDNA Resuspend any additional cDNA pellets using the cDNA sample from step 6 previous page Once you have the desired amount of cDNA proceed to Performing the BP Recombination Reaction with Radiolabeled cDNA next page 30 Performing the BP Recombination Reaction with Radiolabeled cDNA Introduction General guidelines are provided below to perform a BP recombination reaction between your attB flanked cDNA and pDONR 222 to generate a Gateway entry library We recommend that you include a positive control and a negative control no attB substrate in your experiment to help you evaluate your results For a map and a description of the features of pDONR 222 see pages 73 74 TM Propagating If you wish to propagate and maintain pDONR 222 we recommend using 10 ng pDONR 222 of the vector to transform One Shot ccdB Survival 2 T1 Chemically Competent Cells Catalog no A10460 from Invitrogen The ccdB Survival 2 T1 E coli strain is resistant to CcdB effects and can support the propagation of plasmids containing the ccdB gene To maintain the integrity of the vector select for transformants in media containing 50 ug ml kanamycin and 30 ug ml chloramphenicol Note DO NOT use general E coli
70. minate the library We recommend discarding these tubes to avoid accidentally using them in the remainder of the protocol You will be estimating the concentration and yield of your cDNA fractions using the plate spotting assay Refer to Performing the Plate Spotting Assay page 54 for detailed guidelines on preparing the plates and staining the DNA 1 Using the DNA Spotting Assay protocol on page 56 spot 1 ul of each fraction onto a prewarmed plate Record the estimated cDNA concentration of each fraction in column C Multiply the cDNA concentration in column C by the fraction volume in column A to determine the amount of cDNA for that fraction Record this value in column D You will need a final cDNA yield of 75 ng to perform the BP recombination reaction Because you will lose approximately half of your sample during the ethanol precipitation procedure we recommend that you pool a minimum of 150 ng of cDNA from your fractions See the next page for guidelines on selecting and pooling cDNA fractions If you have previously performed the BP recombination reaction using radiolabeled cDNA note that the amount of non radiolabeled cDNA required is greater see page 29 This larger amount is due to the difference in scale between quantifying DNA by radioactivity using a scintillation counter and quantifying DNA by the plate spotting assay using the DNA standard Thus 30 ng of cDNA as measured by counts is roughly equivalent to 50
71. n enzyme analysis DNA sequencing and DNA biochemistry refer to Molecular Cloning A Laboratory Manual Sambrook et al 1989 or Current Protocols in Molecular Biology Ausubel et al 1994 You should have the following materials on hand before beginning Supplied by user e Restriction enzyme BsrG I and appropriate buffer New England Biolabs Catalog no R05755 e 1Kb Plus DNA Ladder recommended Invitrogen Catalog no 12302 011 Other DNA ladders are suitable e Electrophoresis apparatus and reagents You will be digesting positive transformants with BsrG I to determine average insert size and percentage of recombinants BsrG I sites generally occur at a low frequency making it an ideal restriction enzyme to use for insert size analysis BsrG I cuts within the following sites e attL sites of your entry clone to give you the size of your insert see page 46 for a diagram of the recombination region e attP sites and ccdB gene in pDONR 222 to distinguish non recombined pDONR 222 see page 73 for a map We recommend that you analyze a minimum of 24 positive clones to accurately determine average insert size and the percentage of recombinants 1 Pick 24 colonies from the plating assay and culture overnight in 2 ml LB containing 50 ug ml of kanamycin 2 Isolate plasmid DNA using your method of choice We recommend using the S N A P MiniPrep Kit Catalog no K1900 01 or the Concert 96 Plasmid Purification Syste
72. ncy You should have the following materials on hand before beginning Supplied with kit e ElectroMAX DH10B T1 Phage Resistant Cells thaw on ice before use e S O C medium Invitrogen Catalog no 15544 034 Supplied by user e Ice bucket e 0 1 cm cuvettes on ice e Electroporator e 37 C shaking incubator e 15 ml snap cap tubes e g Falcon tubes e Freezing media 60 S O C medium 40 glycerol see page 63 for a recipe If you are using the BioRad Gene Pulser II or BTX ECM 630 we recommend the following settings Voltage 2 0 kV Resistance 200 Q Capacity 25 uF If you are using another electroporator you will need to optimize your settings using the pUC19 control DNA provided with the kit The transformation efficiency of the ElectroMAX DH10B T1 Phage Resistant Cells should be at least 1 x 10 cfu ug of pUC19 control DNA continued on next page Transforming ElectroMAX DH10B T1 Phage Resistant Cells continued Electroporation We recommend that you electroporate your controls first followed by your cDNA samples This will allow you to troubleshoot any arcing problems before you electroporate your cDNA samples see recommendation below 1 To one tube containing a DNA aliquot add 50 ul of thawed ElectroMAX DH10B competent cells Mix gently by pipetting up and down two times Be careful to not introduce bubbles into your sample 2 Transfer the entire contents of the tube from step 1 a
73. nd add all other reagents as listed above Note You may stop at this point and store the tube at 20 C overnight if necessary Place the tube in dry ice or at 80 C for 10 minutes Centrifuge the sample at 4 C for 25 minutes at 14 000 rpm Carefully remove the supernatant while trying not to disturb the cDNA pellet Add 150 ul of 70 ethanol Centrifuge the sample at 4 C for 2 minutes at 14 000 rpm Carefully remove the supernatant Repeat the 70 ethanol wash Remove as much of the remaining ethanol as possible Dry the cDNA pellet in a SpeedVac for 2 3 minutes or at room temperature for 5 10 minutes Resuspend the cDNA pellet in 9 ul of TE buffer by pipetting up and down 30 40 times You will be dividing your cDNA sample into six aliquots and transforming each TM TM aliquot into ElectroMAX DHIOB competent cells To reduce the amount of work we recommend that you transform only two aliquots of the 2 3 kb mRNA BP negative and BP positive controls and one aliquot of the pUC19 control Consider the following before preparing the controls If arcing occurs during electroporation the sample should be immediately discarded You will need to repeat the electroporation You may prepare in advance additional aliquots tubes cuvettes and reagents for any additional electroporations you may have to perform See page 39 for recommendations for reducing arcing during electroporation continued on next page Preparing
74. nt incorporation of a P dCTP 4 Ligate the attB1 adapter to the 5 end of your cDNA 23 23 2 Size fractionate the cDNA by column chromatography 26 47 to remove excess primers adapters and small cDNA 2 Perform the BP recombination reaction between the 31 52 attB flanked cDNA and pDONR 222 3 1 Transform the BP reactions into ElectroMAX 35 35 DH10B T1 Phage Resistant cells Add freezing media to transformed cells to get final cDNA library 2 Perform the plating assay to determine the cDNA 40 40 library titer 4 5 1 Calculate the cDNA library titer using the results from 42 42 the plating assay 2 Inoculate 24 positive transformants from the plating 43 43 assay Determine average insert size and percent recombinants by restriction analysis 3 Sequence entry clones to verify presence of cDNA 45 45 insert if desired Methods Before Using the Kit Isolating mRNA Introduction MEN 7 oy e 0 2 o p General Handling of mRNA mRNA Isolation Important 10 You will need to isolate high quality mRNA using a method of choice prior to using this kit Follow the guidelines provided below to avoid RNase contamination Aerosol resistant pipette tips are recommended for all procedures See below for general recommendations for handling mRNA When working with mRNA e Use disposable individually wrapped sterile plasticware e Use only sterile RNase free pipette tips an
75. nt while trying not to disturb the cDNA pellet Add 150 ul of 70 ethanol Note Use a Geiger counter to monitor the supernatant for the presence of radioactivity The majority of the radioactivity should be in the pellet and not in the supernatant 4 Centrifuge the sample at 4 C for 2 minutes at 14 000 rpm Carefully remove the supernatant Repeat the 70 ethanol wash Remove as much of the remaining ethanol as possible 5 Dry the cDNA pellet in a SpeedVac for 2 3 minutes or at room temperature for 5 10 minutes 6 Resuspend the cDNA pellet in 4 ul of TE buffer by pipetting up and down 30 40 times Transfer the sample to a fresh tube Note Use a Geiger counter to make sure you have resuspended and transferred all of the cDNA pellet The majority of the radioactivity should be found in the fresh tube and not in the old tube continued on next page 29 Size Fractionating Radiolabeled cDNA by Column Chromatography continued Calculating the 1 Place the capped tube containing the resuspended cDNA from step 6 cDNA Yield previous page directly into a scintillation vial Do not add scintillation fluid Obtain Cerenkov counts 2 Determine the cDNA yield using the equation below Refer to Calculating the Double Strand cDNA Yield page 28 for the full equation Cerenkov cpm x 8 SAx 1 515 Amount of ds cDNA ng What You Should You should have a final cDNA yield of approximately 30 40 ng to perform the See BP reco
76. of mRNA 5 ul of water Priming Reaction 1 To your diluted mRNA mRNA DEPC treated water add the Biotin attB2 Oligo dT Primer and 10 mM dNTPs according to the following table ug of starting mRNA Reagent lt 1 2 3 4 5 Control mRNA DEPC treated 10 ul 9u 8ul Zu oul Onl water Biotin attB2 Oligo dT 1 pl 1 ul 1ul 1ul 1ul 1ul Primer 30 pmol ul 10 mM each dNTPs Tul lul lu 1 ul Tul Tul Total Volume 120 ipl 10ul Onl 8 ul 11 ul 2 Mix the contents gently by pipetting and centrifuge for 2 seconds to collect the sample 3 Incubate the mixture at 65 C for 5 minutes and cool to 45 C for 2 minutes During these incubation steps perform step 1 of the First Strand Reaction below First Strand 1 Add the following reagents to a fresh tube Reaction Note If you will be using the non radiolabeling method substitute DEPC treated water for a P dCTP 5X First Strand Buffer 4 ul 0 1 MDTT 2 ul o P dCTP 1 uCi ul 1pgl 2 Mixthe contents gently by pipetting and centrifuge for 2 seconds to collect the sample 16 continued on next page Synthesizing the First Strand continued First Strand Reaction continued First Strand Reaction Sample 3 After the priming reaction has cooled to 45 C for 2 minutes step 3 previous page add the mixture from step 1 to the priming reaction tube Be careful to not introduce bubbles into your
77. of the cDNAs To ensure that you obtain the best possible results we suggest you read this section and the sections entitled Synthesizing the Second Strand pages 18 19 and Ligating the attB1 Adapter pages 23 24 before beginning cDNA synthesis is a multi step procedure requiring many specially prepared reagents which are crucial to the success of the process Quality reagents necessary for converting your mRNA sample into double stranded cDNA are provided with this kit To obtain the best results do not substitute any of your own reagents for the reagents supplied with the kit To successfully construct a cDNA library it is crucial to start with high quality mRNA For guidelines on isolating mRNA see page 10 The amount of mRNA needed to prepare a library depends on the efficiency of each step Generally 1to5 ug of mRNA will be sufficient to construct a cDNA library containing 10 to 10 primary clones in E coli We recommend that you include the 2 3 kb RNA control in your experiments to help you evaluate your results The 2 3 kb RNA control is an in vitro transcript containing the tetracycline resistance gene and its promoter Tc Consider the following points before performing the priming and first strand reactions e We recommend using no more than 5 ug of starting mRNA for the first strand synthesis reaction e Both the amount of DEPC treated water used to dilute your mRNA and the total volume of your reactions w
78. ollowing materials on hand before beginning Supplied with kit e cDNA Size Fractionation Columns e Glycogen 20 ug ul Supplied by user e Ice bucket e Thermocycler recommended or water bath heated to 70 C e TEN buffer 10 mM Tris HCl pH 7 5 0 1 mM EDTA 25 mM NaCl e Scintillation vials e Scintillation counter e 100 ethanol e 75M NH4 OAc ammonium acetate e Dry ice or 80 C freezer e 70 ethanol e TE buffer 10 mM Tris HCl pH 8 0 1 mM EDTA 1 Incubate the tube from step 2 page 23 at 70 C for 10 minutes to inactivate the ligase 2 Place the tube on ice continued on next page Size Fractionating Radiolabeled cDNA by Column Chromatography continued Setting Up the Column Washing the Column Important Collecting Fractions Keep the following points in mind when setting up a fractionation column e Anchor the column securely in a support stand e Place a rack containing 1 5 ml tubes below the column e The outlet of the column should be 1 to 2 cm above the 1 5 ml tubes e You will need to be able to freely move the rack under the column cDNA size fractionation columns are packed in 2076 ethanol which must be completely removed before adding your cDNA sample Follow the steps below to remove the ethanol from the columns The washing steps will take approximately 1 hour 1 Withthe column attached to a support stand remove the top cap first followed by the bottom cap Allow the ethanol to drain c
79. ompletely by gravity 2 Oncethe column stops dripping pipette 0 8 ml of TEN buffer into the column and let it drain completely Refer to the important note below for column specifications 3 Repeatthe wash step three more times for a total of four washes and 3 2 ml of TEN buffer Let the column drain until dry Proceed to Collecting Fractions below If the flow rate is noticeably slower than 30 40 seconds per drop do not use the column If the drop size from the column is not approximately 25 to 35 ul do not use the column The integrity and resolution of the cDNA may be compromised if the column does not meet these specifications When collecting fractions we recommend wearing gloves that have been rinsed with ethanol to reduce static 1 Label 20 sterile 1 5 ml tubes from 1 to 20 Place them in a rack 1 to 2 cm from the bottom of the column with tube 1 under the outlet of the column 2 Add 100 ul of TEN buffer to the 50 ul heat inactivated cDNA adapter ligation reaction from step 1 previous page Mix gently by pipetting and centrifuge for 2 seconds to collect the sample 3 Add the entire sample to the column and let it drain into the resin bed Collect the effluent into tube 1 4 Move tube 2 under the column outlet and add 100 ul of TEN buffer to the column Collect the effluent into tube 2 Let the column drain completely Note It is important to make sure all of the effluent has drained from the column before adding
80. on hand before beginning Supplied with kit e 30 PEG Mg solution Supplied by user e S N A P MidiPrep Kit recommended Invitrogen Catalog no K1910 01 e LB media containing 50 pg ml kanamycin e TE buffer 10 mM Tris HCl pH 8 0 1 mM EDTA e Your cDNA library e Destination vector of choice 150 ng ul e LRClonase enzyme mix Invitrogen Catalog no 11791 019 e 5X LR Clonase Reaction Buffer supplied with LR Clonase enzyme mix e Ice bucket e Proteinase K 2 ug ul supplied with LR Clonase enzyme mix e Sterile water e Glycogen 20 ug ul e 75MNH OAc e 100 ethanol e Dry ice ora 80 C freezer e 70 ethanol e ElectroMAX DH10B T1 Phage Resistant Cells or equivalent Preparing Double You may prepare plasmid DNA from your cDNA library using your method of Stranded DNA choice We recommend using the S N A P MidiPrep Kit Catalog no K1910 01 Consider the following points when preparing your DNA e Inoculate 5 x 100 1 x 10 cfu of your cDNA library into 50 ml of LB containing 50 pg ml kanamycin e Grow the culture to an OD of 1 0 approximately 6 hours e Use TE buffer pH 8 0 to elute your DNA continued on next page 57 Performing the LR Library Transfer Reaction continued PEG Precipitation Determining the DNA Yield LR Library Transfer Reaction 58 After you have prepared plasmid DNA from your cDNA library precipitate the DNA using the 3076 PEG Mg solution provided with the kit
81. onase Reaction Buffer 4 ul 4ul 4ul TE Buffer pH 8 0 5 ul 7 ul 5 ul Total volume 14 ul 14 ul 14 ul continued on next page Performing the LR Library Transfer Reaction continued LR Library Transfer Reaction continued Ethanol Precipitation Transforming Competent E coli 2 Remove the LR Clonase enzyme mix from 80 C and thaw on ice 2 minutes 3 Vortex the LR Clonase enzyme mix briefly twice 2 seconds each time 4 Add 6 ul of LR Clonase enzyme mix to each sample Mix well by vortexing briefly twice 2 seconds each time Reminder Return LR Clonase enzyme mix to 80 C immediately after use 5 Incubate reactions at 25 C for 16 20 hours 6 Add 2 ul of the proteinase K solution to each reaction Incubate the reactions at 37 C for 15 minutes then at 75 C for 10 minutes 7 Proceed to Ethanol Precipitation below 1 To the LR reaction add reagents in the following order Be sure to use sterile water and not DEPC treated water Sterile water 80 pl Glycogen 20 ug pl 1 ul 7 5 M NH OAc 50 ul 100 ethanol 375 ul Note You may stop at this point and store the tube at 20 C overnight if necessary 2 Place tube in dry ice or at 80 C for 10 minutes Centrifuge the sample at 4 C for 25 minutes at 14 000 rpm 3 Carefully remove the supernatant trying not to disturb the pellet Add 150 ul of 70 ethanol 4 Centrifuge the sample at 4 C for 2 minutes at 14 000 rpm Carefully remove the supe
82. or all work areas equipment and yourself for radiation contamination e Follow all the radiation safety rules and guidelines mandated by your institution Any material in contact with a radioactive isotope must be disposed of properly This will include any reagents that are discarded during the cDNA library synthesis procedure e g phenol chloroform extraction ethanol precipitation cDNA size fractionation Contact your safety department for regulations regarding radioactive waste disposal Experimental Timeline Introduction Recommended Timeline NS RECO Nous I Optional Stopping Points TM The CloneMiner cDNA Library Construction Kit is designed to produce an entry library from your starting mRNA within three days It will take an additional two days to determine the titer and quality of the cDNA library Note that this manual is organized according to the recommended timeline below If you will not be following this timeline be sure to plan ahead for convenient stopping points see below for more information Isolate mRNA Synthesize First Strand V J Synthesize Second Strand nl Ligate attB1 Adapter a ee M Size Fractionate cDNA Analyze First Strand Radiolabeling Method r Day 1 Day 2 Perform the BP Recombination Reaction Prepare for Transformation Transform Competent Cells Xs en Perform
83. our calculations Refer to page 70 for sample results 3 Add together the insert sizes for all clones Divide this number by the number of clones containing inserts to calculate the average insert size for your cDNA library 4 Divide the number of clones containing inserts by the number of clones analyzed to determine the percent recombinants You should see an average insert size of 21 5 kb and at least 95 recombinants for your cDNA library If the average insert size or percent recombinants of your library clones is significantly lower the cDNA going into the BP recombination reaction is either of poor quality or is insufficient in quantity For guidelines on isolating quality mRNA see page 10 To troubleshoot any of the cDNA synthesis steps see Troubleshooting page 61 If you wish to sequence entry clones proceed to Sequencing Entry Clones next page You may screen your cDNA library to identify a specific entry clone and use this entry clone in an LR recombination reaction with a destination vector to generate an expression clone Refer to the Gateway Technology manual to perform an LR recombination reaction using a single entry clone Alternatively you may transfer your cDNA library into a destination vector to generate an expression library for functional analysis For detailed guidelines refer to Performing the LR Library Transfer Reaction page 57 Sequencing Entry Clones Introduction Sequencing Primers
84. pped tube directly into a scintillation vial Do not add scintillation fluid Obtain Cerenkov counts for each tube and record this value in column C Cerenkov counts will appear above background after approximately 300 ul of total volume corresponding to fraction 5 in the sample worksheet page 67 1 For each fraction in which the Cerenkov counts exceed background calculate the cDNA yield Refer to Calculating the Double Strand cDNA Yield below Record this value in column D 2 Divide each cDNA amount in column D by the fraction volume in column A to determine the cDNA concentration for that fraction Record this value in column E Cerenkov counts are approximately 50 of the radioactivity that would be measured in scintillant Use the specific activity SA determined from the first cDNA Yield strand reaction sample and the equation below to calculate the yield of double stranded cDNA Refer to page 68 for a sample calculation Amountotde DNA E Cerenkov cpm x 2x 4 pmol dNTP pmol dCTP x 1 000ng ug ds cDNA 28 SA cpm pmol dCTP x 1 515pmol dNTP ug ds cDNA _ Cerenkov cpm x 8 SAx 1 515 continued on next page Size Fractionating Radiolabeled cDNA by Column Chromatography continued Required cDNA Yield Selecting and Pooling cDNA Fractions Ethanol Precipitation You will need a final cDNA yield of at least 30 ng to perform the BP recombination reaction Because you will lose approximately
85. r x 200 SA x 3030 In the above equation the numerator takes into account that 1 20 of the first strand reaction was removed for analysis The numerator also takes into account that 10 ul of the 25 ul analysis sample was spotted on the washed filter Calculating the Use the cDNA yield to calculate the percent incorporation of o P dCTP using Percent the equation below Refer to page 66 for a sample calculation Incorporation of DNA yield a P dCTP Percent Incorporation PEN NEN cL t 100 starting mRNA amount ug What You Should The percent incorporation gives an estimate of the cDNA quality and reflects the See quality of the starting mRNA A first strand reaction demonstrating 20 50 incorporation of a P dCTP will give a library with larger clones on average than a library with 10 20 incorporation If the first strand reaction shows an incorporation of 1076 or less your library will yield clones that are well below average in size and that are not highly representative of your starting mRNA For these reasons we recommend that you do not continue with your cDNA library construction if your first strand reaction shows less than 10 incorporation of a P dCTP Start again with higher quality mRNA If you would like to improve your percent incorporation of labeled dCTP see the Troubleshooting Guide page 61 22 Ligating the attB1 Adapter Introduction Before Starting Protocol Follow the guidelines
86. r and the equation below to determine the total number of colony forming units Total CFU cfu average titer cfu ml x total volume of cDNA library ml Note If you completed 6 electroporations for your cDNA library the total volume will be 12 ml For the controls you will need to extrapolate the total number of colony forming units using a total volume of 12 ml In general a well represented library should contain 5 x 106 to 1 x 107 primary clones If the number of primary clones is considerably lower for your cDNA library see Troubleshooting page 61 See the table below for expected titers and expected total colony forming units for the control reactions Control Expected Titer Expected Expected Total Volume CFUs 2 3 kb RNA control 2 1x 106 cfu ml 12 ml 21x10 cfu BP positive control 2 1x 10 cfu ml 12ml 21x10 cfu BP negative control lt 0 3 of BP 12ml S 0 3 of BP positive control positive control pUC1 control 21 x 10 cfu ug DNA Qualifying the cDNA Library Introduction General Molecular Biology Techniques Before Starting Analyzing Transformants by BsrG Digestion Restriction Digest It is important to qualify the cDNA library to determine the success of your cDNA library construction Determining the average insert size and percentage of recombinants will give you an idea of the representation of your cDNA library For help with restrictio
87. rnatant Repeat the 70 ethanol wash Remove as much of the remaining ethanol as possible 5 Dry the DNA pellet in a SpeedVac for 2 3 minutes or at room temperature for 5 10 minutes 6 Resuspend the DNA pellet in 9 ul of TE buffer by pipetting up and down 30 40 times You may use any recA endA E coli strain including TOP10 DH5a DH10B or equivalent for transformation Do not transform the LR reaction mixture into E coli strains that contain the F episome e g TOP10F These strains contain the ccdA gene and will prevent negative selection with the ccdB gene We recommend using ElectroMAX DH10B T1 Phage Resistant Cells for TM TM maximum transformation efficiency If you will be using ElectroMAX DH10B T1 Phage Resistant cells follow the guidelines outlined in the section entitled Transforming Competent Cells page 34 continued on next page 59 Performing the LR Library Transfer Reaction continued Analyzing the Follow the guidelines outlined in the section entitled Analyzing the cDNA Expression Library page 41 to determine the titer average insert size and percent Library recombinants of your expression library We recommend that you e Analyze transformants by digesting with BsrG I which cuts within both attB sites of the expression library as well as within the attR sites and ccdB gene for non recombined destination vectors e Digest and electrophorese your destination vector with no insert
88. s Gateway Two recombination reactions constitute the basis of the Gateway Technology Recombination By using the CloneMiner cDNA Library Construction Kit you can take Reactions advantage of these two reactions to clone and shuttle your cDNA library into a destination vector of choice e BP Reaction Facilitates recombination of attB flanked cDNA with an attP containing vector pDONR 222 to create an attL containing entry library TM see diagram below This reaction is catalyzed by BP Clonase enzyme mix attB1 attB2 attP1 attP2 attL1 attL2 att R1 att R2 DECR D Gamo attB flanked cDNA pDONR 222 entry clone by product or entry library e LR Reaction Facilitates recombination of an attL entry clone or entry library with an attR substrate destination vector to create an attB containing expression clone or expression library see diagram below This reaction is catalyzed by LR Clonase enzyme mix attL1 attL2 attR1 attR2 attB1 attB2 attP1 attP2 entry clone destination expression clone or entry library vector or expression library LR Clonase by product Choosing a Library Construction Method Introduction Radiolabeling vs Non Radiolabeling There are several ways to construct your cDNA library using the CloneMiner cDNA Library Construction Kit You will need to decide between e Radiolabeling or not radiolabeling your cDNA e Size fract
89. s 11 Proceed to Performing the Plating Assay page 40 N 1 If you experience arcing during transformation try one of the following SAMEND 7 3 a e Make sure the contents are distributed evenly in the cuvette and there are no P bubbles e Reduce the voltage normally used to charge your electroporator by 10 e Make sure to ethanol precipitate the BP reaction prior to electroporation to reduce the salt concentration e Dilute the 1 5 ul aliquots with water and divide the sample in two Electroporate extra samples of competent cells Make sure that you have enough ElectroMAX DHI1OB Cells to perform this troubleshooting step see page xi for ordering information 39 Performing the Plating Assay Before Starting Plating Assay You should have the following materials on hand before beginning Supplied by user cDNA library and control aliquots e S O C medium Invitrogen Catalog no 15544 034 e LB plates containing 50 ug ml kanamycin six for each cDNA library and BP reaction controls warm at 37 C for 30 minutes e LB plates containing 100 ug ml ampicillin two for pUC19 control warm at 37 C for 30 minutes 1 Serially dilute your sample aliquots with S O C medium according to the table below For each 1 10 serial dilution add 100 ul of the sample to 900 ul of S O C medium 2 You will be plating your serial dilutions in duplicate You will need six prewarmed LB plates containing 50 ug m
90. s substituting DEPC treated water for o P dCTP For more information Method on the advantages and disadvantages of constructing a non radiolabeled library see page 5 Before Starting You should have the following materials on hand before beginning Keep all reagents on ice until needed Supplied with kit e 23kb RNA control 0 5 ug l optional e DEPC treated water e Biotin atfB2 Oligo dT Primer 30 pmol l e 10mM each dNTPs e 5X First Strand Buffer e O1MDTT e SuperScript II RT 200 U l Supplied by user e High quality mRNA up to 5 ug e Thermocycler recommended or water bath heated to 65 C e Ice bucket e a P dCTP diluted to 1 uCi ul radiolabeling method only e Thermocycler recommended or water bath heated to 45 C e 20mM EDTA pH 8 0 radiolabeling method only continued on next page 15 Synthesizing the First Strand continued Diluting Your In a PCR tube or 1 5 ml tube dilute your starting mRNA with DEPC treated water Starting mRNA according to the table below The total volume for your mRNA DEPC treated water will vary depending on the amount of starting mRNA If you will be using the 2 3 kb RNA control supplied with the kit add 5 ul of DEPC treated water to 4 ul of the control mRNA for a total volume of 9 ul and a final mRNA amount of 2 ug ug of starting mRNA Reagent lt 1 2 3 4 5 Control mRNA DEPC treated 10 ul 9 ul 8ul Zu 6gu Ou water 4 ul
91. sheet is provided below to demonstrate how to estimate by Column the yield of your non radiolabeled cDNA Samples were size fractionated by Chromatography column chromatography and cDNA yields were estimated using the plate spotting assay Refer to Labeling Plates page 55 to see how plates were labeled Note that samples are in the reverse order Serial dilutions of pEXP7 tet control DNA and column fractions 1 13 were spotted and stained with SYBR Gold as described on page 54 A B C D Fraction Total Volume Concentration Amount of Tube Volume ul pl of cDNA ng ul cDNA ng 1 151 151 2 85 236 3 34 270 4 36 306 5 36 342 0 5 18 6 34 376 4 136 7 35 411 8 280 8 36 447 10 360 9 36 483 10 33 516 11 136 552 12 36 588 13 36 624 14 36 15 36 16 35 17 36 18 36 19 36 20 36 continued on next page 71 Sample Size Fractionation with Non Radiolabeled cDNA continued Selecting and Fractions 5 6 and part of fraction 7 were pooled together for a total of 294 ng of Pooling Fractions cDNA see table below Fraction Pooled Volume Concentration of Amount of cDNA ul cDNA ng ul ng 36 0 5 18 34 4 136 17 5 8 140 Total Pooled cDNA ng 294 Estimating the After ethanol precipitating the pooled cDNA cDNA yield was estimated usin
92. sive preparation of reagents equipment and work area Requires minimal preparation of DNA standards and agarose plates for the plate spotting assay Lab Environment Need to work in designated areas dispose of radioactive waste monitor work area follow radioactive safety regulations Regular lab environment with no radioactive hazards or radioactive safety regulations Note Be sure to read the section entitled Advance Preparation page 12 to prepare any necessary reagents required for your method of choice If you will be using the radiolabeling method also read the section entitled Working with Radioactive Materials page 7 If you will be using the non radiolabeling method we recommend that you read the section entitled Performing the Plate Spotting Assay page 54 before beginning continued on next page 5 Choosing a Library Construction Method continued Choosing a Size Fractionation Method Column Chromatography Gel Electrophoresis Important Size fractionation generates cDNA that is free of adapters and other low molecular weight DNA Although we recommend size fractionating your cDNA by column chromatography you may also size fractionate your cDNA by gel electrophoresis Either method can be used with radiolabeled or non radiolabeled cDNA Refer to the guidelines outlined below and choose the method that best suits your needs Column chromatography is commonly used to s
93. termined using the counts for the unwashed filter and the equation below cpm unwashed filter 10 ul PA cpm Rode TE ee ceo mal dTP AT0 u 45998cpm 10 ul 200pmol dCTP 10 ul 230cpm pmol dCTP First Strand cDNA Yield The first strand cDNA yield was determined using the counts for the washed filter the calculated specific activity and the equation below cpm of washed filter x 254 10 ul x 20ul 1 ul x 4 pmol dNTP pmol dCTP DNA Yield ug I ug SA cpm pmol dCTP x 3030pmol dNTP ug cDNA _ cpm of washed filter x 50x 4 pmol dNTP pmol dCTP SA cpm pmol dCTP x 3030pmol dNTP ug cDNA cpm of washed filter x 200 SA x 3030 _ 2601x 200 230x 3030 0 746 ug cDNA continued on next page 65 Sample cDNA Library continued First Strand Percent Incorporation Analysis The percent incorporation of o P dCTP was determined using the calculated continued first strand cDNA yield and the equation below cDNA yield ug starting mRNA amount ug Percent Incorporation x 100 0 746ug cDNA 3 pg starting mRNA x 100 25 The results of the first strand analysis are summarized below Specific Activity 230 cpm pmol dCTP cDNA Yield 0 746 ug Percent Incorporation 25 Size Fractionation After attB1 adapter ligation the cDNA was size fractionated using column by Column chromatography The results are listed in the sample worksheet on the next page
94. tional cDNA synthesis reactions Tube A Fraction Volume p Total Volume p C Cerenkov Counts cpm D Amount of cDNA ng E Concentration of cDNA ng ul 10 11 12 13 14 15 16 17 18 19 20 75 Experimental Worksheet for the Non Radiolabeling Method Introduction 76 A worksheet is provided to help you with your record keeping and calculations Before you record any data we suggest you make several copies of this worksheet for use with additional cDNA synthesis reactions Tube A Fraction Volume ul B Total Volume ul C Concentration of cDNA ng ul D Amount of cDNA ng 10 11 12 13 14 15 16 17 18 19 20 Technical Service World Wide Web Contact Us Visit the Invitrogen website at www invitrogen com for e Technical resources including manuals vector maps and sequences application notes MSDSs FAQs formulations citations handbooks etc e Complete technical support contact information e Access to the Invitrogen Online Catalog Additional product information and special offers For more information or technical assistance call write fax or email Additional international offices are listed on our website ww
95. to determine the background BsrG I digestion pattern for your particular destination vector What You Should When starting with 25 x 10 cfu from your cDNA entry library you should See obtain 5 x 105 1 x 107 primary clones from one LR recombination reaction If the number of primary clones is considerably lower for your expression library you may perform additional LR recombination reactions using any remaining plasmid DNA from your entry library The average insert size and percentage of recombinants of your expression library should be maintained from your cDNA entry library 60 Troubleshooting Introduction The following table lists some potential problems and possible solutions that may help you troubleshoot various steps during cDNA library construction Note that the starting mRNA quality is a key factor that will affect the outcome of your results Problem Cause Solution Low cDNA yield or low incorporation of a P dCTP after first strand synthesis radiolabeling method only Insufficient starting mRNA Quantitate the mRNA by measuring the A2 if possible We recommend using 1 5 ug of starting mRNA Poorly prepared mRNA or degraded mRNA Follow the recommendations for mRNA isolation and working with mRNA see page 10 Old a P dCTP or a P dCTP not added Do not use a P dCTP that is more than 2 weeks old Use fresh o P dCTP See page 15 for guidelines on preparing
96. transformation efficiency 21 x 10 cfu ug DNA making them ideal for generating cDNA libraries Follow the guidelines below to prepare for the transformation procedure pUC19 plasmid is included to check the transformation efficiency of ElectroMAX DH10B T1 Phage Resistant Cells Transform 10 pg of pUC19 using the protocol on page 39 You should have the following materials on hand before beginning Supplied with kit e Proteinase K 2 ug ul e Glycogen 20 ug ul e pUC19 positive control 10 pg ul Supplied by user e BP recombination reactions from step 5 page 32 e Water bath heated to 37 C e Thermocycler or water bath heated to 75 C e Sterile water e 75M NH OAc ammonium acetate e 100 ethanol e Dry ice or a 80 C freezer e 70 ethanol e 15 ml snap cap tubes e g Falcon tubes e Ice bucket 1 To each BP reaction from step 5 page 32 add 2 ul of proteinase K to inactivate the BP Clonase enzyme mix 2 Incubate the reactions at 37 C for 15 minutes then at 75 C for 10 minutes continued on next page 35 Preparing for Transformation continued Ethanol Precipitation Preparing the Controls 36 To each tube add reagents in the following order Use sterile water Do not use the DEPC treated water provided with the kit Sterile water 90 ul Glycogen 20 ug ul 1g 7 5 M NHsOAc 50 ul 100 ethanol 375 ul If you performed a 20 ul BP reaction add 80 ul of sterile water to each tube a
97. ug ul 1u 7 5M NH4 OAc 80 ul 10096 ethanol 600 ul Note You may stop at this point and store the tube at 20 C overnight if necessary Place the tube in dry ice or at 80 C for 10 minutes Centrifuge the sample at 4 C for 25 minutes at 14 000 rpm Carefully remove the supernatant while trying not to disturb the cDNA pellet Add 150 ul of 70 ethanol Note If you are performing the radiolabeling method use a Geiger counter to monitor the supernatant for the presence of radioactivity The majority of the radioactivity should be in the pellet and not in the supernatant Centrifuge the sample at 4 C for 2 minutes at 14 000 rpm Carefully remove the supernatant Repeat the 70 ethanol wash Remove as much of the remaining ethanol as possible Dry the cDNA pellet in a SpeedVac for 2 3 minutes or at room temperature for 5 10 minutes Resuspend the pellet in 18 ul of DEPC treated water by pipetting up and down 30 40 times Centrifuge for 2 seconds to collect the sample Transfer the sample to a fresh tube and place on ice Note If you are performing the radiolabeling method use a Geiger counter to make sure you have resuspended and transferred all of the cDNA pellet The majority of the radioactivity should be associated with the sample and not with the old tube Proceed to Ligating the attB1 Adapter page 23 19 Analyzing the First Strand Reaction Introduction Before Starting Preparing Filters 20 This se
98. unt of cDNA Generally spots containing more than 50 ng of cDNA will appear equally stained under UV light DNA may be detected using ethidium bromide or SYBR Gold Nucleic Acid Gel Stain available from Molecular Probes Catalog no 511494 We recommend using SYBR Gold because it is 10 fold more sensitive than ethidium bromide for detecting DNA in electrophoretic gels Ethidium bromide staining requires preparing plates containing agarose plus ethidium bromide SYBR Gold staining requires preparing agarose only plates followed by staining the plate using a SYBR Gold solution Guidelines are provided in this section for both stains Supercoiled pEXP7 tet DNA is included with the kit as a positive control for the BP recombination reaction pEXP7 tet can also be used as a DNA standard for the plate spotting assay The concentration of your cDNA samples can be estimated by comparison under UV light to known quantities of pEXP7 tet DNA You will need two plates per library One plate will contain each of your fractions and another plate will contain cDNA samples that were pooled and ethanol precipitated You should have the following materials on hand before beginning Supplied with kit e pEXP7 tet control DNA 50 ng ul Supplied by user e Polystyrene petri dishes 100 x 15 mm e Ethidium bromide optional 10 mg ml e SYBR Gold Nucleic Acid Gel Stain recommended Molecular Probes Catalog no 511494 e 1 agarose in TA
99. urns and is harmful if swallowed or inhaled Add 227 ml of deionized water to a 500 g bottle of TCA 2 Cap the bottle tightly and invert the bottle slowly several times to dissolve the TCA thoroughly 3 Adda stir bar to the bottle and stir the solution until homogeneous No further volume adjustment is required 4 Storeatroom temperature for up to one year 1 Add 50 ml of 100 trichloroacetic acid to 950 ml of deionized water 2 Storeat room temperature for up to 3 months 60 S O C medium 40 glycerol 1 Combine 60 ml of S O C medium and 40 ml of glycerol and stir until solution is homogeneous Autoclave for 30 minutes on liquid cycle Store at room temperature for up to 1 month Sample cDNA Library Introduction In this section we provide a sample experiment to illustrate the cDNA library construction process This experiment starts with isolated mRNA and continues through construction and qualification of a radiolabeled cDNA library All steps were performed according to the protocols in this manual Starting mRNA 3 ug of high quality HeLa cell mRNA First Strand A sample of the first strand reaction was removed and analyzed to determine Analysis specific activity cDNA yield and percent incorporation of a P dCTP The unwashed and washed filters gave the following counts Counts per Minute cpm Unwashed Filter 45998 Washed Filter 2601 Specific Activity The specific activity was de
100. verview of The overall yield of the first strand reaction is calculated from the amount of Calculations acid precipitable radioactivity In order to perform this calculation you must first determine the specific activity of the radioisotope in the reaction You will be performing a series of calculations to determine e Specific activity SA of a P dCTP e Yield of first strand cDNA e Percent incorporation of a P dCTP Calculating the The specific activity is defined as the counts per minute cpm of an aliquot of Specific Activity the reaction divided by the quantity pmol of the same nucleotide in the aliquot The specific activity for o P dCTP used at 1 uCi ul is calculated using the equation below Refer to page 65 for a sample calculation cpm unwashed filter 10 ul SA cpm pmol dCTP 200pmol dCTP 10 ul cpm unwashed filter 200pmol dCTP continued on next page 21 Analyzing the First Strand Reaction continued Calculating the Use the specific activity and the acid precipitable radioactivity of the washed First Strand filter to calculate the cDNA yield using the equation below Refer to page 65 for a cDNA Yield sample calculation cpm of washed filter x 254 10 ul x 20ul 1 ul x 4 pmol dNTP pmol dCTP cDNA Yield ug SA cpm pmol dCTP x 3030pmol dNTP ug cDNA _ cpm of washed filter x 50x 4 pmol dNTP pmol dCTP SA cpm pmol dCTP x 3030pmol dNTP ug cDNA cpm of washed filte
101. w invitrogen com Corporate Headquarters Japanese Headquarters European Headquarters 5791 Van Allen Way LOOP X Bldg 6F Inchinnan Business Park Carlsbad CA 92008 USA 3 9 15 Kaigan 3 Fountain Drive Tel 1 760 603 7200 Minato ku Tokyo 108 0022 Paisley PA4 9RF UK Tel Toll Free 1 800 955 6288 Tel 81 3 5730 6509 Tel 44 0 141 814 6100 Fax 1 760 602 6500 Fax 81 3 5730 6519 Tech Fax 44 0 141 814 6117 E mail tech_support invitrogen com E mail jpinfo invitrogen com E mail eurotech invitrogen com MSDS Requests Material Safety Data Sheets MSDSs are available on our website at www invitrogen com msds Certificate of Analysis The Certificate of Analysis provides detailed quality control and product qualification information for each product Certificates of Analysis are available on our website Go to www invitrogen com support and search for the Certificate of Analysis by product lot number which is printed on the box continued on next page 77 Technical Service continued Limited Warranty 78 Invitrogen a part of Life Technologies Corporation is committed to providing our customers with high quality goods and services Our goal is to ensure that every customer is 100 satisfied with our products and our service If you should have any questions or concerns about an Invitrogen product or service contact our Technical Support Representatives All Invitrogen pro
102. who has a license from Life Technologies under the patents identified above to distribute such materials Transfer of such materials and or information to collaborators does not convey rights to practice any methods claimed in the foregoing patents or patent applications Commercial Purposes means any activity by a party for consideration and may include but is not limited to 1 use of the product or its components in manufacturing 2 use of the product or its com ponents to provide a service information or data 3 use of the product or its components for therapeutic diagnostic or prophylactic purposes or 4 resale of the product or its components whether or not such product or its components are resold for use in research Life Technologies Corporation will not assert a claim against the buyer of infringement of the above patents based upon the manufacture use or sale of a therapeutic clinical diagnostic vaccine or prophylactic product developed in research by the buyer in which this product or its components was employed provided that none of i this product ii any of its components or iii a method claim of the foregoing patents was used in the manufacture of such product Life Technologies Corporation will not assert a claim against the buyer of infringement of the above patents based upon the use of this product to manufacture a protein for sale provided that no method claim in the above patents was used in the manufacture of su
103. y cDNA concentration in sample is too high You will not be able to distinguish between spots containing more than 50 ng of cDNA Spot 0 5 ul of the sample or dilute an aliquot of the sample before spotting Samples are not properly spotted Make sure to not touch or pierce agarose with the pipette tip Allow spots to dry at room temperature before staining with SYBR Gold Plates stored incorrectly or plates too old Store agarose plates with ethidium bromide in the dark at 4 C Store plates for no longer than one month For best results use fresh plates Stain stored incorrectly or stain too old Store stain according to manufacturer s instructions When staining plates with SYBR Gold make sure to protect plate from light 63 Recipes 10 Trichloroacetic 100 trichloroacetic acid TCA see below Acid 1 Sodium Sodium pyrophosphate decahydrate Pyrophosphate 100 Trichloroacetic Acid 5 Trichloroacetic Acid Freezing Media 64 E O Ter ies Dissolve 10 g of sodium pyrophosphate in 750 ml of deionized water Add 100 ml of 100 trichloroacetic acid TCA Bring final volume to 1 L with deionized water Store at 4 C for up to 6 months This recipe is designed to hydrate one standard 500 g bottle of TCA crystals If you wish to hydrate a different size bottle of TCA adjust the volume sizes accordingly Use caution when handling TCA TCA causes severe b
104. y Proceed to page 47 Size Fractionation by Gel Electrophoresis Refer to the Web Appendix 24 Day 2 Size Fractionating cDNA by Column Chromatography and Performing the BP Recombination Reaction Size Fractionate cDNA Day 2 Perform the BP Recombination Reaction 25 Size Fractionating Radiolabeled cDNA by Column Chromatography Introduction How the Columns Work Important Before Starting Stopping the Ligation Reaction 26 Column chromatography optimizes size fractionation of the cDNA and makes the cloning of larger inserts more probable Follow instructions closely using the columns supplied with the kit to produce the highest quality library possible Use extreme caution when working with radioactive material Follow all federal and state regulations regarding radiation safety For general guidelines when working with radioactive material see page 7 Each column provided with the kit contains 1 ml of Sephacryl S 500 HR resin This porous resin traps residual adapters and or small cDNAs 500 bp and prevents them from contaminating the library Larger molecules bypass the resin and elute quickly while smaller molecules are retained within the resin and elute more slowly Thus earlier eluted fractions contain larger cDNA fragments than later fractions If you are constructing more than one cDNA library only add one cDNA adapter ligation reaction per column You should have the f

CloneMiner cDNA Library Construction Kit

Contents

Download Pdf Manuals

Related Search

Related Contents