Home

SeeGene_DEGKit 509KB May 19 2008 12:55:46 AM

image

Contents

1. PCR D Note A primer set consisting of one of the ten arbitrary ACPs in the kit and dT ACP2 should be used as the 5 and 3 primers in each PCR reaction 2 Place the tube in a preheated 94 thermal cycler Note It is important to preheat 94 C the thermal cycler before placing the tube in the thermal cycler Important 3 Immediately commence the PCR reaction using the following program Segment No of cycles Temperature Duration 1 1 94 C 5 min 2 1 50 C 3 min 3 1 72 1 min 4 40 94 C 40 sec 65 C 40 sec 72 C 40 sec 5 1 72 C 5 min Mote Note We recommend the GeneAmp PCR System 9700 of Applied Biosystems that has a heated lid 15 www seegene com 4 Electrophorese 2 3 ul of the PCR products on a 2 agarose gel containing EtBr D Note If the band intensity of the DEGs of your sample is very weak the intensity can be increased by raising the amount of starting material diluted first strand cDNA or the ACP primer concentration in the GeneFishing PCR 5 Extract the differentially expressed bands from the agarose gel amp Note The gel extraction kit e g QlAquick Gel extraction kit Qiagen cat No 28704 or the GENECLEAN II kit Q BlOgene cat No 1001 400 is recommended to extract the differentially expressed bands from the agarose gel 6 Clone the product into a TA cloning vector Note We suggest that you avoid re amplifying the extracted PCR product because using the same primer set in r
2. 2 2 2 Principle The GeneFishing DEG Premix Kits are designed to identify differentially expressed genes DEGs in two or more nucleic acid samples The designing of the kit specifically focused on overcoming the disadvantages and limitations of current gene expression profiling related methodologies such as the microarray and differential display techniques The GeneFishing DEG Premix Kits require the following three steps which consist of reverse transcription RT and a two stage PCR GeneFishing PCR see Figures 2 and 3 pages 4 and 7 respectively Step 1 RT is conducted using dT ACP1 to synthesize the first strand cDNAs from the samples The 3 end core portion of dT ACP1 consists of a hybridizing sequence that is complementary to the poly A region of mRNA transcripts This results in the first strand cDNA bearing the universal sequence of dT ACP1 at its 5 end Step 2 The first strand cDNA resulting from the first step is diluted and placed in a PCR tube with an arbitrary ACP and dT ACP2 The 3 end core portion 10 mer of the arbitrary ACP consists of a hybridizing sequence that is sufficiently complementary to a region on the first strand cDNAs A single PCR cycle 1 stage PCR is conducted under conditions that permit only the arbitrary ACP to anneal with its 3 end core to the first strand PCR These conditions do not allow the 3 end core portion of dT ACP2 to anneal to the first strand cDNA The result of the
3. end portions separated by a regulator which interact with the template in turn during a two stage PCR ACP Annealing Control Primer HEHHEHEENEEEN 3 Designation Function a Core sequence Anneal at the 1 PCR Stage targeting b Regulator Universal sequence c Universal sequence Anneal at the 2 PCR Stage Fig 1 ACP Structure www seegene com 2 The 3 end core which is designated as a in Figure 1 is the targeting portion that consists of a hybridizing sequence that is substantially complementary to a site on a nucleic acid template The 5 end portion designated as b in Figure 1 has a universal sequence The regulator bridging the core and universal sequences of the ACP designated as c in Figure 1 plays a key role in controlling the annealing of each portion to the template The ACP system requires a two stage PCR ACP M based PCR amplification to maximize the functions of each portion as follows 1 stage PCR to generate a specific PCR product During the 1 stage PCR the conditions are set such that the 3 end core portion of the ACP anneals to a specific site on the template The annealing of the regulator to the template is not favored under these conditions Consequently the regulator interrupts the annealing of the 5 end portion to the template thereby restricting the primer annealing portion to the 3 end The reaction equilibr
4. mix The master mix is proven to be stable for at least 3 months at 4 C 3 3 Reagents and Equipments to be Supplied by the User RNase free H20 Reverse transcriptase 2 mM dNTP RNase inhibitor Thermal cycler Micro centrifuge www seegene com 2 4 Protocol 4 1 Positive Control Experiments Please consider the following in prior to your experiments G If you are using GeneFishing DEG Premix kits for the first time please establish the GeneFishing PCR conditions with the positive control experiments Important The positive control experiments should be conducted using the control cDNAs as templates and a primer set of Control ACP and dT ACP2 provided in the kit according to the instructions in this protocol You can assume that the initial experiment conditions are set up when the pattern of the positive control displayed on the agarose gel is similar with the figure on the right Refer the instructions on page 15 3 ul 2 ul 1 ul 4 ul 10 ul 20 ul 13 Control cDNA Kidney or Liver Control ACP dT ACP2 10 uM Distilled water 2X SeeAmp ACP Master Mix Total volume www seegene com gt 5 x Liver 4 2 Protocol for GeneFishing DEG Premix Kits 4 2 1 Reverse Transcription 1 Add the following reagents to a RT tube on ice ul Total RNA 3 ug 2 ul 10 uM dT ACP1 ul RNase free water 9 5 ul Note Mix the reagents by tapping or pipetting Note In order
5. 1 stage PCR is the synthesis of second strand cDNA that bears the complementary sequence of the universal sequence of dT ACP1 on its 3 end and the universal sequence of the arbitrary ACP on its 5 end This step ensures that no artifacts and dT ACP2 dT ACP2 products are obtained www seegene com Step 3 The mixtures in the PCR tubes arising from step 2 are then subject to 2 stage PCR under high stringency conditions that allow both dI ACP2 and the arbitrary ACP to respectively anneal to the 3 and 5 ends of the arbitrary ACP primed second strand cDNA generated in step 2 These annealing events exclusively involve the universal sequences of the two primers since the 3 end of the second strand cDNA is complementary to the universal sequence of the arbitrary ACP while the 5 end is recognized by the universal sequence of dT ACP2 This results in the amplification of the targeted PCR products ONLY www seegene com 6 5 3 a dT ACP1 SSS Lt First strand cDNA synthesis 5 4 First strand cDNA is synthesized by RT using dT ACP 1 1 2 GeneFishing PCR gt dT ACP2 5 Arbitrary ACP dT ACP2 5 Arbitrary ACP 3 3 Electrophoresis of PCR products on an agarose gel First stage PCR for second strand cDNA synthesis Annealing is allowed at Tannea 50 C which is high enough to prevent the core of dT ACP2 from binding 3a 4 Only 10 mer core of arbitrary ACP is able to bin
6. Cat No K1021 K1026 Gene s Wave Seegene Innovation in Gene Discovery amp Molecular Diagnostics www seegene com Seegene s Product User manual V 5 1 Published Nov 2007 GeneFishing Kit O Seegene Table of Contents Notices to Customers 1 1 Product Warranty and Liability 1 1 2 Safety Warning and Precautions 1 1 3 Notice to Customers 1 Introduction 2 1 ACP Technology nnn 2 2 2 GeneFishing DEG Premix kits 2 2 1 Overview 4 2 2 2 Principle 9 2 2 3 Key Features 8 Components 3 1 List of Components 10 3 2 Storage Conditions 12 3 3 Reagents and Equipments to be Supplied by User 12 Protocol 4 1 Positive Control Experiments 13 4 2 Protocol for GeneFishing DEG Premix Kit 4 2 1 Reverse Transcription 14 4 2 2 GeneFishing PCR 15 5 Expected Results 17 6 Troubleshooting Guide 19 7 Or
7. R reaction generates a wide range of PCR products ranging from 150 bp to 2 kb which not only increases the chances of identifying DEGs and but also provides more significant sequence information for the prediction of gene function www seegene com 3 3 1 Components List of Components e dT ACP1 10 uM For Reverse Transcription 1 vial dT ACP1 5 CTGTGAATGCT GCGACTACGAT XXXXX T 18 3 e dT ACP2 10 uM For GeneFishing PCR 1 vial dT ACP2 5 CTGTGAATGCTGCGACTACGATXXXXX T 15 3 e Arbitrary ACPs 5 uM For GeneFishing PCR Cat No K1021 K1022 K1023 K1024 K1025 K1026 Arbitrary ACPs Arbitrary ACP Arbitrary ACP Arbitrary ACP Arbitrary ACP Arbitrary ACP Arbitrary ACP 1 21 41 61 81 101 Arbitrary ACP Arbitrary ACP Arbitrary ACP Arbitrary ACP Arbitrary ACP Arbitrary ACP 20 40 60 80 100 120 vial 20 20 20 20 20 20 Note All of the GeneFishing DEG Premix Kits K1021 K1026 contain 20 arbitrary ACPs The 3 end core portion of each arbitrary ACP consists of a 10 mer of randomly selected nucleotides while the 5 end consists of the universal sequence For example the 20 arbitrary ACPs enclosed in the K1021 have the following sequences www seegene com ACP1 5 GTCTACCAGGCATTCGCTTCATXXXXXGCCATCGACC 3 ACP2 5 GTCTACCAGGCATTCGCTTCATXXXXXAGGCGATGCC 3 ACP3 5 GTCTACCAGGCATTCGCTTCATXXXXXCCGGAGGATG 3 ACP4 5 GTCTACCAGGCATTCGCTTCATXXXXXGC
8. TGCTCGCG 3 ACP5 5 GTCTACCAGGCATTCGCTTCATXXXXXAGTGCGCTCG 3 ACP6 5 GTCTACCAGGCATTCGCTTCATXXXXXGGCCACATCG 3 ACP7 5 GTCTACCAGGCATTCGCTTCATXXXXXCTGCGGATCG 3 ACP8 5 GTCTACCAGGCATTCGCTTCATXXXXXGGTCACGGAG 3 ACP9 5 GTCTACCAGGCATTCGCTTCATXXXXXGATGCCGCTG 3 ACP 10 5 GTCTACCAGGCATTCGCTTCATXXXXXT GGTCGTGCC 3 ACP 11 5 GTCTACCAGGCATTCGCTTCATXXXXXCTGCAGGACC 3 ACP 12 5 GTCTACCAGGCATTCGCTTCATXXXXXACCGTGGACG 3 ACP13 5 GTCTACCAGGCATTCGCTTCATXXXXXGCTTCACCGC 3 ACP 14 5 GTCTACCAGGCATTCGCTTCATXXXXXGCAAGTCGGC 3 ACP 15 5 GTCTACCAGGCATTCGCTTCATXXXXXCCACCGTGTG 3 ACP 16 5 GTCTACCAGGCATTCGCTTCATXXXXXGT CGACGGTG 3 ACP 17 5 GTCTACCAGGCATTCGCTTCATXXXXXCAAGCCCACG 3 ACP 18 5 GTCTACCAGGCATTCGCTTCATXXXXXCGGAGCATCC 3 ACP 19 5 GTCTACCAGGCATTCGCTTCATXXXXXCTCTGCGAGC 3 ACP20 5 GTCTACCAGGCATTCGCTTCATXXXXXGACGTTGGCG 3 e Control cDNAs Kidney 10 ng ul 1 vial These control cDNAs were synthesized from total RNAs isolated from adult mouse kidney tissues e Control cDNAs Liver 10 ng ul 1 vial These control cDNAs were synthesized from total RNAs isolated from adult mouse liver tissues e Control ACP 5 uM For GeneFishing PCR 1 vial e 2X SeeAmp ACP Master Mix 280 rxns 4 vials www seegene com 3 2 Storage Conditions In case of the SeeAmp ACP master mix 4 C for short term storage and 20 C for long term storage are recommended Avoid repetitive thawing as it may decrease the activity of the master
9. d to the first strand cDNA with 8 10 base pair matches 3b Second strand cDNA is synthesized in only one cycle 4 Second stage PCR for amplifying the second strand cDNA 35 40 cycles of PCR are performed at Tannea 65 C which is stringent enough to prevent core sequences from annealing yet still permits the binding of universal sequences to each other Arbitrary ACP and dT ACP2 cannot anneal on the first strand cDNA at 65 C 5a The second strand cDNA is amplified by priming the Arbitrary ACP and dT ACP2 at 3 and 5 ends respectively 5b Only target PCR products are amplified 6 NO false positives Fig 3 Flow chart of cDNA synthesis and the GeneFishing PCR www seegene com 2 2 3 Key Features 1 No false positives GeneFishing DEG Premix Kits identify Differentially Expressed Genes DEGs and never fail upon confirmation by Northern blot analysis or RT PCR The problem of false positives has been a major remaining bottleneck for current DEG profiling methodologies such as the microarray and differential display technologies The lack of false positives allows the researcher to concentrate on authentic DEGs 2 No PAGE required as an agarose gel is sufficient The Annealing Control Primer ACP dramatically improves the specificity and sensitivity of PCR amplification and results in only specific PCR products In addition the GeneFishing Technology requires small amounts o
10. dering Information 21 www seegene com 1 1 1 2 1 3 Notices to Customers Product Warranty and Liability Seegene guarantees the performance of all products as described when they are used according to the instructions in this manual Any problem that occurs for reasons other than misuse should be reported to Seegene immediately This warranty limits our liability for product replacement Safety Warning and Precautions This product is limited to research use only It is not recommended or intended for the diagnosis of disease in humans or animals Do not use internally or externally in humans or animals Notice to Customers The PCR process is covered by patents owned by Hoffman La Roche Inc No license or immunity under any other patent is either expressed or implied by the sale of any Seegene product www seegene com 2 Introduction 2 1 ACP Technology The specificity with which a primer anneals to its target sequences is the most critical factor for successful target specific PCR amplification The principle of our ACP Technology patent pending focuses on an oligonucleotide primer that anneals with exquisite specificity to the intended template therefore allowing only the target products to be amplified The primer is denoted Annealing Control Primer ACP and it has a unique tripartite structure As shown in Figure 1 it has distinct 3 and 5
11. due to its poor band intensity we recommend you try the following procedures a Repeat the GeneFishing PCR 2 3 times employing the same arbitrary ACP dT ACP2 combination used original PCR Extract the DEG band in question from each in the gel and combine Directly clone the DEG band b Repeat the GeneFishing PCR using the arbitrary ACP dT ACP2 combination at a 2 3 times higher concentration This may increase the band intensity allowing the cloning of the DEG bands after gel extraction www seegene com 20 21 7 Ordering Information Cat No K1021 K1022 K1023 K1024 K1025 K1026 K1040 Cat No P1131 P1132 P1001 1120 E1010 Products Size GeneFishing DEG101 amp 102 Premix Kits 20 X 12 rxns GeneFishing DEG103 amp 104 Premix Kits 20 X 12 rxns GeneFishing DEG105 amp 106 Premix Kits 20 X 12 rxns GeneFishing DEG107 amp 108 Premix Kits 20 X 12 rxns GeneFishing DEG109 amp 110 Premix Kits 20 X 12 rxns GeneFishing DEG111 amp 112 Premix Kits 20 X 12 rxns GeneFishing DEG101 amp 112 Premix Kits Full package Products Description Size dT ACP1 Reverse Transcription 20 rxns dT ACP2 GeneFishing PCR 40 rxns Arbitrary ACPs GeneFishing PCR 40 rxns 2X SeeAmp ACP Master Mix 2X Master Mix 5 ml www seegene com www seegene com 22 23 www seegene com
12. e amplification may generate smearing or non specific products Even if the differentially expressed band of interest is faint the extracted DNA should be directly used for cloning into a TA cloning vector In this case we strongly recommend to use an efficient TA cloning system e g the Invitrogen TOPO TA Cloning Kit www seegene com 6 5 Expected Results Examples of GeneFishing DEG Premix Kits Applications Various experiments to compare differentially expressed genes DEGs in two or more RNA samples from different organisms were conducted with the ACPs of the GeneFishing Premix DEG Kits in accordance with the instructions given in this User Manual Below are examples of resulting data shown by agarose gel photographs These agarose gels show the typical results that are generated by such experiments Note that the number of PCR products can vary depending on the type of sample loaded A Mouse Conceptus Tissues E4 5 vs E11 5 vs E18 5 M A BC A B C A B C Lane Template A E4 5 B E11 5 0 E18 5 M 100 bp Ladder Lane Template A Normal B Tumor M 100 bp Ladder 17 www seegene com C Human Stomach Tissues Normal vs Tumor Lane Template A Normal B Tumor M 100 bp Ladder Fig 4 Agarose gel photographs indicating various DEGs obtained by using GeneFishing Technology A An agarose gel photograph showing DEGs obtained from E4 5 E11 5 and E18 5 mouse embryos by using five arbi
13. ed your reagents replace the reagents Fewer than usual bands in the sample while the cDNA experiment works lanes control a Check the integrity of your total RNA b The number of PCR products may fluctuate depending on the type of samples More bands may be obtained by decreasing the annealing temperature at the 1 stage PCR although it may increase the chance of obtaining false positives as well Bad resolution on agarose gel We recommend using 2 agarose gel and running the gel 12 X 14 cm until the bromophenol blue dye has migrated 6 cm from the well www seegene com Problems Comments Smearing only in experimental You may have problems with the RNA quality or the PCR reaction itself samples a Clean up your RNA samples by phenol chloroform extraction or use fresh RNA samples in the RT reaction b Check the integrity of the RNA by formaldehyde agarose gel electrophoresis c Confirm the integrity of the PCR reaction by using the control cDNAs d It is important to place the PCR reaction on ice immediately before samples are placed in the thermal cycler Minimum RNA When we performed RT using mouse conceptus total RNA to quantity required determine the lower limit of total RNA needed we found that reproducible results could be obtained when at least 250 ng of total RNA was used Cloning of weak DEG band If you failed to clone the extracted PCR product
14. f starting material The PCR products can be detected on standard ethidium bromide stained agarose gels and hence obviating the use of PAGE gels with the attendant issues in handling and use The bands shown on agarose gels by GeneFishing Technology are of adequate resolution to be detected by Northern blot analysis 3 No expensive detection methods The use of Radioactive fluorescent detection methods is limited in terms of its cost and risks Such expensive detection methods are additional drawbacks of current gene expression profiling methods Therefore the detection of PCR products by EtBr staining of agarose gels is a key benefit of the GeneFishing DEG Premix Kit 4 Guaranteed reproducibility The GeneFishing DEG Premix Kits provide highly reproducible PCR products time after time as all reagents are provided with the kit This ensures that variations caused by the use of old incompatible reagents are prevented www seegene com 0 5 No special skills required GeneFishing Technology is a robust PCR based technology and as such is simple to use 6 Speedy and cost effective The GeneFishing DEG Premix Kits enable researchers to identify authentic DEGs within 5 hrs and not to waste time on accessing false positives In contrast all other current DEG profiling methods require intensive downstream work and time to identify the authentic DEG candidates 7 Wide range of PCR products Each GeneFishing PC
15. ium in the 1 stage PCR lies more favorably towards the specific annealing of the 3 end portion sequence than the non specific annealing under this annealing temperature This results in an improvement of the primer annealing specificity Thus the effect of the regulator on the 5 and 3 end portions of the ACP is one of the key features of the ACP Technology 255 stage PCR to amplify the 1 PCR product The product generated by the annealing and extension of the 3 end portion sequence of the ACP in the 1 stage PCR is amplified in the 2 stage PCR which is conducted under high stringency conditions This prevents further annealing of the 3 end core portion of the ACP to the original template Instead only the sequences at the 3 and 5 ends of the 1 PCR product act as donors of priming sequences for the amplification This results in the amplification of only the target product with an amplification efficiency that is close to the theoretical optimum of a two fold increase of product for each PCR cycle www seegene com 2 2 GeneFishing DEG Premix Kit 2 2 1 Overview J Synthesize first strand cDNA by RT using dT ACP1 Amplify differentially expressed cDNAs by GeneFishing PCR with an arbitrary ACP and dT ACP2 Display DEGs on an agarose gel J 5 primer ACP1 ACP2 ACP3 ACP4 ACP5 3 primer dT ACP2 AB AB AB AB AB Fig 2 Overview of the GeneFishing DEG Premix Kits www seegene com 4
16. to identify differentially expressed bands between RNA samples it is important to add equal amount of RNA to each tube 2 3 4 CO NO 0 Incubate the tube at 80 C for 3 min Chill the tube on ice for 2 min and spin the tube briefly Add the following reagents to the tube from step 3 4 ul 5X RT buffer 5 ul 2 mM dNTP 0 5 ul RNase inhibitor 40 u ul 1 ul M MLV reverse transcriptase 200 u ul 20 ul Total volume Incubate the tube at 42 C for 90 min Heat the tube at 94 C for 2 min Chill the tube on ice for 2 min and spin the tube briefly Dilute the first strand cDNA by adding 80 ul of DNase free water Note Store all cDNA samples at 20 C until ready for use www seegene com 4 2 2 GeneFishing PCR 1 Add the following reagents to a PCR tube on ice 3 7 ul Diluted first strand cDNA 50 ng 2 ul 5 uM arbitrary ACP one of the arbitrary ACPs 1 ul 10 uM dT ACP2 ul Distilled water 10 ul 2X SeeAmp ACP Master Mix 20 ul Total volume D Note Depending on the samples different amounts of diluted first strand cDNA can be used as templates for GeneFishing PCR High amounts of the starting material the first strand cDNA results in perfect reproducibility and amplification of rare mRNAs It also permits the use of the ethidium bromide stained agarose gel to detect differentially expressed products We recommend using 3 5 ul of the diluted first strand cDNA as the template for the GeneFishing
17. trary ACPs B An agarose gel photograph showing DEGs obtained from normal human brain and astrocytic tumor tissues by using four arbitrary ACPs C An agarose gel photograph showing DEGs obtained from normal human stomach and stomach tumor tissues by using three arbitrary ACPs The DEGs are marked by white arrowheads M represents the molecular weight marker obtained by using the Forever 100 bp Ladder Personalizer Kit Seegene Cat No M0100 www seegene com 0 19 6 Troubleshooting Guide Problems Comments and suggestions No band You may have a problem with the RT or PCR reaction Please follow the instructions a Confirm the integrity of the PCR reaction by using our control cDNAs If several bands arise from the control cDNAs but not from your experimental samples you may have a problem with the RT reaction and or the RNA quality Make sure that Seegene s dT ACP1 was added to the RT reaction and check the integrity of the RNA samples by formaldehyde agarose gel electrophoresis b If there is no problem with the RT check the concentration of the first strand cDNA too little cDNA may cause no or poorly intense bands If this is the case add more cDNA When samples the pattern comparing you 6 same band Your RNA samples or PCR reagents may be contaminated a If your RNA samples are contaminated with chromosomal DNA treat your RNA with DNase b If PCR products have cross contaminat

Download Pdf Manuals

image

Related Search

Related Contents

Benutzerhandbuch WorkCentre 6505 Farb  MTS Operators' Manual - Deep Blue  FM Stereo FM-AM Tuner  Vol.42(2012年10月発行)  1241 WS4  BoConcept 600 Assembly Instruction  FICHA TECNICA 1. NOMBRE DEL MEDICAMENTO  Prima Donna Designs LPR 710 Washer/Dryer User Manual  PDT2A Pump - Allwest Underground  INTE GRA  

Copyright © All rights reserved.
Failed to retrieve file