Home

pLenti-TOPO - Thermo Fisher Scientific

1. Allows viral packaging but self inactivates the 5 LTR for biosafety purposes Dull et al 1998 The element also contains a polyadenylation signal for transcription termination and polyadenylation of mRNA in transduced cells SV40 polyadenylation signal Allows transcription termination and polyadenylation of mRNA bla promoter Allows expression of the ampicillin resistance gene Ampicillin resistance gene B lactamase Allows selection of the plasmid in E coli pUC origin Permits high copy replication and maintenance in E coli 33 Map of pLenti6 3 V5 GW lacZ Control Vector Map The map below shows the elements of the pLenti6 3 V5 GW lacZ vector pLenti6 3 V5 GW lacZ is a 8675 bp control vector expressing galactosidase and was generated using the Gateway LR recombination reaction between an Entry Clone containing the lacZ gene and pLenti6 3 V5 DEST galactosidase is expressed as a C terminal V5 fusion protein with a molecular weight of approximately 121 kDa For more information about the Gateway Cloning Technology and pLenti6 3 V5 DEST refer to the pLenti6 3 V5 DEST manual which is available for downloading from or web site www invitrogen com or contact Technical Support page 36 attB1 lacZ attB2 V5 epitope pLenti6 3 V5 GW lacZ 10822 bp Comments for pLenti6 3 V5 GW lacZ 10822 nucleotides RSV 5 LTR hybrid promoter bases 1 410 RSV promoter bases 1
2. e Determine the titer of your viral stock Note pLenti7 3 vectors do not contain an antibiotic selection marker and therefore do not generate antibiotic resistant clones Once you have produced a lentiviral stock with a suitable titer you use this stock to transduce your lentiviral construct into the mammalian cell line of choice You may assay for transient expression of your recombinant protein pLenti7 3 V5 TOPO or use Blasticidin to select for stably transduced cells pLenti6 3 V5 TOPO Before generating your stably transduced cell line we recommend that you generate a kill curve to determine the minimum concentration of Blasticidin required to kill your untransduced host cell line For guidelines to generate a kill curve refer to the ViraPower HiPerform Lentiviral Expression System manual For instructions to prepare and handle Blasticidin see Appendix page 24 21 Expression and Analysis Continued Transducing Mammalian Cells Detecting Recombinant Fusion Proteins Note Assay for p galactosidase Activity Important Spectral Properties of EmGFP Fluorescence 22 TM TM Refer to the ViraPower HiPerform Lentiviral Expression System manual for instructions and guidelines to e Transduce your lentiviral construct into the mammalian cell line of interest at the appropriate multiplicity of infection MOI e Generate stable cell lines using Blasticidin selection pLenti6 3 V5 TOPO v
3. reverse sequencing primer Primer Sequence Quantity CMV forward primer 5 CGCAAATGGGCGGTAGGCGTG 3 306 pmoles V5 C term reverse primer 5 ACCGAGGAGAGGGTTAGGGAT 3 305 pmoles Accessory Products Additional Products Products listed in this section may be used with the pLenti TOPO TA Cloning kits Many of the reagents supplied in the pLenti TOPO TA Cloning kits are also available separately from Invitrogen and are listed below For more information visit our web site at www invitrogen com or contact Technical Support page 36 Item Quantity Catalog no Taq DNA Polymerase Native 100 units 18038 018 500 units 18038 042 Taq DNA Polymerase Recombinant 100 units 10342 053 500 units 10342 020 Platinum Taq DNA Polymerase 100 units 10966 018 Platinum Taq DNA Polymerase High Fidelity 100 units 11304 011 PureLink HiPure Plasmid Midiprep Kit 25 reactions K2100 04 50 reactions K2100 05 PureLink HQ Mini Plasmid Purification Kit 100 reactions K2100 01 PureLink Quick Gel Extraction Kit 50 reactions K2100 12 ViraPower Promoterless Lentiviral Gateway 1 kit K5910 00 Expression System with MultiSite Gateway Technology ViraPower Promoterless Lentiviral Gateway 1 kit K591 10 Vector Kit with MultiSite Gateway Technology Vivid Colors pLenti6 3 V5 GW EmGFP 20 ug V370 06 Expression Control Vector PCR Optimizer Ki
4. www invitrogen com Corporate Headquarters Japanese Headquarters European Headquarters Invitrogen Corporation Invitrogen Japan Invitrogen Ltd 1600 Faraday Avenue LOOP X Bldg 6F Inchinnan Business Park Carlsbad CA 92008 USA 3 9 15 Kaigan 3 Fountain Drive Tel 1 760 603 7200 Minato ku Tokyo 108 0022 Paisley PA4 9RF UK Tel Toll Free 1 800 955 6288 Tel 81 3 5730 6509 Tel 44 0 141 814 6100 Fax 1 760 602 6500 Fax 81 3 5730 6519 Tech Fax 44 0 141 814 6117 E mail tech_support invitrogen com E mail E mail eurotech invitrogen com MSDS Certificate of Analysis Limited Warranty 36 jpinfo invitrogen com MSDSs Material Safety Data Sheets are available on our web site at www invitrogen com msds Product qualification is described in the Certificate of Analysis CofA available on our website by product lot number at www invitrogen com cofa Invitrogen is committed to providing our customers with high quality goods and services Our goal is to ensure that every customer is 100 satisfied with our products and our service If you should have any questions or concerns about an Invitrogen product or service contact our Technical Support Representatives Invitrogen warrants that all of its products will perform according to specifications stated on the certificate of analysis The company will replace free of charge any product that does not meet those specifications This warranty limits
5. 229 HIV 1 5 LTR bases 230 410 5 splice donor base 520 HIV 1 psi y packaging signal bases 521 565 HIV 1 Rev response element RRE bases 1075 1308 3 splice acceptor base 1655 3 splice acceptor base 1683 cPPT bases 1800 1922 CMV promoter bases 1934 2518 attB1 site bases 2567 2591 lacZ ORF bases 2606 5670 attB2 site bases 5682 5706 V5 epitope bases 5759 5800 WPRE bases 5819 6416 SV40 promoter bases 6427 6736 EM7 promoter bases 6791 6857 Blasticidin resistance gene bases 6858 7256 AU3 HIV 1 3 LTR bases 7342 7576 AUS bases 7342 7395 Truncated HIV 1 3 LTR bases 7396 7576 SV40 polyadenylation signal bases 7648 7779 bla promoter bases 8638 8736 Ampicillin bla resistance gene bases 8737 9587 pUC origin bases 9742 10415 continued on next page 34 Map of pLenti7 3 V5 GW lacZ Control Vector Map The map below shows the elements of the pLenti6 3 V5 GW lacZ vector pLenti6 3 V5 GW lacZ is a 11066 bp control vector expressing p galactosidase and was generated using the Gateway LR recombination reaction between an Entry Clone containing the lacZ gene and pLenti6 3 V5 DEST f galactosidase is expressed as a C terminal V5 fusion protein with a molecular weight of approximately 121 kDa For more information about the Gateway Cloning Technology and pLenti6 3 V5 DEST refer to the pLenti6 3 V5 DEST manual which is available for downloading from or web site www invitrogen com or cont
6. Annu Rev Biochem 67 509 544 Yamaguchi H Yamamoto C and Tanaka N 1965 Inhibition of Protein Synthesis by Blasticidin S I Studies with Cell free Systems from Bacterial and Mammalian Cells J Biochem Tokyo 57 667 677 Zhang G Gurtu V and Kain S 1996 An Enhanced Green Fluorescent Protein Allows Sensitive Detection of Gene Transfer in Mammalian Cells Biochem Biophys Res Comm 227 707 711 Zufferey R Dull T Mandel R J Bukovsky A Quiroz D Naldini L and Trono D 1998 Self inactivating lentivirus vector for safe and efficient in vivo gene delivery J Virol 72 9873 9880 2007 Invitrogen Corporation All rights reserved For research use only Not intended for any animal or human therapeutic or diagnostic use 43 invitrogen Corporate Headquarters Invitrogen Corporation 1600 Faraday Avenue Carlsbad CA 92008 T 1 760 603 7200 F 1 760 602 6500 E tech service invitrogen com For country specific contact information visit our web site at www invitrogen com
7. Competent E coli supplied with kit Additional information on optimizing the TOPO Cloning reaction for your needs can be found on page 9 Note The red or yellow color of the pLenti TOPO vector solution is normal and is used to visualize the solution Reagent Quantity Fresh PCR product 0 5 to 4 ul Salt Solution 1 pl Sterile Water add to a final volume of 5 ul pLenti TOPO vector 1ul Store all reagents at 20 C when finished Salt solution and water can be stored at room temperature or 4 C Mix reaction gently and incubate for 5 minutes at room temperature 21 23 C Note For most applications 5 minutes will yield plenty of colonies for analysis Depending on your needs the length of the TOPO Cloning reaction can be varied from 30 seconds to 30 minutes For routine subcloning of PCR products 30 seconds may be sufficient For large PCR products gt 1 kb or if you are TOPO Cloning a pool of PCR products increasing the reaction time will yield more colonies Place the reaction on ice and proceed to Transforming One Shot Stb13 Competent E coli next page Note You may store the TOPO Cloning reaction at 20 C overnight 11 Transforming One Shot StbI3 Competent E coli Introduction Important Materials Needed 12 Follow the instructions in this section to transform your TOPO Cloning reaction previous page into One Shot Stbl3 Chemically Competent E
8. GCC AAT TCT GCA GAT ATC CAG CAC GGAA PCR PRODUCT TTCC CGG TTA AGA CGT CTA TAG GTC GTG V5 epitope V5 C term reverse priming site Xho Apal Sful Ser Gly Gly Arg Ser Ser Leu Glu Gly Pro Arg Phe Glu Gly Lys Pro Ile Pro Asn Pro Leu Leu 2590 AGT GGC GGC CGC TCG AGT CTA GAG GGC CCG CGG TTC GAA GGT AAG CCT ATC CCT AAC CCT CTC CTC TCA CCG CCG GCG AGC TCA GAT CTC CCG GGC GCC AAG CTT CCA TTC GGA TAG GGA TTG GGA GAG GAG Gly Leu Asp Ser Thr Arg Thr Gly ww 2656 GGT CTC GAT TCT ACG CGT ACC GGT TAG TAA TGA CCA GAG CTA AGA TGC GCA TGG CCA ATC ATT ACT Continued on next page Designing PCR Primers Continued TOPO TA Cloning Site for pLenti7 3 V5 TOPO Restriction sites for pLenti7 3 V5 TOPO are labeled to indicate the actual cleavage site The vector is supplied supercoiled between base pair 2562 and 2563 This is the TOPO Cloning site Note The full sequence of the pLenti7 3 V5 TOPO vector K5325 20 may be downloaded from our web site www invitrogen com or requested from Technical Support see page 36 A map of pLenti7 3 V5 TOPO vector is provided on page 32 fi CAAT 1 CMV forward priming site TATA DU T 1 f 2379 TCGTAACAAC TCCGCCCCAT TGACGCAAAT GGGCGGTAGG CGTGTACGGT GGGAGGTCTA TATAAGCAGA GCTCGTTTAG Transcriptional start Gamh I Spe 2459 TGAACCGTCA GATCGCCTGG AGACGCCATC CACGCTGTTT TGACCTCCAT AGAAGACACC GACTCTAGAG GATCCACTAG 2562 Pstl Arg Ala Asn Ser Ala Asp Ile Gln His 2539 TCCAGT
9. Invitrogen Corporation s liability only to the cost of the product No warranty is granted for products beyond their listed expiration date No warranty is applicable unless all product components are stored in accordance with instructions Invitrogen reserves the right to select the method s used to analyze a product unless Invitrogen agrees to a specified method in writing prior to acceptance of the order Invitrogen makes every effort to ensure the accuracy of its publications but realizes that the occasional typographical or other error is inevitable Therefore Invitrogen makes no warranty of any kind regarding the contents of any publications or documentation If you discover an error in any of our publications please report it to our Technical Support Representatives Invitrogen assumes no responsibility or liability for any special incidental indirect or consequential loss or damage whatsoever The above limited warranty is sole and exclusive No other warranty is made whether expressed or implied including any warranty of merchantability or fitness for a particular purpose Purchaser Notification Introduction Limited Use Label License No 19 Gateway Cloning Products Use of the pLenti TOPO vectors is covered under a number of different licenses including those detailed below This product and its use is the subject of one or more of U S Patent Nos 5 888 732 6 143 557 6 171 861 6 270 969 and 6 277
10. Topoisomerase I from Vaccinia virus binds to duplex DNA at specific sites and cleaves the phosphodiester backbone after 5 CCCTT in one strand Shuman 1991 The energy from the broken phosphodiester backbone is conserved by formation of a covalent bond between the 3 phosphate of the cleaved strand and a tyrosyl residue Tyr 274 of topoisomerase I The phospho tyrosyl bond between the DNA and enzyme can subsequently be attacked by the 5 hydroxyl of the original cleaved strand reversing the reaction and releasing topoisomerase Shuman 1994 TOPO Cloning exploits this reaction to efficiently clone PCR products see below Topoisomerase o CCCTT PXAGGG GGGARN PCR Product TTCCC HO di Topoisomerase Once the PCR product is cloned into pLenti6 3 V5 TOPO or pLenti7 3 V5 TOPO and the transformants are analyzed for the correct orientation of the PCR product the plasmid is transfected into mammalian cells for expression The PCR product may be expressed as a fusion to the V5 epitope for detection and purification or by designing the 3 PCR primer with a stop codon the PCR product may be expressed as a native protein Continued on next page Overview Continued How Topoisomerase Works The ViraPower HiPerform Lentiviral Expression System CMV Promoter Topoisomerase I from Vaccinia virus binds to duplex DNA at specific sites and cleaves the phosphodiester backbone after 5 CCCTT in one stran
11. agarose gel electrophoresis A discrete 750 bp band should be visible Proceed to the Control TOPO Cloning Reactions next page Continued on next page 25 pLenti6 3 V5 TOPO TA Cloning Control Reactions Continued Control TOPO Cloning Reactions Analysis of Results Transformation Control 26 Using the control PCR product produced on the previous page and the pLenti V5 TOPO vector set up two 6 ul TOPO Cloning reactions as described below 1 Set up control TOPO Cloning reactions Reagent Vector Only Vector PCR Insert Sterile Water 4ul 3 pl Salt Solution 1 pl 1gl Control PCR Product 1gl pLenti6 3 V5 TOPO vector or 1gul 1 pl pLenti7 3 V5 TOPO Vector Incubate at room temperature for 5 minutes and place on ice Transform 2 ul of each reaction into separate vials of One Shot Stb13 Chemically Competent E coli page 12 Spread 10 50 ul of each transformation mix onto LB plates containing 50 100 pg ml ampicillin Be sure to plate two different volumes to ensure that at least one plate has well spaced colonies For plating small volumes add 20 pl of SOC to allow even spreading Incubate overnight at 37 C Hundreds of colonies from the vector PCR insert reaction should be produced Greater than 90 of these will be blue and contain the 750 bp insert pUC19 plasmid is included in each vector kit to check the transformation efficiency of the
12. coli supplied with kit The transformation efficiency of One Shot StbI3 Chemically Competent E coli is 2 1 x 10 cfu ug plasmid DNA TM For optimal results we recommend using Stb13 E coli for transformation as this strain is particularly well suited for use in cloning unstable DNA such as lentiviral DNA containing direct repeats Note Transformants containing unwanted recombinants are generally not obtained when Stbl3 E coli are used for transformation You will need following items e TOPO Cloning reaction previous page e LB Amp plates containing 100 ug ml Ampicillin two for each transformation warm at 37 C for 30 minutes before use e LB Medium if performing the pUC19 Control Transformation e 42 C water bath e 37 C shaking and non shaking incubator Materials supplied with kit e S O C Medium pre warmed to room temperature e OneShot Stbl3 Chemically Competent E coli one vial per transformation thaw on ice immediately before use e pUC19 positive control Optional to verify the transformation efficiency Continued on next page Transforming One Shot StbI3 Competent E coli continued One Shot StbI3 Transformation Procedure Use this procedure to transform the TOPO Cloning reaction into One Shot TM Stbl3 Chemically Competent E coli 1 TM Thaw on ice one vial of One Shot Stbl3 chemically competent cells for each transformation Add 2 to 3 pl of
13. is sufficient to perform 20 cotransfections in 10 cm plates TM To use the ViraPower Packaging Mix resuspend the contents of one tube 195 ug in 195 pl of sterile water to obtain a 1 ug ul stock Note ViraPower Packaging Mix is available separately from Invitrogen or as part of the ViraPower Lentiviral Support Kits page viii The human 293FT Cell Line is supplied with the ViraPower HiPerform Lentiviral Expression kits to facilitate optimal lentivirus production Naldini et al 1996 The 293FT Cell Line a derivative of the 293F Cell Line stably and constitutively expresses the SV40 large T antigen from pCMVSPORT6TA g neo and must be maintained in medium containing Geneticin page vii For more information about pCMVSPORT6T Ag neo and how to culture and maintain 293FT cells refer to the 293FT Cell Line manual This manual is supplied with the ViraPower HiPerform Lentiviral Expression kits and is also available by downloading from www invitrogen com or by contacting Technical Support page 36 Note The 293FT Cell Line is also available separately from Invitrogen page viii The health of your 293FT cells at the time of transfection has a critical effect on the success of lentivirus production Use of unhealthy cells will negatively affect the transfection efficiency resulting in production of a low titer lentiviral stock For optimal lentivirus production i e producing lentiviral stocks with the expe
14. pH 8 3 at 42 C 100 ul 500 mM KCl 25 mM MgCl 0 01 gelatin dNTP Mix 12 5 mM dATP 12 5 mM dCTP 10 pl 12 5 mM dGTP 12 5 mM dTTP neutralized at pH 8 0 in water Salt Solution 1 2 M NaCl 0 06 M MgCl 50 pl CMV Forward Primer 0 1 ug ul in TE Buffer 20 pl V5 C term Reverse Primer 0 1 pg pl in TE Buffer 20 pl Control PCR Template 0 05 ug pl in TE Buffer 10 pl Control PCR Primers 0 1 pg pl each in TE Buffer 10 ul pLenti6 3 V5 GW lacZ or 0 5 ug pl in TE Buffer 20 ul pLenti7 3 V5 GW lacZ expression control vector Sterile Water 1ml Continued on next page Kit Contents and Storage Continued One Shot StbI3 Chemically Competent E coli Genotype of StbI3 Cells Sequencing Primers vi Box 2 of the pLenti TOPO kits contains the One Shot Stb13 Chemically Competent E coli kit The contents concentration and quantity of each reagent are detailed below Store Box 2 at 80 C Reagent Composition Quantity S O C Medium 2 Tryptone 0 5 Yeast Extract 10 mM NaCl 2 5 mM KCl 10 mM MgCl 10 mM MgSO 20 mM glucose 6 ml Stbl3 Cells 21x 50 pl pUC19 Control DNA 10 pg pl in 5 mM Tris HCI 0 5 mM EDTA pH 8 50 ul F mcrB mrr hsdS20 rs ms recA13 supE44 ara 14 galK2 lacY1 proA2 rpsL20 Str xyl 5 leu mtl 1 Note This strain is end A14 The table below provides the sequence and pmoles of the CMV sequencing primer and the V5 C term
15. protein expression optional see page 19 Note Typical DNA yield should be 150 300 ug and the O D 260 280 ratio should be between 1 8 and 2 1 Maintaining the Once you have generated your expression clone maintain and propagate the Expression Clone plasmid in LB medium containing 100 pg ml ampicillin Addition of Blasticidin is not required 17 Expression and Analysis Introduction 18 Once you have obtained purified plasmid DNA of your pLenti TOPO expression construct you are ready to use Invitrogen s ViraPower HiPerform Lentiviral Expression System to produce a lentiviral stock which may then be used to transduce your mammalian cell line of choice to express your recombinant protein see experimental outline below Es cam Expression Construct ViraPower Packaging Mix 293FT Producer Cell Line Your Mammalian Cell Line of Interest promoter gene of interest V5 1 Generate the pLenti expression construct containing your gene of interest 2 Cotransfect the 293FT producer cell line with your pLenti expression construct and the optimized packaging mix 3 Harvest viral supernatant and determine the titer 4 Add the viral supernatant to your mammalian cell line of interest Select for stably transduced cells if desired 5 Assay for recombinant protein of interest Continued on next page Expression and Analysis Continued Verifying Expression of R
16. purification add Taq polymerase buffer dATP and 0 5 unit of Taq polymerase and incubate 10 15 minutes at 72 C Use 4 pl in the TOPO Cloning reaction Vent is a registered trademark of New England Biolabs 30 Map of pLenti6 3 V5 TOPO Map The map below shows the elements of the pLenti6 3 V5 TOPO vector For more information visit our web site at www invitrogen com or contact Technical Support page 35 Comments for pLenti6 3 V5 TOPO 7692 nucleotides RSV 5 LTR hybrid promoter bases 1 410 RSV promoter bases 1 229 HIV 1 5 LTR bases 230 410 HIV 1 psi y packaging signal bases 521 565 HIV 1 Rev response element RRE bases 1075 1308 cPPT bases 1800 1922 CMV promoter bases 1934 2518 TOPO cloning site bases 2557 2566 V5 epitope bases 2629 2670 WPRE bases 2689 3286 SV40 promoter bases 3297 3605 EM7 promoter bases 3660 3726 Blasticidin resistance gene bases 3727 4125 AU3 3 LTR bases 4211 4445 AUS bases 4211 4264 3 LTR bases 4265 4445 SV40 polyadenylation signal bases 4517 4648 bla promoter bases 5507 5605 Ampicillin b a resistance gene bases 5606 6466 pUC origin bases 6611 7284 continued on next page 31 Map of pLenti7 3 V5 TOPO Map The figure below summarizes the features of the pLenti7 3 V5 TOPO vector For more information visit our web site at www invitrogen com or contact Technical Support page 36 pLenti7 3 V5 TOPO Comments for pLenti7 3 V5 TOPO 79
17. synthesis of the luminescent protein GFP is often used as a molecular beacon because it requires no species specific cofactors for function and the fluorescence can be detected using fluorescence microscopy or other methods such as flow cytometry Modifications have been made to the wild type GFP to enhance its expression in mammalian systems These modifications include nucleic acid substitutions that correspond to the codon preference for mammalian use and mutations that increase the brightness of the fluorescence signal resulting in enhanced GFP Zhang et al 1996 Mutations have also arisen or have been introduced into GFP that further enhance and shift the spectral properties of GFP such that these proteins will emit fluorescent color variations reviewed in Tsien 1998 The Emerald GFP EmGFP is a variant of enhanced GFP The pLenti7 3 V5 TOPO vector contains EmGFP in the vector backbone to allow for rapid transient expression and determination of lentiviral titer within two days see Important page 22 The EmGFP variant has been described in a published review Tsien 1998 and the amino acid changes are summarized in the table below The mutations are represented by the single letter abbreviation for the amino acid in the consensus GFP sequence followed by the codon number and the single letter amino acid abbreviation for the substituted amino acid Fluorescent Protein GFP Mutations EmGFP S65T S724 N149K M1
18. to 400 mg gel into a sterile 1 5 ml polypropylene tube Divide gel slices exceeding 400 mg among additional tubes Add 30 ul GS1 for every 10 mg of gel e For gt 2 agarose gels use sterile 5 ml polypropylene tubes and add 60 ul GS1 for every 10 mg of gel 5 Incubate the tube at 50 C for 15 minutes Mix every 3 minutes to ensure gel dissolution After gel slice appears dissolved incubate for an additional 5 minutes 6 Preheat and aliquot of TE Buffer TE to 65 70 C Place a Quick Gel extraction Column into a Wash Tube Pipet the mixture from Step 5 above onto the column Use 1 column per 400 mg agarose 8 Centrifuge at 12 000 x g for 1 minute Discard the flow through Place the column back into the wash tube 9 Optional Add 500 ul GS1 to the column Incubate at room temperature for 1 minute Centrifuge at gt 12 000 x g for 1 minute Discard flow through Place the column back into the Wash Tube 10 Add 700 pl Wash Buffer W9 with ethanol add 96 100 ethanol to the Wash Buffer according to instructions on the label of the bottle to the column and incubate at room temperature for 5 minutes Centrifuge at gt 12 000 x g for 1 minute Discard flow through 11 Centrifuge the column at gt 12 000 x g for 1 minute to remove any residual buffer Place the column into a 1 5 ml Recovery Tube 12 Add 50 ul warm 65 70 C TE Buffer TE tp the cemter pf the cartridge Incubate at room temperature for 1 minute 13 Centrifuge at 212 000
19. to use to ensure that you obtain the best possible results If this is the first time you have TOPO Cloned perform control reactions parallel with your samples see page 21 for information on positive controls Experiments at Invitrogen demonstrate that inclusion of salt 200 mM NaCl 10 mM MgCl in the TOPO Cloning reaction increases the number of transformants 2 to 3 fold We have also observed that in the presence of salt incubation times of greater than 5 minutes can also increase the number of transformants This is in contrast to earlier experiments without salt where the number of transformants decreases as the incubation time increases beyond 5 minutes Inclusion of salt allows for longer incubation times because it prevents topoisomerase I from rebinding and potentially nicking the DNA after ligating the PCR product and dissociating from the DNA The result is more intact molecules leading to higher transformation efficiencies Because of the above results see Note we recommend adding salt to the TOPO Cloning reaction A stock salt solution is provided in the kit for this purpose For TOPO Cloning and transformation into One Shot Stbl3 Competent E coli adding sodium chloride and magnesium chloride to a final concentration of 200 mM NaCl 10 mM MgCl in the TOPO Cloning reaction increases the number of colonies over time A Salt Solution 1 2 M NaCl 0 06 M MgCl is provided to adjust the TOPO Cloni
20. using genomic DNA as a template Use the cycling parameters suitable for your primers and template Be sure to include a 7 to 30 minute extension at 72 C after the last cycle to ensure that all PCR products are full length and 3 adenylated DNA Template 10 100 ng 10X PCR Buffer 5ul 50 mM dNTPs 0 5 ul Primers 100 200 ng each Sterile water add to a final volume of 49 ul Tag Polymerase 1 unit ul lul Total Volume 50 ul 2 Check the PCR product by agarose gel electrophoresis You should see a single discrete band If you do not see a single band see Note below If you do not obtain a single discrete band from your PCR you may gel purify your fragment before performing TOPO Cloning see page 28 Take special care to avoid sources of nuclease contamination and long exposure to UV light Alternatively you may optimize your PCR to eliminate multiple bands and smearing Innis et al 1990 The PCR Optimizer Kit page vii from Invitrogen can help you optimize your PCR For additional information contact Technical Support page 36 TOPO Cloning Reaction Introduction Note Important Transforming Chemically Competent E coli Materials Needed 10 TOPO Cloning technology allows you to produce your PCR products ligate them into the pLenti TOPO vector and transform the recombinant vector into One Shot Stb13 Competent E coli in one day It is important to have everything you need set up and ready
21. with the pLenti TOPO expression construct into the 293FT producer cell line this optimized mixture of plasmids supplies the viral proteins in trans that are required to create viral particles TM e Transfection reagent for efficient delivery of the ViraPower Packaging Mix and the pLenti TOPO expression construct to 293FT cells We recommend TM using Lipofectamine 2000 Reagent for optimal transfection efficiency e Blasticidin for selection of stably transduced mammalian cells pLenti6 3 V5 TOPO vector only see the Appendix page 24 for more information e Optional Control lentiviral expression vector page 21 For more information about the 293FT Cell Line see the 293FT Cell Line manual For more information about the ViraPower Packaging Mix refer to the ViraPower HiPerform Lentiviral Expression System manual Both manuals are available for downloading from www invitrogen com or by contacting Technical Support page 33 Continued on next page 19 Expression and Analysis Continued ViraPower Packaging Mix 293FT Cell Line Additional Information 20 The pLP1 pLP2 pLP VSVG plasmids are provided in an optimized mixture to facilitate viral packaging of your pLenti expression vector following cotransfection into 293FT producer cells The amount of the packaging mix 195 ug and Lipofectamine 2000 transfection reagent 0 75 ml supplied in the ViraPower Lentiviral Expression kit
22. x g for 2 minutes The Recovery Tube contains the purified DNA Store the purified DNA at 20 C Discard the column 14 Use 4 pl of the purified DNA for the TOPO Cloning reaction Continued on next page Purifying PCR Products continued Low Melt Agarose If you prefer to use low melt agarose use the procedure below Please note that Method the gel purification will result in a dilution of your PCR product and a potential loss of cloning efficiency 1 Electrophorese as much as possible of your PCR reaction on a low melt agarose gel 0 8 to 1 276 in TAE buffer Visualize the band of interest and excise the band Place the gel slice in a microcentrifuge tube and incubate the tube at 65 C until the gel slice melts Place the tube at 37 C to keep the agarose melted Add 4 ul of the melted agarose containing your PCR product to the TOPO Cloning reaction as described on page 10 Incubate the TOPO Cloning reaction at 37 C for 5 to 10 minutes This is to keep the agarose melted Transform 2 to 4 pl directly into chemically competent One Shot TOP10 cells using the method on page 10 Please note that cloning efficiency may decrease with purification of the PCR Note product You may wish to optimize your PCR to produce a single band see Producing PCR Products page 9 29 Addition of 3 A Overhangs Post Amplification Introduction Direct cloning of DNA amplified by Vent or Pfu polymerases into TOPO T
23. 25 Purifying PCR Products teet epe ege ne ee erre e pei re I e pe ente pet erii res 28 Addition of 3 A Overhangs Post Amplification sssssssssseeeeeenenenennre tenete 30 Mapiof pLentio3 Vo TOPO ninsi n a ei snauslanespn edicion das uf btelei prede ta dus 31 MapofpLentz 3 V9 ORG S sta et a Ed o Agde EUM pum amet Mt aqu Mf 32 Features of pLenti6 3 V5 TOPO and pLenti7 3 V5 TOPO Vectors sssseeeeeeeee eee 33 Map of pLenti6 3 V5 GW lacZ Control Vector sese eene nnne nnne 34 Map of pLenti7 3 V5 GW lacZ Control Vector sese ee eene nnne 35 T chhicaliSupports 5n oeste iem aah sane deb i ed cada fie iori fest aah sd iret be i 36 Purchaser Notfication ome anionen Cd cana DUOC RU ieu PURO Rus 37 Referetices Joins Ou e E uide 42 Kit Contents and Storage Types of Kits This manual is supplied with the kits listed below Product Catalog no pLenti6 3 V5 TOPO TA Cloning Kit K5315 20 pLenti7 3 V5 TOPO TA Cloning Kit K5325 20 ViraPower HiPerform Lentiviral TOPO Expression Kit K5310 00 ViraPower HiPerform Lentiviral FastTiter TOPO K5320 00 Expression Kit Shipping and The pLenti TOPO TA Cloning Kits are shipped in two boxes Box 1 contains Storage the pLenti TOPO TA Cloning reagents and is shipped on dry ice Box 2 contains the One Shot Stbl3 Chemically Competent E coli kit and is shipped on dry ice Upon receipt store each box
24. 35 nucleotides RSV 5 LTR hybrid promoter bases 1 410 RSV promoter bases 1 229 HIV 1 5 LTR bases 230 410 HIV 1 psi w packaging signal bases 521 565 HIV 1 Rev response element RRE bases 1075 1308 cPPT bases 1801 1923 CMV promoter bases 1935 2519 TOPO cloning site bases 2558 2567 V5 epitope bases 2630 2671 WPRE bases 2690 3287 SV40 promoter bases 3298 3606 EmGFP bases 3665 4384 AU3 3 LTR bases 4455 4689 AU3 bases 4455 4508 3 LTR bases 4509 4689 SV40 polyadenylation signal bases 4761 4892 bla promoter bases 5751 5849 Ampicillin b a resistance gene bases 5850 6710 pUC origin bases 6855 7528 32 Features of pLenti6 3 V5 TOPO and pLenti7 3 V5 TOPO Vectors Features pLenti6 3 V5 TOPO and pLenti7 3 V5 TOPO vectors contain the following elements All features have been functionally tested and the vectors completely sequenced Feature Benefit Rous Sarcoma Virus RSV enhancer promoter Allows Tat independent production of viral mRNA Dull et al 1998 HIV 1 truncated 5 LTR Permits viral packaging and reverse transcription of the viral mRNA Luciw 1996 5 splice donor and 3 acceptors Enhances the biosafety of the vector by facilitating removal of the y packaging sequence and RRE such that expression of the gene of interest in the transduced host cell is no longer Rev dependent Dull et al 1998 HIV 1 psi v packaging signal Allows vira
25. 53T I167T Mutations listed are as described in the literature When examining the actual sequence the vector codon numbering starts at the first amino acid after the initiation methionine of the fluorescent protein so that mutations appear to be increased by one position For example the S65T mutation actually occurs in codon 66 of EmGFP Experimental Outline Experimental The flow chart below outlines the experimental steps necessary to clone and Outline express your blunt end PCR product Determine strategy for PCR Produce PCR product TOPO Cloning Reaction Mix together PCR product and pLenti V5 TOPO Incubate 5 minutes at room temperature Transform into One Shot Stbl3 E coli cells Select and analyze colonies Prepare purified plasmid for transfection Transfect mammalian cell line and test for expression of PCR product or proceed to produce lentivirus Methods Designing PCR Primers Designing Your PCR Primers Note TOPO TA Cloning Site for pLenti6 3 V5 TOPO Design of the PCR primers to clone your DNA sequences of interest is critical for expression pLenti6 3V5 TOPO and pLenti7 3 V5 TOPO are C terminal fusion vectors that do not contain an ATG initiation codon If there is no initiating ATG codon or optimal sequences for translation initiation Kozak sequences in the DNA to be amplified then these features need to be incorporated into your fo
26. 6 3 V5 TOPO Vector Only Blasticidin Blasticidin 5 HCl is a nucleoside antibiotic isolated from Streptomyces griseochromogenes which inhibits protein synthesis in both prokaryotic and eukaryotic cells Takeuchi et al 1958 Yamaguchi et al 1965 Resistance is conferred by expression of either one of two Blasticidin S deaminase genes bsd from Aspergillus terreus Kimura et al 1994 or bsr from Bacillus cereus Izumi et al 1991 These deaminases convert Blasticidin S to a non toxic deaminohydroxy derivative Izumi et al 1991 Molecular Weight The formula for Blasticidin S is Ci7H2sNsOs HCl and the molecular weight is Formula and 458 9 The diagram below shows the structure of Blasticidin Structure N HOOC o CH3 HCI Dr Y YYr Handling Always wear gloves mask goggles and protective clothing e g a laboratory Blasticidin coat when handling Blasticidin Weigh out Blasticidin and prepare solutions in a hood Preparing and Blasticidin may be obtained separately from Invitrogen page vii in 50 mg Storing Stock aliquots Blasticidin is soluble in water Sterile water is generally used to prepare Solutions stock solutions of 5 to 10 mg ml e Dissolve Blasticidin in sterile water and filter sterilize the solution e Aliquot in small volumes suitable for one time use see next to last point below and freeze at 20 C for long term storage or store at 4 C for short term storage e Aqueous stock soluti
27. 608 and or other pending U S and foreign patent applications owned by Invitrogen Corporation The purchase of this product conveys to the buyer the non transferable right to use the purchased amount of the product and components of the product in research conducted by the buyer whether the buyer is an academic or for profit entity The purchase of this product does not convey a license under any method claims in the foregoing patents or patent applications or to use this product with any recombination sites other than those purchased from Invitrogen Corporation or its authorized distributor The right to use methods claimed in the foregoing patents or patent applications with this product for research purposes only can only be acquired by the use of Clonase purchased from Invitrogen Corporation or its authorized distributors The buyer cannot modify the recombination sequence s contained in this product for any purpose The buyer cannot sell or otherwise transfer a this product b its components or c materials made by the employment of this product or its components to a third party or otherwise use this product or its components or materials made by the employment of this product or its components for Commercial Purposes The buyer may transfer information or materials made through the employment of this product to a scientific collaborator provided that such transfer is not for any Commercial Purpose and that such collaborator agrees in wri
28. 7200 Fax 760 602 6500 Continued on next page Purchaser Notification Continued Limited Use Label License No 109 Retroviral Helper Lines Limited Use Label License No 317 LentiVector amp Technology Retroviral helper cell lines are licensed from Wisconsin Alumni Research Foundation under U S Patents and corresponding patents and applications in other countries for internal research purposes only Use of these cell lines for Commercial Purposes requires a license from Life Technologies This product is licensed under U S Pat Nos 5 817 491 5 591 624 5 716 832 6 312 682 6 669 936 6 235 522 6 924 123 and foreign equivalents from Oxford BioMedica UK Ltd Oxford UK and is provided for use in academic and commercial in vitro and in vivo research for elucidating gene function and for validating potential gene products and pathways for drug discovery and development but excludes any use of LentiVector technology for creating transgenic birds for the purpose of producing useful or valuable proteins in the eggs of such transgenic birds the delivery of gene therapies and for commercial production of therapeutic diagnostic or other commercial products not in tended for research use where such products do not consist of or incorporate a lentiviral vector Information about licenses for commercial uses excluded under this license is available from Oxford BioMedica UK Ltd Medawar Centre Oxford Science Park
29. A Cloning vectors is often difficult because of very low cloning efficiencies These low efficiencies are caused by the lack of the terminal transferase activity associated with proofreading polymerases which adds the 3 A overhangs necessary for TA Cloning A simple method is provided below to clone these blunt ended fragments Before Starting You will need the following items e Taq polymerase e A heat block equilibrated to 72 C e Phenol chloroform optional e 3Msodium acetate optional e 100 ethanol optional e 80 ethanol optional e TE buffer optional Procedure This is just one method for adding 3 adenines Other protocols may be suitable 1 After amplification with Vent or Pfu polymerase place vials on ice and add 0 7 1 unit of Tag polymerase per tube Mix well It is not necessary to change the buffer Incubate at 72 C for 8 10 minutes do not cycle Place the vials on ice The DNA amplification product is now ready for ligation into pcDNA3 1 V5 His TOPO Note If you plan to store your sample s overnight before proceeding with TOPO Cloning you may want to extract your sample s with phenol chloroform to remove the polymerases After phenol chloroform extraction precipitate the DNA with ethanol and resuspend the DNA in TE buffer to the starting volume of the amplification reaction You may also gel purify your PCR product after amplification with Vent or Pfu Note see previous page After
30. GTGG TGGAATTGGC CCTT AAGG GCC AAT TCT GCA GAT ATC CAG CAC GGAA PCR PRODUCT TTCC CGG TTA AGA CGT CTA TAG GTC GTG V5 epitope V5 C term reverse priming site Xho Apal Sful I I f Ser Gly Gly Arg Ser Ser Leu Glu Gly Pro Arg Phe Glu Gly Lys Pro Ile Pro Asn Pro Leu Leu 2591 AGT GGC GGC CGC TCG AGT CTA GAG GGC CCG CGG TTC GAA GGT AAG CCT ATC CCT AAC CCT CTC CTC TCA CCG CCG GCG AGC TCA GAT CTC CCG GGC GCC AAG CTT CCA TTC GGA TAG GGA TTG GGA GAG GAG Gly Leu Asp Ser Thr Arg Thr Gly x 2657 GGT CTC GAT TCT ACG CGT ACC GGT TAG TAA TGA CCA GAG CTA AGA TGC GCA TGG CCA ATC ATT ACT Producing PCR Products Introduction Materials Needed Polymerase Mixtures Producing PCR Products Note Once you have decided on a PCR strategy and have synthesized the primers you are ready to produce your PCR product You will need the items e Platinum Taq DNA Polymerase High Fidelity page vii or equivalent e Thermocycler DNA template and primers for PCR product If you wish to use a mixture containing Tag polymerase and a proofreading polymerase we strongly recommend using Platinum Tag DNA Polymerase High Fidelity page vii If you use polymerase mixtures that do not have enough Tag polymerase or a proofreading polymerase only you can add 3 A overhangs using the method on page 30 1 Setup the following 50 ul PCR reaction Use less DNA if you are using plasmid DNA as a template and more DNA if you are
31. Invitrogen pLenti6 3 V5 TOPO and pLenti7 3 V5 TOPO TA Cloning Kits Five minute cloning of Taq polymerase amplified PCR products for high level expression in mammalian cells using the ViraPower HiPerform Lentiviral Expression Systems Catalog nos K5315 20 K5325 20 K5310 00 K5320 00 Version B 7 June 2010 A10291 Table of Contents KitContentsatid StOTage tss aestum egere tirare etidela esi Hirgeen demi o db aguda unas iv Accessory Products oer eee eee eg rete p edu rite ee eet ed Ere vii ierit p n 1 aul M 1 Experimental Outline 2 eee nete eei n HA e TU S Eee ERI tae e ees 6 uU 7 Designing PCR Primers emere eee ee eerte epe dte te tior tere a nda 7 Producing PCR Products hans eese aee de e eene 9 TOPO Cloning Reactlobhosseap atus teutnndns toledo b Hula la eus tO cd ida sut bt M I adn iaes 10 Transforming One Shot Stbl3 Competent E coli us code emp o tede dtu epe us 12 Analyzing Transformants ss eee senate teg in ete ette i EET e rentrer inen repete eee e 14 Pn 23 IRecipes iie edendis eratis ae ee rta n eee Messe dione niin dines 23 Blasticidin pLenti6 3 V5 TOPO Vector Only uates RO E A RSEN RN Dus 24 pLenti TOPO TA Cloning Control Reactions 25e pes pat ga o tpe RE RARI E petat d
32. One Shot StbI3 Chemically Competent E col 1 TM Transform one vial of One Shot Stb13 Chemically Competent E coli with 10 pg of pUC19 Plate 10 pl of the transformation mixture plus 20 ul SOC on LB plates containing 100 pg ml ampicillin Transformation efficiency gt 85 will contain the 750 bp insert Continued on next page pLenti6 3 V5 TOPO TA Cloning Control Reactions Continued Factors Affecting Cloning Efficiency Please note that lower transformation and or cloning efficiencies will result from the following variables Most of these are easily corrected but if you are cloning large inserts you may not obtain the expected 90 or more cloning efficiency Variable Solution pH gt 9 Check the pH of the PCR amplification reaction and adjust with 1 M Tris HCl pH 8 Incomplete extension during PCR Be sure to include a final extension step of 7 to 30 minutes during PCR Longer PCR products will need a longer extension time Cloning large inserts gt 3 kb Gel purify as described on page 28 Excess or overly dilute PCR product Reduce or concentrate the amount of PCR product Cloning blunt ended fragments Add 3 A overhangs by incubating with Taq polymerase page 30 PCR cloning artifacts false positives TOPO Cloning is very efficient for small fragments lt 100 bp present in certain PCR reactions Gel purify your PCR product page 28 PC
33. Oxford OX4 4GA UK enquiries oxfordbiomedica co uk or BioMedica Inc 11622 EI Camino Real 100 San Diego CA 92130 2049 USA LentiVector is a registered US and European Community trademark of Oxford BioMedica plc 39 Purchaser Notification Continued Limited Use Label License No 267 Mutant Green Fluorescent Products 40 This product and its use is the subject of one or more of U S Patent Nos 6 090 919 5 804 387 and 5 994 077 and foreign equivalents Continued on next page Purchaser Notification Continued Limited Use Label License No 308 WPRE Element in Lentiviral Vectors This product contains the Woodchuck Post transcriptional Regulatory Element WPRE which is the subject of intellectual property owned by The Salk Institute for Biological Studies and licensed to Invitrogen Corporation The purchase of this product conveys to the buyer the non transferable right to use the purchased amount of the product and components of the product in research conducted by the buyer whether the buyer is an academic or for profit entity The buyer cannot sell or otherwise transfer a this product b its components or c materials made using this product or its components to a third party or otherwise use this product or its components or materials made using this product or its components for Commercial Purposes The buyer may transfer information or materials made through the use of this product to a scientific colla
34. R product does not contain sufficient 3 A overhangs even though you used Tag polymerase Taq polymerase is less efficient at adding a nontemplate 3 A next to another A Taq is most efficient at adding a nontemplate 3 A next to a C You may have to redesign your primers so that they contain a 5 G instead of a 5 T Brownstein et al 1996 27 Purifying PCR Products Introduction PureLink Quick Gel Extraction Kit 28 Smearing multiple banding primer dimer artifacts or large PCR products gt 1 kb may necessitate gel purification If you intend to purify your PCR product be extremely careful to remove all sources of nuclease contamination There are many protocols to isolate DNA fragments or remove oligonucleotides Refer to Current Protocols in Molecular Biology Unit 2 6 Ausubel et al 1994 for the most common protocols Three simple protocols are provided below for your convenience The PureLink Quick Gel Extraction Kit page vii allows you to rapidly purify PCR products from regular agarose gels To use the PureLink Quick Gel Extraction Kit 1 Equilibrate a water bath or heat block to 50 C 2 Cutthe area of the gel containing the desired DNA fragment using a clean sharp blade Minimize the amount of surrounding agarose excised with the fragment 3 Weigh the gel slice 4 Add Gel Solubilization Buffer GS1 supplied with kit as follows e For lt 2 agarose gels place up
35. act Technical Support page 36 attB1 lacZ attB2 V5 epitope Qo pLenti7 3 V5 GW lacZ Comments for pLenti7 3 V5 GW lacZ 9630 nucleotides RSV 5 LTR hybrid promoter bases 1 410 RSV promoter bases 1 229 HIV 1 5 LTR bases 230 410 5 splice donor base 520 HIV 1 psi w packaging signal bases 521 565 HIV 1 Rev response element RRE bases 1075 1308 3 splice acceptor base 1656 3 splice acceptor base 1684 cPPT bases 1801 1923 CMV promoter bases 1935 2519 attB1 site bases 2568 2592 lacZ ORF bases 2608 5672 attB2 site bases 5684 5708 V5 epitope bases 5761 5802 WPRE bases 5821 6418 SV40 promoter bases 6429 6738 EmGFP bases 6796 7515 AU3 3 LTR bases 7586 7820 AU3 bases 7586 7639 3 LTR bases 7640 7820 SV40 polyadenylation signal bases 7892 8023 bla promoter bases 8882 8980 Ampicillin b a resistance gene bases 8981 9841 pUC origin bases 9986 10659 35 Technical Support Web Resources Visit the Invitrogen web site at www invitrogen com for e Technical resources including manuals vector maps and sequences application notes MSDSs FAQs formulations citations handbooks etc e Complete technical support contact information e Access to the Invitrogen Online Catalog e Additional product information and special offers Contact Us For more information or technical assistance call write fax or email Additional international offices are listed on our web site
36. as follows Component Shipping Store Box at Box 1 pLenti TOPO TA Cloning reagents Dry ice 20 C Box 2 One Shot Stbl3 Chemically Competent Cells Dry ice 80 C System The following table shows the components supplied with the ViraPower Components HiPerform Lentiviral TOPO Expression Kits For details on the system components refer to the ViraPower HiPerform Lentiviral System manuals Catalog no Components K5315 20 K5325 00 K5310 00 K5320 00 pLenti6 3 V5 TOPO TA Cloning Kit Y Y pLenti7 3 V5 TOPO TA Cloning Kit Y Y One Shot Stb13 Chemically Competent E coli Y Y Y Y ViraPower Lentiviral Support Kit Y Y 293FT Cell Line Y Y Blasticidin Y Continued on next page Kit Contents and Storage Continued TOPO TA Cloning Reagents Box 1 of the pLenti TOPO kits contains the TOPO TA Cloning Reagents The contents concentration and quantity of each reagent are detailed below Store Box 1 at 20 C Note Taq polymerase is available separately from Invitrogen page vii and must be supplied by the user Reagent Concentration Quantity pLenti6 3 V5 TOPO Vector 5 10 ng ul plasmid DNA in 20 ul Mm 50 glycerol pLenti7 3 V5 TOPO j 5 supplied linearized in 50 mM Tris HCl pH 7 4 at 25 C solution 1 mM EDTA 2 mM DTT 0 1 Triton X 100 100 pg ml BSA 30 uM phenol red 10X PCR Buffer 100 mM Tris HCl
37. below or any other suitable protocol to determine the presence Transformants by and orientation of inserts and analyze positive transformants using PCR For PCR PCR primers use a primer such as the V5 C term Reverse primer that hybridizes in the vector downstream of your insert and a forward primer that hybridizes within your insert see below for sequence You will have to determine the amplification conditions If you are using this technique for the first time we recommend performing restriction analysis in parallel Artifacts may be obtained because of mispriming or contaminating template Materials Needed You will need the items e Platinum Tag DNA Polymerase High Fidelity page vii or equivalent DNA template and primers for PCR product e Thermocycler Procedure 1 Foreach reaction add the following components to a DNase RNase free microcentrifuge tube Total volume is 50 ul For multiple reactions prepare a master mix of common components to minimize reagent loss and enable accurate pipetting DNA Template 10 100 ng 10X PCR Buffer 5ul dNTP Mix 0 5 ul Primers 100 200 ng each Sterile water add to a final volume of 49 ul Tag Polymerase 1 unit ul lul Total Volume 50 ul 2 Pick 10 20 colonies that have been analyzed by restriction digest with Afl II and Xho I see previous page and resuspend them individually in 50 pl of the master mix containing PCR primers remember to make a patch plate to preserve the co
38. borator provided that such transfer is not for any Commercial Purpose and that such collaborator agrees in writing a not to transfer such materials to any third party and b to use such transferred materials and or information solely for research and not for Commercial Purposes Commercial Purposes means any activity by a party for consideration and may include but is not limited to 1 use of the product or its components in manufacturing 2 use of the product or its components to provide a service information or data 3 use of the product or its components for therapeutic diagnostic or prophylactic purposes and or 4 resale of the product or its components whether or not such product or its components are resold for use in research In addition any use of WPRE outside of this product or the product s authorized use requires a separate license from the Salk Institute Invitrogen will not assert a claim against the buyer of infringement of patents owned by Invitrogen and claiming this product based upon the manufacture use or sale of a therapeutic clinical diagnostic vaccine or prophylactic product developed in research by the buyer in which this product or its components was employed provided that neither this product nor any of its components was used in the manufacture of such product or for a Commercial Purpose If the purchaser is not willing to accept the limitations of this limited use statement Invitrogen is willing to accept
39. chnical Support page 36 Continued on next page Overview Continued Features of pLenti TOPO Vectors The pLenti TOPO vectors contain the following features Rous Sarcoma Virus RSV enhancer promoter for Tat independent production of viral mRNA in the producer cell line Dull et al 1998 Modified HIV 1 5 and 3 Long Terminal Repeats LTR for viral packaging and reverse transcription of the viral mRNA Dull et al 1998 Luciw 1996 Note The U3 region of the 3 LTR is deleted U3 and facilitates self inactivation of the 5 LTR after transduction to enhance the biosafety of the vector Dull et al 1998 HIV 1 psi V packaging sequence for viral packaging Luciw 1996 HIV Rev response element RRE for Rev dependent nuclear export of unspliced viral mRNA Kjems et al 1991 Malim et al 1989 Polypurine Tract from HIV cPPT for increased viral titer Park et al 2001 Human cytomegalovirus CMV immediate early enhancer promoter for high level constitutive expression of the gene of interest in a wide range of mammalian cells Andersson et al 1989 Boshart et al 1985 Nelson et al 1987 See below for more information TOPO Cloning site for rapid and efficient cloning of PCR products with A overhangs C terminal V5 epitope for detection of the recombinant protein of interest Southern et al 1991 Woodchuck Posttranscriptional Regulatory Element WPRE for increase transgene expression Zufferey et a
40. cted titers follow the guidelines below to culture 293FT cells before use in transfection e Ensure that cells are healthy and greater than 90 viable e Subculture and maintain cells in complete medium containing 0 1 mM MEM Non Essential Amino Acids 4 mM L Glutamine 1 mM sodium pyruvate 500 pg ml Geneticin and 10 fetal bovine serum that is not heat inactivated page vii e Do not allow cells to overgrow before passaging e Use cells that have been subcultured for less than 16 passages TM The 293FT Cell Line and the ViraPower Lentiviral Support Kits containing the ViraPower Packaging Mix Lipofectamine 2000 and selection agent are included with the ViraPower HiPerform Lentiviral TOPO Expression Kit and the ViraPower HiPerform Lentiviral FastTiter TOPO Expression Kit catalog nos K5310 00 and K5320 00 respectively These reagents are also available to order separately from Invitrogen see page viii Continued on next page Expression and Analysis Continued Positive Controls Propagating the Control Plasmids Producing Viral Stocks Determining Antibiotic Sensitivity A positive control vector is included with each pLenti TOPO vector for use as an expression control in the ViraPower HiPerform Lentiviral Expression System see table below In each vector f galactosidase is expressed as a C terminally tagged fusion protein that may be easily detected by western blot or functi
41. ctly in mammalian cell lines pLenti6 3 V5 TOPO 7691 bp and pLenti7 3 V5 TOPO 7935 bp expression vectors contain two new elements WPRE and cPPT to yield cell specific high performance results The WPRE Woodchuck Posttranscriptional Regulatory Element from the woodchuck hepatitis virus is placed directly downstream of the gene of interest allowing for increased transgene expression Zufferey et al 1998 with more cells expressing your gene of interest cPPT Polypurine Tract from the HIV 1 integrase gene increases the copy number of lentivirus integrating into the host genome Park 2001 and allows for a two fold increase in viral titer Both WPRE and cPPT together produce at least a four fold increase in protein expression in most cell types compared to other vectors that do not contain these elements The pLenti7 3 V5 TOPO vector kit Catalog no K5320 00 allows for an accurate determination of titer of functional lentivirus in just two days using Emerald Green Fluorescent Protein EmGFP TM TM For more information about the ViraPower HiPerform Lentiviral Expression Systems Catalog nos K5310 00and K5320 00 review the ViraPower HiPerform Lentiviral System manual This manual is included with the kits page iv and is also available for downloading from our web site at www invitrogen com For more information on TOPO Cloning Technology or the ViraPower HiPerform Systems visit our web site or contact Te
42. d Shuman 1991 The energy from the broken phosphodiester backbone is conserved by formation of a covalent bond between the 3 phosphate of the cleaved strand and a tyrosyl residue Tyr 274 of topoisomerase I The phospho tyrosyl bond between the DNA and enzyme can subsequently be attacked by the 5 hydroxyl of the original cleaved strand reversing the reaction and releasing topoisomerase Shuman 1994 TOPO Cloning exploits this reaction to efficiently clone PCR products The ViraPower HiPerform Lentiviral Expression System Catalog nos K5310 00 and K5320 00 facilitates highly efficient in vitro delivery of a target gene to dividing and non dividing mammalian cells using a replication incompetent lentivirus Based on the lentikat system developed by Cell Genesys Dull et al 1998 the ViraPower HiPerform Lentiviral Expression System possesses features which enhance its biosafety while allowing high level gene expression in a wider range of cell types than traditional retroviral systems To express your gene of interest in mammalian cells using the ViraPower HiPerform Lentiviral Expression System you will 1 Create an expression clone in either the pLenti6 3 V5 TOPO vector or the pLenti7 3 V5 TOPO 2 Cotransfect your expression clone and the ViraPower Packaging Mix into the 293FT Cell Line to produce lentivirus 3 Use your lentiviral stock to transduce the mammalian cell line of choice Assay for t
43. d of pLenti DNA with PureLink HQ Mini Plasmid Purification Kit is 5 7 ug which is lower than the average DNA yield using this purification kit 3 Perform restriction digests on plasmid DNA then analyze the digested DNA on 0 8 or 1 2 agarose gels to confirm the correct clones To confirm that no rearrangement in the LTR regions of the plasmid has taken place perform restriction digests using a combination of Afl II and Xho I Afl II sites are present in both LTRs The Xho I site is present in the plasmid backbone at the 3 end of the insert Assuming there are no Afl II or Xho I sites in the insert 3 DNA fragments are generated from the Afl II Xho I digest Any unexpected DNA fragments are a result of LTR recombination If Afl II and or Xho I sites are present in the insert you can use a restriction enzyme or a combination of enzymes that cut once in the vector and once in the insert The complete restriction enzyme maps of vectors are available at www invitrogen com Depending on the restriction sites you are using you should be able to determine the number and size of bands you should obtain from your digestion Agarose gel analysis should show the correct digestion pattern indicating proper recombination into the lentiviral vector Additional or unexpected bands indicate aberrant recombination of the lentiviral vector Continued on next page 15 Analyzing Transformants Continued Analyzing Use the protocol
44. ecombinant Protein optional Materials Needed Optional Before proceeding to generate a lentiviral stock of your pLenti TOPO expression construct you may verify that the construct expresses the gene of interest by transfecting the plasmid directly into mammalian cells and assaying for your recombinant protein if desired Follow the guidelines below e Use an easy to transfect dividing mammalian cell line e g HEK 293 or COS 7 e Use a transfection reagent that allows high efficiency transfection we recommend using Lipofectamine 2000 Reagent TM Note Lipofectamine 2000 is supplied with the ViraPower HiPerform Lentiviral TOPO Expression Kits but is also available separately from Invitrogen page vii e Follow the manufacturer s instructions for the transfection reagent you are using to perform plasmid transfection If you are using Lipofectamine 2000 follow the instructions included with the product To express your gene of interest from the pLenti TOPO construct using Invitrogen s ViraPower HiPerform Lentiviral TOPO Expression Kits Catalog nos K5310 00 and K5320 00 you will need the following reagents that are supplied with the Expression kits e 293FT Cell Line for producing maximized levels of virus Naldini et al 1996 This cell line is derived from 293F cells and stably expresses the SV40 large T antigen for enhanced virus production e ViraPower Packaging Mix When cotransfected
45. ector only To detect expression of your recombinant fusion protein you may perform e Western blot analysis using the Anti V5 Anti V5 HRP or Anti V5 AP antibodies available from Invitrogen or an antibody to your protein e Immunofluorescence using an Anti V5 FITC antibody e Functional analysis For more information about the Anti V5 antibodies visit www invitrogen com or call Technical Support page 36 The C terminal peptide containing the V5 epitope and the attB2 site will add approximately 4 5 kDa to the size of your protein The f galactosidase protein expressed from the pLenti6 3 V5 GW lacZ and pLenti7 3 V5 GW lacZ control lentiviral constructs is approximately 121 kDa in size You may assay for f galactosidase expression by western blot using cell free lysates Miller 1972 or by staining Invitrogen offers an anti P galactosidase 9 Gal Assay Kit and the Gal Staining Kit see page vii for ordering details of the above products for detection of galactosidase For detecting EmGFP in pLenti7 3 V5 TOPO we recommend using flow cytometry We do not recommend the use of fluorescence microscopy for detecting EmGFP in your cells from the pLenti7 3 vectors The pLenti7 3 vectors are designed with EmGFP in their vector backbone which allows for quick screens of transient expression in your cells and titering times of only 2 days While the quantity of cells expressing your gene of interest is significantly grea
46. ercial Purpose and that such collaborator agrees in writing a not to transfer such materials to any third party and b to use such transferred materials and or information solely for research and not for Commercial Purposes Commercial Purposes means any activity by a party for consideration and may include but is not limited to 1 use of the product or its components in manufacturing 2 use of the product or its components to provide a service information or data 3 use of the product or its components for therapeutic diagnostic or prophylactic purposes or 4 resale of the product or its components whether or not such product or its components are resold for use in research Invitrogen Corporation will not assert a claim against the buyer of infringement of the above patents based upon the manufacture use or sale of a therapeutic clinical diagnostic vaccine or prophylactic product developed in research by the buyer in which this product or its components was employed provided that neither this product nor any of its components was used in the manufacture of such product If the purchaser is not willing to accept the limitations of this limited use statement Invitrogen is willing to accept return of the product with a full refund For information on purchasing a license to this product for purposes other than research contact Licensing Department Invitrogen Corporation 1600 Faraday Avenue Carlsbad California 92008 Phone 760 603
47. esearch contact Licensing Department Invitrogen Corporation 1600 Faraday Avenue Carlsbad California 92008 Phone 760 603 7200 Fax 760 602 6500 The Lentiviral Technology based upon the lentikat system is exclusively licensed from Cell Genesys Inc under U S Patent Nos 5 686 279 5 834 256 5 858 740 5 994 136 6 013 516 6 051 427 6 165 782 and 6 218 187 and corresponding patents and applications in other countries for internal research purposes only Use of this technology for gene therapy applications or bioprocessing other than for non human research use requires a license from Cell Genesys Cell Genesys Inc 342 Lakeside Drive Foster City California 94404 The purchase of this product conveys to the buyer the non transferable right to use the purchased amount of the product and components of the product in research conducted by the buyer including non gene therapy research and target validation applications in laboratory animals whether the buyer is an academic or for profit entity The buyer cannot sell or otherwise transfer a this product b its components or c materials made using this product or its components to a third party or otherwise use this product or its components or materials made using this product or its components for Commercial Purposes The buyer may transfer information or materials made through the use of this product to a scientific collaborator provided that such transfer is not for any Comm
48. g patents was used in the manufacture of such product Invitrogen Corporation will not assert a claim against the buyer of infringement of the above patents based upon the use of this product to manufacture a protein for sale provided that no method claim in the above patents was used in the manufacture of such protein If the purchaser is not willing to accept the limitations of this limited use statement Invitrogen is willing to accept return of the product with a full refund For information on purchasing a license to use this product for purposes other than those permitted above contact Licensing Department Invitrogen Corporation 1600 Faraday Avenue Carlsbad California 92008 Phone 760 603 7200 Continued on next page 37 Purchaser Notification Continued Limited Use Label License No 27 RNA Transfection Limited Use Label License No 51 Blasticidin and the Blasticidin Selection Marker Limited Use Label License No 108 Lentiviral Technology 38 Use of this product in conjunction with methods for the introduction of RNA mo lecules into cells may require licenses to one or more patents or patent applications Users of these products should determine if any licenses are required Blasticidin and the blasticidin resistance gene bsd are the subject of U S Patent No 5 527 701 sold under patent license for research purposes only For information on purchasing a license to this product for purposes other than r
49. ian Cells Exp Cell Res 197 229 233 Kimura M Takatsuki A and Yamaguchi I 1994 Blasticidin 5 Deaminase Gene from Aspergillus terreus BSD A New Drug Resistance Gene for Transfection of Mammalian Cells Biochim Biophys ACTA 1219 653 659 Kjems J Brown M Chang D D and Sharp P A 1991 Structural Analysis of the Interaction Between the Human Immunodeficiency Virus Rev Protein and the Rev Response Element Proc Natl Acad Sci USA 88 683 687 Luciw P A 1996 in Fields Virology Fields B N Knipe D M Howley P M Chanock R M Melnick J L Monath T P Roizman B and Straus S E eds 3rd Ed pp 1881 1975 Lippincott Raven Publishers Philadelphia PA Malim M H Hauber J Le S Y Maizel J V and Cullen B R 1989 The HIV 1 Rev Trans activator Acts Through a Structured Target Sequence to Activate Nuclear Export of Unspliced Viral mRNA Nature 338 254 257 Miller J H 1972 Experiments in Molecular Genetics Cold Spring Harbor Laboratory Cold Spring Harbor New York Naldini L Blomer U Gage F H Trono D and Verma I M 1996 Efficient Transfer Integration and Sustained Long Term Expression of the Transgene in Adult Rat Brains Injected with a Lentiviral Vector Proc Natl Acad Sci USA 93 11382 11388 Nelson J A Reynolds Kohler C and Smith B A 1987 Negative and Positive Regulation by a Short Segment in the 5 Flanking Region of the Human Cytomegalo
50. into LB ampicillin and grow 8 Isolate plasmid DNA using a midiprep kit see Important next page for lentivirus production Continued on next page Analyzing Transformants Continued Important Materials Needed Screening Colonies by Miniprep Restriction Digest What You Should See TM Stbl3 E coli is wild type for endonuclease 1 endA1 When performing plasmid DNA isolation with commercially available kits ensure that Solution I of the Lysis buffer often called Resuspension Buffer contains 10 mM EDTA to inactivate the endonuclease to avoid DNA nicking and vector degradation Alternatively follow the instructions included in the plasmid purification kits for end A14 E coli strains We recommend using the PureLink HO Mini Plasmid Purification Kit and TM preparing lentiviral plasmid DNA using PureLink MidiPrep Kits page vii You will need the following materials LB medium containing 100 ug ml ampicillin e PureLink HQ Mini Plasmid Purification Kit page vii or equivalent e Appropriate restriction enzymes see above e E Gels 1 2 agarose gels or equivalent For each transformation 1 Pick 10 20 colonies from plates obtained after plating the transformation mix Step 9 page 13 Culture colonies overnight in LB medium containing 100 ug ml ampicillin 2 Isolate plasmid DNA using PureLink HQ Mini Plasmid Purification Kit or equivalent see Important above The typical yiel
51. l 1999 SV40 promoter to drive expression of Blasticidin pLenti6 3 V5 TOPO vector or EmGFP pLenti7 3 V5 TOPO vector Blasticidin Izumi et al 1991 Kimura et al 1994 Takeuchi et al 1958 Yamaguchi et al 1965 resistance gene for stable transduction and selection in E coli and mammalian cells pLenti6 3 V5 TOPO vector only or Emerald Green Fluorescent Protein EmGFP derived from Aequorea Victoria GFP pLenti7 3 V5 TOPO vector only which allows you to easily determine the lentiviral titer by flow cytometry Ampicillin resistance gene for selection in E coli pUC origin for high copy replication of the plasmid in E Coli Continued on next page Overview Continued How TOPO Cloning Works pLenti6 3 V5 TOPO 7691 bp and pLenti7 3 V5 TOPO 7935 bp are expression vectors designed to facilitate rapid cloning of TA PCR products for expression in mammalian cells The plasmid vector pLenti6 3 V5 TOPO or pLenti7 3 V5 TOPO is supplied linearized with e Single3 thymidine T overhangs for TA Cloning e Topoisomerase covalently bound to the vector this is referred to as activated vector Taq polymerase has a nontemplate dependent terminal transferase activity that adds a single deoxyadenosine A to the 3 ends of PCR products The supercoiled vector supplied in this kit has single overhanging 3 deoxythymidine T residues This allows PCR inserts to ligate efficiently with the vector
52. l packaging Luciw 1996 HIV 1 Rev response element RRE Permits Rev dependent nuclear export of unspliced viral mRNA Kjems et al 1991 Malim et al 1989 Polypurine Tract from HIV cPPT Provides for increased viral titer Park 2001 Human cytomegalovirus CMV immediate early promoter enhancer Permits high level constitutive expression of the gene of interest Andersson et al 1989 Boshart et al 1985 Nelson et al 1987 TOPO Cloning site Allows cloning of PCR products containing A overhangs in frame with the V5 epitope V5 epitope Allows detection of the recombinant fusion protein by Anti V5 Antibodies Southern et al 1991 Woodchuck Posttranscriptional Regulatory Element WPRE Provides for increased transgene expression Zufferey et al 1998 SV40 early promoter and origin Allows high level expression of the selection marker and episomal replication in cells expressing the SV40 large T antigen EM7 promoter Synthetic prokaryotic promoter for expression of the selection marker in E coli Blasticidin bsd resistance gene pLenti6 3 V5 TOPO only Permits selection of stably transduced mammalian cell lines Kimura et al 1994 Emerald Green Fluorescent Protein EmGFP pLenti7 3 V5 TOPO only Allows for fluorescence detection by flow cytometry and quick screen of transient expression in only 2 days post transfection U3 HIV 1 truncated 3 LTR
53. lonies for further analysis 3 Incubate reaction for 10 minutes at 94 C to lyse cells and inactivate nucleases 4 Amplify sample s in a thermocycler for 20 to 30 cycles Note Use the cycling parameters suitable for your primers and template 5 Visualize PCR products by agarose gel electrophoresis Continued on next page 16 Analyzing Transformants Continued Sequencing To confirm that your gene of interest is in frame with the C terminal tag you may sequence your expression construct to confirm that your gene is cloned in the correct orientation and in frame with the V5 epitope We recommend using the following primers to help you sequence your expression construct Refer to the diagrams on pages 31 32 for the locations of the primer binding sites in each vector Note For your convenience Invitrogen has a custom primer synthesis service For more information see our Web site www invitrogen com or contact Technical Support page 36 Vectors Primer Sequence pLenti6 3 V5 TOPO and CMV forward primer 5 CGCAAATGGGCGGTAGGCGTG 3 pLenti7 3 V5 TOPO V5 C term reverse primer 5 ACCGAGGAGAGGGTTAGGGAT 3 DNA Isolation Once you have generated and validated your clone you will isolate plasmid DNA Guidelines for transfection Plasmid DNA for transfection into eukaryotic cells must be very clean and free from contamination with phenol and sodium chloride Contaminants will kill the cel
54. ls and salt will interfere with lipid complexing decreasing transfection efficiency We recommend isolating lentiviral plasmid DNA using the PureLink MidiPrep Kit Important Do not use mini prep plasmid DNA for lentivirus production TM Isolating Lentiviral This protocol provides general steps to retransform Stbl3 E coli and perform Plasmid DNA isolation of plasmid DNA for lentivirus production pLenti plasmid DNA midipreps often have lower yields therefore a 100 ml volume of culture must be used for one DNA midiprep 1 Dilute 1 pl of miniprep plasmid DNA from a positive clone 1 500 in TE 2 Use 1 pl of this diluted DNA to retransform into One Shot Stbl3 Chemically Competent Cells as described on page 12 3 Plate approximately one tenth of the transformation on LB plates containing 100 pg ml ampicillin and incubate at 37 C overnight 4 Pick 1 colony and culture in 2 3 ml LB medium containing 100 pg ml ampicillin for 6 8 hours at 37 C to obtain a starter culture 5 Inoculate the entire volume of the starter culture into LB medium containing 100 ug ml ampicillin and culture at 37 C overnight Note Use a 50 100 ml volume for large scale or midiprep isolation of DNA TM Isolate plasmid DNA using the PureLink MidiPrep Kit page 15 Important Perform restriction analysis page 15 to confirm the presence of the insert Use the purified plasmid DNA from the positive clone for producing the lentivirus and to check
55. ng reaction to the recommended concentration of NaCl and MgCl You will need the following items e 42 C water bath e LB plates containing 50 100 pg ml ampicillin two for each transformation e Reagents and equipment for agarose gel electrophoresis e 37 C shaking and non shaking incubator Materials supplied with kit e pLenti TOPO vector e 10X PCR Buffer e Salt Solution e Sterile Water e One Shot Stbl3 Competent E coli Continued on next page TOPO Cloning Reaction continued Note Preparation for Transformation Setting Up the TOPO Cloning Reaction Performing the TOPO Cloning Reaction There is no blue white screening for the presence of inserts Individual recombinant plasmids need to be analyzed by restriction analysis or PCR sequencing for the presence and orientation of insert Sequencing primers included in the kit can be used to sequence across an insert in the multiple cloning site to confirm orientation and reading frame For each transformation you will need one vial of competent cells and two selective plates Equilibrate a water bath to 42 C Warm the vial of SOC medium from Box 2 to room temperature Warm selective plates at 37 C for 30 minutes Thaw on ice 1 vial of One Shot Stbl3 Competent E coli cells for each transformation The table below describes how to set up your TOPO Cloning reaction 6 ul for transformation into chemically competent One Shot Stbl3
56. o validate the clones You may also perform PCR analysis and or sequencing of your clones to determine that your insert is in the correct orientation and is in frame with the V5 epitope tag After verifying the correct clones you will use the miniprep DNA to re transform Stbl3 E coli You will then isolate plasmid DNA for transfection and lentivirus production Plasmid DNA for transfection into 293FT cells must be very clean and free from contaminants and salts and should be isolated by midiprep Do not use PCR screening of clones in place of restriction analysis For example clones that contain both correct and aberrantly recombined DNA may look positive by PCR but may not be optimal for lentivirus production To analyze your transformants 1 Pick 10 20 ampicillin resistant colonies from plating the transformation mix Culture cells overnight 2 Isolate plasmid DNA for each colony using a miniprep kit see Important next page 3 Analyze the plasmids by restriction analysis to confirm the presence and orientation of your insert as well as the integrity of the vector 4 Optional Sequence the plasmids or perform PCR to determine that your gene of interest is in frame with the C terminal V5 epitope tag 5 Re transform One Shot StbI3 Chemically Competent E coli separately with the validated clones 6 Inoculate LB ampicillin with a fresh colony and grow to generate a starter culture Inoculate the starter culture
57. onal assay Vector Positive Control pLenti6 3 V5 TOPO pLenti6 3 V5 GW lacZ pLenti7 3 V5 TOPO pLenti7 3 V5 GW lacZ A control lentiviral expression vector pLenti6 3 V5 GW EmGFP containing Emerald Green Fluorescent Protein EmGFP to optimize transfection and virus production is available separately from Invitrogen For ordering information see page vii or visit www invitrogen com Note The control vectors provided with the pLenti TOPO TA Cloning Kits and the ViraPower HiPerform Lentiviral Expression Systems are Gateway Technology control vectors These control vectors work well with the pLenti TOPO vectors Visit our web site at www invitrogen com for more information on Gateway Technology The control plasmids are supplied in solution at a concentration of 0 5 pg pl To propagate and maintain the control plasmids 1 Transform 10 ng of the stock solution into OneShot Stb13 E coli see page 12 Select transformants on selective plates containing 100 pg ml ampicillin 3 Propagate the plasmid in LB containing 100 pg ml ampicillin 4 Prepare a glycerol stock of a transformant containing plasmid for long term storage TM TM Refer to the ViraPower HiPerform Lentiviral Expression System manual for detailed guidelines and protocols to e Cotransfect your pLenti TOPO expression construct and the ViraPower Packaging Mix into the 293FT Cell Line to generate a lentiviral stock
58. ons are stable for 1 2 weeks at 4 C and 6 8 weeks at 20 C e pH of the aqueous solution should be 7 0 to prevent inactivation of Blasticidin e Do not subject stock solutions to freeze thaw cycles do not store in a frost free freezer e Upon thawing use what you need and store the thawed stock solution at 4 C for up to 2 weeks e Medium containing Blasticidin may be stored at 4 C for up to 2 weeks 24 pLenti TOPO TA Cloning Control Reactions Introduction Producing the Control PCR Product We recommend performing the following control TOPO Cloning reactions the first time you use the kit to help you evaluate your results Performing the control reactions using the reagents included in the kit involves producing a 750 bp control PCR product To produce the 750 bp control PCR product containing the lac promoter and lacZ set up the following 50 ul PCR Control DNA Template 50 ng 1 pl 10X PCR Buffer 5 pl 50 mM dNTPs 0 5 pl Control PCR Primers 0 1 g l each 2 pl Sterile Water 40 5 pl Tag Polymerase 1 unit yl lul Total Volume 50 ul Overlay with 70 pl 1 drop of mineral oil Amplify using the following cycling parameters Step Time Temperature Cycles Initial Denaturation 2 minutes 94 C 1X Denaturation 1 minute 94 C Annealing 1 minute 60 C 25X Extension 1 minute 72 C Final Extension 7 minutes 72 C 1X Remove 10 ul from the reaction and analyze by
59. pitope see table below Horseradish peroxidase HRP or alkaline phosphatase AP conjugated antibodies allow one step detection using chemiluminescent or colorimetric detection methods A fluorescein isothiocyanate FITC conjugated antibody allows one step detection in immunofluorescence experiments The amount of antibody supplied is sufficient for 25 western blots or 25 immunostaining reactions as appropriate Item Quantity Catalog no Anti V5 Antibody 50 pl R960 25 Anti V5 HRP Antibody 50 ul R961 25 Anti V5 AP Antibody 125 pl R962 25 Anti V5 FITC Antibody 50 pl R963 25 Overview Introduction Additional Information Introduction The pLenti6 3 V5 TOPO and pLenti7 3 V5 TOPO vectors are lentiviral expression vectors that are adapted for use with TOPO Cloning technology The pLenti TOPO vectors are designed to allow high level expression of recombinant fusion proteins in dividing and non dividing mammalian cells using Invitrogen s ViraPower HiPerform Lentiviral Expression Systems Catalog nos K5310 00 and K5320 00 Using the TOPO Cloning technology the pLenti TOPO vectors provide a highly efficient 5 minute one step cloning strategy for the direct insertion of Tag polymerase amplified PCR products into a plasmid vector No ligase post PCR procedures or PCR primers containing specific sequences are required Once cloned analyzed and transfected the PCR product expresses dire
60. ransient expression of the recombinant protein pLenti6 3 V5 TOPO and pLenti7 3 V5 TOPO vectors or generate a stable cell line using Blasticidin selection pLenti6 3 V5 TOPO only TM TM For more information about the ViraPower HiPerform Lentiviral Expression System the ViraPower Packaging Mix and the biosafety features of the System refer to the ViraPower HiPerform Lentiviral Expression System manual For more information about the 293FT Cell Line refer to the 293FT Cell Line manual Both manuals are available for downloading from www invitrogen com or by contacting Technical Support page 36 The pLenti6 3 V5 TOPO and pLenti7 3 V5 TOPO vectors contain the human CMV immediate early promoter to allow high level constitutive expression of the gene of interest in mammalian cells Andersson et al 1989 Boshart et al 1985 Nelson et al 1987 Although highly active in most mammalian cell lines activity of the viral promoter can be down regulated in some cell lines due to methylation Curradi et al 2002 histone deacetylation Rietveld et al 2002 or both Note If you experience silencing of your transgene expression you may use the ViraPower Promoterless Lentiviral Gateway Expression System with MultiSite Gateway Technology page vii and use a gene specific promoter Continued on next page Overview Continued Promoter Driving Blasticidin Positive Control Vector Green Fluorescent P
61. return of the product with a full refund For information on purchasing a license to this product for purposes other than research contact Licensing Department Invitrogen Corporation 1600 Faraday Avenue Carlsbad California 92008 Phone 760 603 7200 Fax 760 602 6500 or The Salk Institute for Biological Studies 10010 North Torrey Pines Road La Jolla CA 92037 Attn Office of Technology Management Phone 858 453 4100 extension 1275 Fax 858 546 8093 41 References Andersson S Davis D L Dahlb ck H J rnvall H and Russell D W 1989 Cloning Structure and Expression of the Mitochondrial Cytochrome P 450 Sterol 26 Hydroxylase a Bile Acid Biosynthetic Enzyme J Biol Chem 264 8222 8229 Boshart M Weber F Jahn G Dorsch H sler K Fleckenstein B and Schaffner W 1985 A Very Strong Enhancer is Located Upstream of an Immediate Early Gene of Human Cytomegalovirus Cell 41 521 530 Curradi M Izzo A Badaracco G and Landsberger N 2002 Molecular Mechanisms of Gene Silencing Mediated by DNA Methylation Mol Cell Biol 22 3157 3173 Dull T Zufferey R Kelly M Mandel R J Nguyen M Trono D and Naldini L 1998 A Third Generation Lentivirus Vector with a Conditional Packaging System J Virol 72 8463 8471 Izumi M Miyazawa H Kamakura T Yamaguchi I Endo T and Hanaoka F 1991 Blasticidin S Resistance Gene bsr A Novel Selectable Marker for Mammal
62. rotein GFP GFP and Spectral Variants EmGFP The pLenti6 3 V5 TOPO vector contains the SV40 promoter to drive mammalian expression of the Blasticidin selection marker In some mammalian cell types the activity of viral promoters such as SV40 may become significantly reduced over time due to promoter silencing from methylation Curradi et al 2002 or histone deacetylation Rietveld et al 2002 Note If you experience Blasticidin silencing we recommend using any of the ViraPower II Lentiviral Gateway Expression Systems These kits contain lentiviral vectors in which expression of the Blasticidin gene is controlled by the PGK promoter For more information visit our web site at www invitrogen com or contact Technical Support page 36 A control plasmid containing the lacZ gene is included with each pLenti TOPO TA Cloning kit for use as a positive expression control in the mammalian cell line of choice For more information on these vectors refer to pages34 35 A control lentiviral expression vector Vivid Colors pLenti6 3 V5 GW EmGFP containing Emerald Green Fluorescent Protein EmGFP is available separately from Invitrogen page vii Green Fluorescent Protein GFP is a naturally occurring bioluminescent protein derived from the jellyfish Aequorea victoria Shimomura et al 1962 GFP emits fluorescence upon excitation and the gene encoding GFP contains all of the necessary information for posttranslational
63. rward primer Example Kozak consensus sequence is G A NNATGG Depending on the nature of your PCR product you have two options to consider e Clone in frame with the V5 epitope C terminal peptide to detect and or purify your PCR product or e Include the native stop codon to express the native protein Note Cloning efficiencies may vary depending on the 5 primer nucleotide sequence see page 17 Use the diagram below to design your PCR primers Once you have designed your PCR primers proceed to Producing PCR Products page 9 Do not add 5 phosphates to your primers for PCR The PCR product synthesized will not ligate into the pLenti TOPO vector Restriction sites for pLenti6 3 V5 TOPO are labeled to indicate the actual cleavage site The vector is supplied linerarized between base pair 2561 and 2562 This is the TOPO Cloning site Note The full sequence of the pLenti6 3 V5 TOPO vector K5315 20 may be downloaded from our web site www invitrogen com or requested from Technical Support see page 36 A map of pLenti6 3 V5 TOPO vector is provided on page 31 CAAT CMV forward priming site TATA U 1 c 2378 TCGTAACAAC TCCGCCCCAT TGACGCAAAT GGGCGGTAGG CGTGTACGGT GGGAGGTCTA TATAAGCAGA GCTCGTTTAG Putative transcriptional start B Spe 2458 TGAACCGTCA GATCGCCTGG AGACGCCATC CACGCTGTTT TGACCTCCAT AGAAGACACC GACTCTAGAG GATCCACTAG 2561 Pst Arg Ala Asn Ser Ala Asp Ile Gln His 2538 TCCAGTGTGG TGGAATTGGC CCTT AAGG
64. t 100 reactions K1220 01 One Shot Stb13 Chemically Competent E coli 20 x 50 pl C7373 08 Ampicillin 20 ml 11593 027 Blasticidin 50 mg R210 01 Geneticin 20 ml 10131 035 100 ml 10131 027 Lipofectamine 2000 Reagent 15 ml 11668 019 0 75 ml 11668 027 Phosphate Buffered Saline pH 7 4 500 ml 10010 023 anti B galactosidase 0 5 ml A 11132 B Gal Assay Kit 100 reactions K1455 01 p Gal Staining Kit 1 kit K1465 01 X gal 100 mg 15520 034 1g 15520 018 Continued on next page vii Accessory Products Continued ViraPower HiPerform Lentiviral Expression Products Detection of Recombinant Protein viii The pLenti TOPO TA Cloning Kits are designed for use with the ViraPower HiPerform Lentiviral Expression Systems available from Invitrogen Ordering TM TM information for the ViraPower HiPerform Lentiviral support products and expression kits is provided below Product Quantity Catalog no ViraPower HiPerform Lentiviral TOPO 1 kit K5310 00 Expression Kit ViraPower HiPerform Lentiviral FastTiter 1 kit K5320 00 TOPO Expression Kit Vivid Colors pLenti6 3 GW EmGFP Expression 20 ug V370 06 Control Vector ViraPower Lentiviral Support Kit 20 reactions K4970 00 ViraPower Lentiviral Packaging Mix 60 reactions K4975 00 293FT Cell Line 3x 10 cells R700 07 Expression of your recombinant fusion protein can be detected using an antibody to the V5 e
65. ter than other pLenti vectors that do not contain the WPRE and cPPT elements the signal intensity of EmGFP expressed in your cells is not optimal for viewing with fluorescence microscopy For this reason we recommend flow cytometry For more details refer to the ViraPower HiPerform Lentiviral System Manual The EmGFP expressed from the pLenti6 3 V5 GW EmGFP Expression Control Vector has the following excitation and emission wavelengths as published in the literature Tsien 1998 Fluorescent Protein Excitation nm Emission nm EmGFP 487 509 Recipes LB Luria Bertani Medium LB Plates Containing Ampicillin Appendix 1 0 Tryptone 0 5 Yeast Extract 1 0 NaCl pH 7 0 1 For 1 liter dissolve 10 g tryptone 5 g yeast extract and 10 g NaCl in 950 ml deionized water 2 Adjust the pH of the solution to 7 0 with NaOH and bring the volume up to 1 liter 3 Autoclave on liquid cycle for 20 minutes Allow solution to cool to 55 C and add antibiotic if desired 4 Store at 4 C Follow the instructions below to prepare LB agar plates containing ampicillin 1 Prepare LB medium as above but add 15 g L agar before autoclaving 2 Autoclave on liquid cycle for 20 minutes 3 After autoclaving cool to 55 C add ampicillin to a final concentration of 100 g ml and pour into 10 cm plates 4 Let harden then invert and store at 4 C in the dark 23 Blasticidin pLenti
66. the TOPO Cloning reaction page 11 into a vial of One Shot StbI3 cells and mix gently Do not mix by pipetting up and down For the pUC19 control add 10 pg 1 ul of DNA into a separate vial of One Shot cells and mix gently Incubate the vial s on ice for 30 minutes Heat shock the cells for 30 seconds at 42 C without shaking Remove the vial s from the 42 C water bath and place them on ice for 2 minutes Add 225 ul S O C media pre warmed to room temperature Cap the tube s tightly and shake horizontally at 37 C for 1 hour at 225 rpm in a shaking incubator Spread 100 ul of the transformation mix on a pre warmed LB Ampicillin plate and incubate overnight at 37 C For the pUC19 control dilute the transformation mix 1 10 into LB Medium e g add 100 ul of the transformation mix to 900 ul of LB Medium and plate 25 100 ul Store the remaining transformation mix at 4 C Plate out additional cells the next day if desired 10 Proceed to Analyzing Transformants next page 13 Analyzing Transformants Introduction Note Experimental Outline 14 We recommend analyzing the transformants using both restriction digestion and sequencing or PCR analysis as described below This allows you to confirm the presence of the insert as well as ensure the absence of any aberrant lentiviral vector recombination between the LTRs You will screen colonies by performing miniprep DNA isolation and restriction analysis t
67. ting a not to transfer such materials to any third party and b to use such transferred materials and or information solely for research and not for Commercial Purposes Notwithstanding the preceding any buyer who is employed in an academic or government institution may transfer materials made with this product to a third party who has a license from Invitrogen under the patents identified above to distribute such materials Transfer of such materials and or information to collaborators does not convey rights to practice any methods claimed in the foregoing patents or patent applications Commercial Purposes means any activity by a party for consideration and may include but is not limited to 1 use of the product or its components in manufacturing 2 use of the product or its components to provide a service information or data 3 use of the product or its components for therapeutic diagnostic or prophylactic purposes or 4 resale of the product or its components whether or not such product or its components are resold for use in research Invitrogen Corporation will not assert a claim against the buyer of infringement of the above patents based upon the manufacture use or sale of a therapeutic clinical diagnostic vaccine or prophylactic product developed in research by the buyer in which this product or its components was employed provided that none of i this product ii any of its components or iii a method claim of the foregoin
68. virus Major Immediate Early Gene Molec Cell Biol 7 4125 4129 Park F and Kay MA 2001 Modified HIV 1 based lentiviral vectors have an effect on viral transduction efficiency and gene expression in vitro and in vivo Mol Ther 4 3 164 173 Rietveld L E Caldenhoven E and Stunnenberg H G 2002 In vivo Repression of an Erythroid Specific Gene by Distinct Corepressor Complexes EMBO J 21 1389 1397 Shimomura O Johnson F H and Saiga Y 1962 Extraction Purification and Properties of Aequorin a Bioluminescent Protein from the Luminous hHydromedusan Aequorea Journal of Cellular and Comparative Physiology 59 223 239 Shuman S 1991 Recombination Mediated by Vaccinia Virus DNA Topoisomerase I in Escherichia coli is Sequence Specific Proc Natl Acad Sci USA 88 10104 10108 Shuman S 1994 Novel Approach to Molecular Cloning and Polynucleotide Synthesis Using Vaccinia DNA Topoisomerase J Biol Chem 269 32678 32684 Southern J A Young D F Heaney F Baumgartner W and Randall R E 1991 Identification of an Epitope on the P and V Proteins of Simian Virus 5 That Distinguishes Between Two Isolates with Different Biological Characteristics J Gen Virol 72 1551 1557 42 References Continued Takeuchi S Hirayama K Ueda K Sakai H and Yonehara H 1958 Blasticidin S A New Antibiotic The Journal of Antibiotics Series A 11 1 5 Tsien R Y 1998 The Green Fluorescent Protein

pLenti-TOPO - Thermo Fisher Scientific

Contents

Download Pdf Manuals

Related Search

Related Contents