Home
miRCURY LNA™ microRNA ISH Optimization Kit (FFPE)
Contents
1. miRCURY LNA microRNA Array ready to spot probe set Ready to spot oligos for direct printing of arrays or coupling in bead based applications miRCURY LNA Universal RT microRNA PCR Exigon s microRNA qPCR system offers the best available combination of performance and ease of use on the microRNA real time PCR market The combination of a Universal RT reaction and LNA enhanced PCR primers results in unmatched sensitivity and specifi city The Ready to use microRNA PCR panels enable fast and easy microRNA expression profiling Pre validated individual assays and custom assays are also available miRCURY LNA microRNA Detection Probes For in situ hybridization and northern blotting of all microRNAs miRCURY LNA microRNA Inhibitors and Power Inhibitors Unravel the function of microRNAs by microRNA inhibition Sophisticated LNA design ensures potent inhibition of all microRNAs regardless of their GC content Chemically modified highly stable Power Inhibitors for unrivalled potency miRCURY LNA microRNA Inhibitor Library For genome wide high throughput screening of microRNA function o w YNT AYNIY Hy uoneziumndo HSI e 3d34 Hy uoneziumndo HSI VN30421U w YNT AYNIY Product description In situ hybridization ISH is a powerful technique and the most common method for visualizing gene expression and localization in specific tissue and cell types The technology is far from tri
2. humidifying chamber and incubate with blocking solution for 15 min at RT Important Steps 9 16 are carried out in the humidifying chamber or in Shandon Slide Racks Y Remove blocking solution and apply anti DIG reagent sheep anti DIG AP at 1 800 in antibody dilutant see table 3 and incubate for 60 minutes at RT Y Wash the slides 3x3 minutes with PBS T Y Apply freshly prepared AP substrate to the sections see Table 3 and incubate slides for 2 hours at 30 C in the humidifying chamber Protect from light during development Y Incubate slides in KTBT buffer 2x5 minutes to stop the reaction N 3d33 Hy uoneziumndo HSI w VN AYNIY N N Ad44 Hy uoneziumndo HSI w YNT AYNIY Step 14 Wash with water 2x1 min Step 15 Counter stain with Nuclear Fast Red Step 16 Rinse in tap water for 10 min Step 17 Dehydrate slides Step 18 Mount slides Step 19 Microscopy Wash with water 2x1 minutes Y Apply 200 pL Nuclear Fast Red nuclear counter stain for 1 minute for nuclear counter staining Y Remove slides from the humidifying chamber to a slide rack placed within a glass jar containing tap water Carefully rinse the slides with running tap water for app 10 min Y Dehydrate slides in ethanol solutions according to Table 7 Place the slides on clean paper towels Step Solvent Duration 1 70 Ethanol Immerse 10 ti
3. microRNA ISH in the lab Kit content Reagent Vol Conc RNA T LNA microRNA probe double DIG labeled 40uL 25uM See datasheet LNA scrambled microRNA probe double 40uL 25uM SS DIG labeled 5 gtgtaacacgtctatacgccca 3 LNA U6 snRNA probe 5 DIG Labeled 40uL 84 C 5 cacgaatttgcgtgtcatcctt 3 microRNA ISH buffer 2x 25mL Proteinase K lyophilized 12mg Shipping and storage Upon receipt The kit is shipped at room temperature Immediately upon receipt remove the miRCURY LNA microRNA ISH buffer from the box and store at 4 C Store the DIG labeled miRCURY LNA microRNA Detection probes and Proteinase K in the box at 20 C or below Under these conditions the probes are stable for at least 6 months It is recommended to store the probes in aliquots and to avoid multiple freeze thaw cycles see recommendations below Do not store in frost free freezer with automatic thaw freeze Before First Use e Proteinase K stock reconstitute to 20 mg mL by adding 600 uL 10mM Tris HCl pH7 5 RNase free Store appropriate aliquots at 20 C DIG labeled LNA probes The following options are possible 1 The probes may be stored at 4 C if used within 4 weeks 2 Prepare aliquots to be stored at 20 C or below and avoid multiple freeze thaw cycles Example divide the LNA Detection probes into 5uL or 10uL aliquots into non stick RNase free tubes 3 Prepare pre diluted probe aliquots to be stored
4. steps to be added at various stages of the protocol and requires optimization Please go to www exiqon com mirna ish kit for more information N 3d33 Hy uoneziumndo HSI w YNT AYNIY wo eo 3d34 y uoneziumndo HSI w YNT AYNIY References gt Robust One day in situ hybridization protocol for detection of microRNA in paraffin samples using LNA probes Jorgensen S Baker A Maller S Nielsen BS Methods 2010 52 375 381 e The Laboratory Mouse Mark A Suckow Peggy Danneman Cory Brayton CRC Press ISBN 0849303222 Pathology of Genetically Engineered Mice Jerrold Michael Ward Joel F Mahler Robert R Maronpot lowa State University Press ISBN 0813825210 e www exigon com miRCURY LNA microRNA ISH Optimization Kit FFPE Outside North America Exigon A S Skelstedet 16 DK 2950 Vedbaek Denmark Phone 45 45 660 888 Fax 45 45 661 888 North America Exiqon Inc 12 Gill Street Suite 1650 Woburn MA 01801 United States Phone 781 376 4150 Fax 781 376 4152 exigon com EXIQON Seek Find Verify v2 0 12 2011 13 0085 919521
5. BS sterile SSC buffer ultrapure e 1M Tris HCl pH 7 4 0 5M EDTA 5M NaCl Tween 20 Sigma cat no P1379 e 30 BSA Sigma cat no A9576 e For KTBT buffer Tris HCl NaCl and KCl see page 14 Dako Pen or equivalent hydrophobic PAP pen Non stick RNase free microfuge tubes Sterile filter tips N 3d33 x uoneziumndo HSI w YNT AYNIY oo Adds 319 uoneziundo HSI wiVN7 AYNIY Related products Exiqon offers a broad variety of products enabling new discoveries concerning the isolation expression function and spatial distribution of microRNAs L Expression 4 T Do do Isolation Analysis Localization ead miRCURY LNA microRNA ISH Buffer Set Hybridation buffer and Proteinase K for continuation of the optimized ISH procedure with miRCURY LNA microRNA Detecion probes miRCURY RNA Isolation Kits Get high quality total RNA suitable for miRCURY LNA microRNA Array analysis in as little as 20 minutes Protocols are available for a large number of sample types and organisms miRCURY LNA microRNA Array microarray kit Pre printed miRCURY LNA microRNA Array microarray slides for hsa mmu rno Kit includes hybridization and wash buffers as well as synthetic spike in microRNAs miRCURY LNA microRNA Power and Hi Power labeling kit For fluorescent labeling of microRNAs from total RNA samples ready for array hybridization
6. DIG and NBT BCIP substrate Required reagents and equipment not supplied In addition to the reagents supplied in the miRCURY LNA microRNA ISH Optimization Kit a series of reagents as well equipment is needed to perform the ISH experiments as described in the protocol The list below includes recommendations for specific products that have been shown to work well with the microRNA ISH protocol details of how to prepare buffers and reagents can be found on page 13 16 e Double DIG labeled miRCURY LNA Detection probes for your microRNA s of interest Exiqon e Sheep anti DIG AP Roche Cat No 11 093 274 910 Sheep serum Jackson mmunoresearch Cat No 013 000 121 NBT BCIP ready to use tablets Roche Cat No 11 697 471 001 or equivalent Levamisole Fluka Cat No 31742 or equivalent Rubber cement Fixogum MP Biomedicals Cat No 11FIX00050 or equivalent Nuclear counter stain Nuclear Fast Red Vector laboratories Cat No H 3403 or equivalent Mounting medium Eukitt VWR Cat No 3618940 RNaseZap Ambion Hybridizer e g Dako Hybridizer Vysis ThermoBrite or Invitrogen s Spotlight Hybridizer Humidifying chamber or equivalent for immunohistochemical detection Superfrost Plus slides Cover slides e Slide rack s and several glass jars for deparaffinization dehydration and washes Xylene for de paraffination e Ethanol for hydration and dehydration P
7. Localization miRCURY LNA microRNA ISH Optimization Kit FFPE Instruction manual v2 0 for product 90000 90001 90002 90003 90004 90005 90007 90008 90009 December 2011 EXIQON Seek Find Verify N 3d34 Hy uoneziumndo HSI w YNT AYNIY Literature citations Please refer to miRCURY LNA microRNA Detection probes and ISH optimization kit when describing a procedure for publication using this product or to the following article Robust One day in situ hybridization protocol for detection of microRNA in paraffin samples using LNA probes Jgrgensen S Baker A Maller S Nielsen BS Methods 2010 52 373 381 Patents and Trademarks Exiqon LNA and miRCURY are registered trademarks of Exiqon A S Vedbaek Denmark Locked Nucleic Acids LNA are covered by patents and patent applications owned by Exiqon A S All other trademarks are the property of their respective owners Locked nucleic Acids LNA s are protected by US Pat No 6 268 490 US Pat No 6 770 748 US Pat No 6 639 059 US Pat No 6 734 291 and other applications and patents owned or licensed by Exiqon A S Disclaimer Products are for research use only and not for diagnostic or therapeutic use The products in their original or any modified form may be used only for the buyer s internal research purposes and not for commercial diagnostic therapeutic or other use including contract research The buyer may not resell prod
8. NIY Hy uoneziumndo HSI Table 9 miRCURY LNA microRNA Detection probe suggested concentrations positive control as supplied with the Kit Probe name Concentration nM RNA T miR 20 GIO miR 21 20 40 GIG miR 122 40 eC miR 124 40 89 C miR 126 40 85 C miR 223 40 83 C miR 145 20 88 C miR 205 20 40 OD optimization range for the double DIG LNA probe could be 20 80 nM N Oo Ad44 Hy uoneziumndo HSI w YNT Agam Identify optimal hybridization temperature Optimal performance of an ISH probe is related to its signal to noise ratio Oligonucleotide probes and especially LNA containing probes can potentially hybridize to highly similar sequences if the hybridization temperature is too low The positive control LNA probes supplied with the microRNA ISH Optimization kit typically result in a high signal to noise ratio at 55 C using the One day miRCURY LNA microRNA ISH protocol The LNA probes also hybridize at 60 C but generally provide weaker signals At 50 C the LNA probes give stronger signals but the risk of cross hybridization to highly similar sequences in RNA transcripts or the genome will increase at low hybridization temperatures As a rule of thumb hybridization should be performed at 30 C below the given RNA T or 20 C below DNA T Troubleshooting No signal If no signal is obtained with the LNA U6 sn
9. RNA probe incubated at 10 nM it is recommended to ensure that all reagents are prepared according to the recommendations and are RNase free pages 14 16 Always test sections from more than one block a minimum of 4 is recommended Not sufficient sensitivity level with the LNA U6 snRNA probe It is recommended that the LNA U6 snRNA signal is intense when incubated in the range of 0 1 1 nM If this is not the case ensure that the buffers are prepared correctly and that tissue sections are in the range 5 7 um Ensure that the AP reaction takes place at 30 C Low sensitivity may also be caused by RNase contamination during sectioning or handling during the in situ hybridization protocol Make sure all steps of the ISH protocol are performed in an RNase free environment Be aware that both insufficient or hard fixation of tissue samples may result in a low signal Thus it is necessary to test several blocks in parallel and avoid concluding on a single sample Strong 06 snRNA signal but no or low microRNA signal If a strong U6 snRNA signal is obtained with 0 1 0 5 nM probe but no signal is obtained with the supplied positive control LNA microRNA probe it is most likely due to sub optimal Proteinase K treatment Hence the Proteinase K concentration or duration of treatment should be optimized see Tip 2 for details In order to boost a weak signal remove the anti DIG reagent in step 10 halfway through the incubation e g after 30 mi
10. aseAlert Lab test Kit Ambion is an easy and fast test that is recommended for optional testing of potential RNase activity in buffers and reagents Table 3 Reagents to prepare on the day of the experiment Proteinase K reagent Prepare immediately before use For a Proteinase K concentration of 15 pg mL Add 7 5 uL Proteinase K stock to 10 mL Proteinase K buffer prepared in Table 2 See further recommendations in Tip 2 page 23 Hybridization mix 1 Dilute the 2x microRNA ISH buffer 1 1 with microRNA ISH buffer RNase free water e g mix 1 mL 2x microRNA ISH and LNA Detection buffer with 1 mL RNAse free water to give 2 mL probes 1x buffer 2 For each probe to be used in the experiment place the appropriate amount of LNA probe in a 2 mL non stick RNase free tube see table below 3 Denature the probes at 90 C for 4 minutes 4 Place the tubes in table top microfuge and spin down shortly 5 Immediately add the 2 mL 1x microRNA ISH buffer to each of the tubes with the different LNA probes Final probe Dilution 1x ISH Probe conc Probe vol factor buffer vol LNA U6 snRNA 0 5uM 1 nM 4 ul 500 2ml LNA microRNA probe 254M 20 nM 1 6 ul 111250 2ml LNA microRNA probe 25uM 40 nM 3 2 ul 625 2ml LNA scrambled microRNA 40 nM 3 2 ul 625 2ml probe 25uM Suggested starting concentrations for microRNA probes can be found in table 9 page 25 Note left over hybridization mix can be s
11. at 20 C or below in the microRNA ISH buffer This option is only recommended once the optimal probe concentration has been determined For details of how to make 1x ISH buffer c 3d33 Hy uoneziumndo HSI w YNT AYNIY oO 3d34 Hy uoneziumndo HSI w YNT AYNIY and how to denature and dilute the probes please see page 15 On the day of use thaw the pre diluted probe to room temperature and apply directly to the sections Note Probe concentration must be optimized see Tip 3 page 24 Additional required material ISH protocols vary extensively due to different equipment set up and laboratory routines This one day miRCURY LNA microRNA ISH protocol details the process of manual ISH on formalin fixed and paraffin embedded tissue samples using double DIG labeled miRCURY LNA microRNA Detection probes For the ISH steps we recommend a hybridization station that allows precise and rapid temperature adjustments e g Dako Hybridizer This protocol is developed using a hybridization station but if unavailable conventional hybridization ovens may be used see details in FAQs on page 29 For the immunohistochemical steps Exiqon has had good experience with both horizontal humidifying chambers and Shandon s Sequenza Slide Rack systems The chromogenic ISH assay is based on the use of DIG labeled probes and therefore requires proper detection reagents e g alkaline phosphatase conjugated anti
12. cessful ISH analyses For ISH analysis in human specimens standard overnight fixation in neutral buffered formalin followed by paraffin embedding often works well For studies in mouse tissues perfusion fixation with 4 fresh PFA is recommended Consult animal care guidelines before setting up this protocol see e g The Laboratory Mouse by Mark A Suckow Peggy Danneman Cory Brayton CRC Press or Pathology of Genetically Engineered Mice by Jerrold ichael Ward Joel F Mahler Robert R Maronpot lowa State University Press Optimization of the assay performance should preferably be based on analysis of at least 4 FFPE blocks For detailed guidelines to Tissue Sectioning please see Tip 1 page 23 Glassware n order to reduce potential RNase contamination of glassware it is recommended to autoclave all glassware or to heat treat all glassware for 8 hours at 180 C Prior to the heat treatment it is recommended to wrap all items in aluminum foil including appropriate stacks of cover slips Keep apart from untreated glassware Preparation of reagents and buffers In addition to the hybridization buffer and Proteinase K buffer supplied with the microRNA ISH Optimization Kit a number of other reagents and buffers need to be prepared prior to initiating the microRNA ISH experiment see page 7 for a list of recommended materials Recipes for preparation of required reagents and buffers are listed in Table 1 3 Please note that many reage
13. d at the hybridization temperature see step 7 page 20 High background staining Providing all possibilities for non specific staining mentioned above have been ruled out and as long as the specific signal from the microRNA probe is strong high background signal can often be reduced by increasing the hybridization temperature and or increasing the duration of the stringency washes Non specific staining of ECM Non specific staining of extracellular matrix may occur if the concentration of the detecting antibody is too high Sections fall off after de paraffination Avoid storage of paraffin sections at 20 C Small and thick sections fall off more easliy than large thin sections Ensure that the glass slides used have electrostatic properties such as the SuperFrost Plus slides When transferring sections from the waterbath to slides it is important to let all excess water drain evaporate from the section and slide to avoid water or air bubbles getting trapped under the section For fatty tissues or loose connective tissue e g tissue from normal breast increasing the duration of the melting step from 45 minutes to 60 minutes sometimes helps Frequently asked questions Can use a hybridization oven instead of a Dako Hybridizer When using a hybridization oven during the hybridization step make sure cover slides are sealed with Fixogum as specified in step 6 The slides can be placed as such in the hybridization oven without humidif
14. e One day miRCURY LNA microRNA ISH protocol page 17 22 7 Evaluate appropriate Proteinase K treatment range for each sample type 8 Determine ISH sensitivity level using the LNA U snRNA probe It may be necessary to repeat steps 7 and 8 to gradually improve the performance of the protocol 9 Run the microRNA ISH protocol with the LNA microRNA probe and LNA scrambled microRNA probe 10 Optimize hybridization temperature and probe concentration for each probe An overview of the workflow for the One day miRCURY LNA microRNA ISH protocol is shown on page 17 Important cautions for RNA work RNA work requires specific handling and precautions to prevent RNase contamination of the reagents and degradation of the RNA sample Every step in the microRNA ISH procedure including tissue sectioning and DIG detection must take place in a clean and nuclease free environment We recommend that all surfaces are cleaned with RNaseZap RNase Away or other RNase removal solution Wear gloves during the entire process and only use RNase decontaminated glassware All buffers and reagents should be prepared using RNase free water only e g RNase grade Milli Q water or DEPC treated water and be autoclaved if specified FFPE sample requirements and comments on tissue fixation MicroRNAs are like other RNA fragile molecules sensitive to degradation Fast and sufficient fixation of tissue specimens is therefore important for suc
15. ions to allow better histological resolution Figure 1 NBT BCIP C precipitate D LNA probe 5 t MicroRNA Optimization of the ISH procedure is divided into three steps 1 Optimization of the protocol parameters with the LNA U6 snRNA probe by adjustment of hybridization temperature and Proteinase K treatment 2 Control study using the optimized protocol parameters with the kit specific double DIG LNA microRNA probe and scrambled negative control probe a strong specific ISH signal should be obtained 3 Detection of the microRNA of interest using the appropriate miRCURY LNA microRNA Detection probe Figure 2 shows a typical result of the microRNA ISH procedure In this case specific miR 126 ISH signal is seen in endothelial cells as expected no signal is observed with LNA scrambled microRNA probe and overall nuclear staining is seen with LNA U6 snRNA probe Figure 2 Al uL mx HE 7 a 4 a a t e AST gv gus lt weet Lent miR 126 40nM scrambled 40nM U snRNA 0 1nM Figure 2 n situ hybridization on consecutive sections from FFPE tissue sample with human breast cancer using the miRCURY LNA microRNA ISH Optimization kit 5 FFPE with the positive control miRCURY LNA Detection probe miR 126 Once optimized the protocol allows exceptionally clear and specific detection of microRNA at the cellular and partly subcellular level due to high signal to noise ratio An excellent h
16. ished start testing the double DIG labeled LNA microRNA probe positive microRNA control and the LNA scrambled microRNA probe negative control Table 8 Adjust concentration Fixation Temperature Proteinase K Duration conc opt human FFPE routine formalin JE 5 20 ug mL 15 10 min mouse FFPE PFA perfusion SRE 0 5 5 0ug mL 2 10 min Adjust duration Fixation Temperature Proteinase K Duration opt conc human FFPE routine formalin SS 15ug mL 5 30 min 10 mouse FFPE PFA perfusion Sue 2ug mL 3 30 min 10 Identify ISH sensitivity level In order to identify the sensitivity of the performance of the ISH protocol it is recommended to prepare dilutions of the LNA U6 snRNA probe Figure 3 shows that the LNA U6 snRNA probe should provide a significant ISH signal at 0 03 to 0 3nM concentration It is recommended that U6 snRNA ISH signal is intense as shown for 0 1 nM concentration in Figure 3 when the probe is incubated at 0 1 2 0 nM before moving on with the double DIG probes for microRNA ISH N ol Figure 3 n situ hybridization LNA U6 snRNA expression on consecutive sections from FFPE tissue sample from normal human colon probe it is recommended to use the suggested starting concentrations in Table 9 for the double DIG labeled miRCURY LNA microRNA Detection probes supplied in the microRNA ISH Optimization Kits optimal hybridization temperature is in the 50 60 C range w YNT AY
17. istological resolution is obtained in a wide range of tissue samples In fact eight different kits are available each with a unique positive control miRCURY LNA microRNA Detection probe targeting a specific microRNA known to be highly expressed in a distinct organ or cell ty ideal for a variety of applications ranging from study of mi developmental microRNA regulation examination of func diagnostic and prognostic biomarker discovery in clinical pe This makes the kit croRNA localization tional studies over specimens and other biopsy material The robustness of the procedure makes it advantageous for both high throughput ISH analysis as well as individual microRNA localization studies w YNT AYNIY Hy uoneziumndo HSI N Ad44 y uoneziwdo HSI w YNT AYNIY Protocol Before starting the experiment In order to ensure that the lab equipment and reagents for the microRNA ISH procedure are in place before starting the experiment it is recommended to go through the following sequence of steps 1 Prepare and store kit reagents page 5 2 Establish histology Lab environment for RNA work page 12 13 3 Prepare samples including fixation of tissue and FFPE preparations page 13 4 Cut FFPE sections using Tissue Sectioning Guidelines page 23 5 Prepare reagents and buffers page 14 16 6 Become confident with the steps in th
18. low overview One day microRNA ISH protocol Below is an overview of the workflow for the microRNA ISH protocol for FFPE samples The numbers refer to each of the steps in the protocol see details in the protocol section page 18 22 The workflow can be followed for both the initial protocol optimization with the LNA probes provided with the kit and the subsequent specific microRNA detection Process E Equipment Time Temperature Deparaffination 0 Slide rack and Jars 40 min Room Temperature Proteinase K Hybridizer 10 min uc Dehydration 0 Slide rack and Jars 20 min Room Temperature In Situ hybridization Q Hybridizer 60 min 50 60 C Stringent washes eo Water bath 30 min 50 60 C Blocking 0 15 min IHC staining racks Room Temperature Anti DIG AP 60 min AP reaction 9 IHC staining racks in Oven 120 min 30 C Counter stain IHC staining racks 10 min Dehydration Qo Slide rack and Jars 10 min Room Temperature Mounting 5 min PBS washing steps are excluded from the overview Total time required is 7 hours N 3d33 Wy uoneziumndo HSI w YNT AYNIY Ad44 Hy uoneziumndo HSI w YNT AYNIY One day microRNA ISH protocol The protocol describes every step in the microRNA ISH analysis When setting up the microRNA ISH experiment for the first time it is recommended to follow the three optimization steps 1 First optimize the protocol parameters with the LNA U s
19. m temperature RNase free water where folding can be reversed Transfer the sections to he heated water bath where the tissue section is allowed to stretch shortly tis recommended to mount sections immediately thereafter on electrostatic reated slides such as SuperFrost Plus slides obtained from a new non contaminated package Let the paraffin sections dry for 1 2 hours at room temperature and store at 4 C or up to one week Avoid melting the paraffin until the day prior to the in situ hybridization analysis elt paraffin in an oven at 60 C for 45 minutes on the day before conducting the SH experiment Store slides overnight at 4 C in an RNase free environment entify appropriate Proteinase K treatment range The degree of Proteinase K treatment depends on fixation and tissue of origin In general terms the harder the fixation the more Proteinase K is needed however th re ere are lower and upper limits For the Proteinase K treatment step it is commended to vary the concentration or the duration as indicated in Table 8 Optimal opt starting values are shown in parenthesis N w YNT AYNIY Hy uoneziumndo HSI N B 3d34 y uoneziumndo HSI VN30421U w YNT AYNIY To identify the optimal Proteinase K conditions start by testing the LNA U snRNA probe at 4 5 different concentrations between 0 1 2 0 nM using the One day microRNA ISH Protocol Once the conditions have been establ
20. ment Place the slides in the Hybridizer and start a program hybridizing for 1 hour Hybridization temperature must be optimized for individual probes see Tip 4 Y Remove Fixogum using tweezers Avoid sliding the coverslip which may damage the tissue Then carefully detach cover glass and place the slides into a slide rack placed within a glass jar containing 5xSSC at RT Y Wash slides in glass jars according to Table 6 To ensure sufficient stringency perform the washes in glass jars placed in a water bath set to the hybridization temperature Table 6 Step Buffer Duration Temperature 1 ISSE 5 min Hyb temp 2 1xSSC 5 min Hyb temp 9 1xSSC 5 min Hyb temp 4 0 XSS 5 min Hyb temp 5 2XS P 5 min Hyb temp 6 0 2xSSC 5 min RT Step 8 Apply hydrophobic barrier Step Incubate with blocking solution for 15 min Step 10 Apply anti DIG reagent for 60 min Step 11 3x3 min wash in PBS T Step 12 Incubate with AP substrate for 2 hours at 30 C Step 13 Incubate slides in KTBT buffer 2x5 minutes Transfer slides to glass jars with PBS Apply a hydrophobic barrier around tissue sections using a DAKO Pen following the manufacturer s instructions Tissue sections are not allowed to dry out during this and the subsequent immunohistochemistry steps Alternatively if Shandon Slide Racks are employed then assemble slides on coverplates using PBS T Y Place the slides in a
21. mes 2 70 Ethanol 1 min 3 96 Ethanol Immerse 10 times 4 96 Ethanol 1 min 5 99 9 Ethanol Immerse 10 times 6 99 9 Ethanol 1 min Y Mount the slides directly with 1 2 drops of mounting medium Eukitt9 Avoid air drying sections at this step Y Allow precipitate to settle overnight and analyze results by light microscopy the subsequent day Tips and troubleshooting Tissue Sectioning Guidelines o It is strongly recommended to wear gloves during paraffin sectioning and in general to maintain an RNase free environment during all downstream procedures Use only heat treated glassware and RNase free water Use SuperFrost Plus slides drawn directly from new packages Workstation and Microtome B efore starting the tissue sectioning the whole workstation bench top microtome blade holder brushes tweezers cooling plate water bath etc needs to cleaned with RNase Zap RNase Away Cutting sections 1 2 3 4 5 o Prepare a water bath with room temperature RNase free water and a warm water bath with RNase free water at 40 50 C depending on the paraffin type nsert a new disposable blade in the knife carrier and place the paraffin block in he cassette clamp Trim the block in order to avoid the first couple of sections tis recommended to cool the FFPE blocks on a cooling plate to app 15 C before cutting to better control the section thickness Cut 6 um thick paraffin sections and place them in the roo
22. nRNA probe by adjustment of hybridization temperature and Proteinase K treatment 2 Conduct control study using the optimized protocol parameters with the double DIG LNA microRNA positive and negative control probes Adjust hybridization temperature and Proteinase K treatment to obtain a strong specific microRNA ISH signal 3 Finally detect the microRNA s of interest using the appropriate miRCURY LNA microRNA Detection probe s with the defined protocol parameters keeping in mind that the hybridization temperature may need to be adjusted Step 1 Deparaffinize slides in xylene and ethanol solutions at Deparaffinize slides in room temperature RT by placing slides with sections xylene and ethanol in a slide rack and then move from glass jar to glass jar according to Table 4 ending up in PBS Table 4 Step Solvent Duration 1 Xylene 5 min 2 Xylene 5 min 3 Xylene 5 min 4 99 995 Ethanol Immerse 10 times 5 99 9 Ethanol Immerse 10 times 6 99 9 Ethanol 5 min 96 Ethanol Immerse 10 times 8 96 Ethanol 5 min 9 70 Ethanol Immerse 10 times 10 70 Ethanol 5 min 11 PBS 2 5 min Step 2 Incubate with Proteinase K for 10 min at 37 C Step 3 Place slides in PBS Step 4 Dehydrate slides Immediately before use add Proteinase K to Proteinase K buffer see Table 2 amp 3 Place slides on a flat surface and apply approximately 300 uL slide to fully cover the section and inc
23. nts should be freshly prepared on the day of the experiment or even immediately before use Co w YNT AYNIY Wy uoneziumndo HSI a B 3d34 y uoneziumndo HSI w YNT AYNDY W Table 1 Reagents needed during the ISH procedure Antibody blocking solution PBS 0 1 Tween 2 Sheep serum 1 BSA see table 3 for details Antibody dilutant solution PBS 0 05 Tween 1 sheep serum 1 BSA see table 3 for details Sheep anti DIG AP See table 3 NBT BCIP ready to use tablets See table 3 Levamisole For blocking endogenous AP activity Prepare a 100 mM stock Nuclear Fast Red uclear counter stain Table 2 Buffers and stocks to prepare and autoclave prior to the microRNA ISH experiment Proteinase K buffer To 900 mL RNase free water add 5 mL of 1 M Tris HCl pH7 4 2 mL of 0 5 M EDTA 0 2 mL of 5 M NaCl Adjust volume to 1000 mL Autoclave 20xSSC pH 7 0 If purchased as RNase free then leave as is SSC solutions 5xSSC 11 250 mL 20xSSC 750 mL water 1xSSC 1 L 50 mL 20xSSC 950 mL water 0 2xSSC 1 L 10 mL 20xSSC 990 mL water Autoclave PBS T 0 196 pH7 4 Add 1 mL of Tween 20 to 1 L of PBS Autoclave KTBT AP stop solution To 900 mL RNase free water add 7 9g Tris HCl 50mM 8 7g NaCl 150mM 0 75g KCL 10mM Adjust volume to 1000mL Do not adjust pH Autoclave autoclave buffers where listed to minimize RNase activity RN
24. nutes and apply new unused reagent for the second half of the incubation The same approach can be used for the AP substrate in step 12 For low copy number targets it may be possible to increase the signal with Tyramide Signal Amplification TSA based systems Non specific staining It is necessary to clarify whether non specific staining obtained with the LNA scrambled microRNA probe is related to the DIG labeled probe itself the detecting antibody or to endogenous enzymatic reactions This can be done by a systematic approach where the effect of excluding individual reagents is tested including the DIG labeled probe the AP conjugated anti DIG N N w YNT AYNIY Hy uoneziumndo HSI N 3d34 Hy uoneziumndo HSI w YNT AYNIY or both If staining is obtained in the absence of AP conjugated anti DIG then endogenous AP is present If staining is obtained in the absence of the DIG labeled probe and no endogenous AP activity is observed then staining is related to the detecting antibody If abundant endogenous enzymatic reactivity e g in some intestinal areas and placenta cannot be prevented by Levamisol it may require a change to another detection approach such as TSA based fluorescence Some non specific staining can be caused by improperly maintained SSC wash buffer temperatures It is important to ensure that the SSC wash buffers are preheated to and maintaine
25. tored at 20 C and will be stable for up to 6 months avoid multiple freeze thaw cycles Continued next page ol Ad44 Hy uoneziumndo HSI w VN AYNIY w YNT AYNIY Hy uoneziumndo HSI Antibody blocking and dilutant solutions 1 To make 10mL blocking and 10mL dilutant start with 15mL PBS T see table 2 and ad Sheep serum 2 final concentration Lab Blocking solution solution d 300uL el the tube 2 Remove 5 mL from the tube in step 1 place in a new tube and label Dilutant solution 3 To the tube labeled Blocking solution add 330ul 3096 BSA to give a final concentration of 1 The blocking solution is now ready to use 4 To the tube labeled Dilutant solution add 5 mL PBS to give 0 0596 Tween and 1 sheep serum final concentration and 330ul 30 BSA to give concentration The diluant solution is now for use 196 final ready Anti DIG reagent Dilute the sheep anti DIG AP antibody 1 800 in Antibody dilutant solution see above range 1 500 1 2 000 AP substrate Immediately prior to use dissolve a NBT BCI D tablet in Milli Q water according to the manufacturer s instructions Add Levamisol to a final concen 0 2 mM Example if 10 mL AP substrate is prepared t ration of hen add 20 uL Levamisol stock Protect from light before and during incubation Workf
26. ubate slides for 10 min at 37 C for example in a Dako Hybridizer If the Hybridizer is employed then remove the humidifying strip inserts The Proteinase K concentration range must be optimized for individual tissues see Tip 2 Y Place slides into a slide rack inside a jar with PBS wash twice in PBS Y Dehydrate slides in new ethanol solutions according to Table 5 Air dry the slides on clean paper towels app 15 min Table 5 Step Solvent Duration 1 7096 Ethanol Immerse 10 times 2 70 Ethanol min 3 96 Ethanol Immerse 10 times 4 96 Ethanol 1 min 5 99 9 Ethanol Immerse 10 times 6 99 9 Ethanol 1 min Ad44 Hy uoneziumndo HSI w YNT AYNIY N e y uoneziumndo HSI VN30421U w YNT Agata Step 5 Apply hybridization mix and hybridize for 1 hour at 50 60 C Step 6 Disassemble slide and coverglass Step 7 Wash slides in SSC buffers Place slides on a flat surface and apply 25 uL hybridization mix as prepared in Table 3 For initial protocol optimization probe concentrations could be a 1 nM LNA U6 snRNA probe b 40 nM double DIG LNA microRNA probe The probe concentration will need to be optimized for optimal microRNA ISH signal See Tip 3 Avoid touching the tissue sections with the pipette tip Then apply a sterile cover glass onto each section carefully avoiding air bubbles and seal along all four edges with Fixogum rubber ce
27. ucts in their original or any modified form The purchase of products does not include or carry an implied right or license for the buyer to use such products in the provision of services to third parties and a license must be obtained directly from Exiqon A S for such use Copyright 2011 Exigon All rights reserved Table of contents Product Summary vos icc eher kem Seth e see beh e es 4 Product SUMMA sed aee AREA andes RR ft eR 4 Kit content nire teeter teehee PES Seide e Dem nd es 5 Shipping arnd Storage ud cis ism Ae Ae A o Ee Ge b Additional required 6 Reagents and equipment required not supplied naau aaaaaaaaauun na 7 Related products osse td ep ULP EP ERI hae e 8 Produetidescriptlori ies e tb RR DR owing dba dace eee 10 xoi rm 12 Before starting the experiment 0202702 12 Workflow overview One day microRNA ISH protocol 17 One day microRNA ISH protocol 00 e eee eee 18 Tips and troubleshooting ee 23 Troubteshigollhgs inne added at oa eke ed Lashed aces Mead fede 27 Frequently asked questions 00 0 0 cece eee 29 IMP 30 Abbreviations FFPE formalin fixed and paraffin embedded ISH n situ hybridization LNA locked nucleic acid Prot K Proteinase K RT room temperature AP alkaline phosphatase DIG digoxigenin PFA paraformaldehyde wo w YNT AYNIY Hy uoneziumndo HSI FR 3d34 y uone
28. vial and is often a very time consuming and difficult procedure requiring many steps of protocol optimizing to achieve satisfactory ISH results Detection of microRNA by conventional ISH analysis is no exception The miRCURY LNA microRNA ISH Optimization kit FFPE offers a fast and robust procedure for an easy implementation of microRNA ISH analysis requiring a minimum of optimization The microRNA ISH buffer is specifically developed for use with the double DIG labeled miRCURY LNA microRNA Detection probes Used in combination this provides the best available method for specific and sensitive detection of microRNA expression by ISH in FFPE sections of any tissue specimen The ISH protocol is designed for detection of microRNA in FFPE tissue sections and takes advantage of the use of the non mammalian hapten digoxigenin DIG and has been optimized to fit into a one day experimental set up During the protocol the microRNAs are demasked using Proteinase K which allows the access of double DIG labeled LNA probes to hybridize to the microRNA sequence Figure 1 The digoxigenins can then be recognized by a specific anti DIG antibody that is directly conjugated with the enzyme Alkaline Phosphatase AP AP converts the soluble substrates 4 nitro blue tetrazolium NBT and 5 bromo 4 chloro 3 indolylphosphate BCIP into a water and alcohol insoluble dark blue NBT BCIP precipitate Finally the nuclear counter stain is applied to the sect
29. ying conditions However humidifying conditions may be tried e g by using 1xSSC In order to establish a more stable hybridization temperature place a metallic plate e g the inserts from a multiblock heater in the oven Place the slides on the plate and hybridize for 1 2 hours Then go to step 6 Can use the protocol for Fresh frozen tissue The protocol can be adapted to cryosections please find guidelines for fresh frozen samples at www exigon com mirna ish kit The protocol will require optimization for individual sample types and microRNA targets Can pause the ISH procedure The individual steps in the One day protocol have been optimized to accommodate a One day protocol PBS steps may be prolonged but it is not recommended to extend to protocol to more than one day What happens if sections dry out Sections should be maintained in buffered solutions after the hybridization step Tissue sections that dry out may cause protein denaturation which may be particularly harmful to the detecting antibody and its conjugated alkaline phosphatase This may lower the sensitivity of the assay significantly and in addition cause background staining Drying out of tissue sections may also reduce the quality of the tissue morphology Can use other detection methods The DIG labeled LNA probes can be detected using alternative methods for DIG detection such as the TSA based systems The use of alternative systems may necessitate additional
30. ziumndo HSI w YNT AYNIY Product summary Product summary The miRCURY LNA microRNA ISH Optimization Kit FFPE provides the user with reagents and recommendations to ensure the best starting point for successful microRNA in situ hybridizations ISH on formalin fixed paraffin embedded FFPE tissue samples The kit contains 3 digoxigenin DIG labeled probes one double 5 and 3 DIG labeled probe for a known cell specific microRNA one double 5 and 3 DIG labeled scrambled probe to use as negative control and one 5 DIG labeled probe against U snRNA for use in the early phase assay set up In addition the kit contains a formamide free hybridization buffer developed specifically for miRCURY LNA Detection probe based ISH The included Proteinase K will allow the user to optimize the Proteinase K treatment for optimal retention of the microRNA target The accompanying One day microRNA ISH protocol minimizes time consuming optimization steps and enables a fast and optimal microRNA ISH analysis using a colorimetric antibody based development system for the DIG labeled probes In addition the Instruction Manual carefully covers each step of the FFPE ISH procedure including tissue sectioning incubation intervals and temperatures miRCURY LNA microRNA Detection probe concentrations and substrate incubation The manual further contains a list of recommended equipment and reagents required to establish and optimize
Download Pdf Manuals
Related Search
Related Contents
EMVT91_3 [12.83 Mo] - Revue d`élevage et de médecine www.silverlinetools.com Adobe Audition 3.0 SURFACE VEHICLE INFORMATION REPORT NEC X554UNS-TMX4P Mechanical Drawings Manual de instrucciones Quick Installation - Zcomax Technologies Copyright © All rights reserved.
Failed to retrieve file