InsectSelect System - Thermo Fisher Scientific
Contents
1. 1M Tris base 5 ml 5 M NaCl 3 ml Nonidet P 40 1ml 2 Bring the volume up to 90 ml with deionized water and adjust the pH to 7 8 with HCl 3 Bring the volume up to 100 ml Store at room temperature To prevent proteolysis you may add 1 uM leupeptin and 0 1 uM aprotinin continued on next page 21 Recipes continued 1X PBS 4X SDS PAGE Sample Buffer 22 137 mM NaCl 2 7 mM KCl 10 mM Na HPO 1 8 mM KH PO 1 Dissolve 8 g NaCl 0 2 g KCl 1 44 g Na HPO 0 24 g KH PO in 800 ml deionized water Adjust pH to 7 4 with concentrated HCl Bring the volume to 1 liter You may wish to autoclave the solution to increase shelf life oN 1 Combine the following reagents 0 5 M Tris HCI pH 6 8 5 ml Glycerol 100 4 ml B mercaptoethanol 0 8 ml Bromophenol Blue 0 04 g SDS 0 8 g Bring the volume to 10 ml with sterile water Aliquot and freeze at 20 C until needed pIZ V5 His Map and Features Map The figure below summarizes the features of the pIZ V5 His vector For a more detailed explanation of each feature see the next page The complete sequence of pIZ V5 His is available from our Web site www invitrogen com or from Technical Service see page 28 Comments for plZ V5 His 2876 nucleotides OplE2 promoter bases 4 552 Multiple cloning site bases 561 656 V5 epitope bases 663 704 6xHis tag bases 714 731 OpIE2 Reverse priming site bases 741 766 OpIE2 polyadenylation sequence2. HiPure Plasmid MidiPrep Kit is a medium scale plasmid isolation kit that isolates 10 200 ug of plasmid DNA from 10 100 ml of bacterial culture Plasmid can be used directly for transfection of insect cells We recommend lipid mediated transfection with Cellfectin Reagent Note that other lipids may be substituted Expected Transfection Efficiency using Cellfectin Reagent e 40 60 for Sf9 cells e 40 60 for High Five cells Other transfection methods i e calcium phosphate and electroporation Mann and King 1989 have also been tested with High Five cells To test the quality of a plasmid DNA preparation include a mock transfection DNA only no lipids in all transfection experiments At about 24 to 48 hours posttransfection compare the DNA only transfection with cells transfected with plasmid If the plasmid preparation contains contaminants then the cells will appear unhealthy and start to lyse You will need 1 10 ug of highly purified plasmid DNA 1 ug ul in TE buffer for each transfection experiment and the following materials e Either log phase Sf9 cells 1 6 2 5 x 10 cells ml gt 95 viability or log phase High Five cells 1 8 2 3 x 10 cells ml gt 95 viability e Serum free medium see the next page e 60mm tissue culture dishes e 1 5 ml sterile microcentrifuge tubes e Rocking platform only NOT orbital e 27 C incubator e Inverted Microscope e Paper towels and air tight bags or c
3. Translation Initiation Fusion to the C terminal Peptide Secretion of Recombinant Protein This chapter provides information to help you clone your gene of interest into pIZ V5 His A diagram is provided on page 5 to help you ligate your gene of interest in frame with the C terminal peptide sequence e For information on transformation into E coli see pages 7 8 e For information on transfection into Sf9 or High Five cells see pages 9 14 For help with DNA ligations E coli transformations restriction enzyme analysis DNA sequencing and DNA biochemistry refer to Molecular Cloning A Laboratory Manual Sambrook et al 1989 or Current Protocols in Molecular Biology Ausubel et al 1994 To propagate and maintain pIZ V5 His use 10 ng of the vector to transform a recA endA E coli strain like TOP10 DH5 or equivalent using your method of choice Select transformants on Low Salt LB plates containing 25 to 50 ug ml Zeocin see page 7 Your insert should contain a Kozak translation initiation sequence and an ATG start codon for proper initiation of translation Kozak 1987 Kozak 1991 Kozak 1990 An example of a Kozak consensus sequence is provided below Note that other sequences are possible but the G or A at position 3 and the G at position 4 shown in bold illustrates the most commonly occurring consensus sequence The ATG start codon is shown underlined G A NNATGG If you wish to inc
4. The Zeocin antibiotic can be inactivated by high salt concentrations and extremes in pH Special considerations are listed below to help you successfully isolate transformants in E coli Many E coli strains are suitable for transformation of pIZ V5 His including TOP10 Catalog no C610 00 or DH5 We recommend that you propagate vectors containing inserts in E coli strains that are recombination deficient recA and endonuclease A deficient endA For your convenience TOP10 is available as electrocompetent or chemically competent cells from Invitrogen Item Quantity Catalog no Electrocomp TOP10 5x 80 ul C664 55 10 x 80 ul C664 11 One Shot TOP10 chemically competent cells 21 x 50 pl C4040 03 DO NOT USE any E coli strain that contains the complete Tn5 transposon i e DH5 FIO SURE SURE2 This transposon encodes a ble bleomycin resistance gene which will confer resistance to Zeocin preventing selection of colonies containing your pIZ V5 His construct You may use your method of choice to transform E coli To select transformants use Low Salt LB plates containing 25 50 ug ml Zeocin see TM recipe below Zeocin can be inactivated by high salt and extremes in pH Composition 1 0 Tryptone 0 5 Yeast Extract 0 5 NaCl pH 7 5 1 For 1 liter dissolve 10 g tryptone 5 g yeast extract and 5 g NaCl in 950 ml deionized water Adjust pH of solution to 7 5 with NaOH
5. coli OpIE2 promoter Provides high level constitutive expression of the Zeocin resistance gene in lepidopteran insect cells Theilmann and Stewart 1992 EM7 promoter Allows efficient expression of the Zeocin resistance gene fusion in E coli Zeocin resistance gene Selection of transformants in E coli and stable insect cell lines SV40 early polyadenylation sequence Efficient transcription termination and mRNA stability pIZ V5 His CAT Map Description pIZ V5 His CAT is a 3552 bp control vector expressing chloramphenicol acetyl transferase CAT CAT is expressed as a fusion to the V5 epitope and 6xHis tag The molecular weight of the protein is 34 kDa Map The figure below summarizes the features of the plZ V5 His CAT vector The complete nucleotide sequence for pIZ V5 His CAT is available for downloading from our Web site www invitrogen com or by contacting Technical Service see page 28 Hind Ill Acc65 Kpn Ecl136 Il Sac BamH Spe BstX Comments for pIZ V5 His CAT 3552 nucleotides OplE2 promoter bases 4 552 CAT ORF bases 616 1272 V5 epitope bases 1339 1380 6xHis tag bases 1390 1407 OpIE2 Reverse priming site bases 1417 1442 OpIE2 polyadenylation sequence bases 1425 1554 pUC origin bases 1623 2296 OplE2 promoter bases 2341 2889 EM7 promoter bases 2907 2984 Zeocin resistance marker ORF bases 2985 3359 SV4
6. available from QIAGEN GmbH Max Volmer Str 4 D 40724 Hilden Germany The High Five cell line is patented by the Boyce Thompson Institute for Plant Research Ithaca New York and is covered under U S patent no 5 300 435 The High Five cell line is sold for research purposes only Commercial use requires a license from Boyce Thompson For more information please contact Joyce L Frank Tel 607 254 1220 Fax 607 254 1242 E mail jf51 cornell edu The Certificate of Analysis provides detailed quality control information for each product Certificates of Analysis are available on our website Go to www invitrogen com support and search for the Certificate of Analysis by product lot number which is printed on the box References Ausubel F M Brent R Kingston R E Moore D D Seidman J G Smith J A and Struhl K 1994 Current Protocols in Molecular Biology New York Greene Publishing Associates and Wiley Interscience Baron M Reynes J P Stassi D and Tiraby G 1992 A Selectable Bifunctional b Galactosidase Phleomycin resistance Fusion Protein as a Potential Marker for Eukaryotic Cells Gene 114 239 243 Berdy J 1980 Bleomycin Type Antibiotics In Amino Acid and Peptide Antibiotics J Berdy ed Boca Raton FL CRC Press pp 459 497 Blissard G W and Rohrmamn G F 1989 Location Sequence Transcriptional Mapping and Temporal Expression of the gp64 Envelope Glyc
7. desired yield of protein If your protein is secreted you may culture cells in serum free medium to simplify purification As you expand your stable cell line you can reduce the concentration of Zeocin to about 50 ug ml We have grown stably transformed Sf9 and High Five cell lines under nonselecting conditions for 60 passages without loss of protein expression If your protein is secreted use a serum free medium to facilitate expression and purification Sf9 cells can be switched from complete TNM FH to Sf 900 II SFM during passage Refer to the Insect Cell Lines manual for more information on how to adapt cells to different medium TM If you plan to use a metal chelating resin such as ProBond to purify your secreted protein from serum free medium note that adding serum free medium directly to the column will strip the nickel ions from the resin See the information below in Purification of 6xHis tagged Proteins from Medium for a general recommendation to address this issue Many protocols are suitable for purifying proteins from the medium The choice of protocol depends on the nature of the protein being purified Note that the culture volume needed to purify sufficient quantities of protein is dependent on the expression level of your protein and the method of detection To purify 6xHis tagged proteins from the medium see below To purify 6xHis tagged recombinant proteins from the culture medium we r
8. e g polyhedrin or p10 However other proteins may be expressed more efficiently in the InsectSelect System than in baculovirus systems Jarvis et al 1996 To date expression levels range from 1 ug ml human IL 6 Invitrogen to 8 10 ug ml human melanotransferrin Hegedus et al 1999 continued on next page Overview continued Zeocin Resistance Experimental Outline Zeocin a member of the phleomycin family of antibiotics exhibits toxicity towards a broad range of prokaryotic and eukaryotic organisms Recently it has TM been demonstrated that Zeocin can be used to select resistant insect cell lines i e Sf9 and Drosophila Kcl and SL2 Pfeifer et al 1997 Shuttle vectors were developed that utilized a second copy of the OpIE2 promoter to express the Streptoalloteichus hindustanus ble gene Sh ble Zeocin resistance gene Hegedus et al 1998 Insect cells transfected with these plasmids can be selected for stable integration of the plasmid Analysis of stable cell lines reveals that vector integration into chromosomal DNA is multi copy in nature Pfeifer et al 1997 TM For more information on Zeocin see page 27 The table below describes the general steps needed to clone and express your TM gene of interest using the InsectSelect kit of choice For more details refer to the manual and pages indicated Step Action Source Establish culture of Sf9 or High F
9. its blue color This copper chelated form is inactive When the antibiotic enters the cell the copper cation is reduced from Cu to Cu and removed by sulfhydryl compounds in the cell Upon removal of the copper Zeocin is activated and will bind DNA and cleave it causing cell death The structure of Zeocin is shown below Berdy 1980 H CONH2 CH3 H NH N ae Oe e 2 NH MW 1 535 TM High salt and extremes in pH inactivate Zeocin Therefore we recommend that you reduce the salt in bacterial medium and adjust the pH to 7 5 to keep the drug active Store Zeocin at 20 C and thaw on ice before use Zeocin is light sensitive Store drug plates and medium containing drug in the dark Wear gloves a laboratory coat and safety glasses or goggles when handling solutions containing Zeocin Zeocin is toxic Do not ingest or inhale solutions containing the drug 27 Technical Service World Wide Web Visit the Invitrogen website at www invitrogen com for e Technical resources including manuals vector maps and sequences application notes MSDSs FAQs formulations citations handbooks etc e Complete technical support contact information e Access to the Invitrogen Online Catalog Additional product information and special offers Contact Us For more information or technical assistance call write fax or email Additional international offices are listed on our Web page w
10. protein of interest The gene of interest is cloned into pIZ V5 His and transfected into Sf9 or High Five cells using lipid mediated transfection After transfection cells can be assayed for expression of the gene of interest Once you have confirmed that your gene expresses you can select for a stable polyclonal population or stable clonal cell lines using Zeocin as a selection agent Stable cell lines can be used to express the protein of interest in either adherent culture or suspension culture Baculovirus immediate early promoters utilize the host cell transcription machinery and do not require viral factors for activation The OpIE2 promoter is from the baculovirus Orgyia pseudotsugata multicapsid nuclear polyhedrosis virus OpMNPV The virus natural host is the Douglas fir tussock moth however the promoter allows protein expression in Lymantria dispar LD652Y Spodoptera frugiperda cells Sf9 Hegedus et al 1998 Pfeifer et al 1997 Sf21 Invitrogen Trichoplusia ni High Five Invitrogen Drosophila Kc1 SL2 Hegedus et al 1998 Pfeifer et al 1997 and mosquito cell lines unpublished data The OpIE2 promoter has been sequenced and analyzed For more detailed information on this promoter see page 26 The OpIE2 promoter provides relatively high levels of constitutive expression although not all proteins will be expressed at levels equivalent to those obtained from baculovirus very late promoters
11. right to use the purchased amount of the product and components of the product in research conducted by the buyer whether the buyer is an academic or for profit entity The buyer cannot sell or otherwise transfer a this product b its components or c materials made using this product or its components to a third party or otherwise use this product or its components or materials made using this product or its components for Commercial Purposes The buyer may transfer information or materials made through the use of this product to a scientific collaborator provided that such transfer is not for any Commercial Purpose and that such collaborator agrees in writing a not to transfer such materials to any third party and b to use such transferred materials and or information solely for research and not for Commercial Purposes Commercial Purposes means any activity by a party for consideration and may include but is not limited to 1 use of the product or its components in manufacturing 2 use of the product or its components to provide a service information or data 3 use of the product or its components for therapeutic diagnostic or prophylactic purposes or 4 resale of the product or its components whether or not such product or its components are resold for use in research For products that are subject to multiple limited use label licenses the terms of the most restrictive limited use label license shall control Life Technologi
12. specifications stated on the certificate of analysis The company will replace free of charge any product that does not meet those specifications This warranty limits Invitrogen Corporation s liability only to the cost of the product No warranty is granted for products beyond their listed expiration date No warranty is applicable unless all product components are stored in accordance with instructions Invitrogen reserves the right to select the method s used to analyze a product unless Invitrogen agrees to a specified method in writing prior to acceptance of the order Invitrogen makes every effort to ensure the accuracy of its publications but realizes that the occasional typographical or other error is inevitable Therefore Invitrogen makes no warranty of any kind regarding the contents of any publications or documentation If you discover an error in any of our publications please report it to our Technical Service Representatives Invitrogen assumes no responsibility or liability for any special incidental indirect or consequential loss or damage whatsoever The above limited warranty is sole and exclusive No other warranty is made whether expressed or implied including any warranty of merchantability or fitness for a particular purpose 29 Purchaser Notification Limited Use Label The InsectSelect System the Expression Kit was developed into an ex License No 68 pression system by scientists at the Univ
13. to 30 ug protein per lane For the cell pellet sample load the same volume as the lysate Amount loaded depends on the amount of your protein produced Electrophorese your samples blot and probe with antibody to your protein antibody to the V5 epitope or antibody to the C terminal polyhistidine tag see page ix Visualize proteins using your desired method We recommend using chemiluminescence or alkaline phosphatase for detection The C terminal tag containing the V5 epitope and 6xHis tag will increase the size of your protein by 3 kDa Note that any additional amino acids between your protein and the tags are not included in this molecular weight calculation continued on next page Transient Expression in Insect Cells continued Polyacrylamide To facilitate separation of your recombinant protein by polyacrylamide gel Gel electrophoresis a wide range of pre cast NuPAGE and Novex Tris Glycine Electrophoresis polyacrylamide gels are available from Invitrogen In addition Invitrogen also carries a large selection of molecular weight protein standards and staining kits For more information about the appropriate gels standards and stains to use to visualize your recombinant protein refer to our Web site www invitrogen com or call Technical Service see page 28 Western Analysis To detect expression of your recombinant fusion protein by Western blot analysis you may use the Anti V5 antibodies or the Anti His C te
14. under selection with Zeocin For more information on Zeocin see page 27 The table below provides recommended concentrations of Zeocin to use with Sf9 Sf21 and High Five cells Effective concentrations are media dependent If you have trouble selecting cells using the concentrations below we recommend that you perform a kill curve see next page Cells Media Concentration of Zeocin ug ml Sf9 TNM FH 300 400 Express Five Serum Free 200 300 Sf21 TNM FH 300 500 Express Five Serum Free 300 400 High Five TNM FH 400 600 Express Five Serum Free 400 500 continued on next page 15 Selecting Stable Cell Lines continued Zeocin Selection Guidelines Zeocin Selection in High Five Cells Stable Transfection 16 If you wish to test your cell line for sensitivity to Zeocin perform a kill curve as described below Assays can be done in 24 well tissue culture plates e Prepare complete TNM FH Sf9 or Express Five Serum Free Medium High Five supplemented with 100 to 1000 ug ml Zeocin Generally concentrations that kill lepidopteran insect cells are in the 200 to 600 pg ml range e Test varying concentrations of Zeocin on the cell line to determine the concentration that kills your cells within a week kill curve e Use the concentration of drug which kills your cells within a week If you are using High Five cells
15. 0 early polyadenylation sequence bases 3423 3552 25 OplE2 Promoter Description 61 121 181 241 301 361 421 481 541 26 The OpIE2 promoter has been analyzed by deletion analysis using a CAT reporter in both Lymantria dispar LD652Y and Spodoptera frugiperda Sf9 cells Expression in Sf9 cells was much higher than in LD652Y cells Deletion analysis revealed that sequence up to 275 base pairs from the start of transcription are necessary for maximal expression Theilmann and Stewart 1992 Additional sequence beyond 275 may broaden the host range expression of this plasmid to other insect cell lines Tom Pfeifer personal communication In addition an 18 bp element appears to be required for expression This 18 bp element is repeated almost completely in three different locations and partially at six other locations These are marked in the figure below Elimination of the three major 18 bp elements reduces expression to basal levels Theilmann and Stewart 1992 The function of these elements is not known Primer extension experiments revealed that transcription initiates equally from either the C or the A indicated These two transcriptional start sites are adjacent to a CAGT sequence motif that has been shown to be conserved in a number of early genes Blissard and Rohrmann 1989 GGATCATGAT GATAAACAAT GTATGGTGCT AATGTTGCTT CAACAACAAT TGTGTTTTCA TTTTGCACTG TTTCGTAGAC ACACATTGAA TGTTT
16. 000 01 See the table below for shipping and storage information Kit Shipping Storage pIZ V5 His Vector Kit Wet Ice 20 C InsectSelect System Dry Ice Vectors primers 20 C with Sf9 Cells Zeocin 20 C protected from light InsectSelect System Dry Ice Cells Liquid nitrogen with High Five Cells Cellfectin Reagent 4 C Medium 4 C protected from light Supplied with all the kits listed above Store at 20 C Item Composition Volume pIZ V5 His 20 ug at 0 5 ug ul in TE buffer pH 8 0 40 ul 10 mM Tris HCl 1 mM EDTA pH 8 0 pIZ V5 His CAT 20 ug at 0 5 ug ul in TE buffer pH 8 0 40 ul 10 mM Tris HCl 1 mM EDTA pH 8 0 OpIE2 Reverse Sequencing Primer Lyophilized in TE pH 8 2 ug The sequence of the primer is provided below Primer Sequence pMoles Supplied OpIE2 Reverse 5 GACAATACAAACTAAGATTTAGTCAG 3 250 Supplied with the InsectSelect System kits only Zeocin is available separately see page viii Store at 20 C protected from light Amount Supplied 1 g 8 tubes x 125 mg Composition 100 mg ml in autoclaved deionized water 1 25 ml aliquots continued on next page Kit Contents continued Cellfectin Reagent Cells and Medium Manuals Supplied with the InsectSelect System kits only Cellfectin Reagent is available separately see page viii Store at 4
17. C Amount Supplied 125 ul Composition 1 mg ml lipid in membrane filtered water Supplied with the InsectSelect System kits only Additional cells and other cell lines are available separately see page viii Store the cells in liquid nitrogen Store the medium at 4 C protected from light TM Different cells and media are included depending on which InsectSelect System kit you ordered Refer to the table below To culture Sf9 and High Five cells refer to the Insect Cell Lines manual included with each kit M Kit Cells Medium InsectSelect System Sf9 Grace s Insect Cell Culture Medium with Sf9 Cells Unsupplemented contains L glutamine 2 x 500 ml InsectSelect System High Five Express Five Serum Free Medium with High Five Cells 1 liter The following manuals are supplied with each kit Kit Manual InsectSelect System with Sf9 Cells InsectSelect System manual Insect Cell Lines manual InsectSelect System with High Five InsectSelect System manual Cells Insect Cell Lines manual pIZ V5 His Vector Kit InsectSelect System manual only continued on next page Kit Contents continued Reagents Supplied by the User vi Be sure to have the following reagents and equipment on hand before starting experiments Fetal Bovine Serum FBS 5 10 and 25 ml sterile pipettes Cryovials Hemacytometer and Trypan Blue see pag
18. GCCAA CAAAAAAACA TATTTTACAT CCTTTTTGCA TATCGGGTCG l CGTCCTGTCA CAAGCACCTT CGCTTTTGCA AAATAGTCTA GTGCAAAAAA CGTACGAATC TCGTGACAGG AACAGGACGC GCCCGTCCCG ACAGCATCTG ACGCCAGCTT l CCTGTGTTGC ee GCCTCCATAT ES gt ooh CTTATCGCGC TTCGAATTTA CAGCCGCGCG TATA RER CTATAAATAC TATACTCGGT CGCGGGCCCA CACCGTTGTA GTACGTGTCG GGCCTCCCCA TACATAGTAC TACGCTCCAA GCAGTCACGT ACATTATCGG TAACCGCAGC IS TTATCTCATG AGCCCGCAAC l ACCGGACGAG CGGACGCAAC CGCGTGACCG GATCTGGTAA TCTGTTGAAC CCACCAACTT AAACTCTACG ATACACTACC AGGCCGGCCT a TGTTGTCTTA TCCTTATCGG GACACGAGGC Start of Transcription mo ACACAGTTGA Zeocin Introduction Chemical Structure of Zeocin Handling Zeocin Zeocin is a member of the bleomycin phleomycin family of antibiotics isolated from Streptomyces Berdy 1980 Zeocin and the resistance gene Sh ble can be used for selection in mammalian cells Mulsant et al 1988 insect cells Pfeifer et al 1997 plants Perez et al 1989 yeast Baron et al 1992 and prokaryotes Drocourt et al 1990 It is particularly well suited for selection of mammalian and insect stable cell lines Zeocin is a formulation of phleomycin D1 a basic water soluble copper chelated glycopeptide isolated from Streptomyces verticillus The presence of copper gives the solution
19. and bring volume up to 1 liter Autoclave on liquid cycle for 20 minutes at 15 psi Allow solution to cool to 55 C and add Zeocin to a final concentration of 25 50 pg ml 4 Store at room temperature or at 4 C protected from light Medium is stable for 2 weeks Low Salt LB agar plates 1 Prepare Low Salt LB medium as above but add 15 g L agar 2 Autoclave on liquid cycle for 20 minutes at 15 psi 3 Let cool to 55 C add Zeocin 25 50 ug ml and pour into 10 cm plates 4 Let harden then invert and store at 4 C in the dark Plates are stable for 2 weeks to 1 month continued on next page Transforming E coli continued Note Long Term Storage Important For convenient preparation of Low Salt LB medium or plates containing Zeocin we offer imMedia imMedia is premixed pre sterilized E coli growth medium that contains everything you need in a convenient pouch You can easily prepare either Low Salt LB liquid medium 200 ml or agar plates 8 10 plates Simply mix the pouch contents with distilled water microwave the solution and pour plates or cool the liquid medium before inoculating E coli Ordering information is provided below For more information contact Technical Service page 28 Item Amount Catalog no imMedia Zeo Liquid 20 pouches Q620 20 imMedia Zeo Agar 20 pouches Q621 20 For long term storage prepare a glycerol stock of each strain co
20. appropriate serum free medium in a 60 mm dish Rock gently from side to side for 2 to 3 minutes to evenly distribute the cells Do not swirl the plates in a circular motion Cells should be 50 to 60 confluent 2 Incubate the cells for at least 15 minutes without rocking to allow the cells to fully attach to the bottom of the dish to form a monolayer of cells 3 Verify that the cells have attached by inspecting them under an inverted microscope Positive and We recommend that you include the following controls Negative Controls pIZ V5 His CAT vector as a positive control for transfection and expression e Lipid only as a negative control e DNA only to check for DNA contamination e If you use another lipid besides Cellfectin Reagent review the protocol on Note the next page and consult the manufacturer s instructions to adapt the protocol for your use You may have to empirically determine the optimal conditions for transfection e Do not linearize the plasmid prior to transfection Linearizing the plasmid appears to decrease protein expression The reason for this is not known continued on next page 10 Transient Expression in Insect Cells continued Transfection Mix plasmid DNA and Cellfectin Reagent together in the appropriate medium Procedure see below and incubate with freshly seeded insect cells The amount of cells liposomes and plasmid DNA has been optimized for 60 mm culture plates It is im
21. arious InsectSelect vector kits available from Invitrogen visit our World Wide Web site www invitrogen com or call Technical Service see page 28 See the table below for ordering information Product Catalog no pIZT V5 His Vector Kit V8010 01 pIB V5 His Vector Kit V8020 01 pIB V5 His TOPO TA Expression K890 01 Kit continued on next page vii Accessory Products continued Detection of Recombinant Proteins Purification of Recombinant Protein viii Expression of your recombinant fusion protein can be detected using an antibody to the appropriate epitope The table below describes the antibodies available for detection of C terminal fusion proteins expressed using the pIZ V5 His Horseradish peroxidase HRP or alkaline phosphatase AP conjugated antibodies allow one step detection using colorimetric or chemiluminescent detection methods The amount of antibody supplied is sufficient for 25 Westerns Lindner et al 1997 HHHHHH COOH Product Epitope Catalog no Anti V5 Antibody Detects 14 amino acid epitope R960 25 Anti V5 HRP Antibody derived from the P and V proteins of R961 25 the paramyxovirus SV5 Southern et Anti V5 AP Antibody al 1991 R962 25 GKPIPNPLLGLDST Anti His C term Antibody Detects the C terminal polyhistidine R930 25 Anti His C term HRP Antibody 0XHis tag requires the free R931 25 carboxyl group
22. aster stocks available If you purchased one of the InsectSelect System kits Catalog nos K800 01 or K805 01 you will receive either Sf9 or High Five cells and the Insect Cell Lines manual Use this manual as a guide to initiate cell culture This manual may be viewed and printed from our Web site www invitrogen com as a PDF portable document format file if you have Adobe Reader available free from www adobe com Alternatively you may request the manual from Technical Service see page 28 To culture Sf9 or High Five cells refer to the Insect Cell Lines manual This manual covers the following topics e Thawing frozen cells e Maintaining and passaging cells e Freezing cells e Using serum free medium e Growing cells in suspension e Scaling up cell culture For the best recovery and viability thaw High Five cells into Express Five Serum Free medium and thaw Sf9 cells into complete TNM FH TNM FH containing 10 FBS You may also use Sf21 cells as a host for pIZ V5 His Sf21 cells are larger and may produce more protein than Sf9 cells Refer to the Insect Cell Lines manual for more information You will need log phase cells with gt 95 viability to perform a successful transfection Review pages 9 14 to determine how many cells you will need for transfection Cloning into pIZ V5 His Introduction General Molecular Biology Techniques Propagation and Maintenance of pIZ V5 His
23. bases 749 878 pUC origin bases 947 1620 OplE2 promoter bases 1665 2213 EM7 promoter bases 2231 2308 Zeocin resistance marker ORF bases 2309 2683 SV40 early polyadenylation sequence bases 2747 2876 continued on next page 23 pIZ V5 His Map and Features continued Features 24 The features of pIZ V5 His 2876 bp are described below All features have been functionally tested The multiple cloning site has been tested by restriction analysis Features Function OpIE2 promoter Provides high level constitutive expression of the gene of interest in lepidopteran insect cells Theilmann and Stewart 1992 Multiple cloning site 14 unique sites Permits insertion of the gene of interest for expression V5 epitope Gly Lys Pro Ile Pro Asn Pro Leu Leu Gly Leu Asp Ser Thr Allows detection of your recombinant protein with the Anti V5 Antibodies Southern et al 1991 6xHis tag Permits purification of your recombinant protein on metal TM chelating resin such as ProBond In addition the C terminal 6xHis tag is the epitope for the Anti His C term Antibodies Lindner et al 1997 OpIE2 Reverse priming site Allows sequencing of the insert from the 3 end OpIE2 polyadenylation sequence Efficient transcription termination and polyadenylation of mRNA Theilmann and Stewart 1992 pUC origin Replication maintenance and high copy number in E
24. ble cell per well is achieved 1 Forty eight hours after transfection dilute the cells to 1 x 10 cells ml in medium without Zeocin Note Other dilutions of the culture should also be used as transfection efficiency will determine how many transformed cells there will be per well 2 Add 100 pl of the cell solution from Step 1 to 32 wells of a 96 well microtiter plate 8 rows by 4 columns 3 Dilute the remaining cells 1 1 with medium without Zeocin and add 100 ul of this solution to the next group of 32 wells 8 x 4 4 Once again dilute the remaining cells 1 1 with medium without Zeocin and add 100 ul of this solution to the last group of 32 wells Note Although the cells can be diluted to low numbers cell density is critical for viability If the density drops below a certain level the cells will not grow 5 Let the cells attach overnight then remove the medium and replace with medium containing Zeocin Note Removing and replacing medium may be tedious If you slough the cells gently it is possible to dilute the cells directly into selective medium 6 Wrap the plate and incubate at 27 C for 1 week It s not necessary to change the medium Check the plate after a week and mark the wells that have only one colony 8 Continue to incubate the plate until the colony fills most of the well 9 Harvest the cells and transfer to a 24 well plate with 0 5 ml of fresh medium containing Zeocin 10 Continue to ex
25. crylamide gels see below refer to the manufacturer s instructions to prepare the appropriate sample buffer 1 10 11 Prepare an SDS PAGE gel that will resolve your expected recombinant protein Remove the medium from the cells If your protein is secreted be sure to save and assay the medium Optional You may wash the cells with PBS prior to adding the Cell Lysis Buffer if you are concerned about the presence of serum Add 100 ul Cell Lysis Buffer to the plate and slough or scrape the cells into a microcentrifuge tube Vortex the cells to ensure they are completely lysed Centrifuge a maximum speed for 1 2 minutes to pellet nuclei and cell membranes Transfer the supernatant to a new tube Note If you are expressing a membrane protein it may be located in the pellet Be sure to assay the pellet see below Assay the lysate for protein concentration You may use the Bradford method Lowry assay or BCA assay Pierce To assay your samples mix them with SDS PAGE sample buffer as follows e Lysate 30 ul lysate with 10 ul 4X SDS PAGE sample buffer e Cell Pellet Resuspend pellet in 100 ul 1X SDS PAGE sample buffer e Medium 30 ul medium with 10 ul 4X SDS PAGE sample buffer Note Because of the volume of medium it is difficult to normalize the amount loaded on an SDS PAGE gel If you are concerned about normalization concentrate the medium Boil the samples for 5 minutes Centrifuge briefly Load approximately 3
26. e 21 Table top centrifuge 60 mm tissue culture plates other flasks and plates may be used Sterile microcentrifuge tubes 1 5 ml Cell Lysis Buffer see page 21 PBS see page 22 Cloning cylinders optional 96 well plates optional Accessory Products Products Available The following products are available separately from Invitrogen Separately Other InsectSelect Kits Product Amount Catalog no Sf9 Cells frozen 1 ml vial 1 x 107 cells ml B825 01 Sf21 Cells frozen 1 ml vial 1 x 107 cells ml B821 01 High Five Cells frozen 1 ml vial 3 x 10 cells ml B855 02 Grace s Insect Cell Culture Medium 500 ml 11595 030 Unsupplemented Sf 900 II SFM 1 liter 10902 088 Express Five SFM 1 liter 10486 025 Cellfectin Reagent 1ml 10362 010 Zeocin 1 gram R250 01 5 gram R250 05 pIZ V5 His Vector Kit 20 ug pIZ V5 His V8000 01 20 ug pIZ V5 His CAT 2 ug OpIE2 Reverse primer Several other kits that allow you to clone and stably express your gene of interest using the InsectSelect technology are available from Invitrogen These kits include InsectSelect vectors with different antibiotic resistance genes In addition the pIZT V5 His Vector Kit enables expression of a gene of interest and a cycle 3 GFP Zeocin fusion gene This allows both visual monitoring of transfection efficiency and generation of a stable cell line For more information about the v
27. ecommend that you perform ion exchange chromatography prior to affinity chromatography on metal chelating resins lon exchange chromatography allows e Removal of media components that strip Ni from metal chelating resins e Concentration of your sample for easier manipulation in subsequent purification steps Conditions for successful ion exchange chromatography will vary depending on the protein For more information refer to Current Protocols in Protein Science Coligan et al 1998 Current Protocols in Molecular Biology Unit 10 Ausubel et al 1994 or the Guide to Protein Purification Deutscher 1990 continued on next page 19 Scale Up and Purification continued Metal chelating Resin Note Purification of Intracellularly Expressed Proteins Scale Up 20 You may use the ProBond Purification System Catalog no K850 01 or a similar product to purify your 6xHis tagged protein The ProBond Purification System contains ProBond a metal chelating resin specifically designed to purify 6xHis tagged proteins Before starting be sure to consult the ProBond Purification System manual to familiarize yourself with the buffers and the binding and elution conditions If you are using another resin consult the manufacturer s instructions Many insect cell proteins are naturally rich in histidines with some containing stretches of six histidines When using the ProBond Purification System or oth
28. equence of pIZ V5 His is available for downloading from our World Wide Web site www invitrogen com or from Technical Service see page 28 For a map and a description of the features of pIZ V5 His refer to pages 23 24 Start of transcription TATA Box fee CTTATCGCGC CTATAAATAC AGCCCGCAAC GATCTGGTAA ACACAGTTGA ACAGCATCTG TICGAATTTA Sac Hind I Acc65 Kpn Ech 36 1 BamH Spe l BstX EcoR l EcoR V AAG CTT GGT ACC GAG CTC GGA TCC ACT AGT CCA GTG TGG TGG AAT TCT GCA GAT Lys Leu Gly Thr Glu Leu Gly Ser Thr Ser Pro Val Trp Trp Asn Ser Ala Asp BstX l Not Xho l Xba Sac ll m ATC CAG CAC AGT GGC GGC CGC TCG AGT CTA GAG GGC CCG CGG TTC GAA GGT AAG Ile Gln His Ser Gly Gly Arg Ser Ser Leu Glu Gly Pro Arg Phe Glu Gly Lys V5 epitope Mlu 6xHis tag l Age m CCT ATC CCT_AAC CCT CTC CTC GGT CTC GAT TCT ACG CGT ACC GGT CAT CAT CAC Pro Ile Pro Asn Pro Leu Leu Gly Leu Asp Ser Thr Arg Thr Gly His His His OpIE2 Reverse priming site PA AA CAT CAC CAT TGA GTTTAT CTGACTAAAT CTTAGTTTGT ATTGTCATGT TTTAATACAA TATGTTATGT His His His OpIE2 polyadenylation signal EA TTAAATATGT TTTTAATAAA TTTTATAAAA TAATTTCAAC TTTTATTGTA ACAACATTGT CCATTTACAC 3 untranslated region of OplE2 ACTCCTTTCA AGCGCGTGGG ATCGATGCTC ACTCAAAGGC GGTAATACGG TTATCCACAG AATCAGGGGA continued on next page Cloning into pIZ V5 His continued E coli Transformation Important END Y A Eco gt zZ Nous N l Prepare competen
29. er similar products to purify 6xHis tagged proteins these histidine rich proteins may co purify with your protein of interest The contamination can be significant if your protein is expressed at low levels We recommend that you add 5 mM imidazole to the binding buffer prior to addition of the protein mixture to the column Addition of imidazole may help to reduce background contamination by preventing proteins with low specificity from binding to the metal chelating resin If you are expressing your 6xHis tagged protein intracellularly you may lyse the cells and add the lysate directly to the ProBond column You will need 5 x 10 to 1 x 107 cells for purification of your protein on a 2 ml ProBond column see ProBond Purification System manual Seed 2 x 10 cells in two or three 25 cm flasks Grow the cells in selective medium until they reach confluence 4 x 10 cells Wash cells once with PBS Harvest the cells by sloughing the cells Transfer the cells to a sterile centrifuge tube Oy Ql BS 0 1 Centrifuge the cells at 1000 x g for 5 minutes You may lyse the cells immediately or freeze in liquid nitrogen and store at 80 C until needed To scale up insect cell culture refer to the Insect Cell Lines manual Recipes TNM FH Medium Complete TNM FH Medium Trypan Blue Exclusion Assay Cell Lysis Buffer Appendix Grace s Insect Cell Culture Medium with additional supplements TC yeastolate a
30. ersity of British Columbia UBC for InsectSelect high level expression of recombinant proteins Components of the InsectSelect Technology System are covered by one or more U S patents or patent applications and corresponding foreign patents or patent applications owned and or licensed by UBC and others Life Technologies Corporation Life Technologies has an exclusive license to sell the Expression Kit to scientists for academic research or one year commer cial evaluation only under the terms described below Use of the Expression Kit for any Commercial Purpose as defined below other than evaluation re quires the user to obtain a commercial license as detailed below Before using the Expression Kit please read the terms and conditions set forth below Your use of the Expression Kit shall constitute acknowledgment and acceptance of these terms and conditions If you do not wish to use the Expression Kit pur suant to these terms and conditions please contact Life Technologies Technical Services to return the unused and unopened Expression Kit for a full refund Otherwise please complete the Product User Registration Card and return it to Life Technologies Life Technologies grants you a non exclusive license to use the enclosed Expression Kit for academic research or for commercial evaluation purposes only The Expression Kit is being transferred to you in furtherance of and reliance on such license You may not use the Expres
31. es Corporation will not assert a claim against the buyer of infringement of patents owned or controlled by Life Technologies Corporation which cover this product based upon the manufacture use or sale of a thera peutic clinical diagnostic vaccine or prophylactic product developed in research by the buyer in which this product or its components was employed provided that neither this product nor any of its components was used in the manufacture of such product If the purchaser is not willing to accept the limitations of this limited use statement Life Technologies is willing to accept return of the product with a full refund For information about purchasing a license to use this product or the technology embedded in it for any use other than for research use please contact Out Licensing Life Technologies 5791 Van Allen Way Carlsbad California 92008 Phone 760 603 7200 or e mail outlicensing lifetech com continued on next page 31 Purchaser Notification continued Limited Use Label License No 22 Vectors and Clones Containing Sequences Coding for Histidine Hexamer Limited Use Label License No 66 High Five Cells Product Qualification 32 This product is licensed under U S Patent Nos 5 284 933 and 5 310 663 and foreign equivalents from Hoffmann LaRoche Inc Nutley NJ and or Hoffmann LaRoche Ltd Basel Switzerland and is provided only for use in research Information about licenses for commercial use is
32. for detection Anti His C term AP Antibody R932 25 The metal binding domain encoded by the polyhistidine tag allows simple easy purification of your recombinant protein by Immobilized Metal Affinity TM Chromatography IMAC using Invitrogen s ProBond Resin see below To purify proteins expressed using the InsectSelect TM System the ProBond Purification System or the ProBond resin in bulk are available separately See the table below for ordering information Product Quantity Catalog no ProBond Purification System 6 purifications K850 01 ProBond Metal Binding Resin 50 ml R801 01 150 ml R801 15 Purification Columns 50 R640 50 10 ml polypropylene columns Overview Introduction Description of System Description of Promoter Expression Levels Introduction TM The InsectSelect System allows constitutive stable or transient expression of your protein of interest in insect cell lines The system utilizes a single expression vector pIZ V5 His to express your gene of interest This 2 9 kb vector has the following features e OplIE2 promoter for high level constitutive expression of the gene of interest Theilmann and Stewart 1992 e Zeocin resistance gene for selection of stable cell lines Hegedus et al 1998 Pfeifer et al 1997 e Optional C terminal peptide containing the V5 epitope and 6xHis tag for detection and purification of your
33. from 699 Vertebrate Messenger RNAs Nuc Acids Res 15 8125 8148 Kozak M 1991 An Analysis of Vertebrate mRNA Sequences Intimations of Translational Control J Cell Biol 115 887 903 Kozak M 1990 Downstream Secondary Structure Facilitates Recognition of Initiator Codons by Eukaryotic Ribosomes Proc Natl Acad Sci USA 87 8301 8305 Lindner P Bauer K Krebber A Nieba L Kremmer E Krebber C Honegger A Klinger B Mocikat R and Pluckthun A 1997 Specific Detection of His tagged Proteins With Recombinant Anti His Tag scFv Phosphatase or scFv Phage Fusions BioTechniques 22 140 149 Mann S G and King L A 1989 Efficient Transfection of Insect Cells with Baculovirus DNA Using Electroporation J Gen Virol 70 3501 3505 continued on next page 33 References continued Mulsant P Tiraby G Kallerhoff J and Perret J 1988 Phleomycin Resistance as a Dominant Selectable Marker in CHO Cells Somat Cell Mol Genet 14 243 252 Neumann J R Morency C A and Russian K O 1987 A Novel Rapid Assay for Chloramphenicol Acetyltransferase Gene Expression BioTechniques 5 444 447 Perez P Tiraby G Kallerhoff J and Perret J 1989 Phleomycin Resistance as a Dominant Selectable Marker for Plant Cell Transformation Plant Mol Biol 13 365 373 Pfeifer T A Hegedus D D Grigliatti T A and Theilmann D A 1997 Baculovirus Immediate Early Pro
34. heck the following e Impure DNA Cells will appear unhealthy when compared to the negative control DNA only no lipids Use clean pure DNA isolated by resin based DNA isolation kits ie PureLink HiPure Plasmid Midiprep Kit or CsCl gradient ultracentrifugation e Poor Cell Viability Be sure to test cells for viability and make sure you use log phase cells Refer to the Insect Cell Lines manual to troubleshoot cell culture e Method of Transfection Optimize transfection or try a different method Low or No Protein Expression e Gene not cloned in frame with the C terminal sequence If it is not in frame with the C terminal peptide sequence expression will not be detected using the antibody to the V5 epitope or the C terminal histidine tag e No Kozak sequence for proper initiation of translation Translation will be inefficient and the protein will not be expressed at its optimal level e Optimize expression If you ve tried a time course to optimize expression try switching cell lines Proteins may express better in a different cell line e Proteins are degraded Include protease inhibitors in the Cell Lysis buffer to prevent degradation of recombinant protein e Poor secretion Check the cell pellet as well as the medium when analyzing secreted expression Protein may be trapped in the cell and not secreted To TM improve secretion try a different cell line i e High Five Selecting Stable Cell Lines Introd
35. invitrogen InsectSelect System For the Stable Expression of Heterologous Proteins in Lepidopteran Insect Cell Lines using plZ V5 His Catalog nos K800 01 K805 01 V8000 01 Version H 21 October 2010 25 0282 Table of Contents Kit Contents iii A UA de UI A lidad iv A RN vii Introduction eu 1 OVELVIEWE an ee A Aa 1 Methods 3 Culturing Insect Cells ctra nr R in Bahn B Ense 3 Cloning into pIZ VOTES ss ao E A A A A AL A A E AE Ba 4 Transforming E COM 8s doradas spaces AnS eraa dai Oia ER ada 7 Transient Expression in Insect Cells c ccccccccssssesssssseceseteesesesesesnsnsnesescseseeceeeeesesesesesesesnsnenssssesesnananenesessaesees 10 Selecting Stable Cell LINES netiis O 16 ocale Up and Puras caba 21 Appendix iii A Ad a 23 Tei o Te A A EA En EE EA ab A EA Seeds 23 PIZ V5 His Map and Rea tures eiii ernennen el 25 PIZND HS CAT MAD ADA en TA 27 OPTE2 Promoters ota ela ion 28 LEO A id 29 Technical Service montt la a ns aa iaa 30 Purchaser Notification aen sen seneisihntneekatanlent oo RREbEREstelkegchsiiesinsulinulesgehnnsn 32 References A A aaea a a fides d loco selidest leds dosed E 35 Kit Contents Types of Kits Shipping Storage Vectors and Primer Primer Sequence Zeocin This manual covers the kits listed below Kit Catalog no InsectSelect System with Sf9 Cells K800 01 InsectSelect System with High Five Cells K805 01 pIZ V5 His Vector Kit V8
36. ive cells from supplied frozen stock Note Other cell lines i e Sf21 may be used Refer to the Insect Cell Lines manual included with the System Kits or use your own laboratory protocols Develop a cloning strategy to ligate your gene of interest into pIZ V5 His Page 4 this manual Ligate your gene into pIZ V5 His and transform into a recA endA E coli strain e g TOP10 Select on Low TM Salt LB plates containing 25 50 pg ml Zeocin Pages 6 7 this manual Isolate plasmid DNA and sequence your recombinant expression vector to confirm that your protein is in frame with the C terminal peptide Page 6 this manual Transiently transfect Sf9 or High Five cells Page 9 this manual Assay for expression of your protein Page 12 this manual Create stable cell lines expressing the protein of interest by selecting with Zeocin Page 15 this manual Scale up expression for purification Page 19 this manual Insect Cell Lines manual Purify your recombinant protein by chromatography on metal chelating resin i e ProBond Page 19 this manual Methods Culturing Insect Cells Introduction Insect Cell Lines Manual Culturing Sf9 and High Five Cells Note Sf21 Cells Cells for Transfection Before you start your cloning experiments be sure to have cell cultures of either Sf9 or High Five cells growing and have frozen m
37. lude the C terminal peptide for detection with either the V5 or His C term antibodies or purification using the 6xHis tag you must clone your gene in frame with the peptide Be sure that your gene does not contain a stop codon upstream of the C terminal peptide If you do not wish to include the C terminal peptide include the native stop codon for your gene of interest or utilize one of the stop codons available in the multiple cloning site For example the Xba I site contains a stop codon Be sure to clone in frame with the stop codon If your protein of interest is normally secreted try expressing the protein using the native secretion signal To date all mammalian secretion signals tested have functioned properly in insect cells We have successfully expressed human interleukin 6 IL6 using the native secretion signal to levels of 1 2 ug ml In addition we recommend that you create a construct to express your protein intracellularly in the event that your protein is not secreted continued on next page Cloning into pIZ V5 His continued MCS of pIZ V5 His The TATA box start of transcription and the polyadenylation signal are marked 491 561 615 669 723 791 861 as described in Theilmann and Stewart 1992 Restriction sites are labeled to indicate the cleavage site Potential stop codons are shown underlined The multiple cloning site has been confirmed by sequencing and functional testing The complete s
38. mercial Products Expression Products means products ex pressed with the Expression Kit or with the use of any vectors or host strains in the Expression Kit Commercial Product means any product intended for commercial use continued on next page 30 Purchaser Notification continued Limited Use Label License No 68 InsectSelect Technology continued Limited Use Label License No 5 Invitrogen Technology Access to the Expression Kit must be limited solely to those officers employees and students of your entity who need access to perform the aforementioned research or evaluation Each such officer employee and student must be informed of these terms and conditions and agree in writing to be bound by same You may not distribute the Expression Kit or the vectors or host strains contained in it to others You may not transfer modified altered or original material from the Expression Kit to a third party without written notification to and written approval from Life Technologies You may not assign sub license rent lease or otherwise transfer any of the rights or obligations set forth herein except as expressly permitted by Life Technologies and RCT Inquiries for commercial use should be directed to Research Corporation Technologies 101 North Wilmot Road Suite 600 Tucson AZ 85711 3335 Tel 1 520 748 4400 Fax 1 520 748 0025 The purchase of this product conveys to the buyer the non transferable
39. moter Mediated Expression of the Zeocin Resistance Gene for Use as a Dominant Selectable Marker in Dipteran and Lepidopteran Insect Cell Lines Gene 188 183 190 Sambrook J Fritsch E F and Maniatis T 1989 Molecular Cloning A Laboratory Manual Second Edition Plainview New York Cold Spring Harbor Laboratory Press Southern J A Young D F Heaney F Baumgartner W and Randall R E 1991 Identification of an Epitope on the P and V Proteins of Simian Virus 5 That Distinguishes Between Two Isolates with Different Biological Characteristics J Gen Virol 72 1551 1557 Theilmann D A and Stewart S 1992 Molecular Analysis of the trans Activating IE 2 Gene of Orgyia pseudotsugata Multicapsid Nuclear Polyhedrosis Virus Virology 187 84 96 1999 2008 Invitrogen Corporation All rights reserved 34 invitrogen Corporate Headquarters Invitrogen Corporation 5791 Van Allen Way Carlsbad CA 92008 T 1 760 603 7200 F 1 760 602 6500 E tech_support invitrogen com For country specific contact information visit our web site at www invitrogen com
40. nd lactalbumin hydrolysate is referred to as TNM FH Trichoplusia ni Medium Formulation Hink TNM FH is not considered to be a complete medium until fetal bovine serum is added to a final concentration of 10 The serum does not have to be heat inactivated however the quality of the serum is important for optimal cell growth Penicillin Streptomycin may be added to a final concentration of 50 units ml of penicillin G and 50 pg ml of streptomycin sulfate Many scientists prefer to leave out penicillin and streptomycin to avoid propagating low level contamination Grace s Insect Cell Culture Medium Unsupplemented Catalog no 11595 030 may be purchased separately from Invitrogen Shelf life of the medium after opening is approximately 2 weeks at 27 C Shelf life is increased to about a month if the medium is stored at 4 C The color of the medium may vary from clear to yellow This is not harmful to the cells 1 Prepare a 0 4 stock solution of trypan blue in phosphate buffered saline pH 7 4 2 Mix 0 1 ml of trypan blue solution with 1 ml of cells and examine under a microscope at low magnification 3 Dead cells will take up trypan blue while live cells will exclude it Count live cells versus dead cells Cell viability should be at least 95 99 for healthy log phase cultures 50 mM Tris pH 7 8 150 mM NaCl 1 Nonidet P 40 1 This solution can be prepared from the following common stock solutions For 100 ml combine
41. ntaining plasmid It is also a good idea to keep a stock of the DNA at 20 C To prepare a glycerol stock e Grow the E coli strain containing the plasmid overnight e Combine 0 85 ml of the overnight culture with 0 15 ml of sterile glycerol e Vortex and transfer to a labeled cryovial e Freeze the tube in liquid nitrogen or dry ice ethanol bath and store at 80 C Note that pIZ V5 His contains two copies of the OpIE2 promoter see map on page 23 We have tested the stability of this plasmid with and without insert by serially passaging transformed E coli TOP10 cells recA over 3 or 4 days We have detected some rearrangement by day 3 We have not observed rearrangement after overnight growth Transient Expression in Insect Cells Introduction Plasmid Preparation Method of Transfection Control of Plasmid Quality Before Starting Once you have cloned your gene of interest into pIZ V5 His you are ready to transfect your construct into Sf9 or High Five cells using lipid mediated transfection and test for expression of your protein Plasmid DNA for transfection into insect cells must be very clean and free from phenol and sodium chloride Contaminants will kill the cells and salt will interfere with lipid complexing decreasing transfection efficiency We recommend isolating plasmid DNA using the PureLink HiPure Plasmid Midiprep Kit Catalog no K2100 04 or CsCl gradient centrifugation The PureLink
42. ontainers e 5mMEDTA pH8 continued on next page Transient Expression in Insect Cells continued Serum Free Media Several serum free media are available from Invitrogen for use in transfection experiments with pIZ V5 His Express Five SFM Catalog no 10486 025 is recommended for use with High Five cells while Sf 900 II SFM 1X Catalog no 10902 088 is optimized for use with Sf9 and Sf21 cells Other serum free media may be used although you may have to optimize conditions for transfection and selection Note that if you wish to transfect Sf9 or Sf21 cells in serum free medium you will need to adapt the cells to serum free medium before transfection see the Insect Cell Lines manual for a protocol Cellfectin Cellfectin Reagent is a 1 1 5 M M liposome formulation of the cationic lipid N Reagent N N N Tetramethyl N N N N tetrapalmitylspermine TM TPS and dioleoyl phosphatidylethanolamine DOPE in membrane filtered water Cellfectin Reagent has been found to be superior for transfection of Sf9 and High Five insect cells Prepare Cells For each transfection use log phase cells with greater than 95 viability We recommend that you set up enough plates to perform a time course for expression of your gene of interest Test for expression 2 3 and 4 days posttransfection You will need at least one 60 mm plate for each time point 1 For Sf9 cells or High Five cells seed 1 x 10 cells in
43. oprotein Gene of the Orgyia pseudotsugata Multicapsid Nuclear Polyhedrosis Virus Virology 170 537 555 Coligan J E Dunn B M Ploegh H L Speicher D W and Wingfield P T 1998 Current Protocols in Protein Science New York John Wiley Deutscher M P 1990 Guide to Protein Purification In Methods in Enzymology Vol 182 J N Abelson and M I Simon eds Academic Press San Diego CA Drocourt D Calmels T P G Reynes J P Baron M and Tiraby G 1990 Cassettes of the Streptoalloteichus hindustanus ble Gene for Transformation of Lower and Higher Eukaryotes to Phleomycin Resistance Nuc Acids Res 18 4009 Hegedus D D Pfeifer T A Hendry J Theilmann D A and Grigliatti T A 1998 A Series of Broad Host Range Shuttle Vectors for Constitutive and Inducible Expression of Heterologous Proteins in Insect Cell Lines Gene 207 241 249 Hegedus D D Pfeifer T A Theilmann D A Kennard M L Gabathuler R Jefferies W A and Grigliatti T A 1999 Differences in the Expression and Localization of Human Melanotransferrin in Lepidopteran and Dipteran Insect Cell Lines Protein Expression and Purification 15 296 307 Jarvis D L Weinkauf C and Guarino L A 1996 Immediate Early Baculovirus Vectors for Foreign Gene Expression in Transformed or Infected Insect Cells Protein Expression and Purification 8 191 203 Kozak M 1987 An Analysis of 5 Noncoding Sequences
44. over the monolayer This method reduces the chances of disturbing the monolayer 6 Incubate the dishes at room temperature for 4 hours on a side to side rocking platform Adjust speed to 2 side to side motions per minute Note If you do not have a rocker manually rock the dishes periodically 7 Following the 4 hour incubation period add 1 2 ml of complete TNM FH medium Sf9 cells or the appropriate serum free medium to each 60 mm dish place the dishes in a sealed plastic bag with moist paper towels to prevent evaporation and incubate at 27 C Note It is not necessary to remove the transfection solution as Cellfectin Reagent is not toxic to the cells If you are using a different lipid and observe loss of viability then remove the transfection solution after 4 hours rinse two times with medium and replace with 1 2 ml of fresh medium 8 Harvest the cells 2 3 and 4 days posttransfection and assay for expression of your gene see next page There s no need to add fresh medium if the cells are sealed in an airtight plastic bag with moist paper towels continued on next page 11 Transient Expression in Insect Cells continued Testing for Expression Note 12 Use the cells from one 60 mm plate for each expression experiment Before starting prepare Cell Lysis Buffer and SDS PAGE sample buffer Recipes are provided on pages 21 22 for your convenience but other recipes are suitable If you are using pre cast polya
45. pand the clone to 12 and 6 well plates and finally to a T 25 flask Assay each of your cell lines for yield of the desired protein and select the one with the highest yield for scale up and purification of recombinant protein If your protein is secreted remember to assay the medium You may wish to compare the yield of protein in the cells and supernatant In general the level of secreted protein is comparable to that obtained with viral expression systems in insect cells We have obtained stable cell lines that express and secrete human interleukin 6 to levels of 1 ug ml Human melanotransferrin has been expressed to levels of 8 10 pg ml Hegedus et al 1999 Remember to prepare master stocks and working stocks of your stable cell lines prior to scale up and purification Refer to the Insect Cell Lines manual for information on freezing your cells and scaling up for purification Scale Up and Purification Introduction Important Serum Free Medium Adapting Cells to Different Medium Purifying Proteins from Medium Purification of 6xHis tagged Proteins from Medium Once you have obtained stable cell lines expressing the protein of interest and prepared frozen stocks of your cell lines you are ready to purify your protein General information for protein purification is provided below Eventually you may expand your stable cell line into larger flasks spinners shake flasks or bioreactors to obtain the
46. portant that you optimize transfection conditions if you use plates or flasks other than 60 mm plates Note If you are using serum free medium we recommend using Sf 900 II SFM to transfect Sf9 cells and Express Five SFM to transfect High Five cells If you are using Grace s Medium be sure to use Grace s Medium without supplements or FBS The proteins in the FBS and supplements will interfere with the liposomes causing the transfection efficiency to decrease 1 To prepare each transfection mixture use a 1 5 ml microcentrifuge tube Add the following reagents Grace s Insect Media Sf9 OR Appropriate serum free medium 1ml pIZ V5 His plasmid or construct 1 ug ulin TE pH 8 1 10 ul Cellfectin Reagent mix well before use and always add last 20 yl Gently mix the transfection mixture for 10 seconds Incubate the transfection mixture at room temperature for 15 minutes While the transfection mixture is incubating proceed to Step 4 4 Carefully remove the medium from the cells without disrupting the monolayer Note If you are using medium containing serum wash the cells by carefully adding 2 ml of fresh Grace s Insect Media without supplements or FBS This will remove trace amounts of serum that will decrease the efficiency of liposome transfection Remove all of the medium from the monolayer 5 Add the entire transfection mix dropwise into the 60 mm dish Repeat for all transfections Distribute the drops evenly
47. rm antibodies available from Invitrogen see page ix for ordering information or an antibody to your protein of interest In addition the Positope Control Protein Catalog no R900 50 is available from Invitrogen for use as a positive control for detection of fusion proteins containing a V5 epitope or a polyhistidine 6xHis tag WesternBreeze Chromogenic Kits and WesternBreeze Chemiluminescent Kits are available from Invitrogen to facilitate detection of antibodies by colorimetric or chemiluminescent methods For more information refer to our Web site www invitrogen com or call Technical Service see page 28 Assay for CAT If you use pIZ V5 His CAT as a positive control vector you may assay for CAT expression using your method of choice Commercial kits to assay for CAT protein are available There is also a novel rapid radioactive assay Neumann et al 1987 CAT can be detected by Western blot using antibodies against the C terminal fusion tag see page ix or an antibody against CAT Catalog no R902 25 The CAT V5 His protein fusion migrates around 34 kDa on an SDS PAGE gel continued on next page 13 Transient Expression in Insect Cells continued Troubleshooting 14 Cells Growing Too Slowly Or Not At All For troubleshooting guidelines regarding cell culture refer to the Insect Cell Lines manual included with the kit Low Transfection Efficiency If the transfection efficiencies are too low c
48. row to confluence and split the cells 1 5 and test for expression Important Always use medium without Zeocin when splitting cells Let the cells attach before adding selective medium 7 Expand resistant cells into flasks to prepare frozen stocks Always use medium containing Zeocin when maintaining stable lepidopteran cell lines You may lower the concentration of Zeocin to 50 pg ml for maintenance continued on next page Selecting Stable Cell Lines continued Isolation of Clonal Cell Lines Using Cloning Cylinders If you elect to select clonal cell lines try to isolate as many foci as possible for expression testing As in mammalian cell culture the location of integration may affect expression of your gene Tip Perform selections in small plates or wells When you remove the medium you must work quickly to prevent the cells from drying out Using smaller plates or wells limits the number of foci you can choose at a time To select more foci increase the number of plates or wells not the size To select foci 1 Examine the closed plate under a microscope and mark the location of each foci on the top of the plate Transfer the markings to the bottom of the plate Be sure to include orientation marks Note Each foci will contain 50 to 200 cells Sf9 cells tend to spread more than High Five cells Move the culture dish to the sterile cabinet and remove the lid Apply a thin layer of sterile silicon grea
49. se to the bottom of the cloning cylinder Scienceware Catalog no 378747 00 or Belco Catalog no 2090 00608 using a sterile cotton tipped wooden applicator The layer should be thick enough to retard the flow of liquid from the cylinder without obscuring the opening on the inside Note Silicon grease can be sterilized by placing a small amount in a glass petri dish and autoclaving it Aspirate the culture medium and place the cylinder firmly and directly over the marked area Use a microscope if it is available to help you direct placement of the cylinder Use 20 to 100 ul of medium no Zeocin to slough the cells Try to hold the pipette tip away from the sides of the cloning cylinder this will take a little practice Remove the cells and medium and transfer to a microtiter plate and let the cells attach Remove medium and replace with selective medium for culturing Expand the cell line and test for expression of your gene of interest Important Always use medium without Zeocin when splitting cells Let the cells attach before adding selective medium continued on next page 17 Selecting Stable Cell Lines continued Isolation of Clonal Cell Lines Using a Dilution Method Assay for Expression Yield of Expressed Protein Important 18 You may also select clonal cell lines using a quick dilution method The objective of this method is to dilute the cells so that under selective pressure only one stable via
50. sion Kit or the materials contained therein for any Commercial Purpose without a license for such purpose from Research Corporation Technologies RCT If you are a commercial entity your right to use the Expression Kit expires after one year Any commercial entity that wishes to use the Expression Kit beyond this one year period must obtain a commercial license from RCT Commercial entities will be contacted by RCT during this one year period re garding their desire to obtain a commercial license You may terminate your use of the Expression Kit at any time by destroying all InsectSelect expression products in your control Your right to use the Expression Kit will also terminate automatically if you fail to comply with the terms and conditions set forth herein You shall upon such termination of your rights destroy all Expression Kits in your control and notify Life Tech nologies of such in writing Commercial Purpose include any use of Expression Products in a Commercial Product any use of Expression Products in the manufacture of a Commercial Product any sale of Expression Products any use other than evaluation of Expression products or the Expression Kit to facilitate or advance research or development of a Commercial Product and any use other than evaluation of Expression Products or the Expression Kit to facilitate or advance any research or development program the results of which will be applied to the devel opment of Com
51. t recA endA E coli cells e g TOP10 using your method of choice Transform your ligation mixtures and select on Low Salt LB plates containing 25 50 ug ml Zeocin see page 7 for more information Select 10 20 clones and analyze for the presence and orientation of your insert Note that pIZ V5 His contains two copies of the OpIE2 promoter see map on page 23 We have tested the stability of this plasmid with and without insert by serially passaging transformed E coli TOP10 cells recA over 3 or 4 days We have detected some rearrangement by day 3 We have not observed rearrangement after overnight growth We recommend that you sequence your construct to confirm that your gene is fused in frame with the V5 epitope and the polyhistidine tag Use the OpIE2 Reverse primer included in your kit and a primer to your gene of interest to sequence your insert see previous page Important Do not use a primer that is homologous to sequences in the OpIE2 promoter A second OpIE2 promoter drives expression of the Zeocin resistance gene The primer will bind to both locations and give you unreadable sequence Transforming E coli Introduction E coli Host Important Transformation Method Low Salt LB Medium and Agar Plates The pIZ V5 His vector contains the Zeocin resistance gene for selection of transformants in E coli and selection of stable cell lines in insect cells Drocourt et al 1990 Pfeifer et al 1997
52. to generate stable cell lines note that the state of confluency of the cells is important for effective Zeocin selection Zeocin selection is less effective when cells are overly confluent therefore make sure that your cells are not greater than 20 confluent when adding Zeocin see below Important High Five cells do not form an even monolayer on the tissue culture dish when confluent As the density increases cells will pile up on one another and form patches on the plate For stable transfections follow the steps below Include a mock transfection and a positive control pIZ V5 His CAT 1 Follow the transfection procedure on page 11 Steps 1 to 7 2 Forty eight hours posttransfection remove the transfection solution and add fresh medium no Zeocin 3 Split cells 1 5 25 confluent and let cells attach for 15 minutes before adding selective medium 4 Remove medium and replace with medium containing Zeocin at the appropriate concentration Incubate cells at 27 C 5 Replace selective medium every 3 to 4 days until you observe foci forming At this point you may use cloning cylinders or dilution to isolate clonal cell lines next page or you can let resistant cells grow out to confluence for a polyclonal cell line 2 to 3 weeks Note When the cells in the mock transfection are dead you can drop the concentration of Zeocin by half 6 To isolate a polyclonal cell line let the resistant cells g
53. uction Nature of Stable Cell Lines Effect of Zeocin on Sensitive and Resistant Cells Suggested Zeocin Concentrations Once you have demonstrated that your protein is expressed in Sf9 or High Five cells you may wish to create stable expression cell lines for long term storage and large scale production of the desired protein Note that stable cell lines are created by multiple copy integration of the vector Amplification as in the case with calcium phosphate transfection and hygromycin resistance in Drosophila is generally not observed Cells may round up and detach from the plate Sensitive cells may exhibit the following morphological changes upon exposure to Zeocin e Cells stop growing e Vast increase in size similar to the effects of cytomegalovirus infecting permissive cells e Abnormal cell shape e Granular appearance e Presence of large empty vesicles in the cytoplasm breakdown of the endoplasmic reticulum and Golgi apparatus or other scaffolding proteins e Breakdown of plasma and nuclear membrane appearance of many holes in these membranes e Cellular debris in the medium Eventually cells sensitive to Zeocin will completely break down and only cellular debris will remain Zeocin resistant cells should continue to divide at regular intervals to form distinct colonies There should not be any distinct morphological changes in Zeocin resistant cells when compared to cells not
54. ww invitrogen com Corporate Headquarters Japanese Headquarters European Headquarters Invitrogen Corporation Invitrogen Japan K K Invitrogen Ltd 5791 Van Allen Way Nihonbashi Hama Cho Park Bldg 4F Inchinnan Business Park Carlsbad CA 92008 USA 2 35 4 Hama Cho Nihonbashi 3 Fountain Drive Tel 1 760 603 7200 Tel 81 3 3663 7972 Paisley PA4 9RF UK Tel Toll Free 1 800 955 6288 Fax 81 3 3663 8242 Tel 44 0 141 814 6100 Fax 1 760 602 6500 E mail jpinfo invitrogen com Tel Toll Free 0800 5345 5345 E mail Fax 44 0 141 814 6117 tech_support invitrogen com E mail eurotech invitrogen com MSDS Material Safety Data Sheets MSDSs are available on our website at www invitrogen com msds Certificate of The Certificate of Analysis CofA provides detailed quality control information Analysis for each product CofAs are available on our website at www invitrogen com support and are searchable by product lot number which is printed on each box continued on next page 28 Technical Service continued Limited Warranty Invitrogen is committed to providing our customers with high quality goods and services Our goal is to ensure that every customer is 100 satisfied with our products and our service If you should have any questions or concerns about an Invitrogen product or service contact our Technical Service Representatives Invitrogen warrants that all of its products will perform according to the
Download Pdf Manuals
Related Search