Agilent SureGuide gRNA Synthesis Kit Guide
Contents
1. a Tol un a e a e i Un m e 100 150 Template Figure3 effect of template input on yield of gRNA gRNA was synthesized from two different gene fragment templates at five different input concentrations 12 5 nM 25 nM 50 nM 100 nM and 200 nM The standard procedure was used with a 1 hour incubation The gRNA yield in uM is shown plotted against the concentration of DNA template in the transcription reaction At the lowest template concentration tested 12 5 nM the yields were 8 4 and 7 6 uM for the two test templates enough for gt 380 in vitro Cas9 control digests 490 Micro GC User Manual 490 Micro GC User Manual 1600 1400 1400 1000 Yield in ng pl Figure 4 Yield Using Fixed Template Concentration and Variable Incubation Time 22nM gRNA C E 20nM gRNA A ZO0nM gRNA G 5 10 15 20 i5 Incubathon Time Hours The effect of increased incubation time on yield of gRNA gRNA was synthesized from three different gene fragment templates using a template concentration of 20 nM reaction Three identical reactions per target were set up and incubated for 1 2 or 20 hours at 37 C The gRNA yield in ng uL is shown plotted against the incubation time of the transcription reaction Although the absolute yield for the different templates varied improved yield with increased incubation time was observed for all2. you will need to fill in the template prior to gRNA synthesis Due to the strong secondary structure of Cas9 gRNAs fill in reactions should be performed with a thermophilic DNA polymerase The protocol below is based on Agilent s Herculase II Fusion DNA Polymerase p n 600675 In preparation for the fill in reaction resuspend primers at a final concentration of 10 uM 1 In a tube suitable for a thermocycler assemble the mixture in Table 3 Table 3 Fill in reaction volumes Component Volume per reaction 5X Herculase Reaction Buffer 10 uL dNTPs 10 mM each Forward primer 10 uM 5 uL Reverse primer 10 uM 5 uL Herculase Fusion DNA Polymerase 1 uL dH50 28 uL Total 50 2 In a thermocycler incubate for 2 minutes at 95 C followed by 1 minute at 60 C and then 3 minutes at 12 C 3 You can now purify the filled in DNA template using the procedure described below in Purification of double stranded template on page 18 490 Micro GC User Manual 17 Purification of double stranded template Products from the above fill in reaction can be purified using the Agilent StrataPrep PCR Purification Kit p n 400771 with the following modification e Add ethanol to the DNA Binding Solution to a final concentration of 15 v v This modification promotes efficient binding of the small RNA products to the spin cup filters Note that the addition of ethanol to the DNA Binding Solution is a dev
3. Agilent SureGuide gRNA Synthesis Kit Protocol Revision February 2015 5190 7714 5190 7719 For Research Use Only Not for use in Diagnostic Procedures RES Agilent Technologies Notices O Agilent Technologies Inc 2015 No part of this manual may be reproduced in any form or by any means including electronic storage and retrieval or transla tion into a foreign language without prior agreement and written consent from Agilent Technologies Inc as governed by United States and international copyright laws Manual Part Number 5990 7261 Edition Revision February 2015 Agilent Technologies Inc 5301 Stevens Creek Blvd Santa Clara CA 95051 For Research Use Only Not for use in Diagnostic Procedures Warranty The material contained in this docu ment is provided as is and is sub Ject to being changed without notice in future editions Further to the max imum extent permitted by applicable law Agilent disclaims all warranties either express or implied with regard to this manual and any information contained herein including but not limited to the implied warranties of merchantability and fitness for a par ticular purpose Agilent shall not be liable for errors or for incidental or consequential damages in connection with the furnishing use or perfor mance of this document or of any information contained herein Should Agilent and the user have a separate written agreement w
4. Design 2 Single gRNA with extended backbone For a sgRNA with the extended backbone the gRNA is chimera of the crRNA and the tracrRNA synthesized into one single gRNA Figure 8 Sea CGa Ue CAAQSUUUUAG a GCUAUGCL j JO VIN OOV y EE Figure 8 20 single gRNA with extended backbone The DNA template required to encode this sgRNA will generally exceed the length of a standard oligonucleotide synthesis We therefore recommend ordering the template as a double stranded gene fragment from a preferred oligonucleotide vendor see Template option C on page 8 or synthesizing the double stranded template from overlapping single stranded oligonucleotides see Template option B on page 8 However custom gene fragments often have minimum length requirements which the DNA template for this sgRNA would fail to meet on its own To meet a minimum length requirement the gene fragment sequence can be designed with non specific filler or stuffer sequence upstream of the 7 promoter In the example DNA template sequence shown below the stuffer sequence is shown in brown text and the TY promoter is underlined DNA template sequence with stuffer sequence 5 ACG GAC GTG ACC GAA GTA GAC GAC GAT CGA AAG AAA CTT GCC GCA CG ATG TAA TAC GAC TCA CTA TAG GAA ACA GGA ATC GAA TGC AAC GTT TTA GAG C
5. Cleavage Sites dsDNA CASS dual mature guide RNA extended design im crRNA ANI UUUNG GOUMGCUGUUUUGA ah 2 y see ggg e ot tracrRMA we Be 250 do M o m Figure 1 A PAM Site single quide RNA in minimal design GUNUUAG A GCUNTM y extended design IGUUUUAG A GCUADGCU t CGAUACGA 4 Ue GAA ae 1 m Wye duo M T 42 1 Depiction of gRNA directed Cas9 cleavage of double stranded DNA 490 Micro GC User Manual Preprotocol Considerations SureDesign Agilent s online web tool offers an easy to use wizard that allows you to design gRNA sequences for a defined DNA target The DNA target can be from an uploaded BAC plasmid or other sequence as well as from user selected regions in the human genome and common model organisms The wizard takes you through the steps of defining the target regions and setting parameters for the gRNA sequences The SureDesign algorithm then lists gRNA sequences and ranks them in order of target specificity The end result is a set of files that includes the sequences and positions of the gRNAs the secondary hits for each gRNA the corresponding single guide RNA sgRNA sequences and the sequences of the DNA template to be used to synthesize the dual gRNAs or sgRNAs if using in vitro transcription To set up a SureDesign account vis
6. of important data Do not proceed beyond a CAUTION notice until the indicated conditions are fully understood and met A WARNING notice denotes a hazard It calls attention to an operating procedure practice or the like that if not correctly per formed or adhered to could result in personal injury or death Do not proceed beyond a WARNING notice until the indicated condi tions are fully understood and met Agilent SureGuide gRNA Synthesis Kit Protocol Agilent SureGuide gRNA Synthesis Kit Kit Components and Storage Conditions 4 Required and Optional Equipment and Reagents 5 Introduction to gRNA Synthesis 6 Preprotocol Considerations 7 CRISPR and tracr sequences 7 DNA template requirements and design 8 T7 RNA polymerase promoter primer 9 Template input 10 Procedures 12 Transcribe the gRNA from the DNA template 12 Purify the 13 gRNA Analysis 15 Spectrophotometric analysis 15 Electrophoretic analysis 15 Supplementary Protocols 17 Fill in procedure for Template option 17 Purification of double stranded template 18 supplementary Design Information 19 gRNA and DNA template sequences for an example DNA target 19 References 23 NE Agilent Technologies Kit Components and Storage Conditions Complete Kit p n 5190 7714 Kit p n 5190 7719 o pu mum pee 50 ng uL 5X Transcription 250 uL 250 uL 20 C Buffer RNA Binding Spin Cups and 50 each 50 each Ro
7. tracrRNA 20 nttarget sequence site gatcgctgtt aaaaggacaa ttacaaacag gaatcgaatg caaccgdcgc aggaacactg cc ctagcgacaa ttttcctgtt aatgtttgtc cttagcttac gttggccgcg tccttgtgac gg Figure 6 Example target Design 1 Dual gRNA with extended backbone For a dual gRNA design with the extended backbone Figure 7 the two gRNA species are a full length tracrRNA blue text hybridized with an independent crRNA transcript green red text The black text is the T7 promoter sequence The tracrRNA is universal and can be paired with all CRISPR target transcripts of this design GG T7 polymerase initiator nucleotides are shown in cyan text The sequences of the single stranded oligonucleotide DNA templates needed to prepare these gRNAs are shown below Resuspend oligonucleotides in RNase free TE buffer pH 7 and store at 20 C sequence of the DNA template for the crRNA 5 TCA AAA CAT TCT AAA ACG TTG CAT TCG GTT TCC AGT GAG TCG TAT TAC ATC G 3 sequence of the DNA template for the tracrRNA 5 AAG CGA GGT GCC ACT TIT TCA AGT TGA TAA CGG TTA ACT TGC GTT TTG ACC AGT GAG TCG G 3 Du Mur CG A ACG uuu UAG GCU AUG CUG UUU UGA nno ono Svo 32v 999 nov vvv von nov von vnn 922 nov noo ovy n vvv vnn Dov 9v9 vvv von Figure7 Dual gRNA with extended backbone 490 Micro GC User Manual 19
8. A significantly lower RNA concentration compared to an earlier determination of RNA concentration could indicate RNase contamination Electrophoretic analysis In addition to spectrophotometric analysis analyzing the gRNAs by electrophoresis is another way to check sample quality Any electrophoresis method that will resolve very small RNA molecules 40 120 nucleotides will give satisfactory results however we recommend using the Agilent BioAnalyzer Small RNA Chip good result see Figure 5 is a clean band of approximately the correct size with no evidence of degradation e g smearing or banding at lower molecular weight To eliminate secondary structure heat the sample to 80 C for 2 minutes prior to analysis 490 Micro GC User Manual 15 16 Figure 5 BioAnalyzer Small RNA Chip Analysis of gRNA 1 uM dilutions of two different gRNAs were prepared in TE Buffer pH 7 0 and heated to 80 C for 2 minutes then cooled on ice 1 pL was analyzed on an Agilent BioAnalyzer Small RNA Chip according to the manufacturer s instructions The 64 nt gRNA in lane 1 is the Control gRNA included with the kit which is synthesized using a long single stranded oligonucleotide template Template option The 108 nt gRNA in lane 2 was synthesized using a gene fragment template Template option 490 Micro GC User Manual Supplementary Protocols Fill in procedure for Template option B If you are using Template option
9. NA templates for transcription e The 1 base in bold italic is the first base incorporated into the transcript The two G s following the promoter are required for efficient transcription Removal of these nucleotides from the sequence will result in a significantly reduced yield of gRNA The addition of two nonpairing Gs at the 5 end of a guide may or may not affect the specificity or alter the cleavage efficiency of Cas9 digestion of your target If this is of concern guide sequences can be selected from the target sequence that encode GG at the 5 end If your gRNA does not start with 2 consecutive Gs we recommend adding them to the 5 end of the gRNA 10 Template input The amount of DNA template added to the gRNA synthesis reaction greatly influences the total yield as illustrated in Figure We recommend a concentration of 200 nM to generate the highest possible yield within a one hour incubation time There may be limitations on the amount of template available based on the source and type of template being used Low concentration templates can be PCR amplified to produce additional material if desired however this is not required as the gRNA synthesis can be performed with as little as 20 nM template in the reaction You can also increase the yield by simply lengthening the incubation time see Figure 4 ERNA Yield After 1 Hour Incubation With Increasing Concentration of Template DNA e Lu Lun
10. TA TGC TGA GCA TAG CAA AAA AGG GTC CGT TAT CAA GAA AAA GTG GCA CCG AGT CGG TGC TT 3 The sequence above would be ordered directly from the gene fragment vendor of choice Gene fragments are generally confirmed for correct sequence by the vendor and are provided as a fixed amount in lyophilized form Rehydrate the gene fragment in RNase free TE buffer pH 7 at a minimum concentration of 100nM and store at 20 C Alternatively if you were to use Template option B to generate the DNA template needed to synthesize the sgRNA in Figure 8 you would create two shorter overlapping single stranded DNA oligonucleotides and them convert them to double stranded DNA template using a fill in reaction A protocol for the fill in reaction and the subsequent 490 Micro GC User Manual 490 Micro GC User Manual purification protocol are provided in the Supplementary Protocols on page 17 This method may be preferable to synthesizing a gene fragment if there are problems with the gene fragment synthesis or a greater yield of template is desired Example oligonucleotides for this approach are shown below The two primers include the T7 RNA Polymerase Promoter shown in black text the variable 20 nt target sequence in red text the CRISPR sequence in green text and the extended tracr tail in blue text A forward primer must be synthesized for each unique target sequence The reverse primer is universal in this applic
11. User Manual Jinek M et al A programmable dual RNA guided DNA endonuclease in adaptive bacterial immunity Science 337 816 821 2012 Cunningham P and Ofengand J 1990 Biotechniques 9 6 713 714 Sambrook J Fritsch E F and Maniatis 1989 Molecular Cloning A Laboratory Manual Cold Spring Harbor Laboratory Press Cold Spring Harbor NY 23 www agilent com In this Book This guide contains information to use the Agilent SureGuide gRNA Synthesis Kit Agilent Technologies Inc 2015 Revision BO February 2015 5990 7261 RES Agilent Technologies
12. ation except for the terminal base shown in red underlined text which is complementary to the terminal base of the target sequence Forward primer sequence 5 CG ATG TAA GAC TCA TAG GAA ACA GGA GAA TGC AAC GTT TTA GAG CTA TGC TGA AA 3 Reverse primer sequence 5 AAG CAC CGA CTC GGT GCC ACT TTT TCA AGT TGA TAA CGG AGC CTT ATT TTA ACT TGC TAT GCT TTT CAG CAT AGC TCT AAA ACG 3 Design 3 Single gRNA with minimal backbone For a sgRNA with the minimal backbone the backbone sequence is the smallest length shown to be required by the Cas9 nuclease Jinek et al 2012 The shorter length can add cost saving and simplicity however we have observed improved cleavage of some targets when using the extended backbone The ideal backbone length in a given application must be empirically determined Ady AQS3UUUUAG a GCUAS SIM IMI IONE VIEW ve ly Figure9 Single gRNA with minimal backbone The sequence below is that of the purified oligonucleotide that would be ordered to synthesize the sgRNA shown Figure 9 The Forward Primer is included in the kit if a single stranded DNA template is used Resuspend oligonucleotides in RNase free TE buffer pH 7 and store at 202 21 22 Oligonucleotide sequence 5 CGG ACT AGC CTT ATT TTA ACT TGC TAT TTC TAG CTC TAA AAC GTT GCA TTC GAT TCC TGT TT TA TAG TGA GTC TTA CAT CG 3 490 Micro GC User Manual References 490 Micro GC
13. d 1 5 mL tube for final elution Using a clean pipette tip for each sample carefully pipette 50 uL of gRNA Elution Buffer directly to the center of the filter matrix inside each spin cup Spin the filter cups at maximum speed in a microcentrifuge for 1 minute The eluate is the purified gRNA sample Discard the spin cup and cap the tube Determine the gRNA concentration using a preferred method You may also want to calculate the uM concentration for use in subsequent applications Store gRNA stocks at 80 C 490 Micro GC User Manual gRNA Analysis The ultimate confirmation of the quality of any gRNA is demonstrating performance in a digest with Cas9 and confirming cleavage at the desired location However this analysis could give a negative result or unsatisfactory digestion for reasons other than the quality of the gRNA It may be necessary to analyze gRNA samples to eliminate them as a source of negative results Spectrophotometric analysis If your Cas9 nuclease reactions yield completely negative results we recommend that you first double check the design sequence of the DNA template The second line of analysis is to perform standard nucleic acid spectro photometric readings on the gRNA samples at 40 A260 and Aogo If the Aggo Aggp ratio 1 8 2 1 expected or the A go A239 ratio 72 0 expected is not as expected this can indicate that samples may have inhibitory levels of protein or chemical contamination
14. h and without the extraneous GGs The user defined 20 nucleotide target sequence must be immediately upstream of an Streptococcus pyogenes protospacer adjacent motif PAM site which has the sequence NGG DNA template requirements and design In order to synthesize gRNA using the SureGuide reagents you must have DNA templates which include a T7 RNA polymerase promoter to synthesize your desired gRNA In the depiction of Cas9 cleaving a double stranded DNA target shown in Figure 1 the fixed sequence of the mature guide green and blue text is universal for use with Cas9 from 5 pyogenes but the 5 end of the molecule red text has 20 bases of sequence unique to the cleavage target Cleavage targets must be 20 bases in length and located immediately upstream of an S pyogenes PAM site Cas9 cleavage occurs 3 bp upstream 5 of the PAM site Any DNA template containing a T7 RNA polymerase promoter can be used but we recommend using oligonucleotides or synthetic gene fragments as templates since they do not require any cloning steps are more cost effective and are widely available Multiple iterations of DNA templates have been used successfully and are selected based on user preference length of the guide cost turnaround time and ease of use In general there are three basic options for DNA template design which are illustrated in Figure 2 Template option A Uses a long single stranded oligonucleotide template This
15. iation from the standard protocol for that kit 1 For purification add 200 uL of DNA Binding Solution containing 15 ethanol to the fill in reaction and transfer to a spin cup 2 Spin for 30 seconds in a table top microfuge at maximum speed 3 Discard flow through and add 750 uL of Wash Buffer containing 80 ethanol 4 Spin for 30 seconds in a table top microfuge at maximum speed 5 Discard flow through and spin the empty cup for 1 minute at maximum speed to remove all remnants of the Wash Buffer 6 Transfer spin cup to a new receptacle tube 7 Add 50 uL of RNase free TE buffer pH 7 0 to the spin cup Incubate for 1 minute at RT and then spin for 30 seconds in a table top microfuge at maximum speed to elute The purified templates are now ready for use in the 2n vitro transcription reaction Using the above protocol the typical yield is 50 100 ng or 15 30 pmoles resulting in a typical concentration of 300 600 nM 490 Micro GC User Manual Supplementary Design Information gRNA and DNA template sequences for an example DNA target Using an example DNA target sequence this section displays SRNA sequences that use the minimal and extended backbone sequences for both dual gRNAs and single gRNAs called sgRNAs Dual gRNAs consist of two separate RNA species the CRISPR RNA crRNA and the tracrRNA which form a duplex as shown in Figure 1 on page 6 sgRNAs single RNA species that include both the crRNA and
16. is the design used for the Control Template included in the SureGuide kit Template option B Option B uses two partially overlapping oligonucleotides This design approach requires DNA polymerase extension to fill in the template prior to gRNA synthesis See Fill in procedure for Template option B on page 17 Template option Option C uses a synthetic double stranded gene fragment as the DNA template Gene fragments are available from multiple vendors These vendors often have minimum length requirements for gene fragments which your template might fail to meet In order to meet a minimum length requirement the gene fragment sequence can be designed with nonspecific filler or stuffer sequence upstream of the 7 promoter 490 Micro GC User Manual T7 Promoter C stuffer Figure2 DNA Template options Long single stranded oligonucleotide template B Two partially overlapping oligonucleotides requires fill in with DNA polymerase C Synthetic double stranded gene fragments may require 5 stuffer sequence to meet length requirement T7 RNA polymerase promoter primer 490 Micro GC User Manual Shown below is the sequence of the T7 Promoter Primer to be used with single stranded oligonucleotide templates Template option A T7 Promoter Primer is provided with the kit at a 10 uM concentration 5 CGATGTAATACGACTCACTATAGG 3 e The underlined sequence is the minimal 7 promoter required in all D
17. it the SureDesign website at www agilent com genomics suredesign CRISPR and tracr sequences 490 Micro GC User Manual The Control DNA Template that is provided in the SureGuide SRNA Synthesis Kit encodes a sgRNA with minimal length CRISPR tracr backbone see the minimal design sgRNA in Figure 1 This minimal backbone sequence is adequate for many cleavage targets However for many targets we have observed improved cleavage using the extended native CRISPR tracr backbone sequence see the extended design SRNAs in Figure 1 You may wish to design your gRNAs to encode minimal or extended backbones depending on your specific needs Because we have never observed a decrease in cleavage efficiency using an extended backbone we recommend designing gRNAs with this backbone unless there is a compelling reason to use the minimal backbone instead Example sequences of gRNAs with both minimal and extended backbones are provided in the section Supplementary Design Information on page 19 All DNA templates used with the SureGuide gRNA Synthesis Kit must incorporate the T7 RNA polymerase promoter followed by GG The GG nucleotides are ideally encoded at the 5 end of the 20 nucleotide user defined target sequence but may be incorporated as bases unmatched to the DNA target The GG nucleotides in the Control gRNA provided in the kit do not match the Control DNA Target and we have not observed a difference in cleavage efficiency wit
18. ith warranty terms covering the material in this document that conflict with these terms the warranty terms in the sep arate agreement shall control Technology Licenses The hardware and or software described in this document are furnished under a license and may be used or copied only in accordance with the terms of such license Restricted Rights Legend If software is for use in the performance of a U S Government prime contract or sub contract Software is delivered and licensed as Commercial computer soft ware as defined in DFAR 252 227 7014 June 1995 or as a commercial item as defined in FAR 2 101 a or as Restricted computer software as defined in FAR 52 227 19 June 1987 or any equivalent agency regulation or contract clause Use duplication or disclosure of Software is subject to Agilent Technologies standard commercial license terms and non DOD Departments and Agencies of the U S Government will receive no greater than Restricted Rights as defined in FAR 52 227 19 c 1 2 June 1987 U S Govern ment users will receive no greater than Limited Rights as defined in FAR 52 227 14 June 1987 or DFAR 252 227 7015 b 2 November 1995 as applicable in any technical data Safety Notices CAUTION A CAUTION notice denotes a hazard It calls attention to an oper ating procedure practice or the like that if not correctly performed or adhered to could result in damage to the product or loss
19. ix in Table 2 instead of adding 1 uL of each rNTP individually 12 490 Micro GC User Manual 3 Aliquot 20 uL of master mix to the appropriate number of RNase free reaction tubes From this point the reaction set up can be completed at room temperature 4 Add 5 uL of template DNA or 5 uL of 1 uM Control Template to each reaction Cap the tubes securely For maximum yield in one hour we recommend a final DNA template concentration of 200 nM in the reactions which corresponds to a stock concentration of 1 uM Stock concentrations as low as 0 1 uM template can be used however we then recommended increasing the incubation time of the reaction 5 Mix samples by vortexing then spin briefly to eliminate droplets and bubbles 6 Transfer the reactions to a 37 C incubator or heat block 7 Incubate the reactions for at least 1 hour but no longer than overnight 16 20 hours to transcribe the gRNA 8 Following the incubation add 1 uL of RNase free DNase to each transcription reaction 9 Mix well and incubate for another 15 20 minutes at 37 C Following the DNase digestion the gRNA samples are ready to be purified You may proceed directly to the purification or freeze the samples at 80 C until ready to proceed Purify the gRNA Before starting 1 Prepare the gRNA Binding Solution by adding 7 5 mL of molecular biology grade ethanol directly to the bottle final ethanol concentration 60 Mix well and store at room
20. om temperature 2 mL Receiver Tubes 4 490 Micro GC User Manual Required and Optional Equipment and Reagents 490 Micro GC User Manual Table1 Required and optional equipment and reagents for the gRNA synthesis protocol Equipment or Reagent Molecular biology grade ethanol Microcentrifuge RNA quantitation method UV spectrophotometer or dye based RNA quantitation method Optional BioAnalyzer Small RNA Kit Agilent p n 5067 1548 Incubator heat block or temperature cycler for 37 C incubations RNase free reaction tubes User defined DNA template 0 1 1 UM Introduction to gRNA Synthesis Cas9 CRISPR associated protein 9 is an RNA guided DNA nuclease associated with Type II bacterial CRISPR immunity systems Cas9 is widely used to induce site specific double stranded breaks in DNA for multiple applications The guide RNA gRNA structure that binds and directs Cas9 is a hybrid of CRISPR RNA containing homologous sequence to the cleavage target and a trans activating tracrRNA A single guide RNA chimera of the CRISPR tracrRNAs can direct DNA cleavage by Cas9 in vitro in lieu of the naturally occurring duplex The SureGuide gRNA Synthesis kit is intended for the preparation of guide RNAs to be used in conjunction with recombinant Cas9 enzyme for the n vitro site specific cleavage of double stranded DNA The RNA guides are synthesized by T7 RNA polymerase transcription from a DNA template of your choice
21. temperature 2 Prepare the gRNA Wash Buffer by adding 28 mL of molecular biology grade ethanol directly to the bottle final ethanol concentration 80 Mix well and store at room temperature 490 Micro GC User Manual 13 14 Purification procedure 1 10 11 12 13 14 15 16 17 If frozen bring the unpurified gRNA samples to room temperature Prepare a spin cup filter for each sample to be purified by seating a spin cup filter in a fresh 2 mL receptacle tube Label the tubes appropriately Label a 1 5 mL tube for each sample and set aside These tubes will be used as the receptacles for the final elution Add 200 uL of gRNA Binding Solution confirm ethanol has been added to each sample Mix gently by pipetting up and down a few times Transfer the entire volume of each sample 226 uL to an individual spin filter cup Spin the filter cups at maximum speed in a microcentrifuge for 1 minute Remove the spin cup and discard the eluate Replace the spin cup back into the receptacle tube Wash the filter by adding 600 uL of gRNA Wash Buffer confirm ethanol has been added to each spin filter cup Spin the filter cups at maximum speed in a microcentrifuge for 1 minute Remove the spin cup and discard the eluate Replace the spin cup back into the receptacle tube Spin the filter cups for 2 minutes at maximum speed to dry the filter matrix Transfer the dry spin cup to its respective pre labele
22. three 11 Procedures Use universal precautions for working with RNA throughout the procedures Transcribe the gRNA from the DNA template 1 Thaw the kit components that are stored at 20 C For the T7 polymerase RNase Block DNase and Yeast Pyrophosphatase thaw on ice Thaw the 5X Transcription Buffer rNTPs DTT and 7 Promoter Primer if using at room temperature Once thawed mix well by vortexing briefly spin to pellet any droplets and transfer to ice On ice prepare enough master mix for at least 1 2 additional reactions over the required amount Table 1 shows the volumes of each component required for one reaction Use the left column for single stranded oligo templates requiring the T7 forward Promoter Primer Use the right column for double stranded DNA templates Table2 Master mix component volumes per reaction Component Volumes for reactions with Volumes for reactions with single stranded templates double stranded templates or the Control Template DEPC Water 7 pL 7 5 uL 5X Transcription Buffer 5 pL 5 uL rATP 1 uL 1 uL rCTP 1 uL 1 uL rGTP 1 uL 1 uL rUTP 1 uL 1 uL 0 75M 1 uL 1 uL Yeast Pyrophosphatase 0 5 uL 0 5 uL RNase Block 1 uL 1 uL T7 RNA Polymerase 1 uL 1 uL 10 uM T7 Promoter 0 5 uL Primer Total 20 uL 20 uL For convenience you can combine the stocks of rATP rCTP rGTP and rUTP and store them as a mixture You would then add 4 uL of the mixture per reaction the master m
Download Pdf Manuals
Related Search