National Veterinary Services Laboratories Testing Protocol Real
Contents
1. 10050 Ambion Austin ZEK W Product 10027 has 96 ring magnets that pellet beads in a donut shape Product 10050 has 24 big magnetic rods that pellet beads to one side of the wells 2 2 21 Orbital shaker for 96 well plates Lab Line Titer Plate Shaker Model 44625 Melrose Park ILL 2 2 22 5 200 ul 12 channel pipetting tool Matrix Technologies Corp catalog 6012 Lowell MA Use caution when using these reagents Refer to the individual Material Safety Data Sheet MSDS before handling any of these reagents NVSL AVPRO1505 03 Testing Protocol Page 11 of 33 Real Time RT PCR Test for Detection of Virulent Newcastle Disease Virus 3 Preparation for the test For this procedure it is critical to have separate preparation areas and equipment for nucleic acid extraction clean procedures and work with amplified nucleic acid The clean area is used for preparing reagents for use in the PCR procedure Amplified c DNA or sample RNA should never be introduced into this area One biological safety cabinet should be designated for clean work only There should also be a separate set of clean pipettors and tips RNase free water tubes for reagent preparation racks and ice container which are designated for clean use only and never leave the area A 20 C freezer should also be designated as clean for storage of reagents A second biological safety cabinet set of pipettors and other equipment and reagents should be used for2. 6 3 Recommendations for evaluating fluorograms Evaluation of the fluorogram with the following conditions may be helpful in determining results manually 6 3 b Identification of weak positives Remove all reactions with greater than 100 units increase in fluoresce from the graph this changes the Scale making it easier to identify weak positives Figures la and 1b NVSL AVPRO1505 03 Testing Protocol Page 29 of 33 Real Time RT PCR Test for Detection of Virulent Newcastle Disease Virus Figure la Example of a fluorogram from samples run on the Smart Cycler All samples shown Background subtraction is on All analysis criteria are set to the customized default values Note that scale is from 0 to 1000 fluorescence units Y axis making it difficult to evaluate weak positive samples Results Analysi Protoco Temper TET TAMRA ROX Standar SYBR G Melt Figure lb Same fluorogram as e 1a however all samples which increased greater than 100units in oRes ence were removed from the graph Note that the scale is from 0 to uor Y axis making it easier to recognize weak positives h 0h hs D FAHRERAHKE lt im s EAEE ERE EAE a 3 ss 2 T8 AVPRO1505 03 NVSL Page 30 of 33 Testing Protocol Real Time RT PCR Test for Detection of Virulent Newcastle Disease Virus 6 3 2 If there are samples which have a V shaped fluorescence trace incrementally lower the background maximum cycles analysis s
3. 8 Appendix 1 A temporal equivalency validation for the Creelan CalMex assay was conducted with experimentally inoculated chickens The equivalencGy validation included both acutely infected and pre acute infected birds Both tracheal and cloacal swabs were collected commencing on day one The original APMV matrix and CalMex RRT PCR validation was conducted with field specimens collected during the 2002 03 CA vNDV outbreak The original CalMex assay was shown to have a diagnostic sensitivity of 56 02 with acute and pre actute specimens This is significantly different from the Original diagnostic sensitivity Oft 92 95 using field Specimens from acutely infected birds Due to the decreased sensitivity of the original CalMex assay any specimen testing positive with the CalMex primer probe was a strong positive with either the matrix or the Creelan CalMex vNDV RRT PCR assays Diagnostic sensitivity and specificity data NVSL AVPRO1505 03 Testing Protocol Page 34 of 33 Real Time RT PCR Test for Detection of Virulent Newcastle Disease Virus from both validation studies have been included for further tLelustration NVSL AVPRO1505 03 Testing Protocol Page 35 of 33 Real Time RT PCR Test for Detection of Virulent Newcastle Disease Virus vNDV RRT PCR for Creelan CalMex Cree Cal Virus Neg Virus Mex Primers Isolation Isolation Diagnostic Specificity 97 5 Diagnostic Sensitivity 91 26 CalMex RRT PCR Primer Set Using vN
4. Diluted probes should be stored in amber sterile RNase free microcentrifuge tubes or tubes wrapped with foil NVSL AVPRO1505 03 Testing Protocol Page 13 of 33 Real Time RT PCR Test for Detection of Virulent Newcastle Disease Virus Dilute probes to 120 pmol ul 120uM in 1X TE for the stock dilution and to 6 pmol pl in RNase free water for the working dilution Aliquot probe in small volumes to avoid excessive freeze thaw cycles Store diluted probes at 20 C and stock primer solutions at 20 C or 70 C Avoid excessive freezing and thaw cycles Diluted probe should not be frozen thawed more than 4 times A total of 6 pmol of the probe is added per 25 pl reaction 3 4 3 Handling and dilution of Primers and Probe Lyophilized primers and probes must be centrifuged briefly to ensure that the DNA pellet is at the bottom of the tube before they are opened and reconstituted TE buffer should be used for the initial reconstitution of lyophilized primers and probes Quantitation information will be supplied for each oligonucleotide primer oligo by the manufacturer An example of calculation for oligo reconstitution You have 17786 pmol of oligo will be on oligo information sheet from manufacturer Need 200pmol ul for stock concentration Divide pmol of oligo by the pmol pl needed or 17786 pmoT985 amp 9nl of 1X TE 200 pmol pl The calculation for the probe is the same except divide the number of probe pmol by 120 pmol ul Mix
5. The supernatant from this tissue pool 250gl is extracted using the Trizol procedure Validation equivalency data indicate that cloacal swab Specimens are significantly less sensitive than oropharyngeal tracheal swabs for the detection of APMV 1 by RRT PCR For this reason cloacal swabs should be tested by virus isolation and not by RRT PCR Tissues from more than one bird should not be pooled together All samples should be processed in a Class II biological safety cabinet 4 Performance of the test Before beginning the RT PCR test place clean pipettors racks tips etc into the clean hood and expose to the UV germicidal light for several hours or overnight Similarly place the sample equipment into a separate hood and expose to the UV germicidal light 4 1 Extraction of RNA from swab specimens Qiagen RNeasy method 4 1 1 Vortex swab specimen fluid and transfer 500p1 of sample into the microcentrifuge tube labeled with the specimen number 4 1 2 Place 500 pl of Qiagen RLT with B ME into the microcentrifuge tube Vortex 15 sec When processing a large number of specimens the RLT buffer can be mixed with the specimen by pipetting up and down vigorously 4 to 6 times 4 1 3 Pulse spin to eliminate liquid specimen in the lid after vortexing Add 500gl 70 ETOH and vortex NVSL AVPRO1505 03 Testing Protocol Page 16 of 33 Real Time RT PCR Test for Detection of Virulent Newcastle Disease Virus well Centrifug
6. gently by tapping the tube and allow the oligo to resuspend for about 10 minutes before use Working stocks of primers should be 20 pmol pl 20uM and working stocks of probes should be 6 pmol ul Dilute the primers 1 10 and dilute the probe 1 20 in nuclease free H2O do not use TE buffer for the working stocks Additional information on fluorescent probe handling and storage can found at www operon com and www idtdna com www idahotech com NVSL AVPRO1505 03 Testing Protocol Page 14 of 33 Real Time RT PCR Test for Detection of Virulent Newcastle Disease Virus 3 4 4 Prepare a 70 ethanol solution using 100 t absolute ethanol and RNase free water First line O pt 3 4 5 Prepare 80 ethanol solution using 100 absolute ethanol and RNase free water 3 4 6 p Mercaptoethanol 6 ME must be added to the RNeasy RLT lysis buffer before use Add lO0gl 6 ME per 1 ml RLT buffer Buffer RLT is stable for 1 month after addition of 6 ME Be sure to date buffer after adding fp ME 3 4 7 100 absolute ethanol is added to the RNeasy RPE wash buffer according to the QiagenG kit directions 3 4 8 The template for the positive controls is in vitro transcribed RNA from the NDV matrix and fusion protein gene 200 ADV NVSL 1800 Dayton Ave Ames IA 3 4 9 Dilute RNase inhibitor to 13 3 units yul with RNase free water 3 4 10 The transcribed RNA positive control provided by NVSL Ames IA should be diluted to a working concentrati
7. irritant flammable 2 2 4 Isopropanol 99 pure ACS grade or better Caution irritant flammable 2 4 0 Chloroform 99 pure Caution toxic 2 2 6 Trizol LS reagent Caution toxic in contact with skin and if swallowed causes burns Cat 15896 Gk 0296 Life Technologies Grand Island NY 2 2 7 Qiagen RNeasy Extraction Kit Cat 74103 20 preps 74104 50 preps or 74106 250 preps Qiagen Valencia CA 2 2 8 One Step RTSPCR Cate 40710 05 210212 OiagenG Valencia CA Many one step RT PCR kits are commercially available However the Qiagen system has been tested extensively with good results Other kits can be considered for use but a minimum level of equivalency testing is required before substituting any reagents in the approved protocol Currently the only alternative kit that has been tested that has comparable test results to the Qiagen system is the Superscript One Step RT PCR System with Platinum Tag NVSL AVPRO1505 03 Testing Protocol Page 8 of 33 Real Time RT PCR Test for Detection of Virulent Newcastle Disease Virus DNA Polymerase Cat 10928 034 or 10928 042 Invitrogen Carlsbad CA Appropriate changes to optimize the protocol for use with alternative reagents or RT PCR kits including cycling parameters must be supported by an equivalency evaluation as previously noted 2 2 9 Hydrolysis probes and primers oligonucleotides Table 1 for the detection of vNDV Suggested probe source
8. 500 x gDr 30 min Collect 250nL of the tissue supernatant and transfer to a 1 5 microcentrifuge tube 750ul of Trizol LS is added to the tube and sample is vortexed for 15 sec Incubate at room temperature for 7 min 4 2 2 Pulse spin to remove liquid from the tube lid 4 2 3 Add 200p1 100 chloroform to the sample Trizol hom gen amp t Vortex for 15 sec Incubate at room temperature for 7 min 4 2 4 Centrifuge at 12 000 x g for 15 min at room temperature 4 2 5 Transfer 450gul of the upper aqueous layer to a Separate microcentrifuge tube marked with sample number Caution The transfer of organic phase material with the aqueous layer will inhibit the PCR reaction Add 500gl of 100 isopropanol Invert tube Several times to mix Hold at room temperature for LO WET 4 2 6 Centrifuge at 10 000 x g for 10 min at 4 C in the Hermle Z360K or Sorval Biofuge Fesco centrifuge NVSL AVPRO1505 03 Testing Protocol Page 18 of 33 Real Time RT PCR Test for Detection of Virulent Newcastle Disease Virus 4 2 7 Decant liquid Care should be taken to assure that the RNA pellet is not disturbed Add 1 0 ml of 80 ethanol Mix gently 4 2 8 Centrifuge at 10 000 X g for 5 min at 4 C 4 2 9 Decant ethanol Invert tube on a clean tissue wipe and allow to air dry for l0 min or until alW visible signs of moisture are gone It is important not to let the RNA pellet over dry as this wild decrease ips SOs by 4 2 10 Hydrate pellet in 50ul o
9. extraction procedures Ideally a third biological safety cabinet should be used for transfer of RNA to amplification tubes Latex or nitrile gloves in particular must be worn throughout the procedure and must be changed frequently RNA is very labile and easily degraded by RNases that are ubiquitous including on human skin Gloves also help protect the reagents and samples from other contaminating agents and cross contamination that can adversely affect results Always change gloves after working with sample RNA or amplified DNA Always wear fresh gloves when working with clean reagents Protective eyewear gloves and lab coats should be worn as some of the reagents used are toxic It is recommended that the Trizol extraction procedure is conducted in a vented class II BSC 3 1 Personnel qualifications training Personnel performing PCR procedures should be familiar with 3 1 1 Preparation and proper handling of samples and reagents 3 1 2 Calibration maintenance and use of instruments included in this protocol NVSL AVPRO1505 03 Testing Protocol Page 12 of 33 Real Time RT PCR Test for Detection of Virulent Newcastle Disease Virus 3 2 Preparation of equipment instrumentation Refrigeration equipment incubators centrifuges pipettors and thermal cyclers are calibrated and certified according to the respective institution standard operating procedures 3 3 Disinfectants Several classes of disinfectants e g iodophores
10. phenolics quaternary ammonia compounds 70 alcohol 10 sodium hypochlorite and peroxigen compounds will inactivate APMV 1 by destroying the lipid envelope of the virus However of the disinfectants listed above only sodium hypochlorite bleach and peroxygen compounds Virkon S have been shown to degrade nucleic acid as well as destroy infectivity of APMV 1 This is important when selecting a disinfectant to rid surfaces of contaminating nucleic acids 3 4 Preparation of reagents control procedures 3 4 1 Oligonucleotide primers Prepare primers in a clean hood see 3 0 Always wear gloves when dispensing primers Dilute prime s Q pmol ul 200uM in 1X TE for the stock dilution and 20 pmol ul in RNase free water for the working dilution Aliquot primers in small volumes to avoid excessive freeze thaw cycles For short term Storage of primers lt 1 week 4 C is acceptable For longer term storage 20 C or colder is recommended Soe stack primer solutions at 20 C or 70 C 26 8 pmol ofthe vNDV forward primer 13 4 pmol of the vNDV reverse primer and 10 pmol of the matrix forward and reverse primers are added per 25 ul reaction Additionally it is recommended that the PCR primers be at a minimum HPLC purified 3 4 2 Hydrolysis Probe Prepare probe in a clean hood see 3 0 Always wear gloves when working with hydrolysis probes Hydrolysis probes are light sensitive and should be protected from exposure to direct light
11. tubes to enable the RNA reaction mixture to occupy the reaction portion of the tubes and to remove any air bubbles from the reading window of the PCR tubes 4 4 6 Insert reaction tubes into thermal cycler and select the designated PCR run protocol start run and enter sample identification as well as positive and negative control information into the sample identification portion of the results table Save run Table 4a Real time RT PCR reaction mix volumes and conditions for NDV with APMV 1 matrix primer probe sets NVSL AVPRO1505 03 Testing Protocol Page 24 of 33 Real Time RT PCR Test for Detection of Virulent Newcastle Disease Virus Volume Per Final Reaction Concentration H20 6 45 ul 5X buffer 5 1X 25mM MgCl TA oO quM ANTES ALO mM 0 9 320 uM ea dNTP each Forward Primer 0 5 10 pmol 25yA 20 pmol ul Reverse Primer 0 5 10 pmol Z 31 20 pmol ul Rnase Inhibitor 0 5 0 266 Minit S Uu 13 95 nase a Enzyme Mix Legs Probe Fee d 0 24 uM 6pmol ul MM per rxn 17 Template isl DOLI 25ul Oiagen buffer already contains 2 5 mM MgCl at 1X concentration Table 4b Real time RT PCR reaction mix volumes and conditions for NDV with vNDV primer probe set NVSL AVPRO1505 03 Testing Protocol Page 25 of 33 Real Time RT PCR Test for Detection of Virulent Newcastle Disease Virus Volume Per Final Reaction Concentration H20 5 69 ul ox pufrTer 5 1X 25mM MgCl TA oO quM ANTES I0 mM 0 9 320 uM ea dNTP each Forward Prim
12. where the 5 end of the probe or primer anneals to the NDV genome The FAM TAMRA hybridizing probes were validated with the SmartyCycler I system When using the Smart Cycler II system it is recommended that all hybridizing probes be labeled with FAM aS a reporter dye and quenched with either Dabcyl or Black Hole quencher I The Smart Cycler II System is not calibrated to use the TAMRA dye as a quencher A TAMRA dye is read as background noise in channel 2 for the Smart Cycler II 2 2 11 RNase Inhibitor 40 units yul Promega catalog N2911 o N2515 Madison WI 2 2 12 MgClo 25 mM Promega catalog A3511 or A3513 Madison WL 2 2 13 TE buffer pH 8 3 Promega V6231 or V6232 2 2 14 Qiagen RNeasy Mini Kit Qiagen 74104 or 74106 2 2 15 14 3 M 6 mercaptoethanol B ME Sigma M 6250 Caution toxic dispense in a fume hood wear gloves NVSL AVPRO1505 03 Testing Protocol Page 10 of 33 Real Time RT PCR Test for Detection of Virulent Newcastle Disease Virus 2 2 16 Sterile aerosol resistant pipette tips of Varlous Sizes Xl U0md 200 9014 q00 LOnDl X050 51L 2 2 17 1 7 ml microcentrifuge tubes sterile 2 2 18 Either powder free latex or nitrile gloves may be used for any procedure requiring gloves 2 2 19 Calibrated pipettorss trom 0 5 ni to LOO Al 2 sets one extra pipettor for DNA transfer 2 2 20 Ambion Magnetic Stand 96 Ambion Inc catalog 10027 Austin TX or an O ring 96 well Magnetic Ring Stand Cat
13. 96 for 2 minutes and remove supernatant from beads with plate still on magnet Discard the supernatant The mixture should become transparent indicating the capture is complete 4 3 2 5 Remove the plate from the magnetic stand 4 3 2 6 Add 100 ul Wash Solution I Mix with isopropanol added to each well Shake for 30 seconds at approximately 550 660 rpm The RNA Binding Beads may not fully disperse during the step this is expected and it will not affect RNA purity or yield NVSL AVPRO1505 03 Testing Protocol Page 21 of 33 Real Time RT PCR Test for Detection of Virulent Newcastle Disease Virus 4 3 2 7 Pellet the beads for 1 minute and remove Supernatant as in step 4 2 2 4 4 3 2 8 Add 100 pl Wash Solution II Mix with ethanol added to each well Shake for 30 seconds at approximately 550 600 rpm 4 3 2 9 Pellet the beads for 30 seconds and remove supernatant Discard the supernatant Remove the processing plate from the magnetic Stand 4 3 2 10 Repeat steps 4 2 2 8 4 2 2 9 to wash a second time with Wash Solution II 4 3 2 11 Shake vigorously for 2 minutes shaker dial position 9 Lab Line to briefly dry the beads It is important to remove residual ethanol from the samples Residual ethanol may affect RT PCR efficiency 4 3 2 12 Add 5p pl WMlution Solution RT and shake for Four minutes at approximately 1000 PONa 4 3 2 1 Pellet the beads for 2 minutes and transfer the RNA into sample tube storage plate ki
14. AVPRO1505 03 Page 1 of 33 National Veterinary Services Laboratories Testing Protocol Real Time RT PCR for Detection of Virulent Newcastle Disease Virus in Clinical Samples Date February 24 2005 Supersedes AVPRO1505 02 September 29 2004 Number AVPISOISO03019 Contact Person Janice C Pedersen 515 663 7551 Approvals s B Panigrahy Date 2 24 05 B Panigrahy Head Avian Viruses Section s Beverly chm t Dates 2 24 05 Beverly J Schmitt Chief Diagnostic Virology Laboratory United States Department of Agriculture Animal and Plant Health Inspection Service P O Box 844 Ames IA 50010 Mention of trademark or proprietary product does not constitute a guarantee or warranty of the product by USDA and does not imply its approval to the exclusion of other products that may be suitable NVSL AVPRO1505 03 Testing Protocol Page 2 of 33 Real Time RT PCR Test for Detection of Virulent Newcastle Disease Virus Table of Contents I Introduction 1 1 Background 1 2 Keywords 1 3 Collaboration Materials 2 1 Facilities equipment instrumentation 2 2 Reagents supplies Preparation for the test Personnel qualifications training Preparation of equipment instrumentation Preparation of reagents control procedures Preparation of samples WWW W m WD Performance of the test 4 1 Extraction of RNA from swab specimens Qiagen RNeasy method 4 2 Trizol LS extraction for tissue samples 4 3 Hi
15. DV Equivalency Data CalMex Virus Neg Virus Pos 186 d Neg 146 160 wal A O Diagnostic Spgecir clNy 99 37 DiagnostigeseNg amp itibity 56 025 CalMex RRT PCR Validation Using Field Data CalMex Virus Neg Virus we ters Isolation Isolation Pos Jod i a Fe ee Neg 19 1266 ERUCPOER Diagnostic Specificity 99 1 Diagnostic Sensitivity 92 9 NVSL AVPRO1505 03 Testing Protocol Page 36 of 33 Real Time RT PCR Test for Detection of Virulent Newcastle Disease Virus 9 Summary of Revisions 9 1 The concentration of Rnase Inhibitor in Table 4a and 4b was Corrected Version 1505 02 listed the use dilution of Rnase Inhibitor as 6 65 units pl in Table 4a and 6 65 units 50ul in Table 4b The final concentration of Rnase Inhibitor was listed as 0 266 units in both Table 4a and 4b The correct use dril tron ort Riase Il nhrizbrtor as 13 5 units pl The correct final concentration is 0 4209 units ul 9 2 Section 2 2 17 was corrected to include either powder free latex or nitrile gloves for any procedure requiring gloves Neither latex nor nitrile gloves were specified for any of the specific procedures 9 3 The title of the protocol was changed from Real Time RT PCR for Detection of Exotic NewcastleyDisease Virus in Clinical Samples to Real Time RT PCR for Detection of Virulent Newcastle Disease Virus in Clinical Samples 9 4 Exotic Newcastle disease END was replaced by virulent Newcastle disease virus vNDV t
16. RT PCR Test for Detection of Virulent Newcastle Disease Virus Background maximum cycle Enter 28 as the maximum cycle for the calculation of the standard deviation of the fluorescence signal The default is 40 Threshold Settings accept the default of Manual Manual Threshold Fluorescence units Enter 25 fluorescent units It is critical that the C be above the backOWwgund fluorescence The closer the threshold is set to the background fluorescence the more sensitive the detection limit However if the threshold is set too f cloSe eo the background fluorescence background noise could cross the threshold and be reported incorrectly as a positive sample By lowering the threshold fluorescence units from 30 to 25 the analytic sensitivity of the assay bs inereased The possibility of reporting a false negative is reduced while the possibility of detecting a false positive is increased Boxcar Average accept the default of O0 The only changes from the Cepheid Smart Cycler default were the Max background and threshold settings With these analysis settings a specimen will be called positive crosses the Ci when the fluorescence units exceeds 25 units These settings were designed to optimize the discrimination of positive and negative specimens for this particular protocol but the results from each run still need to be verified by the user The curve should be in the log linear phase whem crossing the threshold By lowerin
17. The real time reverse transcriptase polymerase chain reaction RRT PCR assay was developed to aid in the rapid diagnosis of avian paramyxovirus 1 infections in poultry The technique utilizes a one step protocol with specific primers designed to amplify a portion of the genome that contains a target PCR sequence Non extendible fluorogenic hydrolysis Taqman probes monitor the target PCR product formation at each cycle during the PCR reaction The probes are labeled at the 5 end with a reporter dye e g FAM and a quencher dye e g blackhole quencher BHQ 1 at the 3 end The proximally located quencher dye absorbs the emission of the reporter dye as long as the probe is intact and not hybridized to the target When the probe is hybridized to the target the 5 nuclease activity of Taq polymerase will cause hydrolysis of the probe separating the quencher from the reporter dye This separation results in an increase in fluorescence emission of the reporter dye which is detected spectrophotometrically and recorded The amount of fluorescence recorded is proportional to the amount of target template in the samples NVSL AVPRO1505 03 Testing Protocol Page 4 of 33 Real Time RT PCR Test for Detection of Virulent Newcastle Disease Virus The APMV 1 matrix assay described in this protocol will detect viral RNA from both virulent and avirulent APMV 1 strains Due to the lower diagnostic sensitivity of the CalMex assay the fusion gene p
18. atrix APMV 1 assay is designed to detect APMV 1 including vaccine lentogenic strains as well as vNDV mesogenic velogenic strains The vNDV assay was designed Specifically for the California 2002 and Mexico 2000 velogenic vNDV but it has been showneto detect most mesogenic velogenic strains of NDV Because the matrix APMV 1 test is more sensitive 96 7 than the vNDV test 91 26 the matrix APMV 1 test is used to screen all samples For APMV 1 positive samples the vNDV assay is used to confirm the matrix test results If both tests are positive it provides strong evidence that vNDV is present in the sample In some cases where the sample is at the limit of detection a vNDV specimen can test positive with the APMV 1 matrix test and negative by the vNDV assay Samples positive by the matrix primer probe set that cannot be confirmed with the vNDV primer probe set should be considered as suspect and additional samples collected for further testing All suspect specimens should be tested by virus isolation Itpis also possible that APMV 1 matrix positive vNDV negative tests result from lentogenic or vaccine strain NDV isolates being in the sample For samples that have a low cycle threshold Cy of lt 30 where lower Cy means a stronger positive confirmation that the APMV 1 matrix positive vNDV negative samples are vaccine or lentogenic isolates can be made using different primer and probe sets These primers and probes sets are still b
19. between different machines changes in cycling times and probe concentrations are often required to get equivalent sensitivity Therefore optimization of the assay on alternative machines is required This optimization data needs to demonstrate that the alternative machine provides comparable sensitivity and limit of detection to the assay described in the current protocol with the Smart Cycler amp machine This data should be available for review by APHIS 2 1 10 25ul Smart Cycler tubes Catalog 14900 0022 NVSL AVPRO1505 03 Testing Protocol Page 7 of 33 Real Time RT PCR Test for Detection of Virulent Newcastle Disease Virus or 900 0003 Cepheid Smart Cycler Sunnyvale CA 2 1 11 PCR reaction tube refrigerated tube holder and mini microcentrifuge to spin tubes Both items are supplied with the Smart Cycler real time PCR machine 2 1 12 QOiaVac 24 vacuum manifold Valencia CA and vacuum pump with a capacity of 18 20 liter min Gast MFG Corp St Louis MO Use of insufficientyvacuum pressure may reduce RNA yield and purity The vacuum manifold system with vacuum pump is optionag put Nw a highly recommended product for processing large numbers OI Samples tor RAE PCe 2 2 Reagents supplies 2 2 1 Molecular biology grade RNase free sterile distilled water 2 2 2 In vitro transcribed WDA mawrix fusion gene positive control RNA supplied by the NVSL Ames IA 242 3 Ethanol absolute ACS grade or better Caution
20. e lysed swab specimen for 5 min at 5 000 X g in a mmrcrocentritftuge at RT 4 1 4 Transfer all of the lysed specimen supernatant to a RNeasy Qiagen column that has been marked to identify the specimen Centrifuge for 15 sec at 290 000 X gg at RI Check Lo assure the entire sgecimen has flowed through the column Repeat until all of Specimen has been applied to the column When working with a large quantity of specimens it is recommended to use a QiaVac manifold to pull the Specimen and wash solutions through the collection columns This will increase the efficiency and eliminate the need to centrifuge the columns at the steps 4 1 3 4 1 4 4 1 5 4 1 62and mL 4 1 5 Add 700gul of RW1 buffer to the RNeasy column and centrifuge for 15 sec 4 248 W U x g and place the column in a clean collection tube the tube with RW1 flow through may be discarded 4 1 6 Add 500u1 RPE buffer to the RNeasy column and centrifuge for 15 fet Ow J79 000 x g Discard flow through from the collection tube 4 1 7 Repeat for a total of 2 washes with RPE buffer discarding flow through from the collection tube Following the last RPE wash place the RNeasy column in a new 2 ml collection tube 4 1 8 Centrifuge the empty RNeasy column an extra 2 minutes at full speed and discard the collection tube 4 1 9 Place the RNeasy column in an elution tube or a 1 5m microfuge tube that has been marked with the Specimen number and pipet 50ul RNase free H20 in
21. eing optimized and will be included in future versions of this document NVSL AVPRO1505 03 Testing Protocol Page 28 of 33 Real Time RT PCR Test for Detection of Virulent Newcastle Disease Virus All samples positive with either RRT PCR test should be confirmed by virus isolation For samples outside a quarantine zone these samples must be sent to the NVSL since the NVSL is the reference laboratory for vNDV Confirmation by virus isolation is required before an FAD will be officially diagnosed Table 5 Interpretation of the RRT PCR results using the matrix and vNDV primer and probe sets Matrix vNDV vNDV RRT PCR results Results Interpretation Positive Positive Positive Any questionable samples should be re tested If results of the second test are unsatisfactory additional sampling from the flock or premises should be considered if possible 6 2 Expected C for the transcribed RNA positive control The transcribed RNA positive control should be diluted to a working concentration that will consistently give a target Cc of approximately 25 0 Any test run where the positive control has a Cy higher than 29 0 should be repeated to assure that test reproducibility is maintained If the CX of the positive control consistently runs lower than 20 0 recalibration dilution of the positive control is suggested Any time the positive control or any other growth curve CX is lower than a 14 0 the background subtraction can be Skewed
22. er 1 34 26 8 pmol 2 af 20 pmol ul Reverse Primer 0 67 13 4 pmol RQopl 20 pmol ul Rnase Inhibitor 0 5 0 266 units ul 13 3 units ul Enzyme Mix Tasg Probe 6pmol ul OTS 0 18 uM MM per rxn Lg Template 8 Total 25ul Qiagen buffer already contains 2 5 mM MgCl at 1X concentration 5 Data Analysis Settings for the Cepheid Smart Cycler The Smart Cycler software provides multiple methods for determining the cycle threshold C All data analysis options discussed below are selected from the Analysis Settings from the Views screen Changes in the standard default settings have been made to customize the analysis for the detection of vNDV with the matrix and vNDV primer probe sets Edit the Smart Cycler default analysis settings as describe below so the raw data will be analyzed according to the analysis parameters described Curve Analysis Accept the Primary curve setting The CX is detected and reported at the cycle where the primary c v r osses the threshold Usage Accept the default setting Assay for the FAM channel Background Subtraction Accept the default value of ON Bpackoround Minim m accept the derault value ofr 5 Mim The Smart Cycler calculates the background of the fluorescence signal within the range of cycles defined by the Background Min Cycle value and the Background Max Cycle value for each site to measure the background noise NVSL AVPRO1505 03 Testing Protocol Page 26 of 33 Real Time
23. ettings table by 5 cycles until the early cycles are approximately horizontal and aligned with zero fluorescence Figures 2a and 2 Figure 2a Example of a V shaped fluorescence trace The background maximum cycle is set to the default of 40 circled All other analysis criteria are set to the default values The negative control is shown for reference horizontal line at zero E H INNEN E aa SS E e Press R key to reset zoom Ctrl A to show all sites 1 ma er cmm Resutts Click right mouse button to scale graph f H8 HK 52 3 H8 HK 52 2 5mM 2 H9 HK 52 3 75 H8 HK 52 3 75 H8 HK 52 5mM H8 HK 52 5mM H8 HK 52 6 25 H9HkK52neg Fluorescence 30 0 30 0 Manual Manual i Protocols f Temperature EN FAM AMR A NVSL AVPRO1505 03 Testing Protocol Page 31 of 33 Real Time RT PCR Test for Detection of Virulent Newcastle Disease Virus NVSL AVPRO1505 03 Testing Protocol Page 32 of 33 Real Time RT PCR Test for Detection of Virulent Newcastle Disease Virus Figure 2b Same fluorogram as figure 2a however the background maximum cycles have been reduced to 20 circled to align the background fluorescence at 0 units All other analysis criteria are set to the default values The negative control is shown for reference horizontal line at zero Press R key to reset zoom Ctrl A to show all sites 1 BERE eee
24. f RNase free water and allow to sit at 4 C for 1 hr to overflight y vriefly vortex to resuspend pellet before pipetting 4 3 High throughput magnet bead RNA extraction Ambion MagMax method This procedure describes the extraction of total RNA from swab specimens using the Ambion extraction reagent The MagMAX Viral RNA Isolation Kit is designed for rapid high throughput purification of Sotah RNA from oropharyngeal tracheal swab samples as well as cultured cells The addition of guanidinium thiocyanate rapidly disrupts cellular membranes and inactivates cellular nucleases Paramagnetic beads with a nucleic acid binding surface are added to the lysate to bind nucleic acids The beads containing the RNA are then captured on magnets and the supernatant containing cell debris and other contaminants is removed during the wash procedures Different systems for RNA isolation are commercially available and potentially may work as well as the described procedure Alternative methods can be substituted when comparison testing of new and standard methods show equivalency This data should be available for review by APHWS 4 3 1 Preparation of Ambion Viral Isolation Kit Components Lysis Binding Solution Sub aliquot the lysis binding solutrion from the Ambion viral isolation kit into two different nuclease free containers See table below to determine the quantity of lysis binding solution needed Set one aliquot aside for preparatio
25. g the Max background the incidence of traces with a V shape are reduced For samples that still have a V shaped trace the Max background setting can be incrementally lowered to 15 until the early cycles in the trace are approximately horizontal and aligned with zero fluorescence Figures 2a and 2b When lowering the Max background keep in mind that you want as many cycles as possible used to calculate the background subtraction This is a correction on how the software handles the data and it decreases the number of cycles used to calculate the background and correct the curve If you have questions about the trace look at the trace with the background subtraction off This shows the raw fluorescence data and can sometimes aid interpretation The fluorescence trace of each specimen should be reviewed before accepting the Smart Cycler positive negative result NVSL AVPRO1505 03 Testing Protocol Page 27 of 33 Real Time RT PCR Test for Detection of Virulent Newcastle Disease Virus Any specimen whose fluorescence trace has a gradual increase in fluorescence units and approaches but does not cross the Cc should be sent to the NVSL for further testing These Specimens are referred to as late risers LS and on some occasions may indicate a sample near the threshold of detection At this time the significance of late risers samples is not known and testing by virus isolation is recommended 6 Analysis of test results 6 1 The m
26. gh throughput magnetic bead RNA extraction from swab specimens Ambion MagMAX method 4 4 Reverse transcription and PCR Data Analysis Settings for the Cepheid Smart Cycler Analysis of test results References Appendix 1 Summary of revisions NVSL AVPRO1505 03 Testing Protocol Page 3 of 33 Real Time RT PCR Test for Detection of Virulent Newcastle Disease Virus T Introduction 1 1 Background Virulent Newcastle disease vNDV is an acute highly contagious and fatal disease of chickens of all ages The disease also affects turkeys and numerous species of wild and captive birds Virulent Newcastle disease is caused by avian paramyxovirus 1 APMV 1 of the family Paramyxoviridae genus Avulavirus Acute vNDV in susceptible chickens can cause sudden death and high mortality with few or no clinical signs Surviving birds may show respiratory distress diarrhea depression and central nervous system signs The clinical signs of vNDV may resemble those of other diseases Therefore the signs are not considered pathognomonic Virulent Newcastle disease is reportable to the World Organization for Animal Health OIE The causative virus must meet one of the following criteria for virulence a virus that has an intracerebral pathogenicity index ICPI in day old chicks of 0 7 or greater or presence of multiple basic amino acids at the C terminus of the F2 protein and phenylalanine at residue 117 which is the N terminus of F1 protein
27. hroughout the body of the protocol 9 5 Version 03 February 24 2005 supercedes version 02 September 29 2004
28. n of wash NVSL AVPRO1505 03 Testing Protocol Page 19 of 33 Real Time RT PCR Test for Detection of Virulent Newcastle Disease Virus solution I mix Add L0 wh Pory A RNA krt provided per 50 pl lysis binding solution to the second aliquot and mix briefly Following the addition of Poly A RNA add an equal amount 50 ul of 100 isopropanol to lysis binding Poly A mixture to give a total volume of 101 pl per sample Vortex well Lysis binding solution is stable at room temperature for one month It is not recommended to store the prepared Viral Lysis Binding Solution at 4 C or below as this may cause the carrier RNA to precipitate if the solution is inadvertently stored at 4 C warm it at 37 and shake to dissolve any precipitates before use Add carrier RNA to Lysis Solution and mix well before adding isopropanol or carrier RNA may be very difficult to disperse i Gombune the tollowiungs 1 Plate 4 Plates Viral livsus7 Binding Soin 6 2 Iml 254 07 ML Concentrate Carrier RNA Uu 5 jal 500 ul 2e Mix Obey tne add 100 Isopropanol O2 5 mil Pe Os ol 3 Mix well by vortexing oS 4 3 1 1 Bead Resuspension Mix Dilute the Bead Resuspension Solution with Nuclease free Water according to the table below Be sure to add 100 isopropanol to the mixture last or beads may clum together and be more difficult to enter into solution Store at RT Bead Resuspension Mix Volume Per Volume Per Well Pilate 1 Bead Resuspensi
29. on Solution 6 0 ql FOU aL 2 Nuclease free Water 4 0 ul S0 0 qul um buc mn ee 4 0 pl 500 pl T Oeo Le e Ea a 100 Isopropanol 6 0 gil POO a mae well by vortexing Total Volume of Lysis Binding Solution ZO Ak 2 NVSL Testing Protocol AVPRO1505 03 Page 20 of 33 Real Time RT PCR Test for Detection of Virulent Newcastle Disease Virus 4 3 1 2 Wash Solution I Mix Mix the second sub aliquot of lysis binding solution in equal parts with 100 isopropanol A total volume of 100 ul is used per sample Store at RT 4 3 1 3 Wash Solution II Mix Mix 40 ul of Wash Solution II Concentrate with 160 wl of 100 ethanol to gain a total volume of 200 pl per sample Store at RT 4 3 2 Procedure for Extraction of RNA 4 3 2 1 Vortex swab specimen and transfer 50 ul of sample into the corresponding well on the 96 well processing plate supplied with kit 4 3 2 2 Place 101 pl of viral lysis binding solution with Poly A RNA to each well containing sample Ajgter addgtion of the lysis binding solution the processing plate may be removed from the BSC All remaining steps can be performed om the g ck at room temperature anake wlgre on the plate shaker at moderate speed for 30 sec 4 3 2 3 Add 20 ul of beads binding mix to each well Shake plate on orbital shaker for 4 minutes at approximately 550 600 rpm 4 3 2 4 Capture pellet the RNA Binding Beads on a magnetic stand Pellet the beads on the Ambion Magnetic Stand
30. on that will consistently give a target Cr of approximately 25 0 Dilute the stock RNA to the suggested working dilution as described in the product insert sheet that will accompany the transcribed RNA positive control with sterile RNase free water Run the diluted RNA on the RRT PCR assay to determine if the positive control has a C that is within the acceptable range section 60 2 3 5 Preparation of samples Perform all procedures with potentially live agents in an approved Class II biosafety cabinet with HEPA filtration Always wear protective clothing and gloves when handling potentially infected tissues or live virus Samples received for testing are compared to accompanying paperwork to assure correct samples were received and that NVSL AVPRO1505 03 Testing Protocol Page 15 of 33 Real Time RT PCR Test for Detection of Virulent Newcastle Disease Virus appropriate samples were submitted for the PCR test Cases are logged into the logbook Pooled oropharyngeal tracheal swabs 5 swabs tube are the Specimens of choice for the PCR procedure and should be extracted using either the Qiagen or Ambion RNA extraction procedure Appropriate tissue spleen lung brain intestine should be processed by preparing a 10 20 tissue homogenate and extracting RNA using the Trizol extraction procedure Alternatively 5mm piece tissues are added to 2 0 ml of brain heart infusion broth BHI frozem amp Solid thawed and centrifuged
31. reporting results 1 2 Keywords Virulent Newcastle disease virus vNDV real time reverse transcriptase polymerase chain reaction RRT PCR avian paramyxovirus l1 APMV 1 room temperature RT biological safety cabinet BSC 1 3 Collaboration This protocol was developed in cooperation with the Southeast Poultry Research Laboratory Agriculture Research Services USDA Athens GA and the California Animal Health and Food Safety Laboratory University of Cal owl A avis CA 2 Materials 2 1 Facilities equipment instrumentation 2 1 1 Surveillance samples originating from outside a known vNDV quarantine zone can be processed in a biosafety level 2 BSL 2 laboratories However samples originating from inside a known vNDV quarantine zone Or considered suspect for vNDV should be handled under increased biosecurity This includes restricted access to where the clinical samples are being handled until the samples have been rendered non infectious Once a clinical sample has been treated with lysis buffer for RNA extraction the sample can be moved to a less restrictive environment to complete the RNA extraction and RRT PCR analysis Once a sample is biologically amplified isolated in cell culture or chicken embryo and has been confirmed or is suspected of being a vNDV virus the virus should be handled at a higher containment level specifically biosafety level 3 or preferably biosafety level 3 ag NVSL AVPRO1505 03 Testing P
32. rimer set described in AVPRO1505 01 new primer combinations were developed for the detection of vNDV viral RNA This assay will be referred to as the vNDV assay and the primer set is the Creelan CalMex primers A description of the equivalency study for the validation of the Creelan CalMex primers has been included in appendix 1 The vNDV fusion gene assay will detect most vNDV strains including the one that infected U S poultry in CA AZ and NV in 2002 U0 amp Whe matrix assay respectively has a diagnostic sensitivity and specificity of 96 7 and 97 3 for the detection of APMV 1 RNA from chicken cloacal and tracheal swabs and 97 8 and 95 6 for the detection of vNDV in chicken tissues The vNDV assay respectively has a diagnostic sensitivity and Specificity of 91 26 and 97 5 for the detection of vNDV viral RNA from chicken cloacal and tracheal swabs Tissues from more than one bird should not be pooled together However tracheal swabs from up to 5 birds from one premises can be pooled together in 2 3 5 ml of brain heart infusion BHI broth but should not be pooled with cloacal swabs Tracheal swabs are the preferred specimen for the isolation of RNA Validation data has demonstrated a decreased efficiency in the isolation of RNA from cloacal swabs due to the heavy load of organic material It should be emphasized that the RRT PCR technique will detect viral nucleic acid from infectious as well as noninfectious virus For this reda
33. rotocol Page 6 of 33 Real Time RT PCR Test for Detection of Virulent Newcastle Disease Virus 2 1 2 Class II HEPA filtered biological safety cabinets BSCs with UV germicidal lights are required preferably 3 minimum of 2 to maintain sample integrity during processing and testing In addition the Trizol extraction procedure should be performed in a class II BSC that is connected to an external exhaust plenum to minimize exposure to organic chemical fumes 2 1 3 Refrigerator 4 C 2 2 1 4 Ap iuro Sreezer OL B 2osb rpee 2 1 5 UNDO URS EL Sezer 2 1 6 Micro centrifuge non refrigerated International Equipment Co MicroMax Needham Heights MA and refrigerated Hermle Z 360K Germany or Sorval Heraeus Biofuge Fesco Germany 2 1 7 Vortex mixer 2 1 8 Assorted test tubes and Eppendorf tube racks 2 1 9 An integrated DNA RNA amplification and detection instrument system that has the capability to detect specific sequences using hybridization probes Instrumentation should be capable of exciting and detecting fluorescein based probes 450 495nm 500 550 n 5 5 57Unm and 630 750nm ranges The current protocol was developed using the Cepheid Smart Cycler Cepheid Smart Cycler P SC2000N1 1 Sunnyvale CA However most if not all of the commercially available real time PCR machines can detect the fluorescein based probes and likely can be used with this test Based on past experience of transferring protocols
34. s Biosearch Technologies http blackholequenchers com and Operon http oligos qiagen com Suggested primer sources Integrated DNA Technologies http www idtdna com or Operon http oligos qiagen com Other companies can be used to order both primers and probes It is strongly recommended that the probes and primers be purified to a high level to reduce nonspecific reactions Purification is typically performed with HPLC purification as the minimum 2 2 10 Ambion MagMAX 96 Viral RNA Isolation Kit Cat 1835 plate kit or 1929 for single tube kit Ambion Austin TX 78744 1832 NVSL AVPRO1505 03 Testing Protocol Page 9 of 33 Real Time RT PCR Test for Detection of Virulent Newcastle Disease Virus Table 1 NDV real time RT PCR probe and primer sequences Specificity and Primer probe Sequence target gene name Genomic target APMV 1 matrix M 4100 5 AGTGATGTGCTCGGACCTTC 3 S a Mt4169 5 FAM TTCTCTAGCAGTGGGACAGCCTGC BHO 73 L eti enn E 4220 5 CCTGAGGAGAGGCATTTGCTA 3 reverse pd vNDV n a T a a oe forward primer F 4894 FAM AAGCGTTTCTGTCTCCTTCCTCCA BHQ Probe l VFP 1 virulent fusion s 4939x 5 AGCTGTTGCAACCCCAAG 3 reverse primer Validation testing with the vNDV primers and VFP 1 probe set has demonstrated that these reagents will detect the vast majority of mesogenic and velogenic APMV 1 viruses Refers to the nucleotide position
35. sS fmeskhe RRT PCR would not be the test of choice to determine 1f infectious APMV 1 was present in environmental samples Any specimen from outside a USDA quarantine zone that is positive with the APMV 1 matrix assay regardless of the vNDV fusion assay results should be referred to the National Veterinary Services Laboratories for further testing and characterization Virus isolation and characterization is required to officially diagnose a foreign animal disease FAD Virulent NDV is a zoonotic agent and causes conjunctivitis in humans Personnel handling clinical samples or live virus should take appropriate safety precautions to avoid accidental introduction of the virus into the eyes Appropriate safety precautions should include wearing disposable gloves laboratory coat and safety glasses Care should be taken not to rub or touch the eyes before removing gloves and washing hands with Soap and water NVSL AVPRO1505 03 Testing Protocol Page 5 of 33 Real Time RT PCR Test for Detection of Virulent Newcastle Disease Virus The procedure described here is used in the Diagnostic Virology Laboratory DVL of the National Veterinary Services Laboratories NVSL The brands of equipment listed in the protocol are used in the DVL however comparable equipment may also be used Laboratories using this protocol should follow quality assurance procedures as they pertain to equipment maintenance receiving specimens and recording
36. same Click right mouse button to scale graph H9 HK 52 2 H9 HK 52 2 5mM H9 HK 523 75 H8 HK Ez emm e Jas H8 HK 52 5mM H9 HK 526 25 Fluorescence fa e Manual Manual NVSL AVPRO1505 03 Testing Protocol Page 33 of 33 Real Time RT PCR Test for Detection of Virulent Newcastle Disease Virus 7 References Tl IAlLdOous E Wep Me Ga COLLINS A cMocGoldrrck Dag Alexander Rapid pathotyping of Newcastle disease virus NDV using fluorogenic probes in a PCR assay Veterinary MichBobaohogWeiOUy LUUL DO LUS by 7 2 Office of International des Epizooties Manual of Standards for Diagnostic Tests and Vaccines Fourth edition ZUOU Die d 222 7 3 Spackman E Senne D A Myers T J dt a A902 Development of a real time reverse transcriptase PCR assay for type A influenza virus and the avian H5 and H hemagglutinin subtypes J Clin Micro 4033256 3260 7 4 Wise M G D L Suarez B S Seal J C Pedersen D A Senne D J King D R Kapczynski E Spackman Development of a Real Time Reverse Transcription PCR for Detection of Newcastle Disease Virus RNA in Clinical Samples J Clin MIQEOS 2000 4232 52995939 7 5 U S Department of Health and Human Services Public Health Service Centers for Disease Control and Prevention and National Institutes of Health Manual of Biosafety in Microbiological ands Biomedical Laboratories Fourth edition 1999
37. to the column Do not touch the silica gel membrane with the pipettor tip Incubate at room temperature for 1 minute Elute RNA by centrifuging for 1 minute at 2107000 pue Discard RNeasy columns 4 1 10 Store at 4 C until specimen is tested on RRT PCR RNA should be stored at 4 C for as short of period as possible before testing If the sample cannot be tested within 24 hours it should be stored at 20 C or colder NVSL AVPRO1505 03 Testing Protocol Page 17 of 33 Real Time RT PCR Test for Detection of Virulent Newcastle Disease Virus 4 2 Trizol LS Extraction for tissue samples This procedure describes the extraction of total RNA from tissue using the Trizol extraction reagent The reagent is a mono phasic solution of phenol and guanidine isothiocyanate Addition of chloroform followed by centrifugation separates the solution into an aqueous phase and an organic phase The RNA is recovered from the aqueous phase by precipitation with isopropanol Different systems for RNA isolation are commercially available and potentially may work as well or better than the method described here Alternative me thods of RNA extraction can be substituted when comparison testing of new and standard methods show equivalency ThisS data should be available for review by APHIS Always wear protective clothing eyewear and gloves when working with extraction reagents 4 2 1 Centrifuge tissue specimens 20 homogenates or tlssue pools at 1
38. uorescence is acquired at the annealing step 4 4 2 The real time RT PCR reaction should be prepared with the following components and volumes using the appropriate primer and probe set and cycling conditions Set up the reactions with the reaction tubes in the cooling block and use aerosol resistant pipet taips Prepare the reaction mix everything but the template by pipetting H20 kit supplied 5X reaction buffer kit supplied dNTP s forward and reverse primers and 25mM MgCl into a nuclease free microcentrifuge tube using the volumes per reaction for each reagent given in NVSL AVPRO1505 03 Testing Protocol Page 23 of 33 Real Time RT PCR Test for Detection of Virulent Newcastle Disease Virus table 4 Next add the RNase inhibitor and enzyme Add the probe last Mix reagents and centrifuge briefly Once the probe has been added minimize exposure of the reaction mix to Lrght 4 4 3 Add the reaction mix 17ul to the Smart Cycler tubes add the mix to the bottom of the cup at the top of the reaction tube 4 4 4 Add 8 ul of purified test sample RNA to the Smart Cycler reaction tube using a pipettor designated for RNA transfer Close the lid of the tube and number the reaction tubes according to test worksheet Transfer 8ul of diluted transcribed RNA 200 ADV provided by NVSL Ames IA into the positive control reaction tube and 8yul of clean RNase free water into negative control reaction tube 4 4 5 Centrifuge reaction
39. werovmed or RRT PCR amplification plate 4 3 2 14 Store at 4 C until specimen is tested on mm PCR RNA should be stored at 4 C for as short of period as possible before testing If the sample cannot be tested within 24 hours it should be stored at 70 C 4 4 Reverse transcription and PCR Two work areas are required for this procedure a clean area with a dedicated BSC freezer and supplies and a thermal cycling area Never introduce RNA DNA material into the clean area and always change gloves before entering the clean area 4 4 1 In the clean hood prepare a master mix of the following reagents sufficient for the number of NVSL AVPRO1505 03 Testing Protocol Page 22 of 33 Real Time RT PCR Test for Detection of Virulent Newcastle Disease Virus samples being tested The amount given in the table is per sample This procedure was designed for the Cephied Smart Cycler Cepheid Sunnyvale CA Information on setting up and programming the Smart Cycler can be found in the Smart Cycler user s manual The conditions for the RT PCR on the Smart Cycler are shown in tables 2 and 3 Table 2 RT step thermocycling for Qiagen one step RT PCR Kit Do 15 NC Table 3 Thermocycling conditions for gene specific probe and primer sets Probe Primer Step Time set 7 emsealing 30 sec s c extension 10 sec 72 c vNDV VFP 1 NENE o 0ealing el eser sg e 1 i a Sec Note The fl
Download Pdf Manuals
Related Search