cDNA Isolation Kit
Contents
1. 5 First strand cDNA Synthesis 6 PCR reaction for RACE A Primer design B PCR fOr 5 ando PRACE eee tee ce ee a 7 Isolation of Full length target cDNA 8 Troubleshooting Guide Appendix A Expected Result of 5 RAGE Appendix B Expected Result of 3 RACE Appendix C Isolation of Full length cDNA from RACE Fragments Belated Produce eseist a a Seegene s Distributors www see gene com CON NN KB 1 Introduction ACP Technology patent pending represents the most accurate and extensive technology developed by Seegene The specificity with which a primer anneals only to its target sequence is the most critical factor ACP Technology provides a primer with annealing specificity to the template and allows only real products to be amplified such that it enables the researchers to find only real products as a result First strand cDNAs are synthesized using oligo dT ACP wherein the 3 end core portion of the oligo dT ACP comprises a hybridizing sequence complementary to a poly A region of mRNA transcri2. Seegene CapFishir cDNA Isolation Kit User Manual Version 1 1 Catalog No FDRK 2101 Storage Conditions 20 C For Research Use Only Product Warranty and Liability Seegene warrants the performance of all products as described when used according to instruction Any problem incurred for any reason other than misuse should be reported to Seegene immediately This warranty limits our liability to replacement of the products Safety Warning and Precautions This product is limited for research use only not recommended or intended for diagnosis of disease in humans or animals Do not use internally or externally in humans nor animals Ordering Information and Technical Services Seegene USA Seegene Inc P O Box N 142 21 Samsung dong Kangnam gu Del Mar CA 92014 0376 Seoul 135 090 USA Korea Tel 858 610 9610 Tel 82 2 566 9830 Fax 858 623 9610 Fax 82 2 566 9831 E mail inio0 see gene com E mail into see gene com URL www see gene com URL www see gene com The PCR process is covered by patents owned by Hoffman La Roche Inc No license or immunity under any other patent is either expressed or implied by the sale of any Seegene product www see gene com Table of Contents ir ir 2 List of Components 3 Reagent and Equipment to Be Supplied by User 4 Storage Conditions
3. 14 A 19 PCR using 5 and 3 RACE fragments as template and priming site B 2 4 PCR using 1 PCR product as a template with 5 and 3 RACE primers A 1t PCR Reaction for Target Full length cDNA Synthesis First PCR reaction is performed using 5 and 3 RACE products without adding the primers The fragments of 5 and 3 RAGE have two roles template and primer The priming site is the overlapping region between 5 and 3 RACE fragments Figure 3 Full length cDNA of interest is synthesized at 1 PCR reaction 1 Add the following reagents to a PCR tube 1 ul Diluted 5 RACE products 1 ul Diluted 3 RAGE products 2 ul 10X PCR buffer 2 ul 25 mM MgCl 2 ul 2 mM dNTP 0 2 ul Tag DNA polymerase 5 U l 11 8 ul Distilled water 20 ul Total volume Note Aliquot 1 ul of 5 and 3 RACE products to new tubes respectively Then add 39 ul distilled water to 1 ul of each RACE products According to your RACE products the dilution factor may be varied If you have smear band at 2 PCR reaction you have to increase the dilution factor 7 You can use Pfu DNA polymerase instead of Tag DNA polymerase If you want to require high fidelity synthesis we recommend using Pfu DNA polymerse 2 Commence the PCR reaction using the following program segment No of cycles Temperature Duration 1 1 94 C 3 min 2 1 55 60 C 1 min 3 1 72 C 5 min Note The cycling parameters were optimized by using GeneAmp PCR System 9700 7 If your target is lo
4. segment No of cycles Temperature Duration 1 1 94 C 3 min 2 25 35 94 C 1 min 58 68 C 40 sec 72 C 1 mint 3 1 72 C 5 min 7 If your target is longer than 1 Kb you may increase the extension time Note 5 and 3 RACE using control total RNA was performed at 58 C annealing temperature through 30 cycles See figure 6 in appendix C 17page Note For the best results hot start PCR technique is highly recommended in which the procedure is to set up the complete reactions without the DNA polymerase and incubate the tubes in the thermal cycler to complete the initial denaturation step at gt 90 C Then while holding the tubes at a temperature above 90 C the appropriate amount of DNA polymerase can be pipetted into the reaction The cycling parameters were optimized by using GeneAmp PCR System 9700 We recommend using ABI GeneAmp PCR System 9700 thermal cycler Applied Biosystems 3 Electrophorese 5 ul of the PCR products on 2 agarose gel stained with EtBr www see gene com 11 7 Isolation of Full length target CDNA You can generate the full length cDNA of your target gene by one of the following methods End to End PCR Ligation of 5 and 3 RAGE Fragments e Direct PCR using 5 and 3 RACE Fragments End to End PCR If you know the extreme sequences of the 5 and 3 ends of your target cDNA you can use the sequences to design 5 and 3 primers for the generation of your target full length cDNA The extreme sequences of th
5. 5 end for its stability Seegene s CapFishing adaptor sequence is linked to the 3 end of the first stranded cDNAs CapFishing technology patent pending Thus the 5 end enriched first stranded cDNAs can be used directly in 5 RACE reactions without a complex series of enzymatic steps such as adaptor ligation and second strand synthesis If you want to clone the 5 end region of large transcripts 56 Kb or 5 end enriched cDNAs you can use the random hexamer instead of oligo dT ACP as cDNA synthesis primer RACE PCR reaction For the 5 or 3 RACE PCR reaction the sequence of a target gene was needed to www see gene com design target primers Design the target primers to be about 20 24 bases in length 60 GC content with no secondary structure and with no self hybridization and forming primer dimmers at 3 ends The primer design is described in detail below Cloning and sequencing Both 5 and 3 RACE reactions are conducted using the first stranded cDNAs generated by CapFishing Technology Then the full length cDNA of a target gene can be directly obtained using the 5 and 3 RACE products without constructing or screening a CDNA library The RACE products can be cloned directly into a cloning vector and their sequences are confirmed by sequence analysis www see gene com 9 RNA Poly A or total RNA First strand synthesis First strand synthesis using random hexamer using dI ACP 5 end rich cDNAs Full length
6. mutant not deletion mutant reverse transcriptase 1 Add the following reagents to a tube for RT ul Poly A or Total RNA 2 ul 5 mM dNTP 2 ul 10 uM dT ACP or random hexamer ul DEPC treated water 11 5 ul Note For the cDNA synthesis 1 ug 3 ug of total RNA or 50 ng 1 ug of poly AX RNA can be used If you want to clone the 5 end region of a large transcript 56 Kb or to obtain 5 end enriched cDNAs we recommend using the random hexamer as cDNA synthesis primer 2 Incubate the tube at 65 C for 5 min 3 Chill the tube on ice for 2 min and spin the tube briefly 4 Add the following reagents to the tube from step 3 4 ul 5X RT buffer 0 5 ul RNase inhibitor 40 u ul 1 ul 0 1M DTT 2 ul BSA 1 mg ml 1 ul Reverse transcriptase 200 U l 20 ul Total volume Note According to the kind of reverse transcriptase DIT may be needed additionally Note We recommend you use a RNase H M MLV reverse transcriptase Reverse transcriptase without ribonuclease H activity prevents from degradation of RNA during IS strand cDNA synthesis resulting in higher yields of full length cDNA from long templates 5 Incubate at 42 C for 1 hr 6 Add 1 4 ul of CapFishing adaptor solution to the tube Note After the completion of at least 1 hour incubation the CapFishing adaptor solution should be added into the tube containing the RT reaction mixture and reverse transcriptase Before adding the CapFishing adaptor solution to the tube preh
7. possibility of generating a hybrid from two different forms of a polymorphic RNA or transcripts of a multigene family We recommend confirming overlapping region of 5 and 3 RACE fragments by sequencing www see gene com 15 8 Troubleshooting Guide 1 No band in RACE using the target and RACE primers a You may have a problem with cDNA synthesis because of strong secondary structure or high GC content in your gene Repeat the cDNA synthesis using random hexamer and oligo dT ACP b Your gene may be expressed weakly You may have to use other source of RNA c Your gene is not suitable for RT or PCR because it is too long Repeat cDNA synthesis using random hexamer or gene specific primer d You may have a problem with your target primers Redesign target primers 2 No band in RACE using the control and RACE primers You may have a problem with cDNA synthesis Try to synthesize first stranded cDNAs using the control RNA we provided If the expected band is shown you may have a problem with RNA quality Use fresh RNA sample in RT reaction 3 Multiple bands in your experimental sample a Your gene may be a member of a family gene b Degraded RNA causes multiple products Use fresh RNA sample in RT reaction c You may have a problem with your primers Design new primers d Increase the annealing temperature e Reduce the cycle number and or extension time f Perform nested PCR reaction using nested primer 4 Smearing in y
8. 5 Mississauga ONL5L1C7 Tel 1 9058282455 Fax 1 905 828 9422 E mail orders biocan com URL ww blocan com Bio mediator Linnaistentie 5 FIN 01640 Vantaa Tel 35898524898 Fax 358 9 852 4884 E mail info bio mediator com URL wwbio mediatorcom BioCat GmbH Im Neuenheimer Feld 581 D 69120 Heidelberg Tel 49 6221 585844 Fax 49 6221 5858 09 E mail info biocatde URL wwoblocat de Line Analytics Life Sciences Ltd 8 F Eastwood Centre SA Kung Ngam Village Road Hong Kong SAR PRC Tel 852 2578 5839 Fax 852 2807 2674 E mail line lineanalytics com URL wwilineanalytics com TALRON 17 Hazait St Rehovot 76349 Tel 972 8 9472563 Fax 9728 9471156 E mail sales talron co l URL wwwialron co i CABRU sas Via Caduti per la Patria 47 20050 Peregallo di Lesmo MI Tel 390396981589 Fax 39 039 6065174 Emal info cabrut ei Luxembourg ff H IF Taiwan United Ki W LA S www see gene com Funakoshi Co Ltd 9 7 Hongo 2 chome Bunkyo ku Tokyo 113 0033 Tel 81 3 5684 1622 Fax 81 35684 1633 E mail reagent funakoshi co jo URL vww funakoshi co jp ImmunoSource BVBA Ruiterslaan 29 B 2980 Halle Zoersel Tel 32 3 38536 85 Fax 323 38438 18 E mail info immunosource com URL wwvimmunosource com All Eights M Sdn Bhd 45 Jalan TS 610A Suband Industrial Park 47510 Subang Jaya Selangor Darul Ehsan Tel 60 3 5633 49 88 Fax 60356330261 E mall al8 alleights com my URL wwwalleig
9. cDNAs PCR for 5 RACE PCR for 5 or 3 RACE 5 RACE fragment of 5 or 3 RACE fragment of target transcript target transcript Cloning and Sequencing Cloning and Sequencing Cloning of 5 Cloning of 5 or 3 RACE fragment RACE fragment End to end PCR Ligation or Direct PCR Full length cDNA of target transcript Figure 1 Overview of Full length cDNA isolation 6 www see gene com 2 List of Components 1 CapFishing adaptor solution patent pending 2 Oligo AT ACP 10 uM 5 CTGTGAATGCTGCGACTACGAT XXXXX T 18 3 3 Random Hexamer 10 uM 4 5 RACE Primer 10 uM 5 GTCTACCAGGCATTCGCTTCAT 3 5 3 RACE Primer 10 uM 5 CTGTGAATGCTGCGACTACGAT 3 6 Control 5 GAPDH Primer 5 uM 5 AGITGCCAGCCTCGTCCCGTA 3 Control 3 GAPDH Primer 5 uM 5 TGAGCCCTTCCACAATGCCA 3 8 Control Total RNA Mouse Kidney 0 5 ug ul 9 dNTP 5 mM 10 dNTP 2 mM 11 BSA 1 mg ml 12 DEPC treated Water 3 Reagents and Equipment to Be Supplied by User Reverse transcriptase DTT RNase inhibitor Tag or Pfu DNA polymerase Thermal cycler 4 Storage Conditions Store control RNA below 70 C Store all other reagents below 20 C www see gene com 5 Full length First strand cDNA Synthesis We recommend wearing gloves throughout to protect your RNA sample Perform all reaction on ice unless otherwise indicated For the proper full length cDNA synthesis we recommend using MMLV RNase H point
10. e 5 and 3 ends can be obtained from the 5 and 3 RACE products of your gene that is generated by this kit as described in the sections 5 and 6 1 Design the gene specific 5 primer using the extreme 5 end sequence of the 5 RACE product of your target cDNA Note The primer design is described in detail above Section 6 2 Design the gene specific 3 primer using the extreme 3 end sequence of the 3 RACE product of your target cDNA Note Alternatively you can use the 3 RACE primer Supplied instead of the gene specific 3 primer 3 Perform the PCR reaction using the primers designed from steps 1 and 2 4 Clone the PCR products into a PCR cloning vector Ligation of 5 and 3 RACE Fragments If you Know a unique restriction enzyme site in your target cDNA you can use the restriction site to generate the full length target cDNA First you can generate 5 and 3 RACE products of your target cDNA that should have the overlapping region between them See Figure 2 The unique restriction site should be present within the overlapping region Second the 5 and 3 RACE fragments are digested by the unique restriction enzyme and the digested 5 and 3 RACE fragments are ligated to generate full length cDNA 1 Choose a unique restriction enzyme site from the overlapping region of the 5 and 3 RACE fragments of your target cDNA Note You have to select the restriction enzyme that has only one restriction site i
11. eat the CapFishing adaptor solution at 65 C for 5 min and cool it down on ice for 2 min 8 www see gene com 7 Add 0 3 ul reverse transcriptase to the tube containing the CapFishing adaptor solution 8 Incubate at 42 C for 30 min 9 Heat the tube at 70 C for 15 min 10 Incubate the tube at 94 C for 5 min 11 Chill the tube on ice for 2 min and spin the tube briefly 12 Dilute the first stranded cDNAs for the PCR reaction by adding 180 ul DEPC treated water www see gene com 9 6 PCR reaction for 5 or 3 RACE A Primer design You have to design target primers for the 5 and or 3 RACE reactions You may have to design nested primers for real RACE products The primers should be 22 30 nucleotides long GC content gt 50 Tm gt 65 C The primers should have a GC content of 50 70 The primers should not be able to form secondary structures due to internal complementarity Avoid containing sequences at the 3 end that allow base pairing with itself or other primer Avoid repetitive sequence or regions containing stretches of the same nucleotide sometimes the specificity of your PCR reaction may be low high level of nonspecific background resulting in mispriming and the generation of false amplification products In this case design nested primers to amplify an internal region of the original amplified product Nested PCR increases sensitivity by reducing the nonspecific products Region to be ampl
12. ht com my ImmunoSource BVBA Ruiterslaan 29 B 2980 Halle Zoersel Tel 32 3 38536 85 Fax 323 38438 18 E mail info immunosource com URL wwvimmunosource com All Eight Marketing Services Pte Lid No 6 Harper Road 03 02 Leong Huat Building Singapore 369674 Tel 65 6288 6388 Fax 65 6284 9805 E mail alleight alleightcom URL wwwalleightcom BioCat GmbH Im Neuenheimer Feld 581 D 69120 Heidelberg Tel 49 6221 585844 Fax 49 6221 5858 09 E mail info biocatde URL www biocat de Protech Technology Enterprise Co Ltd 14F C No 3 Building F YuanQu St 115 NanKang Dist Taipei Taiwan R O C Tel 886 2 2381 0844 Fax 886 2 2655 7601 E mail howardwu mait hinet net URL wwwwbio protech com tw Insight Biotechnology Limited PO Box 520 Wembley HA9 7XX Tel 44 20 838503038 Fax 44 20 8385 0302 E mail inio insightbio com URL wwwi nsighibio com 19 gotta see gene Seegene www see gene com
13. ified by 5 RACE Region to be amplified by 3 RACE Overlapping region SI Ms 5 RACE primer 3 RACE primer Figure 2 Relationship of target primers to a full length first stranded cDNA template This diagram shows a synthesized first strand cDNA full length cDNA The target primers are designed to produce overlapping 5 or 3 RACE products The spotted arrows indicate target primers for 5 or 3 RACE PCR The blanked arrows indicate nested primers for nested 5 or 3 RACE PCR 10 www see gene com B PCR for 5 and 3 RACE The optimal cycling parameters may vary with different polymerase templates target primers and thermal cyclers We recommend performing the control PCR experiment prior to the experiments with your samples 1 Add the following reagents to a PCR tube for the PCR reaction 5 RACE 3 RACE 2 ul Diluted first strand cDNAs Diluted first strand cDNAs 2 ul 10X PCR buffer MgCl free 10X PCR buffer MgCl free 2ul 25 mM MgCl 25 mM MgCl 1 ul 10 uM 5 RACE primer 10 uM 5 target primer 1w 10 uM 3 target primer 10 uM 3 RACE primer 2 ul 2mMANTP 2 mM dNTP 0 2 ul Tag DNA polymerase 5 U ul Tag DNA polymerase 5 U ul 9 8 ul Distilled water Distilled water 20 ul Total volume Total volume Note You can use Pfu DNA polymerase instead of Taq DNA polymerase If you want to require high fidelity synthesis we recommend using Pfu DNA polymerse 2 Commence the PCR reaction using the following program
14. n your target cDNA 12 www see gene com 2 Digest the 5 and 3 RACE fragments of your target cDNA with the unique restriction enzyme 3 Extract the digested RACE fragments from agarose gels using DNA extraction kit 4 Ligate the digested 5 and 3 RACE fragments to generate the full length cDNA of your target gene 5 Clone the full length cDNA into a PCR cloning vector Direct PCR using 5 and 3 RACE Fragments If you have no sequence information of the 5 and 3 ends of your target cDNA or cannot find the unique restriction enzyme site in the overlapping region of the 5 and 3 RACE fragments you can generate the full length target cDNA by direct PCR using the 5 and 3 RACE fragments _ Overlapping region as priming 5 RACE product site NN SEIN S j3 SE O a Full length cDNA 3 RACE product synthesis by one cycle of 1 PCR reaction 27 PCR reaction with 5 RACE primer J and 3 RACE primer Amplification of target full length cDNA Figure 3 Method for generating full length cDNA of interest This diagram shows one of methods for generating full length cDNA of interest The overlapping region roles as primer at 14 PCR reaction Full length cDNA is generated at 19 PCR reaction and amplified at 2 PCR reaction The black box indicates 5 RACE primer The spotted box indicates 3 RACE primer www see gene com 13 Full length cDNA of interest is obtained by two PCR reactions
15. ng transcript you have to increase the extension time Note 1 PCR using 5 and 3 RACE fragments of control GAPDH was performed at 60 C annealing temperature www see gene com B 2 PCR Reaction for Target Full length cDNA Amplification Second PCR reaction is commenced using 1 PCR product as a template and 5 and 3 RACE primers Full length cDNA of interest is amplified at 2 PCR reaction 1 Add the following reagents to a new PCR tube 1 ul 1 PCR products 2 ul 10X PCR buffer 2 ul 25 mM MgCl 1 ul 10 uM 5 RACE primer 1 ul 10 uM 3 RACE primer 2 ul 2 MM dNTP 0 2 ul Tag DNA polymerase 5 U l 10 8 ul Distilled water 20 ul Total volume Note You can use Pfu DNA polymerase instead of Taq DNA polymerase If you want to require high fidelity synthesis we recommend using Pfu DNA polymerse 2 Commence the PCR reaction using the following program segment No of cycles Temperature Duration 1 1 94 C 3 min 2 25 55 60 C 40 sec 68 C 40 sec 72 C 3 min 3 1 72 C 5 min The cycling parameters were optimized by using GeneAmp PCR System 9700 See figure 6 in appendix C 17page 7 If your target is long transcript you have to increase the extension time 3 Electrophorese 1 ul of the PCR products on 2 agarose gel stained with EtBr 4 Extract the full length cDNA of interest 5 Clone the isolated fragment into a cloning vector Note If your cDNA is one of multigene family or splicing forms this could have the
16. nthesized using 3 ug of total RNA from mouse kidney tissues Full length cDNAs were synthesized as described above Section 5 Each RACE reactions was commenced using control 5 and 3 GAPDH primer respectively For the isolation of GAPDH full length cDNA direct PCR reaction was conducted M 100 bp ladder 1 5 RAGE reaction 2 3 RACE reaction 3 Isolated full length cDNA www see gene com 17 Related Products on NA eferrecerrrerrrr I TITT TITT TTT Ltt I a al al dad d 18 Forever 100bp ladder Personalizer Our unique 100 bp endless usage ladder system patent pending is clearly distinguished from any existing commercialized consumables 100 bp DNA ladder This system supplies templates plasmids which willl be amplified to be used for size markers GeneFishing DEG kits All of the GeneFishing DEG kits DEG101 106 comprise 20 ransdomly selected arbitrary ACPs Annealing Control Primers and each DEG kit works equally for your target samples Full length cDNAs Seegene s Full length cDNAs are ideal to study gene expression in specific tissues and at specific developmental stages and also to clone the genes belonging to a multigene family Pre made Northern Blots Northern blots are pre made for immediate use and designed to See Gene expression in specific tissues and at specific developmental stages Our Northern blots allow you to assess the distribution size alternative splicing form
17. our experimental sample a You may have a problem with RNA quality or reverse transcription Repeat cDNA synthesis using re purified RNA or fresh RNA samples b You may have a problem with your primers Redesign the gene specific primers c Dilute your experimental template d Reduce the cycle number of PCR reaction 16 www see gene com Appendix A Expected Result of 5 RACE M 1 2 3 4 Figure 4 Result of 5 RACE PCR reaction for glycer aldehyde 3 phosphate dehydrogenase GAPDH gene using full length first stranded cDNAs as templates Total RNA was isolated from brain tissues After the synthesis of full length first stranded cDNAs PCR reactions were performed using 5 RACE primer and control 3 GAPDH specific primer M 100 bp ladder 1 Mouse ICR 2 Rat SD 3 Chicken 4 Rabbit Appendix B Expected Result of 3 RACE Figure 5 Result of 3 RACE PCR reaction for glycer aldehyde 3 phosphate dehydrogenase GAPDH gene using first stranded cDNAs synthesized by oligo dT ACP Total RNA was isolated from brain tissues After the synthesis of the first stranded cDNAs PCR reactions were performed using 3 RACE primer and control 5 GAPDH specific primer M 100 bp ladder 1 Mouse ICR 2 Rat SD 3 Chicken 4 Rabbit Appendix C Isolation of Full length cDNA from RACE Fragments M 1 2 3 Figure 6 Result of generating for glycer aldehyde 3 phosphate dehydrogenase GAPDH full length cDNA First strand cDNA was sy
18. pts CapFishing cDNA Isolation Kit provides methods for performing 5 and 3 rapid amplification of cDNA ends RACE without a complex series of enzymatic steps adaptor ligation and second strand cDNA synthesis Full length first stranded cDNA synthesis Seegene s CapFishing cDNA Isolation Kit provides a simple and fast method for generating full length cDNAs during reverse transcription reaction First first strand cDNAs are synthesized using oligo dI ACP Second when reverse transcriptase recognizes the CAP structure of mRNA which is present at its 5 end for its stability Seegene s CapFishing adaptor sequence is linked to the 3 end of the first stranded cDNAs CapFishing technology patent pending Only the full length cDNAs have the Seegene s CapFishing adaptor sequence at their 3 ends and oligo dT ACP sequence at their 5 ends Thus the full length cDNAs generated by CapFishing technology can be used directly in 5 or 3 RACE reactions without a complex series of enzymatic steps such as adaptor ligation and second strand synthesis 5 end enriched first stranded cDNA synthesis Seegene s CapFishing cDNA Isolation Kit provides a simple and fast method for generating 5 end enriched first stranded cDNAs during reverse transcription reaction process First first strand cDNAs are synthesized using random hexamer Second when reverse transcriptase recognizes the CAP structure of mRNA which is present at its
19. s and level of your transcripts in one experiment Zoo Blot We are offering zoo blot pre made Southern blot including 12 different species for your screening assays Genomic DNAs were prepared from human rat SD mouse ICR dog cow pig rabbit chicken frog Xenops fish Zebra fish C elegans and yeast Genomic DNAs We are offering genomic DNAs obtained from 12 different sample sources for your screening assays Seegene s genomic DNA is qualified for genomic analysis including PCR and library construction DNA Walking SpeedUp Kit As a third commercial application of Seegene s proprietary ACP Annealing Control Primer Technology maximizing PCR specificity DNA Walking SpeedUp Kit is directed to the method using our unique DNA Walking ACP DW ACP primer designed to capture unknown target sites and the optimized PCR conditions www see gene com Seegene s Distributors Scientifix Pty Lid PO Box18 Southland Centre Cheltenham Victoria Tel 61 3 9462 7488 Fax 61 395487177 Free call 1800 007 900 E mail info scientifix com au URL wwsoientifix com au BioCat GmbH Im Neuenheimer Feld 581 D 69120 Heidelberg Tel 49 6221 585844 Fax 496221 5858 09 E mail info biocatde URL wwibiocat de ImmunoSource BVBA Ruiterslaan 29 B 2980 Halle Zoersel Tel 32 3 38536 85 Fax 323 38438 18 E mail info immunosource com URL wwimmunosouroe com Bio Can Scientific Inc 2170 Dunwin Drive Unit
Download Pdf Manuals
Related Search