User Manual
Contents
1. The of transduced cells is determined by flow cytometry excitation 561nm emission 600 20 for TagRFP by observing the 9o of RFP cells in the transduced cell sample When the of transduced cells is at or below 20 the number of infections can be considered roughly equivalent to the number of transduced cells At higher transduction efficiencies however the fraction of transduced cells bearing multiple integrations increases so that the number of infected cells after transduction is less than the number of TU In other words some cells are transduced 2 or 3 times Use the graph to calculate the Multiplicity of Infection i e the number of TU cell required to transduce a specific number of cells with MOIs above 0 2 Titer is calculated according to the TITER FORMULA below TU ml of cells at Transduction x MOI ml of Viral Stock used at Transduction Example IF The original of cells at Transduction was 100 000 and The volume of virus stock used was 10 ul and The observed of transduced RFP cells is 25 THEN The calculated MOI is 0 3 and The TITER is 100 000 x 0 3 0 01 3 000 000 TU ml Once titer is estimated the amount of Lentiviral Stock necessary to transduce any given of target cells at any transduction efficiency range of 10 80 infected cells can be backward calculated from the TITER FORMULA and TITER CHART above Example To transduce 20 000 000 cells at 50 transduction efficiency w2. y ALS 2 KS c Dv Mer fs d Jo CE Das Be SA ke Df If 63 Discovery is yours CELLECTA Cellecta CellTracker Lentiviral Barcode Library User Manual V3 6 6 15 www cellecta com CellTracker Lentiviral Barcode Library www cellecta com User Manual Table of Contents A Background 3 B Required Materials 222222222 222222222222 111 3 C Protocol onl te od a a Mon ony Pee a Aeon t a e bc 4 D Transduction and Lentiviral Titer Estimation ee 6 E Genomic DNA Extraction for Barcode Amplification and HT Sequencing 22222 222 10 F Amplification of Barcodes from Genomic DNA LLL 11 HT sequencing of Barcodes 222 13 Barcode Enumeration Conversion of raw HT Seq data to number of reads for each barcode 13 I Troubleshooting 22222222 222250 14 2 Technical Support 222 2 22 27 2 110024 15 Safety Guidelines 16 Appendix 22 222222222 234 936001 17 1 Map of CellTracker Lentiviral Barcode Library Vector 22222222 2 0 17 2 Barcode Library Vector Cassette 2 2 2 4 17 3 HT Sequencing Primers LL LL LLL LL LLL ns 18 4 Barcode Library Vector Features 2 222222422222 18 M Terms and Conditions 19 Cellecta Inc 2 of 19 v3 6 6 15 CellTracker Lentiviral Barcode Library www cellecta com User Manual Background The protocols below provide guide
3. 1 FwdU6 2 ECORI FwdHTS3 Gex1 Bpi BarCodel8TTCG BarCode18 GexSeqS XhoI cPPT Gex2 NR2 R2 RevUbiC1l FwdHTS3 TCGGATTCAAGCAAAAGACGGCATA Gex1 Bpi Bpi TCAAGCAGAAGACGGCATACGAAGACA BC18 BC18 XhoI U6 E U6 TCAGAAGAAAAAACTTAAGTTCGTTTTCTGCCGTATGCTTCTGTCAAGC GC TGACATCTTGAGACTTG TT AAGCCTGACATCTTGAGACTTGGAGA cPPT GexSeqS TTTAAAAGAAAAGGGGGGATTGGGGGGTACAGTGCAGGGGAAAGAATAGTAGACATAATAGCAACAGACATACAAACTAAAGAATTACAAAAACAAATTACAAAAATTCAAAATT AAATTTTCTTTTCCCCCCTAACCCCCCATGTCACGTCCCCTTTCTTATCATCTGTATTATCGTTGTCTGTATGTTTGATTTCTTAATGTTTTTGTTTAATGTTTTTAAGTTTTAA ECORI Agel BstBI BspEI UbiC promoter TCTGCGTTGTTGTCGGTGCTCGTTCTCTGCTCTTCACGCTACT TC TC CGCGCCGGGTTTTGGCGCCTCCCGCGGGCGCCCCCCTCCTCACGGCG AGACGCAACAACAGCCACGAGCAAGAGACGAGAAGTGCGATG GCGCGGCCCAAAACCGCGGAGGGCGCCCGCGGGGGGAGGAGTGCCGC AGACGCAACAACAGCCACGAGAGCCACCAGCGGCATAGTAA AGGAGTGCCGCTCGCGACGGA Gex2 NR2 AAGAGACGAGAAGTGCGATGA RevUbiCl R2 Cellecta Inc 17 of 19 v3 6 6 15 CellTracker Lentiviral Barcode Library User Manual 3 HT Sequencing Primers www cellecta com Primer Name Used for Sequence IDT preferred FwdHTS3 1 Round 5 TCGGATTCAAGCAAAAGACGGCATA 3 R2 1 Round 5 AGTAGCGTGAAGAGCAGAGAA 3 Gexl Bpi 254 Round 5 TCAAGCAGAAGACGGCATACGAAGACA 3 Gex2 NR2 254 Round 5 AATGATACGGCGACCACC
4. 1 x 10 cells ml in D MEM supplemented with 10 FBS and 5 ug ml Polybrene Aliquot 1 ml well in a 12 well plate and add O ul 3 ul 10 ul 33 ul and 100 ul of lentiviral stock supernatant filtered to remove cells and cell debris not concentrated to six different wells If concentrated virus is used scale down virus volumes accordingly Mix and return cells to incubator Grow cells under standard conditions for 24 hours NOTE It is important to accurately record the original of cells at Time of Transduction as this is critical in titer calculation For adherent cells other than HEK293 choose a different of cells at time of transduction depending on cell size As a rule of thumb cells should be transduced at such a density such that they would become confluent in 48 hours For example for HeLa cells the suggested cell is 50 000 cells well in a 12 well plate Cellecta Inc 6 of 19 v3 6 6 15 CellTracker Lentiviral Barcode Library www cellecta com User Manual Day 2 3 At 24 hours post transduction replace media with fresh D MEM supplemented with 10 FBS and without Polybrene Return cells to incubator and grow under standard conditions for additional 48 hours Avoid confluence trypsinize and re plate cells if needed Day 4 72 hours after transduction 4 Detach cells from the plate by trypsin treatment block trypsin with FBS media centrifuge resuspend in 1X D PBS and determine the of transduced
5. The RFP assay is performed with the wrong flow cytometry settings Solution RFP cells are to be detected using a 56inm laser for excitation 530nm still acceptable and 600 20 band pass filters or similar for detection for TagRFP Using blue laser 488nm for excitation leads to gross underestimation of viral titer Problem In the RFP assay the of transduced cells is determined by fluorescence microscopy instead of flow cytometry Solution Use flow cytometry 2 Transduction affects target cell viability Problem Polybrene is toxic for target cells Solution Optimize the concentration and exposure time to Polybrene during the transduction step For some sensitive cells Polybrene should not be used Problem Virus containing conditioned media is toxic to target cells Solution Concentrate and resuspend the virus in target cell growth media PBS 10 FBS or PBS 196 BSA Difficulties with Probe Preparation and HT Sequencing 1 No PCR Product Problem Incorrect primers or bad reagents used or missing reagents Solutions e Include 10 ng of plasmid library DNA as a positive control If it produces the correct amplification product the problem lies with the genomic DNA or previous PCR prep If not confirm use of the correct primers and reagents e Verify that primer sequences are correct Please see Appendix Section I 3 2 No barcodes present in HT Sequencing results Cellecta Inc 14 of 19 v3 6 6 15 CellTracker Len
6. determine the relative size of each clonal population derived from a founder cell Notes on Genomic DNA Extraction and Amplification e If the experiment is intended to track the fate all the cells derived from each clone in a founder cell population e g you want to determine the growth rates of all the founder clones e The best approach is to isolate genomic DNA and amplify pooled barcodes from the whole population of progeny cells e g the whole tumor in a xenograft model e If it is not possible to use all the progeny cells you should start isolation with a minimum of 200 fold the number cells as were in the initial founder population e Ifthe experiment is intended to just identify which fraction of cells from a founder cell population that are still present in a population e g survive some sort of selection that eliminates a portion of the initial founder population you should start isolation with a minimum of 10 fold the number cells as were in the initial founder population e Pooled barcodes should be amplified by two rounds of PCR using Titanium Taq DNA polymerase mix Clontech Takara see Required Materials e protocol was optimized using an ABI GeneAmp PCR System 9700 Use of other PCR enzymes and or thermal cyclers may require additional optimization Recommended Protocol NOTE Use of disposable tubes is highly recommended in order to avoid contamination 1 Suspend cell pellet in 5 ml QIAGEN buffer P1 wit
7. health and safety guidelines at your institution regarding the use of lentiviruses and follow standard microbiological practices which include Wear gloves and lab coat at all times when conducting the procedure Always work with lentiviral particles in a Class II laminar flow hood All procedures are performed carefully to minimize the creation of splashes or aerosols Work surfaces are decontaminated at least once a day and after any spill of viable material All cultures stocks and other regulated wastes are decontaminated before disposal by an approved decontamination method such as autoclaving Materials to be decontaminated outside of the immediate laboratory area are to be placed in a durable leakproof properly marked biohazard infectious waste container and sealed for transportation from the laboratory Cellecta Inc 16 of 19 v3 6 6 15 CellTracker Lentiviral Barcode Library www cellecta com User Manual L Appendix 1 Map of CellTracker Lentiviral Barcode Library Vector Mlul SphI ClaI pRSI16 U6 bc HTS6 UbiC TagRFP 2A Puro W 8025 bp XhoI EcoRI Agel BstBI XbaI KpnI Acc65I BamHI BspEI HincII SalI All Cellecta lentiviral vectors are covered by a lentiviral expression system license owned by Life Technologies Corporation LTC See Terms and Conditions 2 Barcode Library Vector Cassette CellTracker Library in pRSI16 vector size of Gexl Bpi NR2 amplicon is 267 bp ClalI U6 FwdU6
8. samples from the genetic screen Select optimal amount of starting amount and cycle number which produce bright single band without overcycling Repeat second round amplification of barcodes from each sample using the optimized volume of First Round PCR product 2 x 100 ul of Second Round PCR product per sample and 12 14 cycles of PCR Set up 2 x 100 ul reactions for each sample containing an adjusted equal amount of First Round PCR product 2 ul or more 2 ul First Round PCR Product 5 ul Gexi Bpi primer 10 uM 5 ul NR2 primer 10 uM 2 pl 50X dNTP Mix 10 mM each 10X Titanium Taq Buffer 75 ul Deionized water 1 ul 50X Titanium Taq 100 ul Total volume 94 C 3 minutes 1 cycle 94 C 30 seconds 65 C 10 seconds 12 or 14 cycles 72 C 10 seconds 68 C 2 min 1 cycle Please see Appendix for primer sequences Analyze the PCR products by gel electrophoresis on a 3 5 agarose 1XTAE gel in order to ensure equal yields of amplified barcodes for all samples Combine amplified barcodes from the 2 x 100 ul Second Round PCR reactions and purify the samples as follows 1 Purify the each specific PCR product with the single column from QIAquick PCR purification kit QIAGEN following the manufacturer s protocol 2 Separate by electrophoresis in a preparative 3 5 agarose 1XTAE gel Cut out band and extract DNA from the gel using the QIAquick gel purification kit QIAGEN and 4 Quantitate using A260 nm measure
9. C 2 min 1 cycle Please see Appendix for primer sequences Second Round of PCR The second round of PCR nested PCR is required in order to significantly reduce genomic DNA carryover into the samples used for HT sequencing 1 Combine together the 4 x 100 ul First Round PCR reactions and use a 2 ul aliquot in the second round of analytical PCR with nested primers in each 100 yl reaction 2 ul First Round PCR Product 5 ul Gexi Bpi primer 10 uM 5 ul NR2 primer 10 uM 2 pl 50X dNTP Mix 10 mM each 10 ul 10X Titanium Taq Buffer 75 ul Deionized water 50X Titanium Taq 100 ul Total volume 94 C 3 minutes 1 cycle Cellecta Inc 11 of 19 v3 6 6 15 CellTracker Lentiviral Barcode Library www cellecta com User Manual 94 C 30 seconds 65 C 10 seconds 10 12 or 14 cycles 72 C 10 seconds 68 C 2 min 1 cycle Please see Appendix for primer sequences NOTE Avoid overcycling of PCR reactions this will usually result in the generation of a longer fragment that corresponds to a fusion double barcode product The amplified pooled barcode cassettes are then analyzed on a 3 5 agarose 1XTAE gel load 5 ul lane The results should reveal a bright band at 267 bp for the Gex1 Bpi NR2 amplicon The goal of this analytical PCR step is to optimize the starting amount of First Round PCR product and the number of cycles if necessary in order to achieve equal intensities of a single 267 bp barcode band across all DNA
10. GAGAGCACCGACAACAACGCAGA 3 GexSeqS HT Sequencing 5 AGAGGTTCAGAGTTCTACAGTCCGAA 3 HPLC Purified FwdU6 1 Standard sequencing 5 CAAGGCTGTTAGAGAGATAATTGGAA 3 FwdU6 2 Standard sequencing 5 CCTAGTACAAAATACGTGACGTAGAA 3 4 Barcode Library Vector Features Feature Function Source Pous xs virus Allows Tat independent production of viral mRNA Dull et al Rous sarcoma 1998 virus enhancer promoter HIV 1 truncated 5 Permits viral packaging and reverse transcription of the viral mRNA HIV 1 LTR Luciw 1996 HIV 1 psi Allows viral packaging Luciw 1996 HIV 1 packaging signal HIV 1 Rev response Permits Rev dependent nuclear export of unspliced viral mRNA HIV 1 element RRE Kjems et al 1991 Malim et al 1989 Human U6 promoter drives RNA Polymerase III transcription for ne promoter generation of ShRNA transcripts meme Central polypurine tract cPPT improves transduction efficiency by cPPT facilitating nuclear import of the vector s preintegration complex in HIV 1 the transduced cells UbiC promoter Ubiquitin C promoter drives expression of TagRFP and PuroR Human TagRFP fluorescent protein Evrogen serves as an indicator of SEa TagRFP successful transduction quadricolor Thosea asigna virus 2A translational cleavage site containing 18 amino acid residues Cleavage occurs via a co translational 2A T2A ribosome skipping mechanism b
11. License Cellecta grants the end user the Recipient of the CellTracker Pooled Lentiviral Barcode Library the Product a non transferable non exclusive license to use the reagents for internal research use only as described in the enclosed protocols in particular research use only excludes and without limitation resale repackaging or use for the making or selling of any commercial product or service without the written approval of Cellecta Inc separate licenses are available for non research use or applications The Product is not to be used for human diagnostics or included used in any drug intended for human use Care and attention should be exercised in handling the Product by following appropriate research laboratory practices Cellecta s liability is expressly limited to replacement of Product or a refund limited to the actual purchase price Cellecta s liability does not extend to any damages arising from use or improper use of the Product or losses associated with the use of additional materials or reagents This limited warranty is the sole and exclusive warranty Cellecta does not provide any other warranties of any kind expressed or implied including the merchantability or fitness of the Product for a particular purpose Use of the Product for any use other than described expressly herein may be covered by patents or subject to rights other than those mentioned Cellecta disclaims any and all responsibility for injur
12. OT use less than 60 ug ten 15 cm plates to package a batch of CellTracker Barcode library Some barcodes may be lost if the yield is less than 1 x 108 TU 4 Add 900 ul of Lipofectamine Reagent to 12 ml of D MEM medium without serum or antibiotics in order to make a convenient master mix Mix gently 10X plates Component 12 000 ul D MEM no FBS no antibiotics 900 pl Lipofectamine 12 900 ul Total volume 5 Add the diluted Lipofectamine Reagent from step 4 to the DNA Plus Reagent complex from step 3 mix gently by flicking the tube or vortexing and incubate at room temperature for 15 min 6 Add 2 5 ml of the DNA Plus Reagent Lipofectamine Reagent complex from step 5 to each 15 cm plate from step 2 and mix complexes with medium by gentle rotation Take care not to dislodge cells from the plate Incubate at 37 C in the CO incubator for 24 hours Day 2 DNase I Treatment 7 At 24 hours post transfection replace the medium containing complexes with fresh 30 ml D MEM medium supplemented with 10 FBS DNase I 1 U ml MgCl 5 mM 20mM HEPES pH7 4 Continue incubation in the incubator at 37 C overnight Overnight DNase I treatment before harvesting virus does not negatively affect lentiviral titer or infectivity and helps prevent undesirable carryover of plasmid library into the virus prep NOTE Failure to change the media the day after transfection results in large carryover of pl
13. Please see Appendix for HT sequencing primer sequences Barcode Enumeration Conversion of raw HT sequencing data to number of reads for each barcode For help with Barcode Enumeration please contact Cellecta Technical Support at tech cellecta com Troubleshooting Low Lentiviral Titer 105 TU ml in supernatant 1 Poor transfection efficiency 48 hour post transfection less than 80 of 293T cells are very brightly fluorescent Problem 29371 Cells have too high or too low density Solution Plate fewer or more cells in order to have about 8096 confluency at time of transfection Problem Plasmid DNA Lipofectamine Plus Reagent ratios are incorrect Solution Optimize the ratios using the guidelines provided in the Lipofectamine protocol 2 Inefficient production of the virus Problem 293T Cells are of poor quality Solutions e Optimize growth conditions check growth medium and don t grow 293T cells for more than 20 passages e Check for mycoplasma contamination e Do not overgrow the cells do not allow the cells to reach more than 90 confluency in order to keep the culture continuously in logarithmic growth phase Problem Lentiviral supernatant harvested too early or too late Solution Harvest supernatant 48 hours and 72 hours after transfection Problem 293T cell media is too acidic at time of virus harvesting Solution Make sure to replace media 24 hours before harvesting and make sure to supplement media wit
14. RFP positive cells by flow cytometry NOTE Attempting to determine the of transduced cells by fluorescence microscopy is NOT RECOMMENDED IMPORTANT Flow cytometry settings to detect RFP positive cells are the following Excitation 56inm 530nm laser is still acceptable Emission 600 20 band pass filter or similar for TagRFP 5 Proceed to Lentiviral Titer estimation RFP assay Alternative Transduction protocol spinoculation for hard to transduce cells The following protocol has been optimized for K 562 cells For other cell types parameters such as media growth surface time of detection etc will have to be adjusted 1 K 562 cells are transduced infected using spinoculation This is performed using multi well tissue culture plates and a tabletop centrifuge capable of 1 200 x g and centrifugation of multi well plates 2 Grow K 562 cells and maintain them between 2 x 10 and 1 x 109 cells ml Do not let them become too dense or let the medium become yellow at any point 3 For lentiviral library titration K 562 cells are resuspended at 2 x 106 cells per ml RPMI 10 FBS supplemented with 20mM HEPES 7 4 and Polybrene 5 ug ml 0 5 ml aliquots are placed into each well in a 24 well plate 1 x 106 cells well total This cell density has proven effective for many suspension cell lines in house at Cellecta To each cell containing well add increasing amounts of lentiviral stock to be titered For 100 fold conce
15. Reagent Invitrogen Cat 18324 020 e Plus Reagent Invitrogen Cat 11514 015 e 500 ml 0 2 um filter units Fisher Scientific Cat 09 741 05 or Thermo Scientific Cat 569 0020 Additional Materials Required to Transduce Cells with Packaged Lentiviral Particles e Polybrene hexadimethrine bromide Sigma Aldrich Cat 107689 Puromycin Additional Materials Required to Amplify and Sequence Barcodes 15 ml BD FALCON screw cap centrifuge tubes 12 000 RCF rated PP P CHCl3 resistant BD Biosciences Cat 352196 e Buffer P1 50 Tris HCl pH 8 0 10mM EDTA QIAGEN Cat 19051 e RNase A QIAGEN Cat 19101 e Sonicator for Genomic DNA Shearing e Phenol Chloroform pH 8 0 Sigma Aldrich Cat P3803 DNase RNase free Epicentre Cat 4 D9905K e Titanium Taq DNA polymerase with PCR buffer Clontech Takara Cat 639242 e dNTP Mix 10 mM each e QlAquick PCR purification kit QIAGEN Cat 28106 Cellecta Inc 3 of 19 v3 6 6 15 CellTracker Lentiviral Barcode Library www cellecta com User Manual e QlAquick Gel Extraction Kit QIAGEN Cat 28706 e Primer for sequencing barcodes in barcode constructs IDT See Appendix Section e primers for barcode amplification from genomic DNA IDT See Appendix Section e HT sequencing primers IDT See Appendix Section I 3 e HT Sequencing Kits Illumina Platform Kit Type Illumina Cat Descripti
16. addition of fresh glutamine is not necessary 2 3 Days Prior to Starting Packaging 1 Start growing 293T cells in D MEM medium plus glutamine see Required Materials supplemented with 10 FBS without antibiotics Day 0 Plate Cells 2 Twenty four 24 hours prior to transfection plate 12 5 x 106 293T cells in each of ten 10 15 cm plates or 150 cm flasks Use 30 ml of media per plate Disperse the cells and ensure even distribution At the moment of transfection the cells should have reached 80 confluency Increase or decrease the number of 293T cells seeded if optimal confluency is not achieved in 24 hours Incubate at 37 C in a CO incubator for 24 hours Day 1 Transfection Ten 15 cm plates 3 In sterile 50 ml polypropylene tube mix 600 ul 300 of the Ready to use Packaging plasmid mix see Required Materials for formulation with 60 ug of the plasmid library and add the plasmid mixture to 12 ml D MEM medium without serum or antibiotics Add 600 ul of Plus Reagent mix and incubate at room temperature for 15 min 10X 15 cm plates Component 600 pl Ready to use Packaging Plasmid Mix 0 5 60 pl Plasmid CellTracker Barcode Library 1 pg pl 12 000 ul D MEM no FBS no antibiotics Cellecta Inc 4 of 19 v3 6 6 15 CellTracker Lentiviral Barcode Library www cellecta com User Manual 600 ul Plus Reagent 13 260 ul Total volume IMPORTANT DO N
17. asmid free and or Lipofectamine bound in your lentiviral prep This may cause problems with most downstream molecular biology applications especially whenever there is a PCR step involved Day 3 Collect Lentiviral Supernatant 8 At 48 hours post transfection collect all 30 ml of the virus containing medium from each plate and filter the supernatant 300 ml through a Nalgene 0 2 um PES filter a low protein binding filter to remove debris and floating packaging cells Failure to filter supernatant could result in carry over of cells into your lentiviral prep NOTE Usually the peak of virus production is achieved at 48 hours post transfection Supernatant can also be collected again at 72 hours post transfection replace the collected 48 hour supernatant with 30 ml of fresh D MEM medium supplemented with 10 FBS 20mM HEPES pH7 4 and continue incubation in the CO incubator at 37 C for 24 hours CAUTION You are working with infectious lentiviral particles at this stage Please follow the recommended guidelines for working with BSL 2 safety class materials see Safety Guidelines 9 Aliquot and store the supernatant at 80 C Freezing and thawing usually results in 20 loss of lentiviral titer with each cycle Cellecta offers lentiviral packaging services Please contact us at sales cellecta com or visit our website at http www cellecta com for more information Cellecta Inc 5 of 19 v3 6 6 15 CellTracker Lentivi
18. esearch market requires a license from Life Technologies Corporation 5791 Van Allen Way Carlsbad CA 92008 Evrogen IP JSC End User Label License for the use of lentiviral expression constructs comprising TagRFP encoded gene This product is for internal non commercial research use only No rights are conveyed to modify or clone the gene encoding fluorescent protein contained in this product The right to use this product specifically excludes the right to validate or screen compounds For information on commercial licensing contact Evrogen Licensing Department email license evrogen com 2015 Cellecta Inc All Rights Reserved Trademarks CELLECTA is a registered trademark of Cellecta Inc CellTracker is a trademark of Cellecta Inc CRL 11268 is a trademark of ATCC Invitrogen Lipofectamine and Plus Reagent are trademarks of Life Technologies and Invitrogen Corporation Cellecta Inc 19 of 19 v3 6 6 15
19. etween the C terminal glycine and Thosea asigna proline residues leaving 17 residues attached to the end of virus TagRFP and 1 residue to the start of the puromycin resistance marker PuroR Puromycin resistant marker for selection of the transduced cells Streptomyces alboniger WPRE Woodchuck hepatitis virus posttranscriptional regulatory element Woodchuck enhances the stability of viral transcripts hepatitis virus AU3 HIV 1 truncated 3 Self inactivating long terminal repeat Allows viral packaging but self inactivates the 5 LTR for biosafety purposes Dull et al 1998 The element also contains a polyadenylation signal for transcription termination and polyadenylation of mRNA in HIV 1 3 LTR transduced cells Required for viral reverse transcription self inactivating 3 LTR with deletion in U3 region prevents formation of replication competent viral particles after integration into genomic DNA SM Allows transcription termination and polyadenylation of mRNA SV40 SV40 Ori Allows for episomal replication of plasmid in eukaryotic cells SV40 mn xa bacterium AmpR Ampicillin resistance gene B lactamase for selection of plasmid Salmonella bacterial cells paratyphi pUC ori pUC bacterial origin of replication pUC Cellecta Inc 18 of 19 v3 6 6 15 CellTracker Lentiviral Barcode Library www cellecta com User Manual Terms and Conditions Cellecta Inc Limited
20. h HEPES pH 7 4 20mM final 3 Inefficient transduction of titering cells See below Inefficient Transduction of Packaged Library Cellecta Inc 13 of 19 v3 6 6 15 CellTracker Lentiviral Barcode Library www cellecta com User Manual 1 Poor transduction efficiency Problem Target cells have too high or too low density Solution Plate fewer or more cells in order to have 20 50 confluency at transduction stage Problem Target cell line may be difficult to transduce Solutions e Use a higher concentration of lentiviral particles e Perform Spinoculation to improve transduction efficiency e Check to see if Polybrene was added at 5 ug ml Problem Wrong amount of Polybrene added during transduction stage Solution If Polybrene is toxic to the target cells optimize Polybrene concentration in the range of 0 5 ug ml by performing a toxicity titration as described in Transduction Protocols and Lentiviral Titer Estimation Problem Loss of lentiviral titer during storage Solution Ensure storage of aliquoted packaged library at 809C Each freeze thaw cycle typically causes reduction of the titer by 20 Use a fresh stock for transduction Problem The RFP assay is performed too early Solution Normally the maximal expression of RFP from the integrated provirus is expected to develop by 72 hours after transduction However some cells exhibit delayed expression Try the assay at a later time such as 96 hours Problem
21. h RNaseA in 15 ml POLYPROPYLENE phenol chloroform resistant BD FALCON screw cap centrifuge tube 12 000 RCF rated BD Biosciences Cat 352196 2 Add 0 25 ml 1096SDS mix and incubate 5 minutes at RT 3 Using an ultrasonic homogenizer see Required Materials sonicate to shear DNA into 10 100 kb sized fragments To prevent cross contamination thoroughly wash the ultrasound head with running water and dry up with clean paper towel between samples 4 Add 5 ml phenol chloroform pH8 0 solution vortex hard and spin down 60 min 20 C at 8 000 rpm in JA 14 or equivalent rotor Beckman 5 You should have about 5 ml of clear upper phase Transfer 4 ml of upper phase to new 15 ml DISPOSABLE screw cap tube same as in Step 1 6 Add 0 5 ml 3M Sodium Acetate 4 ml isopropanol mix well and spin down 30 min 20 C at 8 000 rpm in JA 14 or equivalent rotor 7 In order to have a more visible pellet compacted at the bottom of the tube it is recommended to incubate overnight at RT before centrifugation IMPORTANT If starting material is less than 5 million cells add carrier before centrifugation linear polyacrylamide 25 pg ml final and spin down for a longer time 60 min 8 Discard supernatant add 10 ml 70 ethanol spin down 5 min 20 C at 8 000 rpm in JA 14 or equivalent rotor 9 Discard supernatant and air dry pellet Cellecta Inc 10 of 19 v3 6 6 15 CellTracker Lentiviral Barcode Library www cellecta com User Manua
22. ith a Lentiviral Stock titer of 3 000 000 TU ml we calculated the required amount of Lentiviral Stock as follows Cellecta Inc 8 of 19 v3 6 6 15 CellTracker Lentiviral Barcode Library www cellecta com User Manual 1 We calculate the required MOI to achieve 50 transduction efficiency using the TITER CHART 50 transduction efficiency 0 7 MOI 2 We calculate the volume of Lentiviral Stock required using the TITER FORMULA TU ml of cells at Transduction x MOI ml of Viral Stock used at Transduction 3 000 000 20 000 000 x 0 7 ml Viral Stock Viral Stock 20 000 000 x 0 7 3 000 000 4 67 ml Transduction of Founder Cells By transducing the CellTracker Barcode Library into a large pooled cell population you can create a founder population in which each cell contains a unique integrated barcode During transduction the library of lentiviral constructs carrying each barcode enter the cells and stably integrate into the genomic DNA Each lentiviral construct also has an RFP marker and puromycin selection to help maintain the barcode cassette Notes on Transducing Founder Cells e Cell transduction is a random process following a statistical distribution Therefore if too high an MOI is used many cells will take up more than one barcode Cells with more than one barcode show up as more than one population in the final analysis For example if two barcodes integrate into one founder cell and the cell produces 50 progen
23. l 10 Dissolve DNA pellet in appropriate volume of dH20 to a concentration of approximately 2 mg ml Expected yield is about 10 ug per 1 million cells 11 Incubate 30 minutes at 80 C before spectrophotometer reading Amplification of Barcodes from Genomic DNA The lentiviral library and PCR primer designs include sequences complementary to the sequences of the immobilized primers necessary for generating amplification clusters in Illumina s GAIIx or HiSeq Flow Cells Our library design is only compatible with Single Read Flow Cells in the Single Read Cluster Generation Kit because our primers are not complementary to the sequences immobilized on Paired End flow cells in the Paired End Cluster Generation Kit See Required Materials for the appropriate Illumina catalog numbers Use 10 ng of plasmid library as an amplification control in the first round of PCR and use the subsequent PCR products in all remaining steps The protocol below is for 200 ug of genomic DNA For whole amount of genomic DNA use proportionally more tubes First Round of PCR 1 For each sample prepare 4 x 100 ul reactions containing 200 ug of genomic DNA ul Genomic DNA 50 ug 3 pl FwdHTS3 primer 10 uM 3 ul R2 primer 10 uM 2 pl 50X dNTP Mix 10 mM each 10 ul 10X Titanium Taq Buffer ul Deionized water 1 ul 50X Titanium Taq 100 ul Total volume 94 C 3 minutes 1 cycle 94 C 30 seconds 65 C 10 seconds 16 cycles 72 C 20 seconds 68
24. lines for packaging the vector library into VSV g pseudotyped lentiviral particles transduction of target cells and the preparation of barcodes derived from transduced cells for high throughput HT sequencing and analysis Ensure that you have the latest version of this user manual Please check the Cellecta website at http www cellecta com resources literature Required Materials The CellTracker Barcode Library is provided as plasmid DNA or as packaged VSV g pseudotyped viral particles CellTracker Barcode Library plasmid Cat BC13X13 30M P 200 ug CellTracker Barcode Library packaged Cat BC13X13 30M V gt 1 x 108 TU Additional Materials Required to Package the Plasmid Library e Ready to use Lentiviral Packaging Plasmid Mix CPCP K2A Libraries can be packaged into lentiviral particles with nearly any 274 or 37 generation HIV based lentiviral packaging mix Cellecta s lentiviral packaging mix contains two plasmids psPAX2 and pMD2 G pre mixed in an appropriate ratio e 2937 17 Cell Line ATCC Cat CRL 11268 Dulbecco s Modified Eagle Medium D MEM 1X Mediatech CellGro Cat 15 013 CV See General Note in Packaging Protocol e Glutamine L Alanyl L Glutamine Dipeptide L glutamine Mediatech Cat 25 015 CI e Fetal Bovine Serum recommended Mediatech Cat MT 35 010 CV e D PBS e e Tissue Culture Plates and Related Tissue Culture Supplies e Lipofectamine
25. ment using NanoDrop spectrophotometer or equivalent and adjust concentration to 10nM 0 75 ng ul HT Sequencing of Barcodes HT sequencing of pooled amplified barcodes can be performed on the Illumina GAIIx 20 30 million reads per sample or HiSeq 80 100 million reads per sample using the GexSeqS sequencing primer and following the manufacturer s protocol The final concentration of GexSeqS primer in the reaction should be 500 nM For the cluster generation step use 20 fmoles 2 ul of 10 nM PCR product of the gel purified band from the 274 round of PCR The number of cycles read length required is 44 Cellecta Inc 12 of 19 v3 6 6 15 CellTracker Lentiviral Barcode Library www cellecta com User Manual The Barcode library and PCR primer designs include sequences complementary to the sequences of the immobilized primers necessary for generating amplification clusters in Illumina s GAIIx or HiSeq flow cells Our design is only compatible with Single Read Flow Cells in the Single Read Cluster Generation Kit because our primers are not complementary to the sequences immobilized on Paired End flow cells in the Paired End Cluster Generation Kit See Required Materials for a list of recommended Illumina kits for HT Sequencing of Barcode Library samples HT sequencing of samples on the Illumina MiSeq is not supported Please contact us at sales cellecta com for information on our HT sequencing and data analysis services
26. nd integration into genomic DNA of the target cells e The RSV promoter upstream of 5 LTR in the lentivector allows efficient Tat independent production of lentiviral RNA reducing the number of genes from HIV 1 that are used in this system e Number of lentiviral genes necessary for packaging replication and transduction is reduced to three gag pol rev The corresponding proteins are expressed from different plasmids lacking packaging signals and share no significant homology to any of the expression lentivectors pVSV G expression vector or any other vector to prevent generation of recombinant replication competent virus e None of the HIV 1 genes gag pol rev will be present in the packaged lentiviral genome as they are expressed from packaging plasmids lacking packaging signal therefore the lentiviral particles generated are replication incompetent e Lentiviral particles will carry only copy of your expression construct Despite the above safety features use of HIV based vectors falls within NIH Biosafety Level 2 criteria due to the potential biohazard risk of possible recombination with endogenous lentiviral sequences to form self replicating virus or the possibility of insertional mutagenesis For a description of laboratory biosafety level criteria consult the Centers for Disease Control Office of Health and Safety Web site at http www cdc gov od ohs biosfty bmbl4 bmbl4s3 htm It is also important to check with the
27. ntrated lentiviral stock for example add O ul 0 3 ul 1 ul ul and 10 ul virus Close the plate mix by gentle agitation wrap the perimeter with parafilm and place the plate into centrifuge with an appropriate balance and centrifuge at 1 200 x g at 25 C for 2 hours 4 Following centrifugation remove plate s from centrifuge carefully remove parafilm and place in incubator After 3 hours feed cells with 0 5 ml additional complete medium per well no Polybrene 5 24 hours after spinoculation resuspend cells at 2 x 10 cells ml in RPMI 10 FBS in the appropriate culture vessel and grow for additional 48 hours 6 72 hours after spinoculation perform titer as previously described NOTE Use larger vessels for large scale genetic screen transductions Scale up all volumes accordingly Lentiviral Titer estimation RFP assay Lentiviral titer is measured as Transduction Units ml TU ml One TU produces one integration event i e one infection in target cells Infections i e transductions can be calculated from observed of transduced cells according to the graph below Cellecta Inc 7 of 19 v3 6 6 15 CellTracker Lentiviral Barcode Library www cellecta com User Manual TITER CHART 100 4 90 4 80 4 70 4 50 40 30 96 infected cells 0 0 5 1 1 5 2 2 5 MOI number of TU number of cells
28. on GAIIx Sequencing FC 104 5001 TruSeq SBS Kit v5 GA 36 cycle Cluster Generation GD 203 5001 TruSeq SR Cluster Kit v5 CS GA HiSeq Sequencing FC 401 3002 TruSeq SBS Kit v3 HS 50 cycle Cluster Generation GD 401 3001 TruSeq SR Cluster Kit v3 cbot HS Related Products and Services from Cellecta HT Barcode Sequencing of Transduced Cell Pellets from Genetic Screen Cat CANA SQ Packaging Protocol The following protocol describes the generation of packaged lentiviral particles from the plasmid CellTracker Barcode Library The yield of recombinant lentiviral particles typically produced with this procedure is 1 10 x 109 TU ml The protocol is written for packaging with 10 x 15 cm plates to produce at least 3 x 10 TU of total lentiviral particles which can then be optionally concentrated It is recommended to package at least this much lentivirus at a time to maintain barcode diversity in the library above 10 million General Note on Packaging e ADD FRESH GLUTAMINE 1X to Dulbecco s Modified Eagle Medium D MEM at the time a sealed bottle of D MEM is opened even if the label indicates glutamine has already been added Glutamine in solution at 4 C has a half life of 1 2 months so glutamine D MEM purchased off the shelf from a supplier is to be regarded as glutamine In our experience the addition of glutamine increases titer approximately 2 fold If D MEM comes supplemented with stable L Alanyl L Glutamine dipeptide
29. ral Barcode Library www cellecta com User Manual Transduction Protocols and Lentiviral Titer Estimation Transduction Lentiviral transductions are performed by mixing cells and virus in culture media supplemented with Polybrene For both adherent and suspension cells transductions are initiated in suspension and carried out overnight Adherent cells are allowed to adhere to substrate during transduction and are transduced at a cell density that allows for 2 3 population doublings before reaching confluence Suspension cells are typically transduced at higher density than standard growth density and then they are diluted to standard growth density 18 24 hours after transduction Check Toxicity of Polybrene Polybrene is a polycation that neutralizes charge interactions to increase binding between the lentiviral envelope and the plasma membrane The optimal concentration of Polybrene depends on cell type and may need to be empirically determined Excessive exposure to Polybrene can be toxic to some cells Before conducting the titer estimation experiment we recommended performing a Polybrene toxicity titration in target cells Grow cells in complete culture medium with a range of Polybrene concentrations 0 pg ml 1 ug ml 2 ug ml 3 ug ml 4 ug ml 5 ug ml for 24 hours and then replace old medium with Polybrene free complete culture medium Grow cells for an additional 72 hours and then check toxicity by counting viable cells For your expe
30. riments use the highest concentration of Polybrene that results in less than 10 cell toxicity compared to no Polybrene typically 5 ug ml is recommended For some cell types you cannot use Polybrene Protocol For Titering lentiviral stock RFP assa The CellTracker Barcode Library vector expresses the fluorescent protein TagRFP excitation S560nm emission 590nm allowing lentiviral titer estimation by flow cytometry RFP assay or by a combined flow cytometry puromycin resistance assay RFP Puro assay To check lentiviral titer we recommend always using the same cells you will use in the screen Most of the commonly used mammalian cell lines can be effectively transduced by lentiviral constructs Relative titers can vary up to 50 fold depending on the chosen cell line Transduction HEK293 cells The following protocol has been optimized for HEK293 cells For other adherent cell types parameters such as media growth surface time of detection etc will have to be adjusted Day 1 1 Quickly thaw the lentiviral particles in a water bath at 37 C Transfer the thawed particles to a laminar flow hood gently mix by rotation inversion or gentle vortexing and keep on ice CAUTION Only open the tube containing the lentiviral particles in the laminar flow hood NOTE Unused lentiviral stock may be refrozen at 80 C but it will typically result in a loss of about 20 in titer 2 Trypsinize and resuspend HEK293 cells to a density of
31. rs of magnitude over the founder population size e Even if the population has expanded many fold over splitting or otherwise discarding cells may skew the clonal population sizes for different barcodes i e clone that grow slowly versus cells that grow quickly may be differentially affected e If you must discard cells it is crucial to design the experiment to minimize the impact on the barcode representation in your samples e Following transduction you may want to select cells with barcodes using Puromycin For this you should calculate a Puromycin Kill Curve using the following procedure 1 Aliquot cells in a 12 well plate at such a density so they are at 72 hours from confluency 2 Add puromycin at 0 ug ml 0 5 ug ml 1 ug ml 2 ug ml 5 ug ml and 10 ug ml in six different wells 3 Mix and return cells to incubator 4 Grow cells under standard conditions for 42 72 hours Use the lowest concentration of Puromycin that kills gt 90 of cells in 42 72 hours Cellecta Inc 9 of 19 v3 6 6 15 CellTracker Lentiviral Barcode Library www cellecta com User Manual Genomic DNA Extraction for Barcode Amplification and HT Sequencing Identification of barcodes in the experimental samples requires amplification of the barcode portion of the integrated lentiviral constructs from sample genomic DNA Subsequent high throughput sequencing of barcodes by the Illumina GAIIx or HiSeq is done to quantify each barcode and based on this
32. tiviral Barcode Library www cellecta com User Manual Problem Incorrect primer used in Illumina Solexa Cluster Generation step Solution Ensure that you or the HT Sequencing core facility uses the GexSeq Sequencing primer see Appendix Section I 3 NOT the Sequencing primer that comes with the Illumina Cluster Generation Kit Problem Incorrect Cluster Generation kit used Solution Ensure that you or the HT Sequencing core facility uses the proper Single Read Cluster Generation Kit see Required Materials J Technical Support For additional information or technical assistance please contact us by phone or email Phone 1 650 938 3910 Toll Free 1 877 938 3910 Fax 1 650 938 3911 E mail Technical Support tech cellecta com General Information info cellecta com Sales sales cellecta com Orders orders cellecta com Blog http www cellecta com blog Postal Mail Cellecta Inc 320 Logue Ave Mountain View CA 94043 USA For more information about Cellecta s products and services please visit our web site at http www cellecta com Cellecta Inc 15 of 19 v3 6 6 15 CellTracker Lentiviral Barcode Library www cellecta com User Manual Safety Guidelines The HIV based lentivector system is designed to maximize its biosafety features which include e deletion in the enhancer of the region of 3 ALTR ensures self inactivation of the lentiviral construct after transduction a
33. y the data after harvesting the cells and HT sequencing of the genomic DNA will show two clonal populations with two different barcodes each having the same number of cells It will not be obvious that these two populations are from the same founder cell For this reason we typically recommend using low MOIs of 0 3 so that gt 90 of the transduced cells only contain one barcode see graph above e Transducing larger populations of cells increases the frequency of having more than one founder cell with the same barcode Since the CellTracker Barcode library has several million unique barcodes a majority of cells will contain unique barcodes even with library transductions of a million or more However with larger transductions two or more founder cells can receive the same barcode To minimize this we recommend starting screens with less than a million cells if possible For more details on the complexity and representation of barcodes in the library and estimates of the number of barcodes repeats you should expect with transductions of different size founder cell populations please refer to the QC information e Since the purpose of using this complete barcode library is to track the fate of cells from a founder population we do not recommend splitting and discarding any cells during the course of an experiment e Discarding any portion of cells will eliminate some of the barcodes unless the cell population has expanded to several orde
34. y or damage that may be caused by the failure of the Recipient or any other person to use the Product in accordance with the terms and conditions outlined herein The Recipient may refuse these licenses by returning the enclosed Product unused By keeping or using the enclosed Product you agree to be bound by the terms of these licenses The laws of the State of California shall govern the interpretation and enforcement of the terms of these Licenses Limited Use Label Licenses The Recipient acknowledges that the Product has been developed by Cellecta based on licenses from Third Parties and agrees with the Terms of Limited Use for the Recipient provided by the Third Parties Life Technologies Corporation End User Label License for the use of Lentiviral Expression System This product or service based upon the Lentiviral Expression System is sublicensed from Life Technologies Corporation under U S Patent Nos 5 686 279 5 834 256 5 858 740 5 994 136 6 013 516 6 051 427 6 165 782 6 218 187 6 428 953 6 924 144 7 083 981 and 7 250 299 and corresponding patents and applications in other countries for internal research purposes only Use of this technology for gene therapy applications or bioprocessing other than for nonhuman research use requires a license from GBP IP LLC Please contact GBP IP LLC 537 Steamboat Road Suite 200 Greenwich CT 06830 Use of this technology to make or sell products or offer services for consideration in the r
Download Pdf Manuals
Related Search