MATCHMAKER One-Hybrid System User Manual
Contents
1. MATCHMAKER One Hybrid System User Manual PT1031 1 Catalog K1603 1 See List of Components for storage conditions FOR RESEARCH USE ONLY PR71132 CLONTECH Laboratories Inc Table of Contents I Introduction 3 ll Product Information 7 A List of Components 7 B Yeast Strain Information 7 lll MATCHMAKER One Hybrid Positive Control Experiment 9 IV MATCHMAKER One Hybrid System Overview 11 V Preparing Your Target Reporter Constructs 12 A Target and Reporter Vector Information 12 B Synthesizing Tandem Copies of Your Target Element 13 C Inserting Tandem Copies of Target Upstream of ReporterGenes 13 VI Integrating Target Reporter Constructs into the Genome 15 A Linearizing Target Reporter Vectors 15 B Transforming Competent Cells 15 C Plating the Transformation Mixture 15 D Testing New Reporter Strains for Background Expression 16 VII Screening an AD Fusion Library for DNA BP Genes 18 A Reagents and Materials Required 18 B Tips for a Successful Transformation 19 C Large Scale Yeast Transformation 19 D Plating the Transformation Mixture 20 Vill Confirming DNA binding Activity 21 IX Troubleshooting Guide 23 X References 25 XI Related Products 27 Appendix A MATCHMAKER One Hybrid Vector Maps and MCSs 28 Appendix B Yeast Media 32 Protocol PT1031 1 Technical Service TEL 415 424 8222 or 800 662 CLON page 2 Version PR71132 FAX 415 424 1064 or 800 424 1350 C2. V Preparing Your Target Reporter Constructs continued e For pHISi and pHISi 1 EcoR and Xba or EcoR and Mlu e For pLacZi EcoR and Sal Electrophorese a 2 ul sample of the digest on a 1 agarose gel to confirm that the plasmid has been efficiently linearized 4 Mix 5 ul of digested plasmid 1 ul of annealed oligo and 4 ul of H O 5 Add 1 2 ul of 10X T4 ligation buffer and 0 8 ul at least 0 8 units of T4 DNA ligase and incubate at room temperature for 4 hr Note Since the molar ratio of oligonucleotide to vector is 100 1 or greater no gel purification to remove the stuffer fragment is required 6 Separately transform competent DH5a with each construct using a standard method Sambrook et al 1989 7 Plate transformants on LB amp plates and incubate at 37 C overnight 8 Prepare plasmid using any standard method that yields highly pure DNA Sambrook et al 1989 Check for inserts by electrophoresing on a 2 agarose gel and sequencing across the junctions 9 Proceed to Section VI to integrate the newly constructed reporter vectors target pHISi target pHISi 1 and target pLacZi into the yeast genome page Protocol PT1031 1 Technical Service TEL 415 424 8222 or 800 662 CLON 14 Version PR71132 FAX 415 424 1064 or 800 424 1350 CLONTECH Laboratories Inc VI Integrating Target Reporter Constructs Into the Genome Although nonintegrated reporters were used in the original one hybrid libr
3. Gstaiger M Knoepfel L Georgiev O Schaffner W amp Hovens C M 1995 A B cell coactivator of octamer binding transcription factors Nature 373 360 362 Guthrie C amp Fink G R 1991 Guide to yeast genetics and molecular biology In Methods in Enzymology Academic Press San Diego 194 1 932 Holm C 1993 A functional approach to identifying yeast homologs of genes from other species In Methods A Companion to Methods in Enzymology 5 102 109 Kumar R Chen S Scheurer D Wang Q L Duh E Sung C H Rehemtulla A Swaroop A Adler R amp Zack D J 1996 The bZIP transcription factor Nrl stimulates rhodopsin promoter activity in primary retinal cell cultures J Biol Chem 271 47 29612 29618 Lehming N Thanos D Brickman J M Ma J Maniatis T amp Ptashne M 1994 An HMG like protein that can switch a transcriptional activator to a repressor Nature 371 175 179 Li J J amp Herskowitz I 1993 Isolation of ORC6 a component of the yeast origin of recognition complex by a one hybrid system Science 262 1870 1873 Liaw G J 1994 Improved protocol for directional multimerization of a DNA fragment Bio Techniques 17 668 670 Liu J Wilson T E Milbrandt J amp Johnston M 1993 Identifying DNA binding sites and analyzing DNA binding domains using a yeast selection system In Methods A Companion to Methods in Enzymology 5 125 137 Luo Y Vijaychander S St
4. 3 AT 4 8 days e If applicable test for B galactosidase activity 1 day e Hist LacZ clones are candidates for expressing AD library proteins that bind to your target element 0 mM 3 AT 3 30 mM 3 AT 60 mM 3 AT AD Fusion Library Figure 2 Using a one hybrid assay to identify cDNAs that encode novel DNA binding proteins page 4 Protocol PT1031 1 Version PR71132 Technical Service TEL 415 424 8222 or 800 662 CLON FAX 415 424 1064 or 800 424 1350 CLONTECH Laboratories Inc l Introduction continued To conduct the assay the user must prepare new yeast reporter strains having the sequence of a specific target element upstream of the reporter gene To prepare each target reporter strain one first makes at least three tandem copies of a known target element These are then inserted upstream of the reporter gene promoter Next the user transforms the target reporter construct into yeast cells and by marker gene selection obtains recombinants with genomically integrated reporters to make a new target reporter strain Integration is straight forward because the reporter vectors provided in the kit Appendix A permit high frequency site specific recombination In many cases dual reporter genes useful for more stringent library screening may be generated by sequentially integrating the HIS3 and lacZ reporters into the same yeast genome at different loci HIS3 and URA3 respectively See S
5. VI Integrating Target Reporter Constructs continued 1 Test yeast colonies with integrated target pLacZi construct in a B galactosidase filter assay see YPH Section VI e Analyze results gt If colony lift turns blue in lt 15 min then background lacZ expression is high Do not use pLacZi reporter strain gt If colony lift turns blue in gt 15 min then background acZ expression is ow Use your pLacZi reporter strain to construct a dual reporter as described below 2 Next test yeast colonies with integrated target pHISi or target pHISi 1 for background expression Pick a single colony and suspend it in 1 ml of TE buffer Plate 5 ul of the suspension on SD His 0 15 30 45 and 60 mM 3 AT 0 URE e Analyze results gt If yeast grows on SD His gt 45 mM 3 AT then background H S3 expression is high very leaky 0 mM 3AT 15 mM 3AT 45 mM 3AT 60 mM 3AT gt If yeast only grows on SD His and lt 45 mM 3 AT then background HIS3 expression is low 0 mM 3AT 15 mM 3AT 45 mM 3AT 60 mM 3AT e Compare results for yeast colonies with integrated target pHISi or target pHISi 1 Identify the HIS3 reporter strain with the lower background level of HIS3 expression for use in the one hybrid library screening 3 Recommendations If B galactosidase assay indicated that background acZ expression is owin your modified lacZ reporter strain make a dual reporter strain for the library screening by integrating
6. using the indicated restriction enzyme Incubate at 37 C for 2 hr or as directed by the enzyme manufacturer e Xho or Aff for target pHISi and target pHISi 1 e Nco lor Apa for target pLacZi Electrophorese a 2 ul sample of the digest on a 1 agarose gel to confirm that the plasmid has been efficiently linearized B Transforming Competent Cells As discussed in Section V A you should initially prepare three customized yeast reporter strains using your three target reporter vectors target pHISi target pHISi 1 and target pLacZi Be sure to completely linearize the vectors before using them to transform YM4271 Follow the protocol in the YPH Section V D E using 1 ug of digested reporter plasmid As a negative control perform the transformation with 1 ug of the same uncut reporter plasmid C Plating the Transformation Mixture 1 Plate the entire target pHISi and target pHISi 1 transformation mix tures on SD His plates and the target pLacZi transformation mixtures on SD Ura plates to select for colonies with an integrated reporter gene Note These colonies are easily distinguished from colonies without an integrated functional reporter gene by their larger size gt 2 mm TEL 415 424 8222 or 800 662 CLON Technical Service Protocol PT1031 1 page FAX 415 424 1064 or 800 424 1350 Version PR71132 15 CLONTECH Laboratories Inc Vi Integrating Target Reporter Constructs continued page 2 Incubate
7. 1350 CLONTECH Laboratories Inc Vil Screening an AD Fusion Library continued YEASTMAKER reagents have been optimized for use in the MATCHMAKER Two Hybrid Systems B Tips for a successful transformation C La Th Fresh one to three week old colonies will give best results for liquid culture inoculation A single colony may be used for the inoculum if it is 2 3 mm in diameter Scrape the entire colony into the medium If colonies on the stock plate are smaller than 2 mm scrape several colonies into the medium If the overnight or 3 hr cultures are visibly clumped disperse the clumps with vigorous vortexing before using them in the next step When you are collecting cells by centrifugation a swinging bucket rotor results in better recovery of the cell pellet For the highest transformation efficiency as is necessary for library screening use competent cells within 1 hr of their prepara tion Ifnecessary competent cells can be stored after Step 11 atroom temperature for several hours with a minor reduction in competency To obtain an even growth of colonies after plating continue to spread the transformation mixtures over the agar surface until all liquid has been absorbed Alternatively use 5 mm sterile glass beads 5 7 beads per 100 mm plate 7 9 beads per 150 mm diameter plate to promote even spreading of the cells rge Scale Yeast Transformation is protocol is scaled for screening gt 1 x 10 inde
8. Section VI Decide which reporters to use based on results and recommendations Section VI Amplify AD fusion library and purify library DNA Screen AD fusion library using modified reporter strain Section VII If dual reporters were used perform a B galactosidase filter assay YPH Chapter VI Isolate AD library plasmid from positives YPH Chapter VII Confirm DNA binding Section VIII Figure 3 Guide to using the MATCHMAKER One Hybrid System Protocols to screen an AD fusion library TEL 415 424 8222 or 800 662 CLON Technical Service Protocol PT1031 1 page FAX 415 424 1064 or 800 424 1350 Version PR71132 11 CLONTECH Laboratories Inc V Preparing Your Target Reporter Constructs PLEASE READ THE ENTIRE PROTOCOL BEFORE BEGINNING A Target and Reporter Vector Information To use the MATCHMAKER One Hybrid System to screen a cDNA or genomic library for DNA BPs you must have identified a true or putative target element It must be precisely defined using for example deletion and or point mutation analysis A construct composed of three or more tandem copies of your target regulatory element bordered by restriction sites is then prepared and inserted upstream of the reporter gene in the plasmid s multiple cloning site Inserting your target element may alter the level of background H S3 and lacZexpression Therefore constructs should be prepared with your target element in all three reporter vectors p
9. integration at the H S3 locus carries the HIS3 reporter gene e pHISi 1 50 ul 0 1 ug ul 5 4 kb vector for integration at the H S3 locus carries the HIS3 reporter gene e pLacZi 50 ul 0 1 ug ul 6 9 kb vector for integration at the URA3 locus carries the lacZ reporter gene Control Plasmids See Section III for further information on the control plasmids e p53HIS 50 ul 0 1 ug l 6 6 kb positive control plasmid Three tandem copies of the consensus p53 binding site were inserted into the EcoR I Xba sites in the MCS of pHISi pS3BLUE 50 ul 0 1 ug ul 6 7 kb positive control plasmid Threetandem copies of the consensus p53 binding site were inserted into the EcoR Sal site in the MCS of pLacZi pGAD53m 50 ul 0 1 pg ul 7 8 kb positive control plasmid Contains mouse p53 gene in frame with the GAL4 AD e pGAD424 50 ul 0 1 ug ul 6 6 kb negative control plasmid For expressing the GAL4 AD It can also be used as an AD cloning vector see Figure 8 Yeast Strain Store the yeast strain at 70 C e YM4271 0 5 ml used for reporter vector integration Genotype is MATa ura3 52 his3 200 ade2 101 lys2 801 leu2 3 112 tro1 907 tyr1 501 gal4 A512 gal80 A538 ade5 hisG Liu et al 1993 Wilson et al 1991 B Yeast Strain Information 1 The YM4271 stock is provided frozen in medium containing 25 glycerol and can be stored indefinitely at 70 C 2 To recover YM4271 from the frozen glycer
10. plates up side down at 30 C for 4 6 days e Usually for linearized reporter transformants gt 100 2 3 mm colo nies will grow per plate For uncut reporter transformants one or two colonies will grow per plate In addition more pLacZi than pHISi or pHISi 1 transformants will typically be seen This may be a result of the differing lengths of the homologous ends after digestion or due to differences in the genetic susceptibility of the genomic HIS3 and URAS3 loci to integration Ignore tiny background colonies The integration of a linearized plasmid is a relatively rare event compared to plasmid transformation alone While autonomously replicating plasmids may yield 10 transformants per ug of DNA linearized plasmid DNA yields only 10 100 transformants per ug 3 Restreak colonies that arose from transformation using linearized plasmid on the same selection medium used in Step 1 4 Incubate plates at 30 C for 4 6 days 5 These are your master plates Seal them with Parafilm and store them at 4 C for up to 3 4 weeks Testing New Reporter Strains for Background Expression Carefully follow the procedures described in Figure 4 to decide which reporter s to use in your library screening experiment and the optimum amount of 3 AT to use in the selection medium Protocol PT1031 1 Technical Service TEL 415 424 8222 or 800 662 CLON 16 Version PR71132 FAX 415 424 1064 or 800 424 1350 CLONTECH Laboratories Inc
11. the target HIS3 construct with lower background H S3 expression into the target pLacZi strain Go to Section VI gt If B galactosidase assay indicated that background acZ expression is high in your modified lacZ reporter strain perform the one hybrid library screening using only the target HIS3 reporter strain with the lowest level of background H S3 expression Go to Section VII Plating too many yeast cells on one plate will result in colonies that are too small Figure 4 Testing reporter strains to determine which vector s to use with your target TEL 415 424 8222 or 800 662 CLON Technical Service Protocol PT1031 1 page FAX 415 424 1064 or 800 424 1350 Version PR71132 17 CLONTECH Laboratories Inc VII Screening an AD Fusion Library for DNA BP Genes A Reagents and Materials Required e YPD YPH Appendix C e Appropriate sterile tubes and flasks e Appropriate SD agar plates YPH Appendix C Notes Prepare the selection media and pour the required number of agar plates in advance You will need 15 150 mm SD Leu His plates containing the optimal selection concentration of 3 AT from Section VI D and one 100 mm SD Leu plate at 37 C for the transformation control Allow SD agar plates to dry unsleeved at room temperature for 2 3 days or at 30 C for 3 hr prior to plating transformation mixtures The presence of moisture droplets on the agar surface can lead to uneven spreading of cells and localize
12. the cell transformants will not grow or will grow very slowly on the selection plate Sometimes truncation of the AD hybrid protein will alleviate the toxicity and still allow the interaction to occur Solution 2 If the transformation efficiency is too low as determined from the control in Section VII E you may not be screening a sufficient number of library cotransformants This can be critical especially if the interacting protein of interest is encoded by a rare transcript in the source tissue See Section IX B above for tips on improving transformation efficiency Solution 3 If one of the following situations is occurring it may interfere with the ability of the AD hybrid proteins to interact with the target element 1 the hybrid proteins are not stably expressed in the host cell 2 the fused GAL4 AD occludes the site of interaction 3 the hybrid protein folds improperly or 4 the hybrid protein cannot be localized to the yeast nucleus See van Aelst et a 1993 for one example In these cases it may help to construct hybrids containing different domains of the DNA binding protein For example to study proteins that normally do not localize to the nucleus it may be necessary to generate mutant forms of the protein that can be transported across the nuclear membrane page Protocol PT1031 1 Technical Service TEL 415 424 8222 or 800 662 CLON 24 Version PR71132 FAX 415 424 1064 or 800 424 1350 CLONTECH Laboratories I
13. 53 binding to DNA and interaction with the major p53 protein in vitro and in cells EMBO J 13 4823 4830 page Protocol PT1031 1 Technical Service TEL 415 424 8222 or 800 662 CLON 26 Version PR71132 FAX 415 424 1064 or 800 424 1350 CLONTECH Laboratories Inc XI Related Products Product Cat MATCHMAKER Two Hybrid Systems and related products e Mammalian MATCHMAKER Two Hybrid Assay Kit K1602 1 e MATCHMAKER Two Hybrid System K1605 1 e MATCHMAKER Two Hybrid System 2 K1604 1 e Two Hybrid cDNA Library Construction Kit K1607 1 e MATCHMAKER cDNA and Genomic Libraries many e MATCHMAKER Random Peptide Library NL4000AA e GAL4 AD Monoclonal Antibody 5398 1 e MATCHMAKER AD LD Insert Screening Amplimer Set 9103 1 e MATCHMAKER LexA Two Hybrid System K1609 1 e MATCHMAKER LexA Libraries many General reagents for work with yeast e YEASTMAKER Yeast Transformation Kit K1606 1 e YEASTMAKER Carrier DNA K1606 A e YEASTMAKER Yeast Plasmid Isolation Kit K1611 1 e KC8 Chemically Competent Cells C2004 1 e KC8 Electrocompetent Cells C2023 1 e DH5a Chemically Competent Cells C2007 1 DH5a Electrocompetent Cells C2022 1 2 e YPD Medium 8600 1 e YPD Agar Medium 8601 1 e Minimal SD Base contains glucose 8602 1 e Minimal SD Agar Base contains glucose 8603 1 e Trp DO Supplement 8604 1 e Leu DO Supplement 8605 1 e His DO Supplement 8606 1 e Ura DO Supplement 8607 1 e His Leu DO Supplement 8609 1 e YEXpress Ye
14. GFP vectors available from CLONTECH Nuclear localization is characteristic of many DNA binding transcriptional acti vators 6 Prepare protein extracts and perform a gel shift DNA binding assay When preparing yeast protein extracts for use in an electrophoretic mobility shift assay EMSA use a procedure that will yield native proteins The protein extraction protocols in the YPH are not suitable for this application because the resulting proteins are denatured The following procedure is summarized from Arndt et al 1987 a Prepare an overnight culture of the yeast transformant in SD Leu to keep selection on the AD library plasmid The OD o should be 1 0 b Centrifuge 100 ml of the culture Discard the supernatant and resuspend the pellet in 400 ul of extraction buffer 0 1 M Tris HCl pH 7 5 0 2 M NaCl 0 01 M B mercaptoethanol 20 glycerol 5 mM EDTA and 1 mM PMSF c Transfer cell suspension to a prechilled glass tube and add glass beads Place sample on ice and vortex vigorously for 10 min not including pause times to allow for sample cooling d Allow glass beads to settle then transfer all available liquid to another prechilled glass tube e Add 200 ul of extraction buffer to the liquid and vortex again as described above f Separate the liquid from the glass beads by centrifugation Note One way to do this is to punch a pinhole in the microcentrifuge tube and nest this tube inside another tube before add
15. LONTECH Laboratories Inc I Introduction The MATCHMAKER One Hybrid System provides the basic tools for conducting a one hybrid assay an in vivo genetic assay used for isolating novel genes encoding proteins that bind to a target cis acting regulatory element or any other short DNA binding site Figure 1 The system may also be used to map the DNA binding domain of previously known or newly identified DNA binding proteins DNA BP For examples of recent publications using the MATCH MAKER One Hybrid System see papers by Kumar et al 1966 and Chen et al 1996 Cloning genes that encode DNA BPs has been a difficult part of dissecting transcriptional activation systems In 1993 Wang amp Reed first used the one hybrid assay to clone the gene encoding the transcription factor OLF 1 The one hybrid assay was then used to obtain genes encoding several other transcription factors including REST and ORC 6 Gstaiger et al 1995 Lehming et al 1994 Li amp Herskowitz 1993 Luo ef al 1996 and Strubin ef al 1995 Now the MATCHMAKER One Hybrid System allows you to readily obtain the genes encoding DNA BPs of interest The one hybrid assay offers maximal sensitivity because detection of the DNA protein interaction occurs while proteins are in their native configurations In addition the gene encoding the DNA BP of interest is immediately available after a library screening The one hybrid assay is based on the finding th
16. ary screening method described by Wang amp Reed 1993 we have found that using integrated reporter genes is preferrable because integration controls reporter gene copy number and hence expression level Consequently detection of the desired DNA protein interactions is highly reproducible The reporter vectors provided in this kit pHISi pHISi 1 and pLacZi were designed to be integrated into the yeast genome in fact if they do not integrate they will be lost because these vectors do not carry a yeast replication origin Linearization in the 3 untranslated region immediately following the H S3 marker in pHISi and pHISi 1 or within the URA3 marker of pLacZi and pHISi significantly increases the efficiency of homologous recombination at the corre sponding locus in the yeast genome Furthermore integration into the mutated ura3 or his3 locus of YM4271 confers a Urat or Hist phenotype on the transformants so they can be selected on the appropriate medium If you plan to use both reporter plasmids in the same strain itis necessary to integrate them into different genomic loci i e ura3 then his3 in two consecutive transforma tions This is usually accomplished by integrating the target LacZi reporter into YM4271 previously transformed with an integrated target H S3 construct as described below and in Figure 4 A Linearizing Target Reporter Vectors Separately digest 1 ug of each target construct in a total volume of 20 ul
17. ast Inducible Expression Systems many e YEXpress Secretion Yeast Expression System 6200 1 General Cloning Reagents e DH5a Chemically Competent Cells C2007 1 e DH5a Electrocompetent Cells C2022 1 FAX 415 424 1064 or 800 424 1350 Version PR71132 27 CLONTECH Laboratories Inc Appendix A MATCHMAKER One Hybrid Vectors MCS 1 47 Hind Ill 456 Hind IIl 643 Aat Il 5837 PinHIS3 HIS3 T ninHIS3 Amp 1446 E pHISi m 6 8 kb Hind Ill Anal 3634 aa 10 20 30 40 GAATTCCCGGGGAGCTCACGCGTTCGCGAATCGATCCGCGGTCTAGA EcoRI Smal Saci Mlul Sacil Xbal Figure 5 Map and multiple cloning site MCS of pHISi pHISi is a yeast integration and reporter vector for use with the MATCHMAKER One Hybrid System pHISi contains the yeast HIS3 gene downstream of the MCS and the minimal promoter of the H S3locus Prints Cis acting sequences of interest i e target elements can be inserted into the MCS Without activation by a target element constitutive H S3 expression from P pints is very low in yeast but allows enough growth to select for integration when constructing H S3 reporter strains During library screening the leaky expression of H S3 is controlled by adding 3 AT to the medium The yeast URA3 and H S3 genes of pHISi can be used as selectable markers for integration into the nonfunctional ura3 and his3 loci respectively of the YM4271 host strain Before integrating the vector is linearized at the Xho o
18. at many eukaryotic transcriptional activators are composed of physically and functionally independent DNA binding domains and activation domains AD This fact allows researchers to construct various gene fusions that when expressed as fusion proteins in yeast can simultaneously bind to a target sequence and activate transcription Theoretically in the one hybrid assay any target element can be used to trap a protein having a binding domain specific for that element Figure 1 Detection of DNA binding proteins using the MATCHMAKER One Hybrid System TEL 415 424 8222 or 800 662 CLON Technical Service Protocol PT1031 1 page FAX 415 424 1064 or 800 424 1350 Version PR71132 3 CLONTECH Laboratories Inc l Introduction continued e Prepare competent YM4271 cells 1 day e Separately transform competent YM4271 with each target reporter vector linearized integration and circular control 1 day e Select for recombinants on the appropriate minimal selection medium 4 6 days Restreak large well isolated colonies from cells transformed with linearized plasmid on selection medium 3 days e For yeast transformed with H S3 reporter constructs determine the optimal 3 AT for inhibiting leaky HIS3 expression 3 days e If applicable integrate lacZ reporter construct into the H S3 reporter strain 3 5 days e Transform reporter strain with AD fusion library select on SD His Leu optimal
19. ational read through c If your sequencing results fail to reveal any ORF in frame with the AD coding region it could be that the positive library clone is transcribed in the reverse orientation from a cryptic promoter within the ADH1 terminator Chien et a 1991 Such proteins apparently function as transcriptional activators as well as interact with the target elements TEL 415 424 8222 or 800 662 CLON Technical Service Protocol PT1031 1 page FAX 415 424 1064 or 800 424 1350 Version PR71132 21 CLONTECH Laboratories Inc VIII Confirming DNA Binding Activity continued 3 If a nonbinding mutant of your target element is available consider using it in a one hybrid assay In this case first prepare a mutant type construct otherwise identical to your original target reporter construct Then integrate the construct into YM4271 and transform the new reporter strain with the candidate AD library plasmid Colonies should result from transcriptional activation using the wild type but not mutant type target indicating that you have identified an interacting DNA BP For an example see Li amp Herskowitz 1993 4 Perform in vitro translation and a DNA binding assay Wu et al 1994 5 If you have a library clone that you believe encodes a transcriptional activator transfer the insert to an expression vector that will generate a fusion of the protein with a cellular localization tag such as the green fluorescent protein
20. cells to the Step 12 DNA mixture and mix well by vortexing Note If cells are not mixed well transformation efficiency may decline Add 6 ml of sterile PEG LiAc to the transformation mixture Vortex at high speed for 10 sec to mix well Incubate at 30 C for 30 min with shaking at 200 rpm Add 700 ul of DMSO and mix well by gentle inversion Do not vortex Heat shock for 15 min in a 42 C water bath Swirl occasionally to mix Chill on ice for 2 min Centrifuge at 1 000 x g for 5 min at room temperature and remove supernatant Resuspend cells in 7 ml of TE buffer for a final volume of 7 5 ml D Plating the Transformation Mixture 1 Dilute 10 ul of the transformation mixture in 1 ml of TE buffer and plate 200 ul of the dilution on the 100 mm SD Leu plate to determine the transformation efficiency see the YPH Section V E 23 Plate 500 ul of the transformation mixture on each 150 mm plate 15 plates total containing SD His Leu optimal 3 AT Section VI D Spread the cells immediately after pipetting them onto the plate to avoid localized dilutions in the 3 AT concentration Incubate at 30 C for 4 6 days Pick the largest colonies and restreak them on SD Leu His optimal 3 AT e Colonies resulting from H S3 activation should be significantly larger than small colonies resulting from growth due to leaky H S3 expres sion e Ifadual reporter strain was used streak the colonies onto dupl
21. d variations in 3 AT concentration that can result in false positives Customized yeast reporter strain from Section VI AD library plasmid DNA in solution Your AD fusion library should have at least 10 clones Premade MATCHMAKER cDNA and genomic libraries representing many species and tissues are available from CLONTECH If you have purchased one see the MATCHMAKER library protocol for more information on amplification The library may need amplification to provide enough plasmid for the yeast transforma tion Alternatively the Two Hybrid cDNA Library Construction Kit K1607 1 may be used for constructing compatible cDNA libraries For more information on constructing your own AD libraries see Vojtek 1993 Durfee et al 1993 and Dalton amp Triesman 1992 Herring testes carrier DNA YPH Appendix D B also available from CLONTECH K1606 A Sterile 1X PEG LiAc solution Prepare immediately prior to use from 10X stocks YPH Appendix D B 100 DMSO Dimethyl sulfoxide Sigma D 8779 1X TE buffer Prepare from 10X TE buffer YPH Appendix D B Sterile glass rod bent pasteur pipette or 5 mm glass beads for spreading transformation mixtures on plates Note The YEASTMAKER Yeast Transformation System K1606 1 contains all the solutions except media H O and DMSO required for yeast transformation page Protocol PT1031 1 Technical Service TEL 415 424 8222 or 800 662 CLON 18 Version PR71132 FAX 415 424 1064 or 800 424
22. dium or when you perform 3 AT titrations or perform B galactosidase assays on your experimental constructs 4 Proceed to Section V to prepare your own experimental target reporter plasmids and host strains TABLE Il CONTROL ONE HYBRID EXPERIMENTS Expt Integrated Reporter Transforming SD Selection Expected Plasmid Plasmid Medium Results p53HIS pGAD53m_ Leu His 45 mM 3 AT Many large colonies p53BLUE pGAD53m Leu Large B galactosidase positive colonies p53HIS pGAD424 Leu His 45 mM 3 AT No growth or tiny colonies only p53HIS pGAD424 Leu His Large colonies p53BLUE pGAD424 Leu Large B galactosidase negative colonies a If you obtain only small lt 1mm colonies on the 3 AT plates you may need to perform a 3 AT titration on the reporter strain as explained in Figure 4 and perhaps use less 3 AT in the medium b The appearance of tiny colonies only after 3 4 days incubation may be due to leaky H S3 expression page Protocol PT1031 1 Technical Service TEL 415 424 8222 or 800 662 CLON 10 Version PR71132 FAX 415 424 1064 or 800 424 1350 CLONTECH Laboratories Inc IV MATCHMAKER One Hybrid System Overview Synthesize tandem copies of target binding sequence Section V Insert tandem copies upstream of reporter in all 3 reporter vectors Section V Integrate modified reporter vectors into separate YM4271 genomes Section VI Test each reporter strain for basal reporter expression
23. ection VI for details To screen a library for a gene encoding a DNA BP of interest the user transforms the target reporter strain with an AD library of fusions between the target independent AD and potentially target specific DNA BPs Transformants are then plated on selective medium If an AD library hybrid protein interacts with the user s target element H S3 reporter gene expression is activated allowing colony growth on minimal medium lacking histidine but containing the concen tration of 3 AT needed to inhibit background H S3 expression If a H S3 lacZ reporter strain is used a B galactosidase assay is performed to verify the DNA protein interaction and help eliminate any false positive clones However using lacZ may not be necessary because in our experience the one hybrid system has a low incidence of false positives Next AD library plasmids are isolated from the Hist transformants Finally DNA binding should be confirmed by independent methods Refer to Section VII for detailed instructions for screening an AD fusion library using the one hybrid assay If you wish to use the MATCHMAKER One Hybrid System to map the DNA binding domain of a known DNA BP the procedure is similar to that described above The main difference is that instead of transforming your reporter strain with an AD fusion library you should make AD fusions with gene segments that correspond to specific domains of the known DNA BP Then transform these cons
24. gure 7 Map and multiple cloning site MCS of pLacZi pLacZi is a yeast integration and reporter vector for use with the MATCHMAKER One Hybrid System This plasmid contains the bacterial lacZ gene downstream of the minimal promoter of the yeast iso 1 cytochrome C gene Poyc1 Target elements can be inserted into the MCS upstream of the Poyc lacZ reporter Without activation from a cis regulatory element lacZ expression is very low when the vector is integrated into the yeast genome The yeast URA3 gene is used as a selectable marker for integration into the nonfunctional ura locus of the YM4271 host strain after linearizing the vector at the Nco or Apa site pLacZi cannot replicate autonomously in yeast This plasmid contains the ampicillin resistance gene Amp and the Col E1 origin for selection and propagation in E coli Unique restriction sites are in bold page Protocol PT1031 1 Technical Service TEL 415 424 8222 or 800 662 CLON 30 Version PR71132 FAX 415 424 1064 or 800 424 1350 CLONTECH Laboratories Inc Appendix A MATCHMAKER One Hybrid Vectors continued MCS 833 866 EcoR Sma Bam Sall PstI Bgl il Kpn l 484 Sph Hind IIl 10 410 Miu SnaB 6018 Hind Ill 1105 Aat l 5244 Sph 1433 pGAD424 6 6 kb Scal 4802 EcoRV Pvul 1891 4692 Bgll 4442 pore Cla 2487 Pvu Il 3253 MATCHMAKER 5 AD LD Insert GAL4 AD Sequencing Primer Screening Am
25. icate SD Leu His optimal 3 AT plates and use one set of plates for a B galactosidase colony lift filter assay YPH Chapter VI Typi cally it takes colonies producing B galactosidase 0 5 8 hr to turn blue However certain strains will turn blue within 20 30 min Incubation gt 8 hr often gives false positives page Protocol PT1031 1 Technical Service TEL 415 424 8222 or 800 662 CLON 20 Version PR71132 FAX 415 424 1064 or 800 424 1350 CLONTECH Laboratories Inc Vill Confirming DNA Binding Activity We recommend that you confirm the identity of your selected clones with independent methods First transform E coli with plasmid isolated from yeast see YPH Chapter VII and then isolate plasmid from E coli using any method that produces highly pure DNA Sambrook et al 1989 Although none of the tests suggested below is independently conclusive the results should provide enough convincing evidence together to support whether the AD library plasmid encodes a DNA BP Note A protocol for isolation of plasmids from yeast is provided in the YPH Chapter VII The YEASTMAKER Yeast Plasmid Isolation Kit K1611 1 provides the reagents and a simple protocol for isolating plasmid from yeast These procedures will provide plasmid DNA suitable for PCR and E coli transformations A protocol for transforming E coli with plasmid isolated from yeast is also provided in the YPH Chapter VII Alternatively you may wish to try
26. ile J amp Zhu L 1996 Cloning and analysis of DNA binding proteins by yeast one hybrid and one two hybrid systems Biotechniques 20 564 568 Sambrook J Fritsch E F amp Maniatis T 1989 Molecular Cloning A Laboratory Manual Cold Spring Harbor Laboratories Cold Spring Harbor NY Strubin M Newell J W amp Matthias P 1995 OBF 1 a novel B cell specific coactivator that stimulates immunoglobin promoter activity through association with octamer binding proteins Cell 80 497 506 TEL 415 424 8222 or 800 662 CLON Technical Service Protocol PT1031 1 page FAX 415 424 1064 or 800 424 1350 Version PR71132 25 CLONTECH Laboratories Inc X References continued van Aelst L Barr M Marcus S Polverino A amp Wigler M 1993 Complex formation between RAS and RAF and other protein kinases Proc Natl Acad Sci USA 90 6213 6217 Vojtek A Hollenberg S amp Cooper J 1993 Mammalian Ras interacts directly with the serine threonine kinase Raf Cell 74 205 214 Wang M M amp Reed R R 1993 Molecular cloning of the olfactory neuronal transcription factor Olf 1 by genetic selection in yeast Nature 364 121 126 Wilson T E Fahrner T J Johnston M amp Milbrandt J 1991 Identification of the DNA binding site for NGFI B by genetic selection in yeast Science 252 1296 1300 Wu Y Liu Y Lee L Miner Z amp Kulesz Martin M 1994 Wild type alternatively spliced p
27. ing information If you purchase yeast media from CLONTECH follow the directions provided with the product Alternatively you can prepare your own media and DO Supplements using the detailed recipes provided in the YPH Appendix C e YPD medium e SD media Depending on which reporter vectors you use and which control transformations you choose to perform you will need all or some of the following minimal SD selection media SD medium contains 2 glucose as the carbon source for optimal growth and a DO Supplement lacking the appropriate nutrient for plasmid selection in yeast For 3 AT containing medium the concentration of 3 AT used in the medium depends on the specific requirements of the customized H S3 reporter strains Section VI D In any case the 3 AT should be added after the SD medium is autoclaved and cooled to 55 C because 3 AT is heat labile SD His SD His varying amounts of 3 AT SD Leu SD Ura SD Leu Ura SD His Leu optimal 3 AT for screening an AD fusion library page Protocol PT1031 1 Technical Service TEL 415 424 8222 or 800 662 CLON 32 Version PR71132 FAX 415 424 1064 or 800 424 1350 CLONTECH Laboratories Inc Notes TEL 415 424 8222 or 800 662 CLON Technical Service Protocol PT1031 1 page FAX 415 424 1064 or 800 424 1350 Version PR71132 33 Parafilm is a registered trademark of the American Can Company YEASTMAKER and YEXpress are trademarks of CLONTECH Labo
28. ing the sample Upon centrifuging the liquid will flow through to the collection tube leaving the beads behind g Freeze the liquid quickly in liquid nitrogen and store it at 70 C h The protein yield is typically 10 20 mg ml Use 2 5 wl inthe EMSA page Protocol PT1031 1 Technical Service TEL 415 424 8222 or 800 662 CLON 22 Version PR71132 FAX 415 424 1064 or 800 424 1350 CLONTECH Laboratories Inc IX Troubleshooting Guide A Excessive Background Growth on Library Screening Medium Solution 1 Check to make sure that you have prepared the selection medium correctly YPH Appendix C Make sure you have added the appropriate amount of 3 AT to the selection medium Section VI D Perform a 3 AT titration on the target reporter strain if you haven t already done so Solution 2 If your target pHISi or target pHISi 1 reporter grows on SD His medium even in the presence of gt 60mM 3 AT the inserted target element may be interacting with yeast endogenous transcriptional activa tors or may not require trans acting factors to activate the H S3 reporter It may be necessary to redesign the target element and construct new reporter strains B Low Transformation Efficiency When Screening an AD Fusion Library The transformation efficiency is determined by the number of colonies growing on the control SD Leu plate Section VII E The transformation efficiency should be at least 104 cfu ug for the library transfor
29. lacZ or HIS3 coding region YM4271 p53HIS Yeast strain YM4271 transformed with an integrated YM4271 p53BLUE p53HIS or p53BLUE vector Yeast Phenotypes His or Leu Requires histidine His or leucine Leu or tryptophan Trp or Ura Trp or uracil Ura in the medium to grow is aux otrophic for one or more of these specific nutrients LacZ Expresses the lacZ reporter gene i e is positive for B galactosidase activity His Expresses the H S3 reporter gene i e does not require His in the medium to grow Miscellaneous 3 AT 3 amino 1 2 4 triazole a competitive inhibitor of the HIS3 gene product His3p DO Dropout supplement or solution a mixture of specific amino acids and nucleosides used to supplement SD base to make SD medium DO solutions are missing one or more of the nutrients required by untransformed yeast to grow on SD medium SD medium Minimal synthetic dropout medium is comprised of a nitrogen base a carbon source glucose unless stated otherwise and a DO supplement page Protocol PT1031 1 Technical Service TEL 415 424 8222 or 800 662 CLON 6 Version PR71132 FAX 415 424 1064 or 800 424 1350 CLONTECH Laboratories Inc ll Product Information A List of Components Reporter Vectors Store plasmids at 20 C Refer to Appendix A for detailed information and maps and to Sections V A and VI D for information on choosing vectors e pHISi 50 ul 0 1 ug l 6 8 kb vector for
30. longer incubation time One or two large colonies appearing on negative control plates may be from the rare integration and expression of nicked plasmid TEL 415 424 8222 or 800 662 CLON Technical Service Protocol PT1031 1 page FAX 415 424 1064 or 800 424 1350 Version PR71132 9 CLONTECH Laboratories Inc lll MATCHMAKER One Hybrid Positive Control Continued 3 Transform YM4271 p53HIS and YM4271 p53BLUE separately with pGAD53m positive control AD p53 plasmid and pGAD424 negative control AD plasmid Use the small scale yeast transformation protocol YPH Chapter V Do not linearize the plasmids before transforma tion a b Plate transformation mixtures as described using the SD selection media indicated in Table Il Incubate plates at 30 C for 4 6 days Take note of growth after 3 days and every day thereafter up to 6 days Perform f galactosidase colony lift filters assays on the transformants obtained using YM4271 p53BLUE as the host strain YPH Chapter VI Compare your results with those shown Table II Pick a representative colony from the control transformations shown on lines 1 2 4 and 5 of Table Il and streak each onto SD Leu to maintain the transforming plasmid After colonies have grown seal plates with Parafilm and store them at 4 C Restreak fresh plates at 3 4 week intervals These transformants are useful as reference strains when you wish to check a new batch of SD selection me
31. mation If your library transformation efficiency is lower than this try one or more of the following suggestions Solution 1 Repeat the experiment using more of the AD library plasmid maximum 50 ug Check the purity of the DNA and if necessary repurify it by ethanol precipitation before using it again If you are not already doing so we strongly recommend using the pretested and optimized YEASTMAKER Carrier DNA which is available separately K1606 A or as part of the YEASTMAKER Yeast Transformation System K1606 1 Solution 2 Repeat the transformation this time including a recovery period after the heat shock To provide a recovery period perform the transformation as described Section VII D but add the following steps after Step D 20 1 Resuspend cells in 50 ml of SD His liquid medium Divide cell suspension into two 50 ml tubes 2 Incubate cells at 30 C for 1 hr with shaking at 230 rpm 3 Centrifuge at 1 000 x g for 5 min at room temperature Remove supernatant 4 Continue protocol from Step D 21 TEL 415 424 8222 or 800 662 CLON Technical Service Protocol PT1031 1 page FAX 415 424 1064 or 800 424 1350 Version PR71132 23 CLONTECH Laboratories Inc IX Troubleshooting Guide continued C Failure To detect an Interaction Between the Target Element and a Protein That Normally Interacts in vivo i e False Negative Results Solution 1 If expression of the AD hybrid protein is toxic to
32. n when constructing H S3 reporter strains During library screening the leaky expression of H S3 is controlled by adding 3 AT to the medium pHISi 1 was constructed by transferring the HIS reporter gene from pHISi to the EcoR BamH I sites of pBR322 Leaky HIS3 expression in pHISi 1 is generally lower than that in pHISi presumably due to differences in the flanking vector sequence The yeast H S3 gene is used as a selectable marker for integration into the nonfunctional his3 locus of the YM4271 host strain after linearizing the vector at the Xho or Afl Il sites The Kpn site cannot be used for integration because it cuts within the coding region of the H S3 gene and that region is deleted in YM4271 Because it does not carry the URA3 marker pHISi 1 can be used together with pLacZi to construct a dual H S3 lacZ reporter strain pHISi 1 cannot replicate autonomously in yeast pHISi 1 contains a bacterial Col E1 origin ori and the ampicillin resistance gene Amp for propagation and selection in E coli Unique restriction sites are in bold TEL 415 424 8222 or 800 662 CLON Technical Service Protocol PT1031 1 page FAX 415 424 1064 or 800 424 1350 Version PR71132 29 CLONTECH Laboratories Inc Appendix A MATCHMAKER One Hybrid Vectors continued Nco MCS BamH l 131 6329 Apa Os Clal 1085 Sca 5322 10 20 30 40 AAGCTTGAATTCGAGCTCGGTACCCGGGGATCTGTCGACCTCGAGGCA Hind IIl EcoR Kpni Smal Sall Xhol Fi
33. nc X References Arndt K T Styles C amp Fink G R 1987 Multiple global regulators control H S4 transcription in yeast Science 237 874 880 Bartel P L Chien C T Sternglanz R amp Fields S 1993 Using the two hybrid system to detect protein protein interactions In Cellular Interactions in Development A Practical Approach ed Hartley D A Oxford University Press Oxford pp 153 179 Chien C T Bartel P L Sternglanz R amp Fields S 1991 The two hybrid system A method to identify and clone genes for proteins that interact with a protein of interest Proc Nat Acad Sci USA 88 9578 9582 Chen X Rubock M J amp Whitman M 1996 A transcriptional partner for MAD proteins in TGF B signalling Nature 383 691 696 Dalton S amp Treisman R 1992 Characterization of SAP 1 a protein recruited by serum response factor to the c fos serum response element Cell 68 597 612 Durfee T Becherer K Chen P L Yeh S H Yang Y Kilburn A E Lee W H amp Elledge S J 1993 The retinoblastoma protein associates with the protein phosphatase type 1 catalytic subunit Genes Dev 7 555 569 Fields S 1993 The two hybrid system to detect protein protein interactions Methods A Compan ion to Methods Enzymol 5 116 124 Ghosh S Selby M J amp Peterlin B M 1993 Synergism between Tat and VP16 in trans activation of HIV 1 LTR J Mol Biol 234 610 619
34. ol stock scrape a small amount of cells from the frozen stock with a sterile loop or wooden stick and streak them onto a YPD plate Incubate plate at 30 C for 1 3 days until colonies appear Seal this working stock plate with Parafilm and store at 4 C Propagate additional cultures only from isolated colonies on this plate Note If you cannot recover the strain by scraping the frozen stock the cells may have settled to the bottom of the tube before the stock was frozen If this happens thaw the frozen culture on ice and vortex it before restreaking The stock may be refrozen TEL 415 424 8222 or 800 662 CLON Technical Service Protocol PT1031 1 page FAX 415 424 1064 or 800 424 1350 Version PR71132 7 CLONTECH Laboratories Inc ll Product Information continued For additional information onthe growth and maintenance of yeast see the YPH Chapter III We also recommend Guthrie amp Fink s 1991 Guide to Yeast Genetics and Molecular Biology V2010 1 3 Healthy yeast colonies grow to gt 2 mm in diameter However small white colonies lt 1mm will form at a rate of 1 2 due to spontaneous mutations that eliminate mitochondrial function Holm 1993 Avoid these small colonies when inoculating cultures 4 3 AT 3 amino 1 2 4 triazole is a competitive inhibitor of the yeast HIS3 protein His3p 3 AT is used to inhibit low levels of His3p expressed in a leaky manner and thus to suppress background growth on SD Hi
35. oning site See Step C 3 below for recommended enzyme pairs 2 Synthesize both strands without 5 phosphates according to the protocol of the synthesizer manufacturer C Inserting Tandem Copies of Target Upstream of Reporter Genes Reagents and materials required e Target element Sense and antisense strand oligo from Step V B 2 Competent E coliDH5a cells Sambrook et al 1989 also available from CLONTECH C2022 1 2 or C2007 1 T4 DNA ligase Available from CLONTECH 8406 1 2 10X T4 ligation buffer Sambrook et al 1989 or the buffer provided with the commerical enzyme Nco Xho and other restriction enzymes see Step C 3 LB amp plates YPH Appendix C 50 mM NaCl pHISi pHISi 1 and pLacZi provided in the kit Materials for purifying plasmid from E coli transformants 1 For each construct planned mix 0 1 ug of sense strand and 0 1 ug of antisense strand oligonucleotide in 10 ul of 50 mM NaCl 2 Anneal the oligonucleotides by heating at 70 C for 5 min and then slowly cooling to room temperature 30 min 3 Completely digest 0 1 ug of each reporter plasmid in a 20 ul double digest using an appropriate pair of restriction enzymes such as those recommended below Incubate at 37 C for 2 hr or as directed by the enzyme manufacturer TEL 415 424 8222 or 800 662 CLON Technical Service Protocol PT1031 1 page FAX 415 424 1064 or 800 424 1350 Version PR71132 13 CLONTECH Laboratories Inc
36. pendent clones It is equivalent to a large scale transformation in the YEASTMAKER Yeast Transformation System K1606 1 1 2 3 Inoculate several colonies of the appropriate reporter yeast strain Section VI D 2 3 mm in diameter into 1 ml of YPD Vortex vigorously for 2 min to disperse any clumps Transfer this cell suspension into a flask containing 50 ml of YPD Incubate at 30 C for 16 18 hr with shaking at 250 rpm to stationary phase OD o gt 1 5 Transfer enough overnight culture to produce an ODs 0 2 0 3 into 300 ml of YPD Incubate at 30 C for 3 hr with shaking at 230 rpm The ODggp will be 0 5 0 1 Centrifuge the culture in 50 ml tubes at 1 000 x g for 5 min at room temperature Discard the supernatant and vortex to resuspend each cell pellet in 25 ml of TE buffer TEL 415 424 8222 or 800 662 CLON Technical Service Protocol PT1031 1 page FAX 415 424 1064 or 800 424 1350 Version PR71132 19 CLONTECH Laboratories Inc Vil Screening an AD Fusion Library continued 9 10 11 14 15 16 17 18 19 20 21 Pool the cells into one tube Centrifuge the cells again at 1 000 x g for 5 min at room temperature Discard the supernatant and resuspend the cell pellet in 1 5 ml of freshly prepared sterile 1X TE LiAc Mix well by vortexing Ina sterile 50 ml tube add 20 ug of AD library plasmid and 2 mg of carrier DNA and mix well Add 1 0 ml of competent
37. plimer i a GAL4 AD AAT ACC ACT ACA ATG GAT GAT GTA TAT AAC TAT CTA TTC GAT GAT GAA GAT ACC CCA 812 CCA AAC CCA AAA AAA GAG ATC GAA TTC CCG GGG ATC CGT CGA CCT GCA GAG ATC TAT GA EcoRI Smal BamH Say Pstil Bgn anok A TCG TAG ATA CTG AAA AAC CCC GCA AGT TCA CTT CAA CTG TGC ATC GTG CAC CAT CTC STOP STOP MATCHMAKER 3 AD LD Insert ORF 1 ORF 2 Screening Amplimer Figure 8 Map and multiple cloning site MCS of pGAD424 pGAD424 Bartel et al 1993 encodes the activation domain AD a a 768 881 of the yeast GAL4 transcriptional activator The AD is expressed at low levels inyeast host cells from a truncated ADH7 promoter and is targeted to the yeast nucleus by the SV40 T antigen nuclear localization sequence A Chien et al 1991 pGAD4 24 carries the LEU2 gene for selection in Leu auxotrophic yeast strains pDGAD424 can also be used to generate GAL4 AD fusion proteins by inserting the cDNA for a protein of interest or a cDNA library into the MCS Unique sites are in bold GenBank Accession U07647 TEL 415 424 8222 or 800 662 CLON Technical Service Protocol PT1031 1 page FAX 415 424 1064 or 800 424 1350 Version PR71132 31 CLONTECH Laboratories Inc Appendix B Yeast Media CLONTECH carries a full line of yeast media including YPD and SD with glucose with or without agar and Dropout DO Supplements ideal for use with the MATCHMAKER One Hybrid System Please see Section XI for order
38. r Afl Il sites his3 locus or at the Apa site ura3 locus The Kpn site cannot be used for integration because it cuts within the coding region of the H S3 gene and that region is deleted in YM4271 pHISi cannot replicate autonomously in yeast The plasmid contains a bacterial Col E1 origin ori and the ampicillin resistance gene Amp for propagation and selection in E coli Unique restriction sites are in bold page Protocol PT1031 1 Technical Service TEL 415 424 8222 or 800 662 CLON 28 Version PR71132 FAX 415 424 1064 or 800 424 1350 CLONTECH Laboratories Inc Appendix A MATCHMAKER One Hybrid Vectors continued MCS 1 47 Scal 4915 Pvu l 4804 Kpn 770 PninHiis3 HIS3 Xho 1 1008 3 UTR gt amp Afl Ml 1189 pHISi 1 minHIS3 5 4 kb BamH l 1446 Sph 1633 Sal 1722 Pvull 3135 GAATTCCCGGGGAGCTCACGCGTTCGCGAATCGATCCGCGGTCTAGA EcoRI Smal Sacl Mlul Sacil Xbal Xma l Figure 6 Map and multiple cloning site MCS of pHISi 1 pHISi 1 is a yeast integration and reporter vector for use with the MATCHMAKER One Hybrid System pHISi 1 contains the yeast HIS3 gene downstream of the MCS and the minimal promoter of the HIS3 locus P minnis Cis acting sequences of interest i e target elements can be inserted into the MCS Without activation by a target element constitutive H S3 expression from P rintis is very low in yeast but allows enough growth to select for integratio
39. r sequence pHISi and pHISi 1 were constructed using different vector backbones gt pHISi also can be integrated into the URA3 locus using the Apa restriction site but do not attempt to integrate pHISi and pLacZi into the same locus in one strain page Protocol PT1031 1 Technical Service TEL 415 424 8222 or 800 662 CLON 12 Version PR71132 FAX 415 424 1064 or 800 424 1350 CLONTECH Laboratories Inc V Preparing Your Target Reporter Constructs continued B Synthesizing Tandem Copies of Your Target Element We recommend that each target reporter construct has at least three tandem copies of the target element inserted upstream of the reporter gene For information about target copy number see Ghosh et al 1993 Although tandem copies may be generated by various methods we have found the most convenient and reliable method for generating them to be oligonucleotide synthesis It works nicely because well defined regulatory elements are usually lt 20 bp See Liaw 1994 for an alternative method 1 Design two antiparallel oligonucleotides one representing the sense strand and the other its antisense complement The sense strand should consist of at least three tandem copies of the target element with a different restriction site on each end When the two strands are annealed the resulting double stranded DNA will have a different overhang at each end for directional cloning into the reporter plasmid s multiple cl
40. ratories Inc 1997 CLONTECH Laboratories Inc
41. reening If you wish to perform a 3 AT titration on YM4271 p53HIS for practice follow the instructions given in Figure 4 for the experimental target H S reporter strains Note that as the 3 AT concentration increases from 0 to 60 mM the size of the colonies should get progressively smaller The 3 AT concentration at which colonies disappear completely is sufficient to permit stringent selection of His transformants on medium lacking His 1 Separately linearize 1 ug of each positive control plasmid in a total volume of 20 ul using the indicated restriction enzyme Incubate at 37 C for 2 hr or as directed by the enzyme manufacturer p53BLUE Nco l e p53HIS Xho l Electrophorese a 2 ul sample of the digest on a 1 agarose gel to confirm that the plasmid has been efficiently linearized 2 Separately transform the linearized reporter plasmids and the same uncut plasmids as negative controls into yeast YM4271 as described in Section VI e Plate the p53HIS transformation mixture on SD His medium Leaky HIS3 expression from p53HIS is sufficiently high to permit selection of transformants on medium lacking His e Plate the p53BLUE transformation mixture on SD Ura medium Expected results for p53HIS and p53BLUE transformations Colonies resulting from integration of linearized vectors should be 2 3 mm in diameter while colonies without integrated vectors should be lt 0 5 mm The latter type should not grow larger even after a
42. rovided pHISi pHISi 1 and pLacZi Table Ill vector maps in Appendix A Then follow the guidelines in Section VI D to determine whether pLacZi can be used and whether to use pHISi or pHISi 1 to provide the most stringent library screening Although we recommend using dual H S3 acZ reporters whenever possible we have found that sometimes using only a H S3 reporter works equally well The H S3 reporter gene is used in two different ways in the MATCHMAKER One Hybrid System For vector integration leaky HIS3 expression from pHISi and pHISi 1 allows just enough colony growth on SD His medium without 3 AT to permit its use as a selectable marker Then ina library screening background growth due to leaky H S3 expres sion is controlled by 3 AT in the medium and the H S3 reporter gene is used to detect interaction of an AD library protein with the target element TABLE Ill COMPARISON OF REPORTER VECTORS PROVIDED FOR INTEGRATION Vector Feature pHISi pHISi 1 pLacZi Reporter gene HIS3 HIS3 lacZ Background expression higha lowa high Integration locus his his ura Restriction site Xho or Afl l Xho or Afli Ncolor Apa Yeast selection medium SD His SD His SD Ura a During selection high background H S3 expression levels will result in larger colonies Back ground growth should be controlled by 3 AT after reporter integration The higher leaky H S3 expression observed in pHISi is presumably due to a weak UAS in the flanking vecto
43. s medium Fields 1993 Durfee et al 1993 page Protocol PT1031 1 Technical Service TEL 415 424 8222 or 800 662 CLON 8 Version PR71132 FAX 415 424 1064 or 800 424 1350 CLONTECH Laboratories Inc lil MATCHMAKER One Hybrid Positive Control Experiment To familiarize yourself with the procedures and expected results of a one hybrid assay first construct two control yeast reporter strains by integrating the p53HIS and p53BLUE positive control plasmids into YM4271 Both of these vectors have three tandem copies of the consensus p53 binding site inserted upstream of the minimal promoter of the reporter gene H S3 and lacZ respectively Then perform a control one hybrid experiment by simply transforming the YM4271 p53HIS and YM4271 p53BLUE reporter strains with pGAD53m which encodes a p53 AD hybrid Interaction of the p53 AD hybrid with the p53 binding sites transcriptionally activates the reporter genes giving a strong positive result in the assay Transforming the reporter strains with pGAD424 which encodes the GAL4 AD only should not activate the reporter genes From our experience with the YM4271 p53HIS we know that 45 mM 3 AT is sufficient to completely suppress background growth due to leaky H S3 expres sion in this reporter strain However the optimal 3 AT concentration for your customized H S3 reporter strain may be different and therefore should be experimentally determined before you use it in an AD library sc
44. the direct transfer of plasmid DNA from yeast to E coli by electroporation Marcil amp Higgins 1992 1 If you have not already done so consider using the JacZ reporter strain to test for transcriptional activation It is a good independent test for transcriptional activation because it does not rely on H S3 growth selection which can be leaky 2 Sequence the positive library clones and compare the sequence with that of other DNA BPs in GenBank EMBL or other databases a If your sequencing results reveal a very short lt 10 amino acid peptide fused to the AD or no fusion peptide at all keep se quencing beyond the stop codon You may find another larger open reading frame ORF for a peptide that interacts with the target elements in your reporter strain and functions as a transcriptional activator Nontranslated gaps upstream of ORF inserts are most commonly found in yeast genomic libraries where intercistronic regions are very short Such gaps can also occur in cDNA libraries due to the cloning of a portion of the 5 untranslated region of the mRNA along with the coding region in the cDNA If the library was bulit in a high level expression vector such as pGAD GH or pACT2 a western blot analysis will reveal the presence and size of an AD fusion protein b In some cases two different ORFs may be expressed as a fusion with the AD even though a nontranslated gap comes between them due for example to occasional transl
45. tructs into a target acZ reporter strain Only the lacZ reporter is used because growth selection is not required and B galactosidase activity can be quantified using a liquid assay The accompanying CLONTECH Yeast Protocols Handbook YPH PT3024 1 contains background information recipes and support protocols for use with this User Manual TEL 415 424 8222 or 800 662 CLON Technical Service Protocol PT1031 1 page FAX 415 424 1064 or 800 424 1350 Version PR71132 5 CLONTECH Laboratories Inc l Introduction continued TABLE I LIST OF ABBREVIATIONS MATCHMAKER One Hybrid Terminology AD GAL4 activation domain a a 768 881 AD fusion library A cDNA or genomic library constructed in an or AD library AD vector such that the proteins encoded by the inserts are fused to the GAL4 AD AD library plasmid Plasmid encoding a fusion of the GAL4 AD and a library insert AD library protein A hybrid comprised of the GAL4 AD fused to a protein encoded by a library insert AD vector Plasmid encoding the GAL4 activation domain AD DNA BP DNA binding protein a protein that binds specifically to your target elements Target element The short DNA sequence you wish to use as a potential protein binding site upstream of a reporter gene Target pLacZi Customized target reporter vectors pLacZi pHISi or Target pHISi pHISi 1 reporter vector with the target element inserted Target pHISi 1 upstream of the minimal promoter of the
Download Pdf Manuals
Related Search