Home

Cumate solution

image

Contents

1. Q o SSB SPARC System Biosciences SparQ Cumate Switch Cat QMXXX Series User Manual A limited use label license covers this product By use of this product you accept the terms and conditions outlined in the Licensing and Warranty Statement ver 1 090810 contained in this user manual SparQ Cumate Switch Inducible Expression System Cat s QMxxx Contents l Introduction and Background ccccceeeeeeeeeeeeeeeeeeeeeeeeeeeeaeees 1 A Purpose of this Manual cccccccsseeeeeeeeeeeeeseeeeeeneeeeeseees 1 B Features and Benefits of the Cumate Switch Inducible System 1 C Mechanism of Transcriptional Control cccccceeeeeeeees 3 D Advantages of the SparQ Lentivector Expression System 4 E SparQ Cumate Switch Map examples cceecceeeees 6 F List of the Cumate Switch Components c c 0eeeee 10 G Additional Required Materials ccccccccsessssseeeseeeeeeeeaes 11 H Safety Guidelines cccccccccscsseeceeeeeesseeseeeeeeesseseseeeeeeees 11 Her IP MOVO CONS ax nicrestesnaatectan tamed a sau xtenstaauumrenitanaieabinenesnineuniennieass 13 A Transduction the CymR Repressor and Inducible Viruses 13 B Induction and Monitoring expression ccccesceeeseeeeeeeeees 14 IIl Troubleshooting ccccseeeeeeeecseeeeeeeeceaeeeceeeseeeeseeeeeaaaaeess 14 A No or low RFP GFP observed under a fluorescent microscope after the addit
2. SparQ Cumate Switch Inducible Expression System Cat s QMxxx IV References Mullick A Xu Y Warren R Koutroumanis M Guilbault C Broussau S Malenfant F Bourget L Lamoureux L Lo R Caron AW Pilotte A Massie B The cumate gene switch a system for regulated expression in mammalian cells BMC Biotechnol 2006 Nov 3 6 43 PMID 17083727 Gaillet B Gilbert R Broussau S Pilotte A Malenfant F Mullick A Garnier A Massie B High level recombinant protein production in CHO cells using lentiviral vectors and the cumate gene switch Biotechnol Bioeng 2010 Jun 1 106 2 203 15 PMID 20178120 Eaton RW p Cymene catabolic pathway in Pseudomonas putida F1 cloning and characterization of DNA encoding conversion of p cymene to p cumate J Bacteriol 1997 May 179 10 31 71 80 Broussau S Jabbour N Lachapelle G Durocher Y Tom R Transfiguracion J Gilbert R Massie B Inducible packaging cells for large scale production of lentiviral vectors in serum free suspension culture Mol Ther 2008 Mar 16 3 500 7 Epub 2008 Jan 8 PMID 18180776 Page 15 System Biosciences SBI User Manual V Appendix A Features of the Lentivectors e Hybrid RSV 5LTR promoter 7 414 provides a high level of expression of the full length viral transcript in producer 293 cells e Genetic elements cPPT 1798 1915 GAG 567 919 LTRs 235 414 4287 4520 necessary for packaging transducing and stably integrating the viral expression construct into g
3. you may use the following sequencing primer which is located upstream of the MCS Vectors with Cumate Operator 5 CACCTGGCCCGATCTGGCC 3 2A Peptide enabled dual expression system Co expression of a reporter gene together with a gene of interest is a useful approach for selecting transfected or transduced cells This is commonly achieved by using two independent internal promoters such as CMV and EF1 in pCDH CMV MCS EF1 copGFP or by linking two transgenes with an internal ribosomal entry site IRES element in a single bicistronic transcript The self cleaving 2A peptides have been used successfully to generate multiple proteins from a single promoter in many applications The 2A like sequences exist in several viruses and are used to mediate protein cleavage from a Page 8 ver 1 090110 SparQ Cumate Switch Inducible Expression System Cat s QMxxx single open reading frame Through a ribosomal skip mechanism the 2A peptide prevents normal peptide bond formation between the 2A glycine and the 2B proline without affecting the translation of 2B T2A Peptide 2A 2B GeneA EGRGSLLTCGDVEENPGP GeneB SBI s cDNA expression vectors incorporate the 2A like sequence T2A from the insect virus Thosea asigna to mediate the co expression of a reporter gene with the target cDNA Reporter genes have been cloned at either the first or second positions and high expression levels can be achieved at both locations Primer Design for Clon
4. Cumate Switch Promoter MCS Lentivectors MCS QM521 A 1 GFP QM522A 1 RFP WPRE Marker choices Cumate Switch Promoter IRES Lentivectors QM530A 1 GFP QM531A 1 RFP SV40 ORI SV40 poly A 3 ALTR WPRE Marker choices The Dual promoter T2A and IRES SparQ vector formats can be used to make inducible expression constructs for cDNA We recommend using either the Dual promoter or IRES vector formats for creating inducible microRNA expression constructs NOTES The Dual promoter format vectors will constitutively express RFP or GFP independent of the cumate switch activation The T2A and IRES formats will express the GFP or RFP markers only when the cumate switch is turned ON Catalog Inducible Configuration QM350PA 1 oCDH Cuo RFP T2A copGFP positive control plasmid QM350VA 1 oCDH Cuo RFP T2A copGFP positive control virus QM500A 1 pCDH CuO MCS empty QM511B 1 pCDH CuO MCS EF1 copGFP Page 7 System Biosciences SBI User Manual QM512B 1 oCDH CuO MCS EF1 RFP RSV 5 LTR wa CymR Repressor a Puc N Lentivectors SV40 ORI SV40 poly A Catalog Repressor Formats QM200PA 1 pCDH EF1 CymR T2A Puro plasmid QM200VA 1 pCDH EF1 CymR T2A Puro virus QM300PA 1 pCDH EF1 CymR T2A RFP plasmid QM300VA 1 pCDH EF1 CymR T2A RFP virus Confirm identity of the cDNA insert by sequence analysis of the construct using the one of the PCR primers Alternatively
5. P or GFP expression correlates with the induced expression of your cDNA or microRNA cloned into the SparQ vector construct Begin monitoring induction after 24 hours in most cases easily detectable levels typically occur after 2 3 days 3 Measurement of microRNA expression You can generate stable cell lines by sorting for GFP or RFP positive cells depending on the selection marker on the expression vector used You may also measure the expression levels of your microRNAs using SBI s QuantiMir Kit Cat RA420A 1 4 Turning OFF the cumate switch The cumate switch can be turned OFF at any time Simply remove and change the media of the cells and add fresh media excluding the cumate The induced expression will fade within 24 72 hours 5 Turning the cumate switch back ON The cumate switch can be turned back on to test for repeated expression of your cDNA or microRNA of interest Simply add cumate back to the cell media whenever you want to induce the expression again lil Troubleshooting A No or low RFP GFP observed under a fluorescent microscope after the addition of cumate for the T2A and IRES formats 1 The amount of viruses used for infection is too low Increase the MOI of the viruses for infection 2 Optimize the ratio of the expression and transactivator viruses Use equal MOls of the expression and transactivator viruses If too much CymR virus is used the induction may become weak or undetectable Page 14 ver 1 090110
6. ction of cDNA or microRNA expression using the cumate switch Catalog Description e QM200PA 1 oCDH EF1 CymR T2A Puro plasmid e QM200VA 1 pCDH EF1 CymR T2A Puro virus e QMS300PA 1 oCDH EF1 CymR T2A RFP plasmid e QMS300VA 1 oCDH EF1 CymR T2A RFP virus e QMI100A 1 Cumate solution 1000x 500ul H Safety Guidelines SBI s Expression lentivectors together with the pPACK packaging plasmids comprise the third generation lentiviral expression system The HIV based lentivectors are based on the vectors developed for gene therapy applications by Dr J G Sodroski US patent 5 665 577 and 5 981 276 Both FlV based and HIV based lentivector systems are designed to maximize their biosafety features which include A deletion in the enhancer of the U3 region of 3 LTR ensures self inactivation of the lentiviral construct after transduction and integration into genomic DNA of the target cells The RSV promoter in HIV based vectors and CMV promoter in FlV based vectors upstream of 5 LTR in the lentivector allow efficient Tat independent production of viral RNA reducing the number of genes from HIV 1 that are used in this system Number of lentiviral genes necessary for packaging replication and transduction is reduced to three gag pol rev and the corresponding proteins are expressed from different plasmids for HIV based packaging plasmids lacking packaging signals and share no significant homology to any of the expression len
7. e is non toxic to cells and allows for greater dynamic ranges of induction levels allowing you to choose your induction level No Cumate 5ug miCumate 10 ug ml Cumate 30ug mlCumate 50 ug ml Cumate 2000 Cumate 1600 1200 800 400 Fluorescence Index RFP Cells Cumate added ug ml HEK293 cells stably expressing CymR Cat QM400A 1 and transduced with pbCDH Cuo RFP T2A copGFP positive control virus Cat QM350VA 1 at MOI 20 Increasing amounts of cumate were added The cells were imaged after 3 days 30 ug Cumate constant Increasing amounts of Virus No Virus 10 MOI Virus 20 MOI Virus 30 MOI Virus The same HEK293 CymR cell line was transduced with increasing MOls of pCDH Cuo RFP T2A copGFP virus and treated with 30ug ml cumate Page 5 System Biosciences SBI User Manual 3 Switch On turn OFF and Switch back ON capabilities The Cumate switch SparQ lentivectors can be induced for multiple rounds by simply adding and removing cumate No Cumate Cumate 3 days ae Remove Cumate to turn OFF 3 days 5 days my Cumate Again 6 days 4 days E SparQ Cumate Switch Map examples SparQ Cumate Inducible Lentivectors and CymR Repressor Formats Page 6 ver 1 090110 SparQ Cumate Switch Inducible Expression System Cat s QMxxx RSV 5 LTR Cumate ie romoter Dual Promoter Lentivectors lt Mcs Bes QM511B 1 GFP QM512B 1 RFP Marker choices
8. enomic DNA e CMV5 CuO A chimeric promoter that is comprised of cumate response repeats of the CymR repressor binding site e MSC Multiple Cloning Site Convenient collection of restriction sites to insert cDNAs or microRNAs for inducible expression e WPRE element enhances stability and translation of the CMV driven transcripts e SV40 polyadenylation signal enables efficient termination of transcription and processing of recombinant transcripts e GFP or RFP provides co expression of cooGFP or RFP reporter with your precursor microRNA of interest under the control of the Cumate switch inducible promoter e Kozak sequence optimized bases and positions for efficient translation initiation of cooGFP or RFP e SV40 origin for stable propagation of the plasmid in mammalian cells e pUC origin for high copy replication and maintenance of the plasmid in E coli cells e Ampicillin resistance gene for selection in E coli cells e The Cumate Switch technology is fully licensed from the National Research Council Canada Page 16 ver 1 090110 SparQ Cumate Switch Inducible Expression System Cat s QMxxx B Related Products pPACKH1 Lentivector Packaging Kit Cat LV500A 1 Unique lentiviral vectors that produce all the necessary HIV viral proteins and the VSV G envelope glycoprotein from vesicular stomatitis virus required to make active pseudoviral particles 293TN cells SBI Cat LV900A 1 transiently transfected wit
9. h the pPACKH1 and a pCDH cDNA expression construct produce packaged viral particles containing a CDH cDNA construct UltraRapid Lentiviral Titering Kit Cat LV961A 1 The easiest kits that allow you to rapidly and accurately determine the titers of infectious pseudoviral particles that are generated with SBs FIV and HIV lentiviral vectors or libraries They are more accurate than all other titering kits on the market as they measure the copy numbers of integrated lentiviral constructs in the genomic DNA of each transduced target cell PEG i t Virus Precipitation Solution LV810A 1 LV825A 1 To easily concentrate Lentiviruses without ultracentrifugation QuantiMir Kit Cat RA420A 1 To measure the expression levels of your mature microRNAs Page 17
10. ing into Vectors with T2A Sequence Since the gene of interest and the reporter gene in cDNA expression vectors containing a T2A peptide sequence will form one open reading frame extra attention should be paid when designing the 3 primer for amplifying the target sequence First of all do not include a stop codon at the 3 end of target sequence This would prevent the expression of the reporter gene Secondly place the target sequence in frame with the 2A peptide For example if you would like to clone your target sequence between Xba1 and BstB1 you would need to add one more nucleotide at the end of your target sequence in order to make it in frame with the 2A peptide and reporter gene Swat BamH1 Noti tctaga ttcgaatttaaatcggatccgcggcecgct T2A sequence tccggg Xba1 BstB1 gag ggc aga gga agt ctt cta aca tgc ggt gac gtg gag gag aat ccc ggc cct Target Sequence Ligation TS tctaga TS ntt cga att taa atc gga tcc gcg gcc gct gag ggc ggc cct tcc ggg Puro Xbal BstB1 Swal BamH1 Not1 T2A Sequence Sequence arrangement after target sequence is inserted between Xba1 and BstB1 in cDNA cloning vector pCDH CuO MCS T2A GFP An additional nucleotide n is added after the last codon of the target sequence in order to keep it in frame with the T2A sequence If you are using either the Dual Promoter or IRES format SparQ cumate switch lentivectors then include a suitable stop codon at the end of your cDNA prior to the downstream promoter
11. ion of cumate for the T2A and IMEDO a E E E E 14 IV FICISIONCCS iasisies advcktovsscasveraiecdouseaeinicnndiekbeusdeiadiadeaetviesadvatiat 15 Va POO occisos a ETE EE EAER 16 A Features of the Lentivectors cccccsseeceeeeeeeeeeeeeeeeeeeeeeens 16 B Related ProdUCtS irucriisopinuaina cate tape entanaeeeeteidaeete 17 C Technical SUPPOSt ccccccsseseeecceeeeesseeeeeeeeeessaaeeeeeeeeeeesaas 18 VI Licensing and Warranty Statement ccsseeseeeeeeeeeees 19 l Introduction and Background A Purpose of this Manual This manual provides detailed information on how to use SBI s tightly regulated SparQ Lentiviral Cumate Switch Inducible system For new users of the system please read the entire manual before starting The SparQ cumate switch lentivectors work through virus transduction Transfection of the vectors will result in constitutive expression from the upstream RSV packaging promoter B Features and Benefits of the Cumate Switch Inducible System e Avoid potential undesired effects from constitutive overexpression e Enhanced Cumate Operator CuO elements regulate the potent CMV5 promoter Page 1 User Manual Extremely low background with robust Cumate On induction Track induction with co expressed RFP or GFP markers Two lentivector system CymR lentivirus plus your inducible construct CymR lentivectors available with co expressed Puro or RFP markers Easy to titrate level of induction with cumate
12. le material e All cultures stocks and other regulated wastes are decontaminated before disposal by an approved decontamination method such as autoclaving Materials to be decontaminated outside of the immediate laboratory area are to be placed in a durable leakproof properly marked biohazard infectious waste container and sealed for transportation from the laboratory e Please keep in mind that lentivectors can be integrated into genomic DNA and may have a risk of insertional mutagenesis Page 12 ver 1 090110 SparQ Cumate Switch Inducible Expression System Cat s QMxxx Protocols A Transduction the CymR Repressor and Inducible Viruses Transduce the DCDH EF1 CymR T2A RFP or pCDH EF1 CymR T2A Puro virus either simultaneously with your SparQ cumate switch construct co transduce or establish a stable CymR cell line first For the best results we recommend establishing a CymR stable cell line first and then transducing your inducible SparQ expression virus construct Co transducing Target Cells with the Pseudoviruses Day 1 1 Plate target cells In each well of a 24 well plate plate your target cells with 0 5 ml complete growth medium containing antibiotics so that the cells will be 10 30 confluent at the time of infection Incubate the cells at 37 C with 5 COs overnight Day 2 1 Add Transduction reagent To each well add TransDux at a final concentration of 1X 2 Co Infect target cells with the CymR repressor vi
13. or IRES elements Page 9 System Biosciences SBI User Manual F List of the Cumate Switch Components Cat Description Size Cumate solution 1000x 500ul in QM100A 1 95 EtOH 500ul QM200PA 1 pCDH EF1 CymR T2A Puro plasmid 10 ug 10 6 QM200VA 1 PCDH EF1 CymR T2A Puro virus us QMS300PA 1 pCDH EF1 CymR T2A RFP plasmid 10 ug 106 QM300VA 1 pCDH EF1 CymR T2A RFP virus ie oCDH Cuo rRFP T2A copGFP QM350PA 1 plasmid 10 ug 10 6 QM350VA 1 OCDH Cuo rRFP T2A copGFP virus roe Page 10 ver 1 090110 SparQ Cumate Switch Inducible Expression System Cat s QMxxx G Additional Required Materials Packaging of SparQ Constructs into Pseudoviral Particles In order to package your SparQ constructs into VSV G pseudotyped viral particles we recommend using the pPACKH1 Lentivector Packaging Kit SBI Cat LV500A 1 The protocols for packaging and transduction of packaged pseudoviral particles are provided in the Lentivector Expression System User Manual 293T Producer Cell Line Recommended SBI s 293TN Cell Line Cat LV900A 1 Transfection Reagent Recommended SBI s PureFection transfection reagent Cat LV750A 1 Concentrating Pseudoviral Particles PEG it Virus Precipitation Solution Cat LV810A 1 Titer Measurement of Pseudoviral Particles Global UltraRapid Lentiviral Titering Kit Cat LV961A 1 Lentivirus transduction TransDux Virus Transduction Reagent Cat LV850A 1 Indu
14. rus along with the SparQ cumate switch inducible expression virus 3 To the 24 well plate add 10 20 or 50 MOI of each of the packaged viruses Ideally a 1 1 ratio of CymR to Cumate switch inducible construct virus provides suitable control of the cumate switch Use 2 10 ug ml puromycin to select for stable CymR cells depending upon your cell type Page 13 System Biosciences SBI User Manual 4 OPTIONAL Add cumate solution to the media after at least 30 minutes to induce expression Cumate is supplied as a 1000x solution in 95 ethanol An easy way to dilute the cumate solution is to make a 100X cumate solution in the cell media you plan to use for your experiment A 1X solution of cumate corresponds to30ug ml We have tested cumate concentrations between 0 2X and 2X with no toxicity observed in the cells 5 Incubate the cells at 37 C with 5 CO overnight B Induction and Monitoring expression 1 Induction Add Cumate if you skipped step 4 above at a final concentration of 1X or desired induction concentration directly to the wells in which you want to induce the expression of the cDNA or microRNA 24 hours after infection Continue incubating the cells at 37 C with 5 CO 2 Monitor Induction The Dual promoter format vectors will constitutively express RFP or GFP independent of the cumate switch activation The T2A and IRES formats will express the GFP or RFP markers only when the cumate switch is turned ON The level of RF
15. solution Switch ON gt Turn OFF gt Switch ON again capabilities No special media or conditions required plug and play system SparQ Cumate Switch Inducible Expression System Cat s QMxxx C Mechanism of Transcriptional Control The regulatory mechanisms of the bacterial operons cmt and cym have been engineered to regulate gene expression in mammalian cells In the repressor configuration regulation is mediated by strong binding of the CymR repressor to the Cumate operator site CuO which is downstream of the CMV5 promoter Addition of cumate a small non toxic molecule relieves the repression Cumate Switch OFF rate Cumate Cym a e Cumate Switch ON comer e RFP GFP Page 3 System Biosciences SBI User Manual D Advantages of the SparQ Lentivector Expression System SBI has built the only lentivector based cumate switch system providing inducible expression of cDNAs and microRNAs Top features of the Cumate Switch 1 Tighter regulation of induction The Cumate Switch has lower background than other inducible systems and provides robust induction levels GFP Positive Cells Page 4 50 45 40 35 32 4 x 3 4 X Induction Induction 30 25 Inducer om Cumate Switch Other Systems ver 1 090110 SparQ Cumate Switch Inducible Expression System Cat s QMxxx 2 Titratable and controllable induction of expression Cumat
16. tivectors pVSV G expression vector or any other vector to prevent generation of recombinant replication competent virus None of the HIV 1 genes gag pol and rev will be present in the packaged viral genome as they are expressed from packaging plasmids lacking packaging signal therefore the lentiviral particles generated are replication incompetent Pseudoviral particles will carry only a copy of your expression construct Page 11 System Biosciences SBI User Manual Despite the above safety features use of SBI s lentivectors falls within NIH Biosafety Level 2 criteria due to the potential biohazard risk of possible recombination with endogenous viral sequences to form self replicating virus or the possibility of insertional mutagenesis For a description of laboratory biosafety level criteria consult the Centers for Disease Control Office of Health and Safety Web site at http www cdc gov od ohs biosfty ombl4 ombl4s3 htm_ lt is also important to check with the health and safety guidelines at your institution regarding the use of lentiviruses and always follow standard microbiological practices which include e Wear gloves and lab coat at all times when conducting the procedure e Always work with pseudoviral particles in a Class II laminar flow hood e All procedures are performed carefully to minimize the creation of splashes or aerosols e Work surfaces are decontaminated at least once a day and after any spill of viab

Download Pdf Manuals

image

Related Search

Related Contents

MiniBox - ruck Ventilatoren  Samsung 50'plasma kuvarid P50HP Kasutusjuhend  FUTURA ONE FUTURA ONE ABUS®  多軸リンクコントローラ - OptoSigma Global Top  ダウンロード  25 years SIS from Bosch: The Troubleshooting device  Philips HP6578  Instructions - Workshopping.co.uk  Manual do produto (PT)  MO Xtm-Xsm 50 Frame ENG  

Copyright © All rights reserved.
Failed to retrieve file