Home

GenTarget`s EcoTMPlasmid DNA Miniprep Kit User Manual

image

Contents

1. 7930 Arjons Drive Suite B San Diego CA 92126 el arue ne Phone 858 6788683 Fax 800 3804198 Email Orders gentarget com pEco T7 nHis PCR cloning Kit User Manual Patent pending Cloning PCR products for E Coli expression of N term His tagged protein Cat Contents Amounts Application pEco T7 nHis vector built in 10 tubes x 50ul ea Eco Cloning cells for 10 rxn E Coli expression of N IC 1001 Positive PCR insert 1 x 10ul ea term His tag protein Sequencing primer pair Forward and reverse 15ul each 25ng ul Storage Eco Cloning Kit is shipped on dry ice Upon received stored at 80 C Once thawed must be used do not re freeze Product should be stable for 6 months Product Description 1 Introduction The revolutionary Eco Fusion in vivo cloning method is the easiest PCR cloning method available 1 Simply amplify your gene of interest with a primer pair that is flanked with short arms homologous to the expression vector 2 Add 2 ul of purified PCR into the engineered vector build in cloning cells 3 Immediately proceed to transformation 2 How it works The engineered E Coli strain in GenTarget s Eco PCR Cloning Kit has an enhanced E Coli competent cells enabling an in vivo joining reaction for cloning with no tube reactions Let the E Coli do the job for you In Vivo GenTarget provides E Coli cloning cells with a selection of built in vectors for mamm
2. PCR insert cells usually form background colonies the no insert negative control also generates a few colonies In the presence of PCR insert however gt 90 colonies are positive Colony number varies depending on the quality and quantity of the PCR products The concentration of purified PCR product can be from 20 ng l to 150 ng ul with sizes ranging from 200 bp to 10 kb For simplicity and particularly for high throughput cloning we recommend adding 1 2 ul of PCR product into the cloning cells Regardless of the PCR product s concentration and size it will generate enough colonies 5 100 colonies in general for downstream work Important if your PCR template can generate background clones having Amp resistance you need treat your PCR product by DPNI or do gel purification of PCR product 4 Save glycerol stocks for later expression and verification of positive clones Pick 2 5 colonies propagate in LB Amp and incubate at 37 C overnight Save an aliquot of each clone in LB Glycerol medium containing 100 ug ml ampicillin at a final concentration of 15 Glycerol Isolate the plasmid DNAs using a DNA miniprep kit Confirm the positive by restriction digestion PCR inset can be cut out by EcoRI HpaI Run 1 2 agarose the positive clones will show two bands 2 8 kb backbone the PCR insert or multiple bands if the cust exist within the PCR insert Final sequencing verification Use the provided sequencing
3. make your clone map simply paste your gene sequence not included the flanking sequences of both ends in the Red highlighted position replacing the NNNN NN In most case the pasted sequence is ATG to last codon Map of pEco T7 nHis vector GOI cloning ends T7 Promoter ___ Mlul S Hpal His tag pUC19 ori g a T7 Promoter 20 39 His 103 123 GOI cloning ends 123 124 T7 term 139 268 F1 ori 339 794 Ampicillin 925 1785 Ampicillin pUC19 ori 2603 1930 7 Troubleshooting Problems Solution No colony Be sure to set up a positive control transformation using the provided positive PCR insert1 which should give you 10 100 colonies Spread all of the transformation mixture onto the plate Background Be sure to set up a background control plate in which no colonies PCR product was added to the cells It should generate 0 5 colonies or less than 10 compared to plates with the insert Note in the absence of a PCR insert cells force vector self ligation resulting in a few background colonies Make sure that the PCR s template does not cause background colonies If it does clean PCR products by gel isolation or treatment with DPNI Plate less transformation mixture onto the plate Eco Cloning of pEco T7 nHis product manual Page 7 of 8 www gentarget com GenTarget Inc Copyrights 2015 7930 Arjons Drive Suite B San Diego CA 92126 ell a
4. that works for you To minimize PCR errors we recommend using high fidelity DNA polymerase Use any PCR purification column to clean your PCR products If you do not obtain a single discrete band from PCR gel purify your fragment Important if your PCR template can generate background clones having Amp resistance treat the PCR product with DPNI or perform gel purification 3 Transformation Thaw Eco Cloning cells in ice water After they are completely thawed add 1 2 ul purified PCR product from 20ng to 150ng into each vial of cells and mix briefly by tapping the tube with your finger For control vials add 1ul positive PCR insert provided as a positive control and then add ul water to a negative control cells vial Put tubes back on ice and proceed to heat shock at 42 C for 40 seconds Note Do not leave DNA cells mixture on ice for prolonged period less than 15min are fine Put tubes back on ice for 1 min add 250 pl of SOC medium and incubate at 37 C shaking for 1hr Plating take a 250 wl competent cells above spread out on pre warmed LB agar plates containing 100 ug ml ampicillin Grow colonies at 37 C overnight Eco Cloning of pEco T7 nHis product manual Page 4 of 8 www gentarget com GenTarget Inc Copyrights 2015 7930 Arjons Drive Suite B San Diego CA 92126 el arue ne Phone 858 6788683 Fax 800 3804198 Email Orders gentarget com Note In the absence of a
5. alian or E Coli expression systems A proprietary process for making ready to use E Coli cells with built in vectors ensures low background and a positive cloning rate of greater than 90 Eco Cloning of pEco T7 nHis product manual Page 1 of 8 www gentarget com GenTarget Inc Copyrights 2015 7930 Arjons Drive Suite B San Diego CA 92126 el arue ne Phone 858 6788683 Fax 800 3804198 Email Orders gentarget com Target PCR Add PCR to cells e ap _ Transformation I EP aie aul Sey In vivo cloning Oe pEco T7 nHis cloning cells has a built in pET based T7 expression vector PCR insert will be cloned in framed with a N terminal His tag 3 Key Features e The easiest and most cost effective PCR cloning method available Simply add iul of PCR insert into provided cells for transformation regardless of the insert s size and concentration e No need to buy vectors and no tedious bench work preparing a vector backbone e No need to buy cloning competent cells e No need for any enzymes or any tube reactions e Precisely directional cloning of PCR products with a in frame His tag N term 6His e Flexibility to allow addition of any cleavage site for removal of N terminal His tag if desired e Compatibility with any PCR product with or without a 3 A overhang the extra A overhang if it exists will be removed in the cloning step e Can be used with PCR produc
6. medium volume at 20 of flask volume for better aeration vigorously shake at 300C 300rpm Induction measure growth OD600 at the time when OD600 0 5 add an appropriate amount of IPTG continue grow for 17 24 hours with vigorously shaking at 300C 300rpm Harvest cells by centrifugation QC Cell pellet was lysed using lysis reagent Following the lysis protocols run protein gel for analysis Purification use your favorite protocols and reagent to purify the expression His tagged protein by His tag affinity column Purity and function analysis of the expressed protein using your favorite protocols 6 Vector maps Cloning site for pEco T7 nHis vector T7 Promoter GATCTCGATC CCGCGAAAT GACCACAACG CTAGAGCTAG GGCGCTTTA T CTGGTGTTGC GTTTCCCTCT AGAAATAATT TTGTTTAACT TTAAGAAGGA GAATTCACCA CAAAGGGAGA TCTTTATTAA AACAAATTGA AATTCTTCCT CTTAAGTGGT His tag PCR insert TGGcG CAT CAC CAT CAT CAT CATNNNNNNN NNTAGACGCG TGTTAACCTG ACcGc GTA GTG GTA GTA GTA GTANNNNNNN NNATCTGCGC ACAATTGGAC The figures above and below summarizes the vector map of pEco T7 nHis The complete nucleotide sequence is available for downloading from our Eco Cloning of pEco T7 nHis product manual Page 6 of 8 www gentarget com GenTarget Inc Copyrights 2015 7930 Arjons Drive Suite B San Diego CA 92126 el arue ne Phone 858 6788683 Fax 800 3804198 Email Orders gentarget com Website at Support page www gentarget com To
7. primer pair The sequencing primer comes in a ready to use dilution use ipl for each sequencing reaction with 500ng plasmid in 20ul volume Cat Vector Forward primer Reverse primer IC 1001 pEco T7 nHis IC 1001 fwd IC 1001 rev 5 taatacgactcactataggg 5 tgctagttattgctcagcge 5 Protein expression Once positive clones are confirmed they can be used directly for protein expression without re transformation into another strain Transformation transform the sequencing verified plasmid DNA into any strain containing a T7 RNA polymerase such as BL21 DE3 or BL21 DE3 pLys from which protein are expressed upon IPTG induction Transformation uses standard heat shock protocol such as add 1ul Eco Cloning of pEco T7 nHis product manual Page 5 of 8 www gentarget com GenTarget Inc Copyrights 2015 7930 Arjons Drive Suite B San Diego CA 92126 el arue ne Phone 858 6788683 Fax 800 3804198 Email Orders gentarget com DNA into 50ul competent cell set ice 5 15min heat shock at 420C for 30 seconds back to ice for 2min add 250ul SOC recovery at 370C shaking for 1 hour Plate 10 to 100ul onto LB plates containing 100ug ml ampicillin Grow colonies at 370C incubator for overnight Propagation Pick one clone grow in LB medium with ampicillin at 370C shaking overnight Add overnight culture into appropriate amount of LB medium containing 100ug ml of ampicillin by making 1 40 dilution keep
8. rimer design To design the primer pair for the following gene sequence atggcctctgtgaaggaaaatccactctagtccctacctgcatttctcagccttgct tacctgttgccaacattgggccaacccgaattcttcccaatctttatcttggctgcca gcgagatgtcctcaacaaggagctgatgcagcagaatgggattggttatgtgtta aatgccagcaatacctgtccaaagcctgacttttta The PCR primer for vector pEco T7 nHis will be Fwd 5 catggcgcatcaccatcatcatcatatggcctctgtgaaggaaaa Rev 5 ttgttagcaggttaacacgcgtctaaaagtcagectttggacage If inserting a protein cleavage site the forward primer will be Eco Cloning of pEco T7 nHis product manual Page 3 of 8 www gentarget com GenTarget Inc Copyrights 2015 7930 Arjons Drive Suite B San Diego CA 92126 el arue ne Phone 858 6788683 Fax 800 3804198 Email Orders gentarget com Fwd 5 catgcatcatcaccatcatcatcatNNNNNNecctctgtgaaggaaaatcc where the NNNNNN is the in framed codon sequence of cleavage site Notes 1 GenTarget s cloning kits with the same terminal tags share PCR insert sites The three Eco cloning kits with N terminal tags Cat IC 1001 IC 1002 and IC 1003 can share the same PCR insert and the two cloning kits with C terminal tags Cat IC 1006 and IC 1007 can share the same PCR insert 2 A stop codon does not need to be included in the PCR reverse primer since a stop codon is already built in immediately after the PCR insert 2 Target amplification by PCR Amplify your target using any PCR amplification protocol
9. rue ne Phone 858 6788683 Fax 800 3804198 Email Orders gentarget com Satellite Be sure to use the right amount of antibiotics in the LB colonies plate and make fresh LB plates if necessary Use carbenicillin instead of ampicillin if applicable Do not incubate plates longer than 16 hours Try to avoid picking the tiny satellite colonies References 1 Oliner et al 1993 Nucleic Acids Res 1 5192 97 2 Aslanidis et al 1994 Genome Res 4 172 177 3 Kaluz et al Nucl Acids Res 1992 20 4369 4370 Related Products Cat Product Name Amount Application PCR cloning kit with a built in mammalian expression vector with neomycin selection marker in provided cloning cells The vector containing an engineered super PCR cloning kit kit CMV promoter for high yield mammalian expression of IC 1002 N term His tagged protein PCR cloning kit with a built in vector non T7 promoter PCR cloning kit kit based in provided cloning cells for E Coli expression of N term His tagged protein specially designed for toxic IC 1003 proteins PCR cloning kit with a built in vector T7 promoter based PCR cloning kit kit in provided cloning cells for E Coli expression of N term GST tagged protein PCR cloning kit with a built in vector T7 promoter based PCR cloning kit kit in provided cloning cells for E Coli expression of C term His tagged protein IC 1004 IC 1006 PCR cloning kit wi
10. th a built in mammalian expression vector with Neomycin selection marker in provided cloning cells for mammalian expression of C term His tagged protein IC 1007 PCR cloning kit kit Eco Cloning of pEco T7 nHis product manual Page 8 of 8 www gentarget com GenTarget Inc Copyrights 2015
11. ts of varying sizes from 200 bp to 10 kb The same PCR product can be used to construct multiple different expression vectors e Engineered E Coli expression vectors for high protein yields e Great for high throughput cloning 4 Protocol Outline Eco Cloning of pEco T7 nHis product manual Page 2 of 8 www gentarget com GenTarget Inc Copyrights 2015 7930 Arjons Drive Suite B San Diego CA 92126 el arue ne Phone 858 6788683 Fax 800 3804198 Email Orders gentarget com Produce and clean PCR products v Add 1 2 ul of PCR product into the cloning cells provided briefly mix and immediately proceed to transformation v Pick colonies save glycerol stocks and isolate plasmids by miniprep to verify the positive clones v Express protein from the saved glycerol stock 5 Detailed Protocol 1 PCR primer design PCR primers used for generating inserts for Eco Cloning must contain a 20 25bp homologous sequence corresponding to the built in vector Design your primer pair as follows Fwd 5 catggcgcatcaccatcatcatcat 20bp of 5 end gene specific forward sequence Rev 5 ttgttagcaggttaacacgcgtcta 20bp of 3 end gene specific reverse sequence A protein cleavage site may be included in the forward primer to allow excision of the N term tag if desired Its codon sequences must be in frame and set between the homologous leader and the 20bp gene specific sequence An example of PCR p

Download Pdf Manuals

image

Related Search

Related Contents

V7 Micro SDHC 8GB Class 4 + SD Adapter  SD–3000 - DLG Automação Industrial  VP6322 Product Announcement  DVM6243 – PORTABLE DIGITAL LC METER  Kurz und bündig - Opel-Team  Sunbeam 3982 Iron User Manual  relatividade combinatória - Repositório da Universidade de Lisboa  

Copyright © All rights reserved.
Failed to retrieve file