Home

Big answers from small worlds

Contents

1. Clamps or stopcocks to close connections Pipettes of varying sizes 10 100 u1 100 1000 1 1 5 mL to sample Equipment for active dispersal continuous landscapes Silicon tubing recommended inner diameter is between 2 to 5 mm Clamps or stopcocks to close connections Polypropylene T and Y connectors Silicon stoppers to close the T connectors Pipettes of varying sizes 10 100 1 100 1000 1 1 5 mL to sample Reagents No specific reagents are required Procedure Passive dispersal For experiments built on the assumption of passive dispersal e g Warren 1996 Cadotte amp Fukami 2005 Altermatt Schreiber amp Holyoak 2011 Carrara et al 2012 in which predefined volumes of cultures are pipetted from the patch of origin to the destination patch any vials can be used including wellplates Eppendorf tubes Petri dishes or Erlenmeyer flasks to name just a few Fig 1A C Connectivity patterns can be determined through pipetting schemes Especially large and highly replicated setups or experiments including complex pipetting schemes may be best performed automatically using robots for a yeast model system but easily transferable to protists see Bell amp Gonzalez 2011 In order to avoid long tailed dispersal one needs to use a mirror landscape described in detail by Carrara et al 2012 as otherwise individuals could potentially disperse across more than one patch distance in one dispersal step 12
2. Asai D L amp Forney J D 2000 Tetrahymena thermophila Academic Press San Diego Cassidy Hanley D M 2012 Tetrahymena in the Laboratory Strain Resources Methods for Culture Maintenance and Storage Methods in Cell Biology Tetrahymena thermophila ed K Collins pp 239 276 Academic Press Amsterdam Donahue M J Holyoak M amp Feng C 2003 Patterns of Dispersal and Dynamics among Habitat Patches Varying in Quality The American Naturalist 162 302 317 Fellous S Duncan A Coulon A l amp Kaltz O 2012a Quorum Sensing and Density Dependent Dispersal in an Aquatic Model System PLoS ONE 7 e48436 Fellous S Duncan A B Quillery E Vale P F amp Kaltz O 2012b Genetic influence on disease spread following arrival of infected carriers Ecology Letters 15 186 192 Fukami T 2004 Assembly history interacts with ecosystem size to influence species diversity Ecology 85 3234 3242 Haddad N M Holyoak M Mata T M Davies K F Melbourne B A amp Preston K 2008 Species traits predict the effects of disturbance and productivity on diversity Ecology Letters 11 348 356 Luckinbill L S 1973 Coexistence in Laboratory Populations of Paramecium Aurelia and Its Predator Didinium Nasutum Ecology 54 1320 1327 McGrady Steed J amp Morin P J 2000 Biodiversity density compensation and the dynamics of populations and functional groups Ecology 81 361 373 Scholes L W
3. Manipulating viscosity of the medium A Methyl cellulose Because methyl cellulose is a hydrophilic substance and only dissolves in cold water a special procedure is required to obtain a homogeneous solution 1 Add half of the powder into warm medium let it soak for a moment then add the remainder till particles are well dispersed in the medium 2 Cool down the medium in ice while stirring leads to a much more rapid dissolution of the particles B Ficoll 1 Add the selected concentration of Ficoll by mass to the medium 2 Stir and use directly References Abrus n G 2004 Filamentous cyanobacteria temperature and Daphnia growth the role of fluid mechanics Oecologia 141 395 401 Altermatt F Bieger A Carrara F Rinaldo A amp Holyoak M 2011 Effects of connectivity and recurrent local disturbances on community structure and population density in experimental metacommunities PLoS ONE 6 e19525 Altermatt F Schreiber S amp Holyoak M 2011 Interactive effects of disturbance and dispersal directionality on species richness and composition in metacommunities Ecology 92 859 870 Beveridge O S Petchey O L amp Humphries S 20102 Direct and indirect effects of temperature on the population dynamics and ecosystem functioning of aquatic microbial ecosystems Journal of Animal Ecology 79 1324 1331 Beveridge O S Petchey O L amp Humphries S 2010b Mechanisms of temperature dependent sw
4. Procedure 1 Remove the most recent stock culture from the incubator 2 Estimate the density of the most recent stock culture from which individuals will be taken to start the new stock culture 3 Calculate the volume of stock culture containing at least 100 individuals 4 Prepare the new stock culture in an appropriate vessel 5 Label the new stock culture appropriately e g species name source of species culture media person responsible date 6 Swirl the source stock withdraw the appropriate volume of culture and squirt it into the new stock culture 7 Replace all stock cultures in the incubator Discard the oldest stock culture if necessary Make sure that at least the second most recent stock culture i e the one used as a source for the fresh one is kept as a backup 8 Enter data about the transfer in the stock culture lab book records Timing Appropriate media at least a two day process and sterile culture vessels should be prepared in advance Steps 1 6 above require approximately half a day for 20 stock cultures Troubleshooting Tips and Tricks The following practices can help avoid unexpected or avoidable loss of stock cultures Redundancy in the form of replicate stock cultures housed in independent incubators ideally in different locations Regular monitoring of stock culture population sizes to prevent extinctions due to population fluctuations and small population sizes Keeping detailed
5. the volumes of liquid sampled and the time in column Time If there was no dilution enter dashes in columns Volume 2 and Volume 3 do not leave these blank Put used Petri dishes into the plastic tub for this Counting protists with a Counting chamber l UAUA W 10 11 12 13 Enter onto the datasheet that you are using this method Do not switch between methods Ensure that microcosms are out of the experimental environment for as short a time as possible Get a plastic Petri dish ready to receive a sample Loosen the lid of the microcosm so it can be removed with one hand Get a pipette with sterile tip ready in one hand Swirl the microcosm to well mix the contents Remove lid with one hand do not put down the lid withdraw a sample with the pipette that you have in your other hand replace the lid The volume of this sample is Volume 1 on the datasheet Put the lid back onto the microcosm and move the microcosms to a safe place We are finished with it and don t want to risk knocking it over or putting something back into it Place the medium in the counting chamber Place the counting chamber under the microscope Make sure that the counter is set to zero Count the cells in the sample using the counter move along the grid in a regular standardized way Record the number of cells in column Cell count of the datasheet 58 Supplementary Information Altermatt
6. 1973 Coexistence in Laboratory Populations of Paramecium Aurelia and Its Predator Didinium Nasutum Ecology 54 1320 1327 Vandermeer J H 1969 The Competitive Structure of Communities An Experimental Approach with Protozoa Ecology 50 362 371 60 Supplementary Information Altermatt et al 2015 Methods in Ecology and Evolution DOI 10 1111 2041 210X 12312 2 3 Image and video analysis Supplementary information for Altermatt et al Methods in Ecology and Evolution DOT 10 1111 2041 210X 12312 Big answers from small worlds a user s guide for protist microcosms as a model system in ecology and evolution Altermatt F Fronhofer EA Garnier A Giometto A Hammes F Klecka J Legrand D Machler E Massie TM Pennekamp F Plebani M Pontarp M Schtickzelle N Thuillier V amp Petchey OL 2 3 Image and video analysis Introduction Digital image and video analysis has successfully been used to reduce the amount of time spent by researchers at the microscope performing manual counts and enables to quantify a variety of traits simultaneously Pennekamp amp Schtickzelle 2013 Dell et al 2014 The fast collection and processing of a large amount of data especially enables the use of microcosm experiments in a trait based community ecology approach McGill et al 2006 Fig S1 gives a general overview of the process of sampling processing and analysing protist experiments using image and video analyses Examples of su
7. Addicott J F 1974 Predation and prey community structure an experimental study of the effect of mosquito larvae on the protozoan communities of pitcher plants Ecology 55 475 492 Adl S M Simpson A G B Lane C E Luke J Bass D Bowser S S et al 2012 The revised classification of eukaryotes Journal of Eukaryotic Microbi ology 59 429 514 Altermatt F amp Holyoak M 2012 Spatial clustering of habitat structure effects patterns of community composition and diversity Ecology 93 1125 1133 Altermatt F Schreiber S amp Holyoak M 2011b Interactive effects of distur bance and dispersal directionality on species richness and composition in meta communities Ecology 92 859 870 Altermatt F Bieger A Carrara F Rinaldo A amp Holyoak M 201 la Effects of connectivity and recurrent local disturbances on community structure and population density in experimental metacommunities PLoS ONE 6 e19525 Asai D L amp Forney J D 2000 Tetrahymena Thermophila Academic Press San Diego Bell G amp Gonzalez A 2011 Adaptation and evolutionary rescue in metapopu lations experiencing environmental deterioration Science 332 1327 1330 Benton T G Solan M Travis J M J amp Sait S M 2007 Microcosm experi ments can inform global ecological problems Trends in Ecology amp Evolution 22 516 521 Beveridge O S Petchey O L amp Humphries S 2010a Direct and indirect
8. Hattori M amp Ohkuma M 2008 Complete genome of the 94 Supplementary Information Altermatt et al 2015 Methods in Ecology and Evolution DOI 10 1111 2041 210X 12312 2 8 Genomics proteomics and epigenomics uncultured Termite Group 1 bacteria in a single host protist cell Proc Natl Acad Sci U S A 105 5555 5560 Jacobs M E DeSouza L V Samaranayake H Pearlman R E Siu K W amp Klobutcher L A 2006 The Tetrahymena thermophila phagosome proteome Eukaryot Cell 5 1990 2000 Jex A R Koehler A V Ansell B R Baker L Karunajeewa H amp Gasser R B 2013 Getting to the guts of the matter the status and potential of omics research of parasitic protists of the human gastrointestinal system Int J Parasitol 43 971 982 Joyce A R amp Palsson B O 2006 The model organism as a system integrating omics data sets Nat Rev Mol Cell Biol 7 198 210 Kalisky T Blainey P amp Quake S R 2011 Genomic analysis at the single cell level Annu Rev Genet 45 431 445 Kalisky T amp Quake S R 2011 Single cell genomics Nat Methods 8 311 314 Karrer K M amp VanNuland T A 2002 Methylation of adenine in the nuclear DNA of Tetrahymena is internucleosomal and independent of histone H1 Nucleic Acids Res 30 1364 1370 Lasken R S 2012 Genomic sequencing of uncultured microorganisms from single cells Nat Rev Microbiol 10 631 640 Le Bihan T Martin S F Chirnside
9. Thereby experiments are providing a link between theory and more complex natural systems as questions motivated by nat ural ecosystems can be addressed in simplified but highly con trolled and replicated experiments which are often designed and performed in close analogy to mathematical models Fig 3 see also Jessup et al 2004 Benton et al 2007 This has led to the development of a variety of experimental tech niques but with little overlap between disciplines for example the common use of protists in cell biology and molecular biol ogy only minimally been integrated into ecology see Asai amp Forney 2000 In ecology laboratory methods and techniques for example introduced by Gause 1934 have been modified and improved in a manifold but often unstandardized way for an overview of diversity of studies see references in Appendix S1 Section 1 1 and protocols are rarely made available in suffi cient detail to be fully reproducible The lack of a consistent use of generally available protocols hinders the comparison of results between different studies limits meta analyses as well as replication and repetition of experiments Furthermore the lack of standardization and availability of methods and protocols also constrains the use and dissemination of novel methods to their full potential In the recent past technology and methodology advanced rapidly and opened up possibilities to conduct and analyse experiments that have n
10. continuous landscapes of complex structure have been developed Giometto et al 2014 Seymour amp Alt ermatt 2014 2014 The Authors Methods in Ecology and Evolution 2014 British Ecological Society Methods in Ecology and Evolution 6 218 231 3 6 MANIPULATION OF TEMPERATURE Temperature Fig 1 7 is said to be the second most important after body size determinant of biological rates such as respiration photo synthesis mortality resource uptake and predation Brown et al 2004 and one of the key drivers of ecosystem change Understanding the ecological consequences of temperature variation is therefore of high priority Experimental manipulation of microcosm temperature is relatively straightforward by placing them in incubators water baths or other controlled temperature environments CTEs A central tech nical challenge is to provide sufficient numbers of independent CTEs so that pseudoreplication is avoided or can be accounted for statistically for example using a mixed effect model Other important consider ations are as follows what range of temperatures to use whether to include temporally changing temperatures how quickly temperatures should change and that this can be realized in the liquid in the micro cosms and random or blocked positioning of microcosms within CTEs and minimizing the time during which microcosms are removed from the CTEs e g for sampling Protist microcosm studies address ing the
11. ing experiments that have been designed to analyse purely ecological questions which may impact the observed patterns and interpretations see Hiltunen et al 2014 Discussion Ecology and evolutionary biology aim at understanding pat terns and processes resulting from interactions among individ uals organisms and their environment Thereby the greatest challenge is to identify understand and causally link processes between the different levels of organization by which an ecosys tem can be described individuals to ecosystem Fig 1 A comprehensive understanding becomes increasingly important as species abundances species diversity and the stability of nat ural populations communities and ecosystems are threatened due to for example anthropogenic effects In particular knowledge and understanding of responses to environmental changes can help us predicting such responses in future environments However gaining such insights in natural and semi natural systems can be challenging as multiple ecological and evolutionary processes are acting and interacting at differ ent rates and at different spatiotemporal scales Fig 1 Protist microcosm experiments have proven to be a suitable model system for a wide range of questions in ecology and evo lutionary biology Fig 2 Lawler 1998 Petchey et al 2002 Holyoak amp Lawler 2005 for an extensive list of studies and their historic context see also references in Appendix S1 1 1
12. munities for the presence of species and eventual extinctions g microspectroscopy RMS Section 2 6 provides information on the physiology ofa single cell and could inform about physi ological responses to stressors on the level of an individual Video analysis Section 2 3 allows detecting behavioural changes in response to changes of an individual s a biotic envi ronment Thus employing such a set of complimentary meth ods and techniques from various disciplines in concert can improve our knowledge about the complexity of the cascading and interacting causalities schematically illustrated in Fig 1 There are however also particular challenges associated with microcosm based experimental work that require contin uous development in standardized methods and techniques First although a large number of traits from different protists species are known one often cannot assume that the full com plexity of an organism s niche being the fundamental driver of eco evolutionary dynamics is approximated by typical mea sures e g mean size Advancing measurement methods see Section 2 will lead to a more detailed understanding of the species traits and how they link to environmental variables for example Secondly even though the experiments are designed to focus on one or a few processes multiple ecological e g competition and predation evolutionary e g local adap tation and stochastic e g drift processes may be actin
13. 3 3 Disturbance and perturbation manipulations 4 The discarded medium including the protists should be safely disposed to avoid that protists can escape into the natural environment autoclaving the disposed medium or by adding bleach Replace the discarded medium with freshly autoclaved possibly bacterized see section 1 2 1 3 medium Heat disturbance The procedure below is for applying density dependent mortality equally to all species However it is possible to cause this mortality in a particular species the one with the lowest temperature tolerance only This requires careful calibration of a temperature disturbance applied to the whole community so that only this species suffers mortality e g Worsfold Warren amp Petchey 2009 l 2 3 Take the vessel with the protist community to be disturbed Thoroughly mix it shaking or with pipette Remove the proportionate content that should be disturbed Note in case of very high disturbance levels e g 99 it may be easier to remove the content that should be maintained with a pipette temporarily keep it in the pipette tip disturb all of the rest and add it back to the vessel Place a vessel with the proportion of the medium that should be disturbed in a microwave and heat it up to boiling temperature The intensity and duration of microwaving needs to be adjusted to the chosen volume Ideally the medium is just quickly heated up to 80 90 C but does no
14. 7 e30630 Zufall R A Dimon K L amp Doerder F P 2013 Restricted distribution and limited gene flow in the model ciliate Tetrahymena thermophila Molecular Ecology 22 1081 1091 Received 1 October 2014 accepted 12 November 2014 Handling Editor Matthew Spencer Supporting Information Additional Supporting Information may be found in the online version of this article Appendix S1 Maintenance measurement methods and manipulation methods 2014 The Authors Methods in Ecology and Evolution 2014 British Ecological Society Methods in Ecology and Evolution 6 218 231 Supplementary Information Altermatt et al 2015 Methods in Ecology and Evolution DOI 10 1111 2041 210X 12312 Table of contents of supplementary information Supplementary information for Altermatt et al Methods in Ecology and Evolution DOT 10 1111 2041 210X 12312 Big answers from small worlds a user s guide for protist microcosms as a model system in ecology and evolution Altermatt F Fronhofer EA Garnier A Giometto A Hammes F Klecka J Legrand D Machler E Massie TM Pennekamp F Plebani M Pontarp M Schtickzelle N Thuillier V amp Petchey OL Chapter protocol page Table of contents 1 1 Maintenance 1 1 Species used 2 1 2 Culture medium 18 1 3 Bacteria 26 1 4 Apparatus 30 1 5 Laboratory practices 34 1 6 Long term maintenance of stock cultures 39 1 7 Long term preservation 41 2 Measurement methods 2 Sampling 51 2
15. An extensive supplement contains detailed protocols of all methods and these protocols also exist in a community updateable online repository 4 Weenvision that such a synthesis and standardization of methods will overcome shortcomings and challenges faced by past studies and also promote activities such as meta analyses and distributed experiments conducted simultaneously across many different laboratories at a global scale Key words Ciliates comparability ecological theory experimental ecology methods protists protocols protozoa standardization processes However a major challenge is to link theoretical Introduction i i concepts with empirical data from natural study systems In A major contemporary challenge in ecology is to causally link processes and patterns across different levels of complexity Fig 1 This requires a causal understanding of i how traits and behaviour at the level of individuals affect fitness relevant processes of birth death and dispersal ii trait distribution within populations consequences on population dynamics and potential evolutionary changes iii community assembly and structure and iv ecosystem functioning A large body of theoretical work has been developed to conceptualize these Correspondence author E mail Florian Altermatt eawag ch many cases natural study systems do not allow the replication and control needed to validate model assumptions and to test model predictions o
16. Guglielmi G Arnaiz O Gout J F Prajer M et al 2014 Genome defence small RNAs exapted for epigenetic mating type inheritance Nature 509 447 452 Sonneborn T M 1950 Methods in the general biology and genetics of Parame cium aurelia Journal of Experimental Zoology 113 87 147 Srivastava D S Kolasa J Bengtsson J Gonzalez A Lawler S P Miller T E et al 2004 Are natural microcosms useful model systems for ecology Trends in Ecology amp Evolution 19 379 384 Strahl B D Ohba R Cook R G amp Allis C D 1999 Methylation of histone H3 at lysine 4 is highly conserved and correlates with transcriptionally active nuclei in Tetrahymena Proceedings of the National Academy of Sciences USA 96 14967 14972 Swart E C Wilkes C D Sandoval P Y Arambasic M Sperling L amp No wacki M 2014 Genome wide analysis of genetic and epigenetic control of programmed DNA deletion Nucleic Acids Research 42 8970 8983 TerHorst C P 2010 Experimental evolution of protozoan traits in response to interspecific competition Journal of Evolutionary Biology 24 36 46 Turkewitz A P Orias E amp Kapler G 2002 Functional genomics the coming of age for Tetrahymena thermophila Trends in Genetics 18 35 40 Vandermeer J H 1969 The competitive structure of communities an experi mental approach with protozoa Ecology 50 362 371 Vasseur D A amp Fox J W 2009 Phase locking and env
17. Hajibabaei M Shokralla S Zhou X Singer G A C amp Baird D J 2011 Environmental Barcoding A Next Generation Sequencing Approach for Biomonitoring Applications Using River Benthos PLoS ONE 6 617497 Hajibabaei M Singer G A Clare E L amp Hebert P D 2007 Design and applicability of DNA arrays and DNA barcodes in biodiversity monitoring BMC Biol 5 24 Hall B G 2013 Building phylogenetic trees from molecular data with MEGA Mol Biol Evol 30 1229 1235 Kher C P Doerder F P Cooper J Ikonomi P Achilles Day U Kupper F C amp Lynn D H 2011 Barcoding Tetrahymena discriminating species and identifying unknowns using the cytochrome c oxidase subunit I cox 1 barcode Protist 162 2 13 Krenek S Petzoldt T amp Berendonk T U 2012 Coping with temperature at the warm edge patterns of thermal adaptation in the microbial eukaryote Paramecium caudatum PLoS ONE 7 e30598 Medinger R Nolte V Pandey R V Jost S Ottenwalder B Schlotterer C amp Boenigk J 2010 Diversity in a hidden world potential and limitation of next generation sequencing for surveys of molecular diversity of eukaryotic microorganisms Mol Ecol 19 Suppl 1 32 40 Moniz M B amp Kaczmarska I 2010 Barcoding of diatoms nuclear encoded ITS revisited Protist 161 7 34 Moradian M M Beglaryan D Skozylas J M amp Kerikorian V 2007 Complete Mitochondrial Genome Sequence of Three lt it
18. Massie TM Pennekamp F Plebani M Pontarp M Schtickzelle N Thuillier V amp Petchey OL 2 4 Particle counter Introduction We describe how to measure protist body size with the particle counter CASY Model TT Cell Counter and Analyzer Roche in the following simply CASY We will use cell size as a synonymous of body size even though the method can also be used to measure body size of multicellular organisms e g rotifer species The CASY measures the volume of individuals via the Electrical Current Exclusion principle please refer to the CASY user manual for in depth description The CASY allows measuring the body size distribution of ensembles of individuals and was found to resolve protists with typical linear size between 2 um and 60 um according to specifications the measurement range is 0 7 um to 160 um both in isolation Giometto et al 2013 and assembled in multi species communities M chler amp Altermatt 2012 The typical measurement time is less than 60 s and requires the sampling of a volume between 100 uL and 4 mL depending on cell density and size If two or more species are present in the same sample their body size distributions can only be discerned if they are non overlapping The CASY can process high cells densities and allows direct measurement of the cell volume with high resolution 512 000 measuring channels The instrument requires sampling of a typical volume between 100 uL and 4 mL thus if a
19. P rez Escudero et al 2014 are also difficult due to low morphological differentiation and limitation to low numbers of individuals in controlled settings However fluorescence marking and quantum dots Daims amp Wagner 2007 Lard et al 2010 are two ways of visually separating two morphologically and behaviourally identical populations or to improve the tracking abilities under difficult settings Procedure The major procedure of this protocol is setting up the image video acquisition system including the illumination and sampling chamber and the automation of the image video processing rather than the videoing itself to which the same requirements apply as to the sampling and general microscopy see section 2 2 Other information about procedures is available in the following references References Amaral A L Motta M d Pons M N Vivier H Roche N Mota M amp Ferreira E C 2004 Survey of Protozoa and Metazoa populations in wastewater treatment plants by image analysis and discriminant analysis Environmetrics 15 381 390 Branson K Robie A A Bender J Perona P amp Dickinson M H 2009 High throughput ethomics in large groups of Drosophila Nature Methods 6 451 457 Chaine A S Schtickzelle N Polard T Huet M amp Clobert J 2010 Kin based recognition and social aggregation in a ciliate Evolution 64 1290 1300 Daims H amp Wagner M 2007 Quantification of uncultured microorga
20. abundances but are directly changed in order to study the consequences of specific aspects of the biotic environment on ecological dynamics e g productivity stability of the system All of these manipulations are directly derived from the ecological question of interest and standardization is thus not directly possible or wanted such that protocols cannot be given However we list below possible manipulations of the biotic environment and give a selection of representative references therefore Manipulation of diversity and identity of species used Lawler amp Morin 1993 McGrady Steed Harris amp Morin 1997 McGrady Steed amp Morin 2000 Morin amp McGrady Steed 2004 Jiang amp Morin 2005 Violle et al 2011 Giometto et al 2013 Carrara et al 2014 Seymour amp Altermatt 2014 Manipulation of the trophic structure of communities e g Lawler amp Morin 1993 Fox McGrady Steed amp Petchey 2000 Fox 2007 Petchey et al 2008 Worsfold Warren amp Petchey 2009 Manipulation of the community assembly history e g Fukami amp Morin 2003 Violle et al 2011 Violle et al 2012 Clements et al 2013 Livingston et al 2013 Manipulation of invasion dynamics e g Machler amp Altermatt 2012 Manipulation of the presence of parasites e g Fellous et al 2012a Fellous et al 2012b References Carrara F Giometto A Seymour M Rinaldo A amp Altermatt F 2014 Inferring species interactions
21. amp Fukami T 2005 Dispersal spatial scale and species diversity in a hierarchically structured experimental landscape Ecology Letters 8 548 557 Cadotte M W Mai D V Jantz S Collins M D Keele M amp Drake J A 2006 On Testing the Competition Colonization Trade Off in a Multispecies Assemblage The American Naturalist 168 704 709 Carrara F Altermatt F Rodriguez Iturbe I amp Rinaldo A 2012 Dendritic connectivity controls biodiversity patterns in experimental metacommunities Proceedings of the National Academy of Sciences 109 5761 5766 Carrara F Rinaldo A Giometto A amp Altermatt F 2014 Complex interaction of dendritic connectivity and hierarchical patch size on biodiversity in river like landscapes American Naturalist 183 13 25 Fellous S Duncan A Coulon A l amp Kaltz O 2012 Quorum Sensing and Density Dependent Dispersal in an Aquatic Model System PLoS ONE 7 e48436 Fjerdingstad E Schtickzelle N Manhes P Gutierrez A amp Clobert J 2007 Evolution of dispersal and life history strategies Tetrahymena ciliates BMC Evolutionary Biology 7 133 124 Supplementary Information Altermatt et al 2015 Methods in Ecology and Evolution DOI 10 1111 2041 210X 12312 3 5 Spatial structure Fronhofer E A amp Altermatt F 2014 Eco evolutionary dynamics during experimental range expansions Nature Communications in review Gause G F 1934 The St
22. hydroxymethylation mark DNA for elimination in Oxytricha trifallax Genome Biol 13 R99 Chen J Gao X Wang B Chen F Wu N amp Zhang Y 2014 Proteomic approach to reveal the proteins associated with encystment of the ciliate Euplotes encysticus PLoS ONE 9 e97362 Croken M M Nardelli S C amp Kim K 2012 Chromatin modifications epigenetics and how protozoan parasites regulate their lives Trends Parasitol 28 202 213 Dawson S C amp Fritz Laylin L K 2009 Sequencing free living protists the case for metagenomics Environ Microbiol 11 1627 1631 Debroas D Humbert J F Enault F Bronner G Faubladier M amp Cornillot E 2009 Metagenomic approach studying the taxonomic and functional diversity of the bacterial community in a mesotrophic lake Lac du Bourget France Environ Microbiol 11 2412 2424 Dowd W W 2012 Challenges for biological interpretation of environmental proteomics data in non model organisms ntegr Comp Biol 52 705 720 Editorial 2014 Challenges and prospects of proteomics of non model organisms Journal of Proteomics 105 1 4 Flores K B Wolschin F amp Amdam G V 2013 The role of methylation of DNA in environmental adaptation Integr Comp Biol 53 359 372 Ge H Walhout A J amp Vidal M 2003 Integrating omic information a bridge between genomics and systems biology Trends Genet 19 551 560 Ghai R Hernandez C M Picazo A Mizuno
23. individual to ecosystem Fig 1 Table 1 Measurements can be made in a local non spatial or in a spatial context for examples of the latter see figures given in the Appendix S1 Section 3 5 Furthermore they can be made in a sce nario that focuses on ecological dynamics only or on eco evolution ary dynamics Some variables can be measured by eye and some by machine Although measurements by machines have advantages we strongly recommend that researchers spend considerable time directly observing the organisms they work with in order to detect unexpected aberrations e g contaminations Almost all the measurements discussed below are described at a per sample level While some methods can be automated and conducted by laboratory robots which allows the processing of much larger numbers of samples replicates we do not cover such automation in detail 2 1 SAMPLING Observing properties of microbial microcosms such as individual traits Fig 1 i and population community dynamics Fig 1 iv often cannot be carried out in situ and usually cannot be performed for the entire microcosm or every individual therein Hence observation virtu ally always involves observing properties of a sample of the microcosm and removing this sample from the microcosm though see below for exceptions How much volume to sample depends on what is being observed and on population density in the microcosm Generally when estimat ing populatio
24. ompantan wth dotobovw t ii de novo astemalage Figure S1 General framework of omics methods applied to protist microcosms The testing of ecological or evolutionary questions involves numerous steps requiring experimental work molecular biology competences and most often bioinformatic treatments 90 Supplementary Information Altermatt et al 2015 Methods in Ecology and Evolution DOI 10 1111 2041 210X 12312 2 8 Genomics proteomics and epigenomics Example of relevant omics methods to study protist microcosms The study of global contents of environmental samples allows the characterization of free living protists like other unicellular organisms Surprisingly however this has not yet let to many eco evolutionary omics studies specifically designed for protist micrososms and taxa therein but we see a high potential for different uses A notable exception concerns the study of the genome structure and regulation in ciliates mostly Tetrahymena thermophila Paramecium species and Oxytricha trifallax The following examples therefore refer to potential applications of omics methods in protist microcosm studies for which detailed protocols can be adapted from papers studying other microbial groups or from papers studying the genome development and cellular physiology in ciliates Metagenomics A metagenomic study refers to the analysis of the genomic DNA from a whole environmental sample This method can eas
25. treatments within controlled temperature environments choice of appropriate temperature levels and regimes Previous studies include effects of temperature on individual metabolic rate Fenchel amp Finlay 1983 movement speed e g Beveridge Petchey amp Humphries 2010 cell size Atkinson Ciotti amp Montagnes 2003 and competition Nelson amp Kellermann 1965 These individual level effects cause altered population and community dynamics e g Petchey 2000 Leary amp Petchey 2009 Fussmann et al 2014 via changes in interaction strengths Jiang amp Kulczycki 2004 Temperature dependent changes in community dynamics can affect ecosystem processes such as net primary production Petchey er al 1999 Materials Equipment Multiple ideally identical controlled temperature environments CTE such as incubators or water baths Reagents None Procedure 1 Design experiment including exactly where in each CTE each microcosm will be placed 2 Thoroughly test the temperature control of the CTEs across the range of planned experimental temperatures Include testing for spatial variation of temperature within CTEs 126 Supplementary Information Altermatt et al 2015 Methods in Ecology and Evolution DOI 10 1111 2041 210X 12312 3 6 Temperature manipulation 3 Ideally test for difference in ecological dynamics e g single species dynamics across CTEs that are set at the same temperature to test for CTE effe
26. with automatic LN2 level monitoring systems that trigger refilling from the external source when needed often user adjustable Except in the rare cases where a pressurized LN2 circuit is available this external LN2 source is a pressurized tank which must itself be refilled either from a larger tank or directly from a truck Local constrains about the regular delivery of LN2 must be taken into account with prime importance when choosing the cryopreservation system to ensure sufficient autonomy even in adverse conditions A LN2 cryoconservator can often survive absence of electricity power for a prolonged time even up to a month but in case of shortage of LN2 there is no way to maintain the integrity of cryosamples Cryoboxes and sterile plastic cryotubes Cryotubes in the 1 2 to 2 mL volume range e g Thermo Scientific Nalgene 75000 0020 or Nunc 7340711 have been proven adequate for protist culture freezing tubes with external thread limit the risk of contamination from handling compared to internally threaded cryotubes A large variety of cryotubes and cryoboxes exist specific features of some brands and models are worth mentioning A small cryotube size allows using cryoboxes holding 100 10 10 or even 169 13 13 tubes boosting the overall capacity of a cryoconservator compared to the classical 81 9 9 cryoboxes with limited extra cost Also cryotubes and cryoboxes with integrated barcode can be useful for easier referencing see
27. 2 Estimating abundances by eye manual microscopy 54 2 3 Image and video analysis 61 2 4 Particle counter 68 2 5 Measuring bacteria density flow cytometry 73 2 6 RAMAN microspectroscopy 78 2 7 DNA sequencing and barcoding 81 2 8 Genomics proteomics and epigenomics 88 2 9 Respirometer 97 2 10 Nutrient dynamics and litter bags 102 2 12 Interaction strengths 104 3 Manipulation methods 3 2 Manipulation of density 108 3 3 Disturbances and perturbation manipulations 111 3 4 Manipulation of nutrient concentration and viscosity 115 3 5 Manipulation of the spatial structure of the landscape 119 3 6 Manipulation of temperature 125 3 7 Manipulation of the biotic environment 127 Supplementary Information Altermatt et al 2015 Methods in Ecology and Evolution DOI 10 1111 2041 210X 12312 1 1 Species used Supplementary information for Altermatt et al Methods in Ecology and Evolution DOI 10 1111 2041 210X 12312 Big answers from small worlds a user s guide for protist microcosms as a model system in ecology and evolution Altermatt F Fronhofer EA Garnier A Giometto A Hammes F Klecka J Legrand D Machler E Massie TM Pennekamp F Plebani M Pontarp M Schtickzelle N Thuillier V amp Petchey OL 1 1 Species used Introduction Species generally used for protist microcosm experiments cover several major domains of life and a large part of eukaryotic phylogenetic diversity Adl et al 2005 Adl et al 2012 Generally and als
28. Buffer pH 8 and vortex them for few seconds until all is homogenized Then add 10 pL proteinase k mg l Inverse the tube 2 3 times Incubate at 37 C for 20 min then vortex for few seconds Inactivate the enzyme by incubation for 20 min at 65 C Add 10mg mL RNAse A mix gently and incubate for 30 min at 37 C Vortex for few seconds Separation with 750 ul of chloroform isoamid 24 1 Then homogenise and centrifuge at 12 000 rcf for 10min at room temperature Collect the upper phase aqueous phase Separation with 750 uL chloroform isoamid 24 1 and repeat the same process Precipitation with 1 mL ethanol 100 20 C at room temperature Mix carefully and incubate for 15 mins Centrifugation at 10000 rpm for 30mins and return the tube to eliminate the ethanol 84 Supplementary Information Altermatt et al 2015 Methods in Ecology and Evolution DOI 10 1111 2041 210X 12312 2 7 DNA sequencing and barcoding 11 Washing with 1 mL ethanol 70 and centrifuge for 5 min at 8000 rpm Remove the ethanol with a pipette Dry only if it rests some ethanol for few minutes 12 Dissolution in 20 uL of water Choice of Barcode and PCR amplification Chantangsi et al 2007 for COX 1 1 Initial denaturation step of 94 C for 4 min 2 Followed by 5 cycles consisting of each cycle 30 s at 94 C 1 min at 45 C 105 s at 72 C 3 Followed by 35 cycles consisting of each cycle 30 s at 94 C 1 min at 55 C s a
29. Bulimina marginata Campylomonas reflexa Cassidulina leavigata Chilomonas paramecium Chilomonas spp Chlamydomonas microsphaera Chlamydomonas moewusii Chlamydomonas noctigama Chlamydomonas reinhadrtii Chlamydomonas terricola Chlorella autotrophica Chlorella pyrenoidosa Chlorella vulgaris Chlorogonium euchlorum Chlorokybus atmophyticus Chloromonas clathrata Chroomonas pochmanii Chrysopsis sp Cibicidoides flordanus Closterium acerosum Closterium libellula Colacium vesiculosum Coleps hirtus Collodictyon triciliatum Colpidium campylum Colpidium cf striatum Colpidium colpidium Colpidium colpoda Colpidium kleini Colpidium striatum Colpoda cucullus Colpoda inflata Condylostoma sp Cosmarium sportella Cryptomonas curvata Cryptomonas erosa SAR Excavata Excavata Archaeplastida SAR Cryptophyta SAR Cryptophyta Cryptophyta Archaeplastida Archaeplastida Archaeplastida Archaeplastida Archaeplastida Archaeplastida Archaeplastida Archaeplastida Archaeplastida Archaeplastida Archaeplastida Cryptophyta Archaeplastida SAR Archaeplastida Archaeplastida Excavata SAR Collodictyonid ae SAR SAR SAR SAR SAR SAR SAR SAR SAR Archaeplastida Cryptophyta Cryptophyta Alveolata Discoba Discoba Rhodophyceae Foraminifera Cryptophyta Foraminifera Cryptophyta Cryptophyta Chloroplastida Chloroplastida Chloroplastida Chloroplastida Chlor
30. C M Ininbergs K Diez B Valas R DuPont C L McMahon K D Camacho A amp Rodriguez Valera F 2012 Metagenomes of Mediterranean coastal lagoons Sci Rep 2 490 Gilbert J A amp Dupont C L 2011 Microbial metagenomics beyond the genome Ann Rev Mar Sci 3 347 371 Gomez Diaz E Jorda M Peinado M A amp Rivero A 2012 Epigenetics of host pathogen interactions the road ahead and the road behind PLoS Pathog 8 e1003007 Gotelli N J Ellison A M amp Ballif B A 2012 Environmental proteomics biodiversity statistics and food web structure Trends Ecol Evol 27 436 442 Gould S B Kraft L G van Dooren G G Goodman C D Ford K L Cassin A M Bacic A McFadden G I amp Waller R F 2010 Ciliate pellicular proteome identifies novel protein families with characteristic repeat motifs that are common to alveolates Mol Biol Evol 28 1319 1331 Grant J R Lahr D J G Rey F E Burleigh J G Gordon J I Knight R Molestina R E amp Katz L A 2013 Gene discovery from a pilot study of the transcriptomes from three diverse microbial eukaryotes Corallomyxa tenera Chilodonella uncinata and Subulatomonas tetraspora Protis Genomics 2 3 18 Hodgins Davis A amp Townsend J P 2009 Evolving gene expression from G to E to G X E Trends in Ecology amp Evolution 24 649 658 Hongoh Y Sharma V K Prakash T Noda S Taylor T D Kudo T Sakaki Y Toyoda A
31. E S van Ooijen G Barrios Llerena M E O Neill J S Shliaha P V Kerr L E amp Millar A J 2011 Shotgun proteomic analysis of the unicellular alga Ostreococcus tauri J Proteomics 74 2060 2070 Mardis E R 2008 Next generation DNA sequencing methods Annu Rev Genomics Hum Genet 9 387 402 Mason O U Hazen T C Borglin S Chain P S Dubinsky E A Fortney J L Han J Holman H Y Hultman J Lamendella R Mackelprang R Malfatti S Tom L M Tringe S G Woyke T Zhou J Rubin E M amp Jansson J K 2012 Metagenome metatranscriptome and single cell sequencing reveal microbial response to Deepwater Horizon oil spill SME J 6 1715 1727 Murray S A Patterson D J amp Thessen A E 2012 Transcriptomics and microbial eukaryote diversity a way forward Trends in Ecology amp Evolution 27 651 652 Nowacki M amp Landweber L F 2009 Epigenetic inheritance in ciliates Curr Opin Microbiol 12 638 643 Oehring S C Woodcroft B J Moes S Wetzel J Dietz O Pulfer A Dekiwadia C Maeser P Flueck C Witmer K Brancucci N M Niederwieser I Jenoe P Ralph S A amp Voss T S 2012 Organellar proteomics reveals hundreds of novel nuclear proteins in the malaria parasite Plasmodium falciparum Genome Biol 13 R108 Pavey S Sutherland B Leong J Robb A von Schalburg K Hamon T Koop B amp Nielsen J 2011 Ecological transcriptomics of
32. Mueller et al 2012 Nakajima et al 2009 Giometto et al 2013 Livingston et al 2013 Livingston et al 2013 Livingston et al 2013 Krumins et al 2006 Gross 2000 Livingston et al 2013 Robinson amp Edgemon 1988 genus Li amp Stevens 2010 Oikos Li amp Stevens 2010 CommEcol Livingston et al 2013 Cadotte et al 2006 genus Have 1993 Cadotte et al 2006 genus Fukami 2004 genus Mata et al 2013 genus Petchey 2000 Have 1990 Luckinbill amp Fenton 1978 Ostman et al 2006 Balciunas amp Lawler 1995 Holyoak amp Lawler 1996 Ecology Scholes et al 2005 Have 1993 Jiang amp Patel 1993 Livingston et al 2013 Violle et al 2010 Cadotte amp Fukami 2005 Fox amp Barreto 2006 Jiang amp Morin 2005 Leary amp Petchy 2009 Warren amp Weatherby 2006 Bretthauer 1980 Fukami 2004 Jiang amp Morin 2005 Krumins et al 2006 Cadotte amp Fukami 2005 Krumins et al 2006 Steiner 2005 Warren 1996 Oikos Li amp Stevens 2010 Oikos Li amp Stevens 2012 Robinson amp Edgemon 1988 genus Giometto et al 2013 Filip et al 2012 genus Livingston et al 2013 Supplementary Information Altermatt et al 2015 Methods in Ecology and Evolution DOI 10 1111 2041 210X 12312 1 1 Species used Cryptomonas ovata Crytolophosis sp Cyclidium glaucoma Cyclotella sp Dexiostoma campylum Dictyosphaerium planctonicum Didinium nasutum Dileptus anser Dileptus monilatus Dinobryon cylin
33. Productivity biodiversity relationships depend on the history of community assembly Nature 424 423 426 Giometto A Altermatt F Carrara F Maritan A amp Rinaldo A 2013 Scaling body size fluctuations Proceedings of the National Academy of Sciences 110 4646 4650 Jiang L amp Morin P J 2005 Predator Diet Breadth Influences the Relative Importance of Bottom Up and Top Down Control of Prey Biomass and Diversity The American Naturalist 165 350 363 Lawler S P amp Morin P J 1993 Food web architecture and populatio dynamics in laboratory microcosms of protists American Naturalist 141 675 686 Livingston G Jiang Y Fox J W amp Leibold M A 2013 The dynamics of community assembly under sudden mixing in experimental microcosms Ecology 94 2898 2906 Miachler E amp Altermatt F 2012 Interaction of Species Traits and Environmental Disturbance Predicts Invasion Success of Aquatic Microorganisms PLoS ONE 7 e45400 McGrady Steed J Harris P M amp Morin P J 1997 Biodiversity regulates ecosystem predictability Nature 390 162 165 McGrady Steed J amp Morin P J 2000 Biodiversity density compensation and the dynamics of populations and functional groups Ecology 81 361 373 Morin P J amp McGrady Steed J 2004 Biodiversity and ecosystem functioning in aquatic microbial systems a new analysis of temporal variation and species richness predictability relations Oikos 1
34. S P 2005 The contribution of laboratory experiments on protists to understanding population and metapopulation dynamics Advances in Ecological Research 37 245 271 Huang W E Stoecker K Griffiths R Newbold L Daims H Whiteley A S amp Wagner M 2007 Raman FISH combining stable isotope Raman spectroscopy and fluorescence in situ hybridization for the single cell analysis of identity and function Environmental Microbiology 9 1878 1889 Huang W E Li M Jarvis R M Goodacre R amp Banwart S A 2010 Shining Light on the microbial world the application of Raman microspectroscopy Advances in Applied Microbiology 70 153 186 Jessup C M Kassen R Forde S E Kerr B Buckling A Rainey P B amp Bo hannan B J M 2004 Big questions small worlds microbial model systems in ecology Trends in Ecology amp Evolution 19 189 197 Jiang L amp Morin P J 2005 Predator diet breadth influences the relative impor tance of bottom up and top down control of prey biomass and diversity American Naturalist 165 350 363 Jiang L amp Patel S N 2008 Community assembly in the presence of distur bance a microcosm experiment Ecology 89 1931 1940 Jin H J Zhang Y M amp Yang R 1991 Toxicity and distribution of copper in an aquatic microcosm under different alkalinity and hardness Chemosphere 22 577 596 Kawecki T J Lenski R E Ebert D Hollis B Olivieri I amp Whitl
35. SSU of rDNA or in the nuclear genome e g ITS1 2 SSU and LSU of rDNA Approaches The procedure for DNA sequencing and barcoding consists of three steps DNA extraction gene barcode choice and amplification by PCR and sequencing methods 81 Supplementary Information Altermatt et al 2015 Methods in Ecology and Evolution DOI 10 1111 2041 210X 12312 2 7 DNA sequencing and barcoding First DNA should be extracted from the cell Different procedures have been developed to isolate the whole DNA Chelex solution Walsh Metzger amp Higuchi 1991 various DNA isolation kits e g Epicentre or modified phenol chloroform extraction Couvillion amp Collins 2012 The extraction of whole DNA is sufficient for known barcodes or single copy gene sequencing However many protist species are polyploid 245 in Tetrahymena thermophila and some events of duplication of particular genes well known Furthermore ribosomal genes have been duplicated from the mitochondrial genome to the nuclear genome In that particular case all copies will be amplified without distinction Since these two genomes do not evolve at the same speed a mixture of amplified sequences will increase the noise on the chromatogram This will complicate the readability of the resulting sequence and can lead to false interpretations When one wants to create new barcodes and ensure their specificity the mitochondrial genome should be separated from the nuclear genome as
36. Supplementary Information Altermatt et al 2015 Methods in Ecology and Evolution DOI 10 1111 2041 210X 12312 1 5 Laboratory practices For microcosm set up Adequate volume of sterile protist medium see section 1 2 Bacterial culture s agar slant or plate Loop for getting bacterial sample off agar Flame for sterilizing Adequate number of autoclaved microcosms vessels and a few spare e g jars tubes flasks 150 ml measuring cylinder Pipettes with teat or Gilson type pipette with tips Protist cultures checked for the presence of unwanted organisms e g microflagellates and at appropriate density Fine permanent marker Medium permanent marker Stickers Sterile wheat seeds Reagents 70 Ethanol Procedure General laboratory care 1 Provide initial training to personnel 2 Display checklists regarding general laboratory etiquette as well as instructions on how to use common instruments 3 Keep up to date journals regarding when and by whom instruments are used Rules of etiquette for the daily routine l 2 3 4 Do not allow food or beverages in the laboratory Keep the laboratory doors closed Wash hands when accessing the laboratory Wear disposable gloves and sterilize them with ethanol 70 when working in sterile axenic conditions Clean the sterile bench with ethanol 70 before and after use leave nothing in it aside from dedicated items Wash hands when leaving the laboratory
37. Tetrahymena Int J Syst Evol Microbiol 57 2412 2425 Chen B Zhong D amp Monteiro A 2006 Comparative genomics and evolution of the HSP90 family of genes across all kingdoms of organisms BMC Genomics 7 156 ANS Supplementary Information Altermatt et al 2015 Methods in Ecology and Evolution DOI 10 1111 2041 210X 12312 2 7 DNA sequencing and barcoding Couvillion M T amp Collins K 2012 Chapter 12 Biochemical Approaches Including the Design and Use of Strains Expressing Epitope Tagged Proteins Methods in Cell Biology ed C Kathleen pp 347 355 Academic Press Diggles B K amp Adlard R D 1997 Intraspecific variation in Cryptocaryon irritans J Eukaryot Microbiol 44 25 32 Foissner W Chao A amp Katz L A 2007 Diversity and geographic distribution of ciliates Protista Ciliophora Biodiversity and Conservation 17 345 363 Gentekaki E amp Lynn D H 2009 High level genetic diversity but no population structure inferred from nuclear and mitochondrial markers of the peritrichous ciliate Carchesium polypinum in the Grand River basin North America Appl Environ Microbiol 75 3187 3195 Gray M W Lang B F Cedergren R Golding G B Lemieux C Sankoff D Turmel M Brossard N Delage E Littlejohn T G Plante I Rioux P Saint Louis D Zhu Y amp Burger G 1998 Genome structure and gene content in protist mitochondrial DNAs Nucleic Acids Research 26 865 878
38. a necessary precaution The separation between nuclear and mitochondrial materials could be achieved by migration on agarose gel 0 496 at 50V for 6h with total DNA isolated by modified chloroform extraction V Thuillier et al unpub results Depending on the organism being studied the upper and brighter band in the agarose gel corresponds to the nuclear DNA and the mitochondrial DNA appears around 40kb The band of interest could be excised and purified by a kit e g wizard SV kit In ciliates two nuclei are found the macronucleus participates in the somatic division and the micronucleus which is responsible for the germinal line Both genomes are particularly similar given that the micronucleus genes are copied several times to form the macronucleus Prescott 1994 Therefore in order to analyse nuclear genes the two nuclei should be separated by gradient separations such as Percoll gradients Allen 1999 Asai amp Forney 2000 Second the choice of the gene of interest or barcode should be carefully made depending on the taxonomic level and species one works on Knowing that the mitochondrial genome evolves faster the accumulation of sequence variability between organisms would be higher enabling to discriminate the intraspecific relationships or recent phylogenetic node Many barcodes have be developed Nassonova et al 2010 Pawlowski et al 2012 either on the mitochondrial genome e g Cox 1 cytochrome oxydase 1 in Tetrahymena i
39. a sheet but can only be moved when all connectors are closed 3 Holes for fixing the tubing or connectors need to be at same height in all vials as some species stratify in the vial and thus this can affect dispersal 4 Fill the vials with medium all connectors open such that the medium can flow across the whole system and fill it Filling through one opening vial prevents formation of air bubbles in the tubing e g happens when filled from two vials simultaneously Air bubbles need to be removed This can be done with a syringe and sterile needles whereby air bubbles are sucked out by inserting the needles into the silicon tubing at the place the air bubble formed 5 Close all connectors before adding the species Therefore remove first the amount of medium that will be replaced by medium containing species Always make sure that sampling adding medium happens when all connectors are closed and make sure that there is a zero net change in medium volume as otherwise flow among patches occurs Active dispersal with continuous landscapes Finally experiments may be done in continuous landscapes which do not differentiate between matrix and patch Active dispersal is continuous through a network of silicone tubes Fig 1D Seymour amp Altermatt 2014 Seymour Fronhofer amp Altermatt 2014 Closing connections can be done using clamps or stopcocks for example 1 Landscapes are built with silicon tubing only whereby horizontally inst
40. absence of external LN2 refilling is usually very short a few days only Whatever its type a fortiori for dry and vapour phase or when external supply of LN2 can be erratic a LN2 cryoconservator should be constantly monitored and alarmed for temperature and LN2 level because any failure in maintaining the minimum level of LN2 in the cryoconservator will lead to irremediable loss of the frozen samples Note that electronic ultra low 135 C freezers exist but their mechanical complexity requires an external LN2 backup in case of failure and their temperature is high compared to LN2 so they are currently rarely used for protist cryopreservation Regular advances in technology might 45 Supplementary Information Altermatt et al 2015 Methods in Ecology and Evolution DOI 10 1111 2041 210X 12312 1 7 Long term preservation lead to changes in the perspectives expressed here in a near future so we advise laboratory planning to acquire a cryopreservation system to enquire about the most recent available equipment and their features before choosing for a specific solution An external source of LN2 for regular refilling of the cryoconservator Depending on the local availability the LN2 refilling could be performed manually by pouring LN2 into the cryoconservator but see safety note above or manually automatically from a pressurized source of LN2 attached to the cryoconservator Many modern cyoconservators can indeed be fitted
41. alleles interfering RNA heat shock proteins or to identify common molecules between communities Gilbert amp Dupont 2011 After the pre experimental step and the resulting microcosm manipulation samples to analyse are taken to the molecular biology laboratory in order to perform the extraction step Depending on the question either media or cells will be kept to perform extractions This can be achieved by centrifugation or by using filters To separate cells of different sizes it can be useful to perform successive filtering using different meshes More sophisticated methods can also be used to precisely determine the number of cells that will be extracted see sections 2 2 2 4 Also some applications may require the isolation of unique cells which can be achieve by micromanipulations or fluorescence activated cell sorting FACS An additional step can consist in the isolation of a particular cell component like the cell membrane micro or macro nucleus in ciliates phagosomes or pellicles There exist numerous techniques and protocols to perform extractions The extraction step will depend upon the biological sample the target molecules and the analytical tools used to obtain the data Although manufactured kits may be more expensive than traditional methods e g chelex trizol phenol chloroform they may be advantageous because some are adapted to cell cultures the quality of extracts is often high and some kits couple the isolati
42. alters habitat 1solation s effect on biodiversity in aquatic microcosms Oikos 114 360 366 Patterson D J 2003 Free living freshwater protozoa A colour guide Manson Publishing Ltd London Pawlowski J Audic S p Adl S Bass D Belbahri L d Berney C d Bowser S S Cepicka I Decelle J Dunthorn M Fiore Donno A M Gile G H Holzmann M Jahn R Jirku M Keeling P J Kostka M Kudryavtsev A Lara E Luke J Mann D G Mitchell E A D Nitsche F Romeralo M Saunders G W Simpson A G B Smirnov A V Spouge J L Stern R F Stoeck T Zimmermann J Schindel D amp de Vargas C 2012 CBOL Protist Working Group Barcoding Eukaryotic Richness beyond the Animal Plant and Fungal Kingdoms PLoS Biol 10 e1001419 Pennekamp F Mitchell K A Chaine A amp Schtickzelle N 2014 Dispersal propensity in Tetrahymena thermophila ciliates a reaction norm perspective Evolution 68 2319 2330 Pennekamp F amp Schtickzelle N 2013 Implementing image analysis in laboratory based experimental systems for ecology and evolution a hands on guide Methods in Ecology and Evolution 4 483 492 Petchey O L 2000 Prey diversity prey composition and predator population dynamics in experimental microcosms Journal of Animal Ecology 69 874 882 Petchey O L Brose U amp Rall B r C 2010 Predicting the effects of temperature on food web connectance Philosophical Tran
43. an online repository that is easily accessible and updateable Providing such an online repository allows continuous editing as well as fast and simple exchange of information This should facilitate comparability repeat ability and meta analyses of future protist microcosm experi ments Standardization of methods can also facilitate large scale distributed experiments that would not be possible to conduct in a single laboratory Such experiments are impor tant since they inform about the reproducibility of experi ments and hence the generality of their results Furthermore standardization will propagate the application of useful meth ods and hopefully ignite interdisciplinary research addressing questions that may be difficult to be answered by one discipline alone For instance a comprehensive understanding of the genetics Section 2 7 of specific model organisms such as Tetrahymena thermophila could link the molecular bases of adaptive processes in eco evolutionary feedback loops Raman tal theoretical concepts Protist microcosm systems allow to individually address these questions in simplified but highly replicated experiments often in close analogy to mathe matical models For example one can study the effects of resource availability on move ment behaviour e movement paths of Tetra hymena manipulate the connectivity of local communities by connecting patches with corri dors made of tubing f or screen whole com
44. and Material sections but which are crucial for the successful and standardized execution of experiments 1 General maintenance methods 1 1 SPECIES USED The choice of study species lineages used in microcosm experiments is crucial as it determines traits behaviours and physiology Fig 1 i as well as the resulting ecological interactions Fig 1 ii and potential evolutionary dynamics Fig 9 When making this choice one therefore has to take into account the specific topics e g Do species cover different trophic levels or not as well as the variables of primary interest e g diversity species interactions Species used for protist microcosm experiments cover several major domains of life and a large part of eukaryotic phylogenetic diversity Adl et al 2012 In the fol lowing we use the term protist to cover free living unicellular eukary otes that are not purely autotrophic sometimes interchangeably used with the term protozoa This includes species within the Cryptophyta Foraminifera Alveolata Chloroplastida Discoba and Amoebozoa Adl et al 2012 Very typical and commonly used repre A user s guide for protist microcosms 221 sentatives are species of the genera Paramecium Tetrahymena or Colpi dium all Alveolates used in gt 80 studies for an extensive list of species used and an overview of representative protist microcosm studies see Appendix S1 Section 1 1 The advantage of using a com
45. associated data Similarly enforcing every cryotube when thawed is recorded as such in the database ensures the current content of the cryoconservator is correctly reflected allowing for easy sample search and inventory in silico Recording freezing success yes or no for each cryotube once it is known whether a culture has successfully developed after thawing also allows to accumulate some knowledge that may be helpful to troubleshoot reasons for freezing failure Reagents Standard growing culture medium with possible addition of suitable antibiotics to prevent contamination whose impact can be bigger on fragile cultures freshly thawed Starvation medium 10 mM Tris pH 7 5 adjusted by adding HCl sterilized in the autoclave DMSO Dimethyl Sulfoxide ACS reagent grade e g Fisher D1281 or Sigma Aldrich 472301 DMSO must be sterilized by filtration using a 0 2 micron syringe filter which has been pre washed with alcohol and rinsed with DMSO CAUTION DMSO is readily absorbed through the skin and can penetrate some rubber gloves leading to potential introduction of harmful agents into the body _AT Supplementary Information Altermatt et al 2015 Methods in Ecology and Evolution DOI 10 1111 2041 210X 12312 1 7 Long term preservation Procedure Freezing usually implies a phase of culture under specific conditions to prepare the cells and ensure the highest cell viability the use of specific cryoprotectants and
46. below the stage Their magnification is more limited than in normal compound microscopes usually up to 40x objectives on the other hand they allow the observation of deeper containers such as Sedgewick Rafter cell counters see below under equipment Most modern microscopes have an internal light source for lighting the observed sample and they allow different kinds of lighting Dark field illumination which emphasizes cells over a dark background is the classic method used for counting protists with dissecting microscopes it can be obtained by either using a stage with dark field capability or more recently a separate LED ring Dark field microscopy allows telling species apart even when they are present in the sample at the same time In principle all microscopes can be accessorized with cameras and or video cameras see section 2 3 allowing automated counting or species delimitations However even in this case it is commonly advised to regularly check the cultures by eye as this can give information on the conditions of the cultures otherwise not available S54 Supplementary Information Altermatt et al 2015 Methods in Ecology and Evolution DOI 10 1111 2041 210X 12312 2 2 Estimating abundances by eye Microscopy Fig S1 Two working spaces equipped with high end stereomicroscopes and cameras Microscopes are equipped with dark field illumination Note for working on the microscopes blinds of the windows woul
47. biological role of temperature looked at its effects on individual metabolic rate e g Fenchel amp Finlay 1983 or movement speed e g Beveridge Petchey amp Humphries 2010b on population and commu nity dynamics e g Fussmann et al 2014 an on affecting ecosystem processes such as net primary production Petchey et al 1999 Fig 1 3 7 MANIPULATION OF THE BIOTIC ENVIRONMENT The composition and dynamics of the biotic environment are not only studied as response variables e g number of species abundances but are also often manipulated to study the consequences of the biotic envi ronment on ecological dynamics e g productivity stability of the sys tem Probably the most common manipulation refers to diversity and identity of species used such as comparing dynamics in single species communities vs multiple species communities e g McGrady Steed Harris amp Morin 1997 Further aspects that can be manipulated are the trophic structure of communities e g Lawler amp Morin 1993 assembly history e g Fukami amp Morin 2003 or invasion dynamics e g Machler amp Altermatt 2012 It is not our goal to describe all possible biotic manipulations as they are directly derived from the ecological question of interest and standardization may not be directly possible or wanted In the supplementary protocol we are giving an overview of examples with respect to different biotic manipulations 3 8 EXPERIMENTAL EVOLUTION AND
48. can make the difference between success and failure This can be obtained by defining clear rules about how to operate common equipment where to find and replace materials how to access and handle cultures of protists and bacteria safely in this appendix we outline these rules of etiquette that should be notified to all the personnel with access to the laboratory and be displayed in form of checklists It is recommended to follow general laboratory protocols and safety rules wearing lab coats cleaning benches with Ethanol before and after work etc The following biosafety rules should be followed glassware should be washed at 80 C and protist cultures should only be disposed after killing all protists e g collecting all culture waste and autoclave it or add 2 bleach only thereafter dispose into the waste water system Specific members of the personnel should be explicitly in charge for taking care of recurrent tasks such as maintaining organism stock cultures see section 1 6 preparing commonly used media see section 1 2 and refurnishing the laboratory with chemicals and consumables of common use Materials Equipment For general use Autoclave for sterilizing medium pieces of equipment glass containers pipettes consumables etc and biohazardous waste Sterile bench for dealing with axenic cultures Pipettes Disposable gloves Some paper towels Plastic bags for biohazardous waste 34
49. cooler box at 10 C and avoid strong exposition to sunlight 3 Take a subsample of about 5 mL into a petri dish dilute with 10 mL of the chosen culture medium in order acclimate the species to the new osmotic conditions and to dilute densities of the protists 4 Separately place five 0 5 mL drops of the culture medium in a petri dish 5 Using the stereomicroscope collect from the natural community sample step 3 one individual of the focal species with a glass capillary pipette with as little water as possible 6 Place this isolated individual into the first of the separate drops step 4 7 Take a new sterile pipette and isolate the focal individual from the drop and place it into the next one again transporting it with as little medium as possible 596 of the total drops volume 8 Repeat at least five times such that with each isolation step the individual and potential co occurring other individuals are diluted and washed eventually isolating the focal individual from all other cells 9 From the final drop transport the washed individual into a culture vessel containing up to 10 mL of bacterized medium 10 Label the vessel with the name of the species isolated or morphospecies source of origin site and date 11 Allow the isolated individuals to grow and reproduce 1 to 5 days 12 Check for survival and potential contaminations If the isolated individual survived and replicated and no contaminations are pr
50. datasheet the number of cells observed in column Cell count the volumes of liquid sampled and the time in column Time If there was no dilution enter dashes in columns Volume 2 and Volume 3 do not leave these blank Set the counter back to zero Dispose of the Petri dish or put it in a plastic tub for washing it when the counting session is over Counting protists using a balance l anua R 10 11 Enter onto the datasheet that you are using this method Do not switch between methods Ensure that microcosms are out of the experimental environment for as short a time as possible Get a plastic Petri dish ready to receive a sample put it onto the balance tare the balance put the dish back on the desk Loosen the lid of the microcosm so it can be removed with one hand Get a sterile Pasteur pipette ready in one hand Swirl the microcosm to well mix the contents Remove lid with one hand do not put down the lid withdraw a sample with the pipette that you have in your other hand replace the lid Put the lid back onto the microcosm and move the microcosms to a safe place We are finished with it and do not want to risk knocking it over or putting something back into it Distribute the sample in small drops onto a clean Petri dish Place the dish on the balance and record the weight in the Volume 1 column Look at the drops under the dissecting microscope Adjust illumination and magnific
51. describing dynamics in ecosystems Fig v is the rate at which the organisms consume oxygen and produce carbon dioxide via respiration and the opposite via photosynthesis see also Fig 2 Coupled with light dark bottle experiments Pratt amp Berkson 1959 measuring rate of oxygen use production can inform about community respiration rate and net photosynthetic rate when auto trophs are present Diverse methods are used to derive respiration rate but all are based on the principle What goes in must come out to calculate changes in O or CO concentrations They can be open or closed circuit recom mended for protists often measuring oxygen concentrations using an oxygen cell these have limited life and require frequent calibration Dissolved O concentration can be measured with electrochemical sen sors Pratt amp Berkson 1959 However more recently non invasive in situ measures of O concentrations using oxygen optodes e g Pre Sens have become more popular MicroResp is a microplate based respiration system to measure CO concentration within 4 6 h based on colorimetric detection Campbell amp Chapman 2003 Camp bell Chapman amp Davidson 2003 2014 The Authors Methods in Ecology and Evolution 2014 British Ecological Society Methods in Ecology and Evolution 6 218 231 2 10 NUTRIENT DYNAMICS AND LITTER BAGS Both the uptake of nutrients as well as the decomposition of organic matter is of
52. developed and used by Gause 1934 were employed This variation however is poorly documented and a standardization of methods is largely lacking Furthermore more sophisticated techniques are available nowadays and the range of study questions has broadened Table 1 While the use of protists as model organisms in microbiology and cell biology especially spe cies of the genus Paramecium and Tetrahymena can rely on a wider range of classic e g Sonneborn 1950 Lee amp Soldo 1992 and advanced methodological tools e g Asai amp Forney 2000 Cassidy Hanley 2012 ecological and evo lutionary research using these species is lagging behind This calls for a common methodological toolbox also covering recent technological advances 2014 The Authors Methods in Ecology and Evolution 2014 British Ecological Society Methods in Ecology and Evolution 6 218 231 220 Altermatt et al Table 1 Overview of variables of interest What measured organized along an increasing level of organization from individuals to ecosystems The variables of interest are used in different disciplines in ecology and evolution Each method is described in detail in Sections 2 and 3 Some of the manipulation methods are also referring to general maintenance manipulations which are described in Section 1 Dispersal and evolutionary changes in yellow are overarching processes that can be linked to all other variables Level of Variable of int
53. differences in the whole transcript content of phenotypes that diverge in response to particular environmental conditions Major steps are Isolate the divergent phenotypes Perform total RNA extraction of each phenotype Construct cDNA libraries adapted to the chosen NGS sequencer Sequence libraries Assemble transcriptomes and determine both qualitative and quantitative differences in gene expression between the two phenotypes There exist detailed published protocols e g Pavey et al 2011 Grant et al 2013 as well as review papers e g Hodgins Davis amp Townsend 2009 Murray Patterson amp Thessen 2012 van Straalen amp Roelofs 2012 Proteomics To assess the molecular bases of adaptation evolutionary ecologists commonly use genomic and transcriptomic approaches The proteomic approach is probably underused because it is more fastidious requires very good technical skills and needs expensive measuring equipment However proteomes represent the end result of the adaptive physiological response of organisms to perturbations Therefore questions tackled in the transcriptomic paragraph are particularly interesting in a proteomic approach Another interesting experiment would consist in culturing strains under 92 Supplementary Information Altermatt et al 2015 Methods in Ecology and Evolution DOI 10 1111 2041 210X 12312 2 8 Genomics proteomics and epigenomics stressful conditions and determine the var
54. does not include time needed to prepare the material and reagents Ist day Wednesday 0 5 h Preculture 1 Put 400 uL of stock culture with 5 mL of culture medium in a 50 mL tube 3rd day Friday 0 5 h Culture 2 Transfer each pre culture in a 500 mL Erlenmeyer flask filled with 50 mL of culture medium culture them at 30 C to log phase c 500 000 cells mL according to strain with 150 rpm shaking Temperature and good culture aeration are important to ensure optimal recovery 6th day Monday 1 h Starvation 3 Measure cell density in the culture and adjust if necessary to c 500 000 cells mL Transfer into a 50 mL tube that can be centrifuged 4 Centrifuge 1100 g for 3 min at room temperature and remove the supernatant by aspiration 5 Dissolve the pellet in 10 mL of Tris transfer into a 500 mL Erlenmeyer flask and complete with Tris to reach a final 50 mL volume 6 Culture them for 3 days at 30 C with 150 rpm shaking 9th day Thursday 1 h Freezing 7 Label the appropriate number of cryotubes and enter their details in the inventory system The label on each cryotube should include the exact position where it will go in the cryoconservator 48 Supplementary Information Altermatt et al 2015 Methods in Ecology and Evolution DOI 10 1111 2041 210X 12312 1 7 Long term preservation 8 9 10 11 12 Transfer the content of each Erlenmeyer into a 50 mL tube Centrifuge 1
55. down to the temperature used in the experiment usually around 20 C and bacteria may be added as food source see section 1 3 We describe five different and commonly used media Bristol medium Chalkley s solution Proteose peptone medium Protozoan pellet medium and wheat hay 2 wheat lettuce medium Fig 1 The former two are based on deionized water to which anorganic nutrients are added These two media cannot be used per se for keeping protists but need an additional carbon source However these two media are generally recommended to be used as a replacement of tap or well water in which the concentrations of inorganic nutrients is either not known or not standardized The latter three medium types are common and simple approaches of media in which organic nutrients are added as a carbon source Protists feed either directly on this carbon source or indirectly through feeding on bacteria that grow in the medium The use of bacteria as well as the making of axenic or monoxenic media is described in section 1 3 The viscosity of the medium can be changed e g for behavioural studies by adding methyl cellulose e g Luckinbill 1973 see section 3 4 All media can be prepared by persons with basic laboratory skills including technician and graduate students and can be learnt within a few hours of instructions Precaution needs to be taken during the handling of hot media after autoclaving only people that have been specifically i
56. et al 2015 Methods in Ecology and Evolution DOI 10 1111 2041 210X 12312 2 2 Estimating abundances by eye Microscopy 14 15 16 Dilute the sample if the cells are too many to be counted reliably Therefore add a new sample from the microcosm of volume Volume 1 into a Petri dish or scintillation vial Use the 1000 ul pipette to add a suitable amount of diluent about 5 to 20 times the volume of the sample is usually appropriate and mix well by squirting in and out of the pipette Record the new volume the sum of the volume of the sample and the volume of diluent added in column Volume 2 of the datasheet Now withdraw a subsample of Volume 2 and repeat steps 9 to 13 The newly sub sampled volume is now Volume 3 on the datasheet Write on the datasheet the number of cells observed for each species in the column Cell count the sample volume in column Volume 1 and the dilution volumes in case a dilution was necessary Dispose of the counting chamber if disposable or wash it thoroughly before processing a new sample Clean up after the counting session i Dr a ae Wash the plastic Petri dishes wiping the surface with a sponge and giving them a quick rinse then stacking them to dry Wipe down surfaces Tidy workspace so that others could use it Clean the eyepiece with ethanol 70 after use Cover the microscope after use Ensure adequate supplies are available for next sampling event Timi
57. for protist microcosms as a model system in ecology and evolution Altermatt F Fronhofer EA Garnier A Giometto A Hammes F Klecka J Legrand D Machler E Massie TM Pennekamp F Plebani M Pontarp M Schtickzelle N Thuillier V amp Petchey OL 1 2 Culture medium Introduction All experimental protist microcosm studies keep protists in a freshwater based medium containing nutrients and sometimes bacteria The composition of the medium e g nutrient content pH presence absence of bacteria has far reaching consequences on dynamics performance and evolution of protist populations Comparability across studies in terms of species traits population and community dynamics and general cultivability thus strongly depends on the use of common media types Generally stock cultures are kept in an optimal medium which prevents local extinctions and facilitates the maintenance of species During experiments media composition might be adjusted to mimic specific conditions such as low nutrients shared or partitioned set of resources among species or viscosity to modify movement behaviour of protists Luckinbill 1973 Haddad et al 2008 Altermatt amp Holyoak 2012 and are described in detail under section 3 4 There is a large number of culture media for protists in the wider sense Extensive summaries and manuals for making media are commonly available e g Cassidy Hanley 2012 especially at web pages of culture collections and it is n
58. growth phase is desirable to get a good estimate of growth rate while less frequent sampling may be enough to get estimates on the carrying capacity Note that these protocols deal with sampling alone i e physically withdrawing a sample Other sections e g section 2 2 Microscopy deal with taking measurements from the samples Materials Equipment A sterile pipette or pipette tip and pipette A vessel into which the sample will be placed This might be for storage until a measurement is made or directly into a measurement vessel e g a Sedgewick Rafter counting chamber or a petri dish Reagents Culture media with which to replace sampled volume 5 Supplementary Information Altermatt et al 2015 Methods in Ecology and Evolution DOI 10 1111 2041 210X 12312 2 1 Sampling and counting Procedure 1 If sampling is sensitive to movement of the microcosms do not move the microcosms If sampling is not sensitive to movement of the microcosms or requires it remove microcosms from their experimental environment 2 Swirl the microcosm if the contents needs to be homogenized 3 Prepare the pipette ready for extracting liquid i e put a clean tip on and keep this in one hand it is important to do not put the pipette on the bench at this stage to avoid contaminations 4 Use the other hand to move the microcosms lid aside Nn Remove the required volume of culture and immediately reseat the lid 6 Do not remo
59. in ecological communities a comparison of methods at different levels of complexity Methods in Ecology and Evolution In review Carrara F Giometto A Seymour M Rinaldo A amp Altermatt F 2014 Experimental evidence for strong stabilizing forces at high functional diversity in aquatic microbial communities Ecology DOI 10 1111 1365 2656 12315 Clements C F Warren P H Collen B Blackburn T Worsfold N amp Petchey O 2013 Interactions between assembly order and temperature can alter both 128 Supplementary Information Altermatt et al 2015 Methods in Ecology and Evolution DOI 10 1111 2041 210X 12312 3 7 Manipulation of the biotic environment short and long term community composition Ecology and Evolution 3 5201 5208 Fellous S Duncan A Coulon A l amp Kaltz O 2012a Quorum Sensing and Density Dependent Dispersal in an Aquatic Model System PLoS ONE 7 e48436 Fellous S Duncan A B Quillery E Vale P F amp Kaltz O 2012b Genetic influence on disease spread following arrival of infected carriers Ecology Letters 15 186 192 Fox J W 2007 Testing the mechanisms by which source sink dynamics alter competitive outcomes in a model system American Naturalist 170 396 408 Fox J W McGrady Steed J amp Petchey O L 2000 Testing for local species saturation with nonindependent regional species pools Ecology Letters 3 198 206 Fukami T amp Morin P J 2003
60. in protist microcosm experiments Methods are given in three main sections Fig 2 see also table of content in Appendix S1 i maintenance covering the set up and handling of protist cultures ii measurements which allow the quantification of over 20 different categories of variables of interest Table 1 covering behavioural ecology ecophysiology ecological genetics population ecology macroecology spatial ecology community ecology ecosystem ecology and evolutionary ecology and iii manipulations which are necessary for determining causality among variables Measurement methods are structured from more traditional to newer methods e g Sections 2 1 to 2 5 at the individual level and thereafter follow a pattern of increasing complexity and derivation looking at the individual and physiological level Sections 2 6 to 2 8 all recent methods then at pro cesses Sections 2 9 and 2 10 and finally at two important aspects of measurement commonly applied though not exclusive to protist micro cosms time series and species interactions Sections 2 11 and 2 12 Each method is shortly described and summarized in a section of the main text Additionally we provide standardized protocols in supple mentary material and as a freely accessible online document emeh pro tocols rtfd org that can be contributed to see this webpage on how to contribute Their focus is on describing detailed techniques and aspects often omitted in Method
61. individual species and in two species combinations is usually required to estimate the strength of interspecific competition Interactions between predators and prey can be quantified via functional response experiments and by fitting a suitable dynamical model to time series of predator and prey population sizes While this is relatively complex for many systems protist microcosm are actually a feasible study system to look at predator prey dynamics In order to fit a suitable predator prey model to time series in order to estimate the parameters of the functional response we refer to more specialised literature e g Harrison 1995 Materials Equipment Only standard equipment is required e g that described in sections 1 1 1 2 1 3 1 4 1 5 and perhaps 2 1 2 2 2 3 2 4 Reagents Lugol s solution can be used to preserve samples Procedure Competition This is a simple procedure to estimate the strength of interspecific competition in a pairwise setting For a detailed discussion and methodological guidelines on how to measure and calculate competitive interaction in protist communities see Carrara et al Carrara et al 2014a Carrara et al 2014b These methods depend on measuring growth rate and carrying capacity of individual species in isolation first Then species are mixed at half carrying capacity to measure changes in population density caused by competition 1 Prepare a bottle of a suitable medium 2 Setup cultures of i
62. inventory control system below Be sure to use cryotubes and cryoboxes suitable for LN2 storage as some can only be used in freezers at temperatures above 100 C A reliable inventory control system designed to organize the contents for ease of location and retrieval is vital for efficient cryopreservation in the laboratory as well as being important in other techniques The key point is that small cryosamples cannot be kept out of LN2 for more than 30 s to 1 min making hunting for a specific sample inside the cryoconservator very difficult without an external inventory system Finding a missing sample can rapidly turn into a nightmare with non negligible risks for the samples and the user A reliable inventory control system is based on three complementary subsystems 1 an individual tube labelling system 2 a database recording the position of each sample together with its associated important data and 3 a system 46 Supplementary Information Altermatt et al 2015 Methods in Ecology and Evolution DOI 10 1111 2041 210X 12312 1 7 Long term preservation limiting errors particularly preventing the possibility to deposit move withdraw a sample without updating its record in the database Such an inventory control system can in principle be developed on paper or on simple electronic supports provided extreme care is taken to label position and record the fate moving thawing etc of each cryosample We however st
63. isola tion Giometto et al 2013 and in communities Machler amp Altermatt 2012 The CASY allows measurement of mean body size with linear size ranging from 0 7 to 160 um its associated variability community size spectra and total biomass A limitation of particle counters though not unique to them is the measurement of low density samples Addi tionally the CASY allows discerning the body size distributions of dif ferent species within the same sample only if the distributions are non overlapping Advantages of the particle counters over digital imaging include direct measurement of cell volume CASY and the rapid pro cessing of samples with high densities 2 5 MEASURING BACTERIA DENSITY PLATING OPTICAL DENSITY AND FLOW CYTOMETRY Quantitative information on bacterial density is often highly desirable for understanding the dynamics of the protist species consuming them Fig 1 ii and 7 Heterotrophic plate counts HPC or optical density 2014 The Authors Methods in Ecology and Evolution 2014 British Ecological Society Methods in Ecology and Evolution 6 218 231 224 Altermatt et al OD measurements can provide measures of bacteria density e g Fox amp Smith 1997 Beveridge Petchey amp Humphries 2010a However both these methods have constraints For example HPC assays are time and work intense and restrict the researcher to bacteria that are cultivable measured as colony forming units CFUs wh
64. lake type and riverine sockeye salmon Oncorhynchus nerka BMC Ecology 11 31 Quackenbush J 2004 Data standards for omic science Nat Biotechnol 22 613 614 Raghunathan A Ferguson H R Jr Bornarth C J Song W Driscoll M amp Lasken R S 2005 Genomic DNA amplification from a single bacterium Appl Environ Microbiol 71 3342 3347 95 Supplementary Information Altermatt et al 2015 Methods in Ecology and Evolution DOI 10 1111 2041 210X 12312 2 8 Genomics proteomics and epigenomics Smith D G Gawryluk R M Spencer D F Pearlman R E Siu K W amp Gray M W 2007 Exploring the mitochondrial proteome of the ciliate protozoon Tetrahymena thermophila direct analysis by tandem mass spectrometry J Mol Biol 374 837 863 Steffen M M Li Z Effler T C Hauser L J Boyer G L amp Wilhelm S W 2012 Comparative metagenomics of toxic freshwater cyanobacteria bloom communities on two continents PLoS ONE 7 e44002 Stepanauskas R 2012 Single cell genomics an individual look at microbes Curr Opin Microbiol 15 613 620 Suzuki M M amp Bird A 2008 DNA methylation landscapes provocative insights from epigenomics Nat Rev Genet 9 465 476 Swan B K Martinez Garcia M Preston C M Sczyrba A Woyke T Lamy D Reinthaler T Poulton N J Masland E D Gomez M L Sieracki M E DeLong E F Herndl G J amp Stepanauskas R 2011 Potential for chemolithoa
65. many species often thrive much better under non axenic cultures and that it is much more difficult to maintain these species under axenic conditions Materials Equipment For the handling of bacteria addition or removal to protist cultures the following equipment is needed Sterile working bench Bunsen burner or other flame source Spatula or wire loop to transfer bacteria Micropipettes to handle solutions in the range of 0 1 to 10 mL Sterile beakers and jars Aluminium foil to cover the lid of the medium container and maintain it sterile after autoclaving Labelling tape and pen to label cultures Stock cultures of the respective bacteria species includes Bacillus subtilis B brevis parabrevis B cereus Enterobacter aerogenes Proteus vulgaris Serratia fonticola or S marcescens ordered at bacteria stock centres Reagents Protist culture medium see section 1 2 Penicillin G Streptomycin sulfate Amphotericin B Fungizone GIBCO 2 ul ml Normocin Glycerol 27S Supplementary Information Altermatt et al 2015 Methods in Ecology and Evolution DOI 10 1111 2041 210X 12312 1 3 Bacteria Procedure Adding bacteria Bacteria are added from high density cultures to the respective culture medium where they are usually allowed to grow before protists are added In many past studies three different bacteria species have been added but the procedure is identical for single species The
66. non invasive destructive measure is required alternative methods e g digital imaging are to be preferred The CASY also allows measuring cell densities in user defined size windows The presence of debris in the sample however might result in imprecise counts thus alternative techniques see sections 2 2 and 2 5 are recommended for measuring abundances The main limitation in the use of the CASY to measure protist size distributions relies on the low signal to noise debris ratio when the protist density is too low or the sample presents many impurities The most common alternative method to measure protist body size is optical microscopy digital images of individuals are recorded with a stereomicroscope equipped with a digital camera cell lengths and widths are measured and volumes are calculated using known formulas for regular solids e g a prolate spheroid However the imaging method is limited in the number of cells that can be processed in short times and relies on the calculation of 3 dimensional volumes from 2 dimensional images 68 Supplementary Information Altermatt et al 2015 Methods in Ecology and Evolution DOI 10 1111 2041 210X 12312 2 4 Particle counter The use of the CASY is suggested when measurement of a large amount of individuals is needed or when the study species presents irregular cell shape or a cell shape that is not a solid of revolution An additional advantage of the CASY system is the possib
67. nutrient concentration of the medium Microbalance to weigh specific amounts of protist pellet seeds Manipulating viscosity of the medium Microbalance to weigh the amount of methyl cellulose or Ficoll Heater or water bath Reagents Manipulating nutrient concentration of the medium The same as for the production of the basic medium for dilution Sources of slow nutrient release such as autoclaved and standardized wheat or millet seeds Manipulating viscosity of the medium Medium prepared according to section 1 2 Methyl cellulose is readily obtained from local pharmacies often with varying names according to the producer concentrations of around 3 5 gL are reported in the literature Luckinbill 1973 Veilleux 1979 to manipulate the swimming movement of Paramecium aurelia and Didinium nasutum Ficoll GE Healthcare companies Ficoll concentrations of 0 0 5 0 7 1 5 2 and 2 5 by mass produce a viscosity range of 1 x 10 to 1 52 x 10 Ns m at 20 C the same as for viscosities expected at temperatures from 20 to 5 C 116 Supplementary Information Altermatt et al 2015 Methods in Ecology and Evolution DOI 10 1111 2041 210X 12312 3 4 Nutrient concentration and viscosity of the medium Beveridge Petchey amp Humphries 2010a Beveridge Petchey amp Humphries 2010b Procedure Manipulating nutrient concentration of the medium Dilution of the medium to levels of lower nutrient availability
68. of protists next to temperature for example Therefore the comparison of basic life history traits growth rate carrying capacity interspecific interac tion coefficients across species and studies depends on the use of a stan dardized medium Protists are generally kept in a freshwater based medium containing nutrients and sometimes bacteria Section 1 3 Many types of medium have been used e g Lee amp Soldo 1992 which can be classified into chemically well defined media e g Bristol med ium Chalkley s solution see Appendix S1 and media made out of sus pensions of less defined organic matter e g proteose peptone medium protozoan pellet medium wheat or wheat hay suspensions Medium made of ground protozoan pellets provided by Carolina Biological Supply Company Burlington NC USA either suspended in well or tap water or in Chalkley s solution is commonly used for an overview of studies using different media types see the Appendix S1 Sections 1 1 and 1 2 where we also refer to many more media types suited for specific species We recommend using proteose peptone medium for axenic cul tures e g Schtickzelle et al 2009 Pennekamp et al 2014b and using protozoa pellet medium otherwise e g Petchey et al 1999 Haddad et al 2008 Altermatt Schreiber amp Holyoak 2011b Often autoclaved wheat seeds or other organic material are added to the standard media in order to provide slow release of nutrients leading t
69. primary research interest especially in community ecology Fig 1 iv 6 v Studies of free living ciliates showed that elemental composition can influence the population dynamics of ciliate predators e g rotifers and thus the regulation of ciliate populations Bo chat amp Adrian 2006 and the selectivity of ciliates according to the elemental stoichiometry and hence food quality of their bacterial prey Gruber Tuorto amp Taghon 2009 Species like T thermophila whose nutrient requirements are very well understood can be kept on chemically defined medium where the exact composition of macronutrients and thus the elemental composi tion is precisely known and amenable to manipulation Asai amp Forney 2000 For other species determination of elemental composition is possible by techniques such as RMS see Section 2 4 combustion and infra red spectrometry and X ray microanalysis Vrede et al 2002 Decomposition is a critical ecosystem process due to its influence on nutrient cycling and availability and protist have an important role in this process Ribblett Palmer amp Coats 2005 Protists grazing on bacte ria can promote decomposition despite decreased bacterial biomass Microcosm studies of decomposition rate include the effects of biodi versity McGrady Steed Harris amp Morin 1997 and effects of tempera ture change Petchey et al 1999 on decomposition Decomposition rate can be estimated by measuring the
70. records about each of the stock cultures including their population sizes Having a single person responsible for maintenance of a set of stock culture Not using stock cultures to seed experiments Rather make a set of separate stock cultures specifically for an experiment Keeping predators on diverse prey assemblages for longer persistence Anticipated results Guaranteed long term persistence of stock cultures Comprehensive and detailed records including population sizes at subculture of each stock culture 40 Supplementary Information Altermatt et al 2015 Methods in Ecology and Evolution DOI 10 1111 2041 210X 12312 1 7 Long term preservation Supplementary information for Altermatt et al Methods in Ecology and Evolution DOT 10 1111 2041 210X 12312 Big answers from small worlds a user s guide for protist microcosms as a model system in ecology and evolution Altermatt F Fronhofer EA Garnier A Giometto A Hammes F Klecka J Legrand D Machler E Massie TM Pennekamp F Plebani M Pontarp M Schtickzelle N Thuillier V amp Petchey OL 1 7 Long term preservation Below we first describe the use of Lugol s solution to preserve dead protists in samples e g for counting identification section A and second describe the procedure to store protists alive using cryopreservation section B A Lugol s solution Introduction Lugol s solution can be used to store samples of protists for severa
71. rpm for 10 min 3 Remove as much of the liquid phase as possible using a micropipette and re suspend the residue at the bottom bacterial pellet with 200 uL 4 Repeat steps 2 and 3 two times or more often if desired 379 Supplementary Information Altermatt et al 2015 Methods in Ecology and Evolution DOI 10 1111 2041 210X 12312 2 6 RAMAN microspectroscopy Prepare slides for RMS 1 Put cleaned protists individuals or bacteria in small droplets on MgF CaF slides These slides are highly light translucent which is a prerequisite for successful application of monochrome light laser used in RMS 2 Let them dry until all liquid is vaporized 3 The organisms are now ready for RMS analysis References Abraham W R 2014 Applications and impacts of stable isotope probing for analysis of microbial interactions Applied Microbiology and Biotechnology 98 4817 4828 Huang W E Li M Jarvis R M Goodacre R amp Banwart S A 2010 Shining Light on the Microbial World The Application of Raman Microspectroscopy Advances in Applied Microbiology Vol 70 eds A I Laskin S Sariaslani amp G M Gadd pp 153 186 Huang W E Stoecker K Griffiths R Newbold L Daims H Whiteley A S amp Wagner M 2007 Raman FISH combining stable isotope Raman spectroscopy and fluorescence in situ hybridization for the single cell analysis of identity and function Environmental Microbiology 9 1878 1889 Li M Hu
72. the appropriate volume of tap water say 100 ml Mark on the outside of the vessel the level of the liquid using a fine permanent marker Pour away the liquid ii Use this reference MV to put similar lines on all other MVs without removing their lids iii Pour in the bacterized PPM to the line on a MV or better add this in two steps first half of the large flask then second half CRITICAL STEP at step 3 the large flask containing the bacterized PPM needs to be well swirled before each pour otherwise the bits of PP will remain in the bottom and be poured only into the last few MVs If needed place the required number of wheat seeds in each MV Now randomly assign MVs to treatments and label them with permanent marker on the MV or on a sticker stuck to the MV Estimate the density in the source cultures of each species of protist in the experiment Put in the appropriate volume number of each species of protist in the appropriate MVs Record the number volume you put in and the density of the source culture for each species From this you can calculate the initial population density in the MVs Put the MVs into the appropriate incubator Correct handling of the microcosms l Ensure that microcosms are out of the experimental environment for as short a time as possible You may find it useful to remove samples from multiple microcosms in the room with the incubator and then count these wherever This avoids lots
73. to specific difficulties and limitations of image video analysis in microcosm systems Furthermore integrated systems using a combination of flow cytometry and image analysis such as FlowCAM Fluid Imaging Technologies Sieracki Sieracki amp Yentsch 1998 rely on the same principles as the respective techniques and will therefore not be covered explicitly here Material Equipment Microscope or stereomicroscope with a C mount video adapter to connect a camera The magnification and illumination brightfield versus darkfield of the experimental chamber depend on the optical equipment used and is discussed in section 2 2 Protists are generally transparent therefore darkfield microscopy improves the contrast between them and the background of the chamber However protist can appear coloured due to the ingestion of pigmented food particles such as algae Image analysis usually disregards colour if it does not provide additional information value and images and videos in grey scale are analysed for computational efficiency The use of fluorescence techniques usually requires specialized hardware as well Individualized adapters for mounting cameras to microscopes are for example provided by Micro Tech Lab company Graz Austria www LMscope com Digital video camera The abilities of the acquisition hardware depend on the research question and range from high resolution and frame rate cameras for detailed individual level descriptions o
74. weight loss of organic matter e g of a wheat seed over a specific amount of time e g Davies et al 2009 similar to the use of leaf litter bags for measuring decomposition in terrestrial ecosystems 2 11 TIME SERIES Times series obtained from experiments are a prerequisite to address numerous questions in ecology They display the dynamic changes of characteristic variables such as density biomass population structure genotype frequency or diversity Fig 1 i and iv Protists are gener ally characterized by rather short generation times usually a few hours making them ideal model organisms to get comprehensive time series over many generations within only a couple of days weeks Typical measures of interest see also Fig 1 Table 1 are variability in popula tion density and its derivatives resilience return rate or Lyapunov exponents e g Lawler amp Morin 1993 competition coexistence or synchrony e g Vasseur amp Fox 2009 Recording entire time series instead of considering only one or two snapshots after starting an experiment gives a far more detailed insight of the ongoing processes This is especially true for transient dynamics between two or more dynamical steady states if there exist any at all for a given system that can be highly complex due to inter and intra specific processes Massie et al 2010 Moreover since comprehensive times series contain more information for analysis derived predictions ar
75. 0 1111 2041 210X 12312 Big answers from small worlds a user s guide for protist microcosms as a model system in ecology and evolution Altermatt F Fronhofer EA Garnier A Giometto A Hammes F Klecka J Legrand D Machler E Massie TM Pennekamp F Plebani M Pontarp M Schtickzelle N Thuillier V amp Petchey OL 22 Estimating abundances by eye Microscopy Introduction Protist ecology has successfully used optical microscopes for estimating protist densities and for observing cell features since its very beginning Gause 1934 Vandermeer 1969 Luckinbill 1973 Different methods and different microscopes can be used for counting protists depending on their cell size their population density and whether they are in monoculture or in combination with other protist species Most protist species having a body length in the range of 10 to 300 um and densities of 10 to 210 000 individuals ml can be counted using dissecting microscopes stereomicroscope see Fig S1 these microscopes are provided with a single objective which allow to zoom up to a magnification of 160x Compound microscopes capable of higher magnification usually up to 1000x allow the detection and the counting of very small organisms e g microflagellates and small amoebae and the observation of cells in detail e g for evidence of parasitism Inverted microscopes are compound microscopes in which the light source is set above the stage and the objectives are
76. 04 458 466 Petchey O L Anna E Borrvall C amp Ebenman B 2008 Trophically Unique Species Are Vulnerable to Cascading Extinction The American Naturalist 171 568 579 Seymour M amp Altermatt F 2014 Active colonization dynamics and diversity patterns are influenced by dendritic network connectivity and species interactions Ecology and Evolution 4 1243 1254 Violle C Enquist B J McGill B J Jiang L Albert C c H Hulshof C Jung V amp Messier J 2012 The return of the variance intraspecific variability in community ecology Trends in Ecology and Evolution 27 244 252 Violle C Nemergut D R Pu Z amp Jiang L 2011 Phylogenetic limiting similarity and competitive exclusion Ecology Letters 14 782 787 Worsfold N T Warren P H amp Petchey O L 2009 Context dependent effects of predator removal from experimental microcosm communities Oikos 118 1319 1326 129
77. 06 cells ml 2000 Wks o e e _ 0 0 50 100 150 200 250 300 350 time h Figure S1 Density of Tetrahymena and a mixed bacteria culture for bacteria used see Giometto et al 2014 over 310 hours Bacteria dynamics in the control are highly significantly different compared to bacteria dynamics in a Tetrahymena culture Materials Equipment A flow cytometer equipped with a 488 nm blue laser gt 15 mW and detectors for green fluorescence 520 20 nm red fluorescence lt 610 nm and high angle sideward scatter 90 SSC The instrument is cleaned and calibrated according to the manufacturer s procedures Sterile Eppendorf tubes 2 mL Heating block 37 C Pipettes and sterile tips Reagents SYBR Green I working solution Dilute SYBR Green I SG Invitrogen stock solution 100x in sterile filtered 0 1 um Millipore dimethyl sulfoxid DMSO and store refrigerated 5 C until use Prest et al 2013 Alternatively the SG dilution can be prepared with sterile TRIS buffer 10 mM pH 8 Hammes amp Egli 2010 7A Supplementary Information Altermatt et al 2015 Methods in Ecology and Evolution DOI 10 1111 2041 210X 12312 2 5 Measuring bacteria density Flow cytometry Particle free water buffer for dilution Prepare particle free dilution media by filtering 0 1 um Millipore commercially available bottled mineral water e g Evian Alternatively sterile buffer e g T
78. 09 Generally density is manipulated at the start of an experiment but can also be manipulated during an experiment Most experiments are either started with a fixed density of each species e g all species populations start with same density Altermatt Schreiber amp Holyoak 2011b or a fixed proportion of each species density relative to its car rying capacity K Carrara et al 2012 The first case has the advantage that all starting densities are equal and thus should be equally affected by drift processes but has the disadvantage that the starting densities may vary in orders of magnitude relative to a species K While the lat ter case may be generally more preferable specific experimental consid erations should take precedence As long as manipulations concern the range of densities up to carry ing capacity growing cultures to K and diluting them with culture med ium to the desired density is sufficient To get densities higher than K cultures need to be concentrated This can be done in two ways first by centrifuging cultures such that a pellet is created at the bottom of the tube which contains the cells whereas the cell free medium the super natant is removed Secondly one can remove medium and concentrate cells by reverse filtration i e discard filtrate and preserve supernatant 3 3 DISTURBANCE AND PERTURBATION MANIPULATIONS Environmental disturbances Fig 1 8 correspond to forces that sub stantially mod
79. 1 Supplementary Information Altermatt et al 2015 Methods in Ecology and Evolution DOI 10 1111 2041 210X 12312 3 5 Spatial structure 1 Thoroughly mix the culture also needs to be done in the no dispersal control 2 Sample the proportion of the culture community that should disperse with a pipette i e emigration For each patch emigration step and new and sterile pipette tip must be used 3 After emigration migrants can be stored temporarily in a mirror landscape or be manipulated or experience a dispersal related treatment e g mortality Furthermore the emigrants can be fractioned into a part that is analysed e g diversity and abundance measured Subsequently distribute the migrants into the patch es of immigration 5 For the control the sampled migrants are given back into the patch of emigration Active dispersal with discrete landscapes Alternatively experiments may require active dispersal of protists For active dispersal patches can be continuously connected or only connected during a certain amount of time in order to control connectivity Fig 1B The connections are most often built of silicone tubes e g Holyoak amp Lawler 1996 Cadotte 2007 Altermatt amp Holyoak 2012 Fellous et al 2012 Closing connections can be done using clamps or stopcocks for example 1 Landscapes are built with vials connected by tubing 2 Landscapes need to be fixed on a completely horizontal shelf or on
80. 1 210X 12312 1 7 Long term preservation 10 11 12 Prepare a set of 50 mL tubes one for each cryotube to be thawed each containing 50 mL of standard culture medium at room temperature and label them Antibiotics should be added to minimize potential contamination Preheat the water bath at 42 C and place in it one or several tubes e g 50 mL conical containing an appropriate quantity of standard culture medium 1 5 mL number of cryotubes to be thawed be sure the top of the tube does not touch the water to avoid contamination Once at 42 C take the tube out of the water bath and wipe it with an alcohol soaked tissue prior to opening under the hood to minimize the risk of contamination Fill 2 expanded polystyrene boxes with a few centimeters LN2 one will receive the cryotubes to be thawed the other will receive the cryobox extracted from the cryoconservator Do not let any cryotube cryobox outside LN2 for more than 30 seconds Be sure to regularly check the LN2 level and refill if necessary to maintain a level allowing cryotubes to be fully submerged in LN2 Take out the first cryobox from the cryoconservator put it in one of the LN2 filled expanded polystyrene box and extract the selected cryotube s Repeat one cryobox at a time until all cryotubes to be thawed are extracted and grouped in the other LN2 filled expanded polystyrene box Place the first cryotube into the 42 C water bath and shake gen
81. 1 heterotroph 278 3 Colpidium sp 8127 8 1 5 0 08 13792 470 2 heterotroph 76 6 Euglena gracilis 36 7 0 87 84578 69 1 mixotroph 6 4 Euplotes aediculatus 854 0 43 359 591 9 mixotroph 8 6 Paramecium aurelia 1116 0 86 0 02 111 1 2 6 1280 8 heterotroph 15 1 Paramecium 101 3 0 23 1639 1090 2 mixotroph bursaria 12 9 Spirostomum sp 843 8 0 57 0 15 13 6 4 2 418 2 heterotroph 149 7 Tetrahymena cf 26 7 4 8 2 24 0 15 2996 8 148 8 heterotroph pyriformis 196 1 data from Haddad et al 2008 Materials Equipment For the isolation of protists the following equipment is needed Stereomicroscope see section 2 2 and general apparatus for cultivation section 1 4 Sterile petri dishes Sterile capillary glass pipettes glass Pasteur pipettes with latex bulbs Reagents Autoclaved and bacterized culture medium see section 1 2 80 Ethanol for sterilizing surfaces and equipment Procedure The following procedure is for isolating species from natural communities or from species purchased from culture collections that are not pure 10 Supplementary Information Altermatt et al 2015 Methods in Ecology and Evolution DOI 10 1111 2041 210X 12312 1 1 Species used 1 Collect a water sample 100 200 mL from the natural source of interest pond tree hole pitcher plant etc 2 Bring the sample as quickly as possible to the laboratory avoid warming of the sample store and transport it in a
82. 100 g for 3 min at room temperature and remove the supernatant by aspiration leaving 500 uL of Tris to dissolve the pellet Add carefully 2 mL of DMSO final DMSO concentration 8 stir gently cells become fragile by DMSO so avoid shocks Put immediately 300 uL in each cryotube and incubate at room temperature for 30min to allow DMSO to penetrate the cells so called equilibration period Cool down at 1 C min overnight Whatever the device used for this controlled cooling down group cryotubes together according to the position they will occupy in the cryoconservator to ease their transfer see below 10th day Friday 0 5 h Transfer in LN2 13 14 15 16 Fill 2 expanded polystyrene boxes with a few centimetres LN2 one will receive the cryotubes out of the 80 C freezer or cooling unit the other will receive the cryobox extracted from the cryoconservator This allows keeping all cryotubes new or existing deeply frozen during manipulation Be sure to regularly check the LN2 level in the two boxes and refill if necessary to maintain a level allowing cryotubes to be fully submerged in LN2 Rapidly move the cryotubes from the freezer to LN2 using tweezers or if possible by overturning the box in which they are and let cryotubes drop into LN2 Do not let any cryotube cryobox outside LN2 for more than 30 seconds Once they are in the expanded polystyrene box soaked floating in LN2 they are safe and you can take
83. 11 2041 210X 12312 3 4 Nutrient concentration and viscosity of the medium Supplementary information for Altermatt et al Methods in Ecology and Evolution DOT 10 1111 2041 210X 12312 Big answers from small worlds a user s guide for protist microcosms as a model system in ecology and evolution Altermatt F Fronhofer EA Garnier A Giometto A Hammes F Klecka J Legrand D Machler E Massie TM Pennekamp F Plebani M Pontarp M Schtickzelle N Thuillier V amp Petchey OL 3 4 Nutrient concentration and viscosity of the medium Introduction Manipulating the nutrient content of medium The level and temporal availability of nutrients are parameters that determine ecological conditions such as resource pulses Yang et al 2008 environmental heterogeneity and autocorrelation Laakso Loytynoja amp Kaitala 2003 Nutrients interact with intrinsic features of the population or community to create resonance Orland amp Lawler 2004 productivity diversity relationships Haddad et a 2008 Altermatt et al 2011 or relationships between productivity and evolutionary responses Friman amp Laakso 2011 Nutrient levels and the temporal availability of nutrients are easily manipulated in microcosms In axenic cultures the nutrient availability is directly manipulated via the concentration of the medium whereas in bacterized medium the nutrients available to the bacteria are manipulated which then feed back into increased bacteria abu
84. 1973 Lee amp Soldo 1992 see also the extensive list of examples given in Appendix SI Section 1 1 A dissecting microscope with dark field illumination capable of low 10x to high 160x mag nification is ideal for counting protists size range approximately A user s guide for protist microcosms 223 10 500 um Giometto et al 2013 Counting is either done in droplets of known volume or with the aid of counting chambers e g hemocy tometer or Sedgwick Rafter counting chamber that contain known volumes of media Compound microscopes capable of higher magnifi cation are required for counting smaller organisms e g microflagel lates individual bacteria and observing cells in detail e g for evidence of parasitism Fellous et al 2012b 2 3 IMAGE AND VIDEO ANALYSIS Direct microscopy by a trained experimenter provides accurate abun dance measurements for single species or complex communities and is unrivalled in terms of registering specific qualitative behaviours and morphology for species identification Section 2 1 However such population or community level properties Fig 1 iv are insufficient in the light of recent trait based approaches in ecology requiring quan titative measurements of individual level traits such as morphology and behaviour for large numbers of individuals Fig 1 i Digital image and video analysis can provide this information Pennekamp amp Schtickzelle 2013 Dell et al 2014 Relia
85. 3 1 1 Recreating cultures from a frozen stock is needed after bacteria fungal contamination or accidental loss extinction of the culture in the liquid medium However regularly reinitializing protist cultures is also necessary to prevent undesired genetic changes due to evolutionary changes during prolonged vegetative growth For example it is advised to restart Tetrahymena cultures every 6 months Cassidy Hanley 2012 This is necessary to prevent major genetic changes in the germinal micronucleus transcriptionally inactive and hence under strong genetic drift Specifically this is needed to preserve specific mutations when the wild type has a selective advantage causing a high risk of the mutation of interest to be lost due to random assortment of macronuclear chromosomes during asexual reproduction Cassidy Hanley 2012 It is however important to note that the low survival during thawing makes there is no 100 guarantee of genetic stability even with cryopreservation Secondly cryopreservation of protist cultures can be a key point in some studies for example in experimental evolution Kawecki et al 2012 Indeed it allows taking a snapshot of a culture strain under specific conditions and at a certain time Such cryopreserved cultures can then be subsequently revived by thawing to be 42 Supplementary Information Altermatt et al 2015 Methods in Ecology and Evolution DOI 10 1111 2041 210X 12312 1 7 Long term preservation c
86. 7 5 EDTA1mM NaCl 100 mM SDS 10 ddH O Choice of Barcode and PCR amplification Choice of Cox 1 barcode with Chantangsi et al 2007 forward primer 5 ATGTGAGTTGATTTTATAGA 3 and reverse primer 5 CTCTTCTATGTCTTAAACCAGGCA 3 83 Supplementary Information Altermatt et al 2015 Methods in Ecology and Evolution DOI 10 1111 2041 210X 12312 2 7 DNA sequencing and barcoding Procedure DNA extractions Phenole Chloroform extraction l 2 3 4 Nn 9 10 11 12 13 Collect 2 5 10 cells in 50 uLTris 10 mM pH 7 5 Re suspend and add 200 uL of pre heated Lysis buffer 60 C Add two volumes water and incubate at 60 C at least 1 h Cool to room temperature add 50 ug mL proteinase K and incubate at 37 C overnight Purify with one volume phenol chloroform isoamid Precipitate with one tenth volume sodium acetate pH 5 2 and one volume of isopropanol Wash pellet in 70 ethanol Re suspend in 75yL Tris EDTA Add 0 8 ug uL RNase A and incubate for 30min at 37 C Purify with one volume phenol chloroform isoamid Precipitate with one tenth volume sodium acetate pH 5 2 and one volume of isopropanol Wash pellet in 70 ethanol Re suspend in the desired volume of Tris EDTA DNA extractions modified Chloroform extraction modified by V Thuillier et al l 10 Dilute the amount of cells in order to have a final volume of 200 u1 ultrapure H O Add 500 uL of lysis
87. 8 Regulation and environmental variability in experimental populations of protozoa Ecology 59 1271 1276 Pennekamp F Mitchell K A Chaine A amp Schtickzelle N 2014 Dispersal propensity in Tetrahymena thermophila ciliates a reaction norm perspective Evolution 68 2319 2330 Warren P H amp Spencer M 1996 Community and food web responses to the manipulation of energy input and disturbance in small ponds Oikos 75 407 418 110 Supplementary Information Altermatt et al 2015 Methods in Ecology and Evolution DOI 10 1111 2041 210X 12312 3 3 Disturbance and perturbation manipulations Supplementary information for Altermatt et al Methods in Ecology and Evolution DOT 10 1111 2041 210X 12312 Big answers from small worlds a user s guide for protist microcosms as a model system in ecology and evolution Altermatt F Fronhofer EA Garnier A Giometto A Hammes F Klecka J Legrand D Machler E Massie TM Pennekamp F Plebani M Pontarp M Schtickzelle N Thuillier V amp Petchey OL 3 3 Disturbance and perturbation manipulations Introduction Disturbances can either be a temporary change in the environment that affects the community i e a pulse perturbation but where eventually the environmental conditions return to the initial state or be a permanent change in the environment i e a press perturbation or somewhere on the continuum between pulse and press Disturbances as persisting changes i
88. At the end of the day tidy and clean the benches with ethanol remove sterilize and dispose biohazardous waste ensure that adequate supplies remain if not arrange for more Periodic tasks l 2 Maintain a stock of commonly used media Maintain a stock of commonly used consumables 35 Supplementary Information Altermatt et al 2015 Methods in Ecology and Evolution DOI 10 1111 2041 210X 12312 1 5 Laboratory practices Microcosm setup Setting up microcosms for bacterivore protists requires two main steps 1 inoculating fresh sterile medium Protist Pellet Medium hereafter PPM see also section 1 2 and supplement thereof with bacteria and 2 adding protists to the bacterized PPM Step 1 adding bacteria to the sterile PPM 1 You will probably have the sterile PPM in 1 litre volumes in one or more large flasks Working under a sterile bench pour about 100 ml into a small autoclaved vessel 2 Using sterile technique take a loop of bacteria from the bacterial culture and dip and swirl it into the media in the small vessel 3 Put the small vessel in a warm 25 C or so not critical place for a couple of hours to let the bacteria grow 4 Under the sterile bench divide the now bacterized media in the small vessel into however many large flasks you have 5 Put the large flasks in a warm place overnight see TIMING Step 2 adding the protists to the bacterized PPM CRITICAL STEP all the steps specified
89. Bacteria can be stored frozen and added to cultures in known compositions and quantities and quantified using flow cytometry Section 2 5 An even higher level of standardization and reproducibility is reached by using axenic cultures i e cultures containing no bacteria To maintain axenic cultures to transform non axenic cultures into axe nic ones or to create mono xenic cultures the culture medium needs to be treated with antibiotics Subsequently strict sterile technique is required Axenic cultures are often used for single species experiments especially Tetrahymena sp e g Asai amp Forney 2000 Pennekamp amp Schtickzelle 2013 Pennekamp et al 2014b while almost all experi ments containing multiple species of protists are done under non axenic conditions as most species cannot be axenized e g Petchey et al 1999 Haddad et al 2008 Altermatt Schreiber amp Holyoak 2011b 1 4 APPARATUS A laboratory equipped with general microbiological apparatus is required including microbalances precision 0 1 mg an autoclave incubators pH meter microscopes and a sterile bench for working with axenic cultures Protist cultures can be maintained and handled with general laboratory equipment though this must be inert with respect to chemicals leaking into the medium e g using silicon tubes or glass jars Jars and pipettes should be rinsed with deionized water to remove detergents Glass jars and polystyrene microwell plates
90. D E 1972b Intrinsic rates of increase saturation densities and competitive ability I An experiment with Paramecium The American Naturalist 106 461 471 Gill D E amp Nelson G H 1972 The dynamics of a natural population of Paramecium and the r le of interspecific competition in community stucture Journal of Animal Ecology 41 137 151 Giometto A Altermatt F Carrara F Maritan A amp Rinaldo A 2013 Scaling body size fluctuations Proceedings of the National Academy of Sciences 110 4646 4650 Giometto A Rinaldo A Carrara F amp Altermatt F 2014 Emerging predictable features of replicated biological invasion fronts Proceedings of the National Academy of Sciences 111 297 301 4 Supplementary Information Altermatt et al 2015 Methods in Ecology and Evolution DOI 10 1111 2041 210X 12312 1 1 Species used Haddad N M Holyoak M Mata T M Davies K F Melbourne B A amp Preston K 2008 Species traits predict the effects of disturbance and productivity on diversity Ecology Letters 11 348 356 Hammill E Petchey O L amp Anholt B R 2010 Predator Functional Response Changed by Induced Defenses in Prey American Naturalist 176 723 731 Hiltunen T Hairston N G Hooker G Jones L E amp Ellner S P 2014 A newly discovered role of evolution in previously published consumer resource dynamics Ecology Letters 17 915 923 Holyoak M 2000a Effects of nu
91. Ecology 48 787 803 Winet H 1976 Ciliary propulsion of objects in tubes wall drag on swimming Tetrahymena Ciliata in the presence of mucin and other long chain polymers Journal of Experimental Biology 64 283 302 Yang L H Bastow J L Spence K O amp Wright A N 2008 What Can We Learn from Resource Pulses Ecology 89 621 634 118 Supplementary Information Altermatt et al 2015 Methods in Ecology and Evolution DOI 10 1111 2041 210X 12312 3 5 Spatial structure Supplementary information for Altermatt et al Methods in Ecology and Evolution DOI 10 1111 2041 210X 12312 Big answers from small worlds a user s guide for protist microcosms as a model system in ecology and evolution Altermatt F Fronhofer EA Garnier A Giometto A Hammes F Klecka J Legrand D Machler E Massie TM Pennekamp F Plebani M Pontarp M Schtickzelle N Thuillier V amp Petchey OL 3 5 Spatial structure Introduction A large range of theoretical predictions from meta population Hanski 1999 meta community Leibold et al 2004 and meta ecosystem ecology Loreau Mouquet amp Holt 2003 can be tested using protist microcosm landscapes Furthermore the temporal dynamics can be used to assess stability and dynamical behaviour of these systems Giometto ef al 2014 Seymour amp Altermatt 2014 as well as evolutionary and eco evolutionary dynamics Fronhofer amp Altermatt 2014 Importantly microcosm landscapes can be cu
92. Ecology 55 1142 1147 Luckinbill L S 1979 Selection and the r K Continuum in Experimental Populations of Protozoa The American Naturalist 113 427 437 Luckinbill L S amp Fenton M M 1978 Regulation and environmental variability in experimental populations of protozoa Ecology 59 1271 1276 Machler E amp Altermatt F 2012 Interaction of Species Traits and Environmental Disturbance Predicts Invasion Success of Aquatic Microorganisms PLoS ONE 7 e45400 McGrady Steed J Harris P M amp Morin P J 1997 Biodiversity regulates ecosystem predictability Nature 390 162 165 McGrady Steed J amp Morin P J 2000 Biodiversity density compensation and the dynamics of populations and functional groups Ecology 81 361 373 Morin P J amp McGrady Steed J 2004 Biodiversity and ecosystem functioning in aquatic microbial systems a new analysis of temporal variation and species richness predictability relations Oikos 104 458 466 Nelson G H 1958 Observations on the Ecology of Paramecium with Comments on the Species Problem Evolution 12 440 450 Nelson G H 1967 Studies on The Limitation of a Natural Population of Paramecium Aurelia Ecology 48 904 910 Nelson G H amp Kellermann S L 1965 Competition between Varieties 2 and 3 of Paramecium Aurelia The Influence of Temperature in a Food Limited System Ecology 46 134 139 Ostman O Kneitel J M amp Chase J M 2006 Disturbance
93. Ecology and Evolution DOI 10 1111 2041 210X 12312 2 12 Interaction strengths 3 Let the predator feed for 4 hours the duration must be short enough so that prey reproduction can be neglected 4 Count the surviving prey individuals or preserve the sample in Lugols solution see section 1 8 and count the protists later Stenostomum has a relatively high consumption rate up to ca 10 Paramecium within four hours Hammill Petchey amp Anholt 2010 which facilitates the measurements b An example protocol based on Delong and Vasseur 2013 using Paramecium as a prey and Didinium as a predator 1 Prepare a series of cultures diluted to a varying degree and place a 50 ul drop from the culture into a Petri dish count the number of prey individuals a reasonable range of prey numbers would be ca 1 20 and use this drop as a source of prey for the experiment 2 Add one predator individual in a known amount of medium e g 20 ul so that the total volume of the drop is known in this case 70 ul 3 Close the Petri dish to minimise evaporation 4 Letthe predator feed for 4 hours the duration must be short enough so that prey reproduction can be neglected 5 Count the surviving prey individuals Delong and Vasseur 2013 measured maximum consumption rate by Didinium using this setup to be around 5 Paramecium consumed during two hours Based on this using a slightly longer duration e g 4 hours of the experiment would be prefe
94. GS costs have much decreased recently NGS are usually used in metagenomics or in comparative studies For Sanger methods resulting sequences should be cleaned most often achieved visually on the chromatogram in MEGA open source software http www megasoftware net Sequencher open source software http www genecodes com download external tools download or Geneious private software http www geneious com download For the analysis of the sequences many software exist and are well explained Hall 2013 depending on the purpose The treatment and analysis of the sequences generated requires expertise in bioinformatics and the detailed procedure is out of scope of this paper NGS are usually used in metagenomics Hajibabaei et al 2011 surveys of microorganism diversity Medinger et al 2010 or in comparative studies Sequencing data are available and compiled into various databases like GenBank NCBI http www ncbi nlm nih gov and BOLD Barcode of Life Data Systems http www barcodinglife org for the barcoding sequences Materials Equipment A standard molecular biology laboratory including a fume hood and respective equipment is needed Reagents DNA extractions Phenole Chloroform extraction Lysis buffer pH 9 5 10mM Tris pH 7 5 0 5M EDTA 1 SDS completed with ultrapure water DNA extractions modified Chloroform extraction modified by V Thuillier et al Lysis buffer pH 8 Tris 20 mM pH
95. Methods in Ecology and Evolution Methods in Ecology and Evolution 2015 6 218 231 doi 10 1111 2041 210X 12312 Big answers from small worlds a user s guide for protist microcosms as a model system in ecology and evolution Florian Altermatt Emanuel A Fronhofer Aur lie Garnier Andrea Giometto Frederik Hammes Jan Klecka Delphine Legrand Elvira M chler Thomas M Massie Frank Pennekamp Marco Plebani Mikael Pontarp Nicolas Schtickzelle Virginie Thuillier and Owen L Petchey Department of Aquatic Ecology Eawag Swiss Federal Institute of Aquatic Science and Technology berlandstrasse 133 CH 8600 D bendorf Switzerland Institute of Evolutionary Biology and Environmental Studies University of Zurich Winterthurerstr 190 CH 8057 Z rich Switzerland Laboratory of Ecohydrology School of Architecture Civil and Environmental Engineering cole Polytechnique F d rale de Lausanne CH 1015 Lausanne Switzerland Department of Environmental Microbiology Eawag Swiss Federal Institute of Aquatic Science and Technology berlandstrasse 133 CH 8600 D bendorf Switzerland Laboratory of Theoretical Ecology Institute of Entomology Biology Centre ASCR Branisovsk 31 Cesk Bud jovice 37005 Czech Republic SDepartment of Fish Ecology and Evolution Eawag Swiss Federal Institute of Aquatic Science and Technology Seestrasse 79 CH 6047 Kastanienbaum Switzerland and Earth and Life Institute Bio
96. OI 10 1111 2041 210X 12312 2 1 Sampling and counting Supplementary information for Altermatt et al Methods in Ecology and Evolution DOT 10 1111 2041 210X 12312 Big answers from small worlds a user s guide for protist microcosms as a model system in ecology and evolution Altermatt F Fronhofer EA Garnier A Giometto A Hammes F Klecka J Legrand D Machler E Massie TM Pennekamp F Plebani M Pontarp M Schtickzelle N Thuillier V amp Petchey OL 2 1 Sampling and counting Introduction Observing properties of microbial microcosms such as organism size and population density often cannot be carried out in situ and usually cannot be performed for the entire microcosm or every individual therein Hence observations are virtually always made on a sample of the microcosm and usually involves removing this sample from the microcosm though see below for exceptions Important questions include what volume sample to remove whether samples will be returned to the microcosm when to sample and whether to homogenise microcosms before sampling There is no single correct answer for any of these questions though most often microcosms are homogenized by swirling prior to sampling How to answer these questions for one s specific situation is discussed in the troubleshooting section How frequently to sample depends on the goals of the experiment and on the rates of interest For example at least daily sampling during exponential
97. Press San Diego Fjerdingstad E Schtickzelle N Manhes P Gutierrez A amp Clobert J 2007 Evolution of dispersal and life history strategies Tetrahymena ciliates BMC Evolutionary Biology 7 133 Haddad N M Holyoak M Mata T M Davies K F Melbourne B A amp Preston K 2008 Species traits predict the effects of disturbance and productivity on diversity Ecology Letters 11 348 356 Pennekamp F amp Schtickzelle N 2013 Implementing image analysis in laboratory based experimental systems for ecology and evolution a hands on guide Methods in Ecology and Evolution 4 483 492 Petchey O L McPhearson P T Casey T M amp Morin P J 1999 Environmental warming alters food web structure and ecosystem function Nature 402 69 T2 29 Supplementary Information Altermatt et al 2015 Methods in Ecology and Evolution DOI 10 1111 2041 210X 12312 1 4 Apparatus Supplementary information for Altermatt et al Methods in Ecology and Evolution DOT 10 1111 2041 210X 12312 Big answers from small worlds a user s guide for protist microcosms as a model system in ecology and evolution Altermatt F Fronhofer EA Garnier A Giometto A Hammes F Klecka J Legrand D Machler E Massie TM Pennekamp F Plebani M Pontarp M Schtickzelle N Thuillier V amp Petchey OL 1 4 Apparatus Introduction A laboratory equipped with general microbiological apparatus is required for protist microcosm
98. RIS buffer 10 mM pH 8 can be used filtered similarly Procedure Sample preparation l 2 Collect the sample 1 mL and homogenise by vortexing 10 sec Dilute the sample 100x 10 uL sample in 990 uL in particle free mineral water or buffer The dilution step may be omitted if a low cell density lt 10 cells mL is expected a larger dilution may be used if needed Transfer 200 LL of the diluted sample into a labelled Eppendorf tube 4 Warm for 3 min at 37 2 C in a heating block Add 2 uL of SYBR Green I working solution The volumes of the sample and stain may be altered but a stain dilution of 100x should be maintained Vortex briefly and incubate in the dark for 10 min at 37 2 C Transfer just before measurement 50 uL of the stained sample into 450 uL of particle free water to achieve a 10 fold dilution The volumes may be adapted for different instrument requirements This final dilution may be omitted if the cell density is already low enough Vortex briefly and measure Flow cytomtric measurement 1 Load the sample in the FCM and measure 2 Usea pre prepared template for measuring bacteria 3 The trigger or threshold should be set on green fluorescence and the instrument set up should be in such a manner as to allow visualisation of all cells stained with SYBR Green I Specific instrument settings will differ between instruments but an example is demonstrated in the Expected Res
99. References Chaine A S Schtickzelle N Polard T Huet M amp Clobert J 2010 Kin based recognition and social aggregation in a ciliate Evolution 64 1290 1300 Fellous S Duncan A Coulon A l amp Kaltz O 2012 Quorum Sensing and Density Dependent Dispersal in an Aquatic Model System PLoS ONE 7 e48436 Fjerdingstad E Schtickzelle N Manhes P Gutierrez A amp Clobert J 2007 Evolution of dispersal and life history strategies Tetrahymena ciliates BMC Evolutionary Biology 7 133 Fronhofer E A amp Altermatt F 2014 Eco evolutionary dynamics during experimental range expansions Nature Communications in review Fronhofer E A Kropf T amp Altermatt F 2014 Density dependent movement and the consequences of the Allee effect in the model organism Tetrahymena Journal of Animal Ecology in press DOI 10 1111 1365 2656 12315 Gause G F 1934a Experimental analysis of Vito Volterra s mathematical theory of the struggle for existence Science 79 16 17 Gause G F 1934b The Struggle for Existence Dover Publications Mineaola N Y Hauzy C Hulot F D Gins A amp Loreau M 2007 Intra and interspecific density dependent dispersal in an aquatic prey predator system Journal of Animal Ecology 76 552 558 Luckinbill L S 1979 Selection and the r K Continuum in Experimental Populations of Protozoa The American Naturalist 113 427 437 Luckinbill L S amp Fenton M M 197
100. SELECTION EXPERIMENTS It is nowadays generally accepted that evolutionary dynamics are often co occurring and interacting with ecological dynamics Fig 1 Experi mental evolution and selection experiments in microcosms are a unique opportunity to study these processes in real time with sufficient replica tion Protists are well suited due to their short generation times and high population densities see Section 1 1 Furthermore they can be preserved over long time periods Section 1 6 and 1 7 and genetic techniques Section 2 7 including genomics Section 2 5 allow relat ing phenotypic evolution to its genetic basis Kawecki et al 2012 give a good overview on the prerequisite and conductance of experimental evolution and selection experiments Examples for the use of protists in experimental evolution and selection experiments comprise early selec tion experiments on r and K strategies in Paramecium Luckinbill 1979 the evolution of body size and growth rates in response to preda tion using Colpoda in Sarracenia pitcher plants TerHorst 2010 the A user s guide for protist microcosms 227 evolution of virulence using Paramecium and its bacterial parasite Ho lospora Magalon et al 2010 and dispersal evolution during range expansions with Tetrahymena Fronhofer amp Altermatt Submitted Note that exactly because of their suitability for evolutionary experi ments protists can unintentionally undergo evolutionary changes dur
101. Supplementary Information Altermatt et al 2015 Methods in Ecology and Evolution DOI 10 1111 2041 210X 12312 1 1 Species used specific experiments e g to study predator prey relationships e g Holyoak 2000b Vasseur amp Fox 2009 compare trait related relationships across orders of magnitude Giometto et al 2013 or to study how phylogenetic relationships are affecting competitive interactions Violle et al 2011 Importantly it needs to be considered that A many trait values are phenotypically plastic and can vary easily within one order of magnitude given the specific experimental conditions B protists often do not fall easily into well defined categories that higher organisms do and that are often used as inspiration for models and concepts to be tested with protists For example many protists may switch between different trophic roles from heterotroph mixotroph to autotroph e g Euglena gracilis or from autotroph to predatory e g Paramecium bursaria Thus some of the classifications may be stricter than the actual behaviour life history of the protists C Protists as used here cover the widest phylogenetically range possible within the Eucaryotes Adl et al 2012 Thus comparisons that include phylogeny as an explanatory variable may be only meaningful within sub groups such as Alveolates see for example Violle et al 2011 as phylogenetic signals across major taxonomic groups may be mostly lost through multipl
102. Tetrahymena thermophila ciliates a reaction norm perspective Evolution 68 2319 2330 Seymour M amp Altermatt F 2014 Active colonization dynamics and diversity patterns are influenced by dendritic network connectivity and species interactions Ecology and Evolution 4 1243 1254 Seymour M Fronhofer E A amp Altermatt F 2014 Dendritic network structure and dispersal affect temporal dynamics of diversity and species persistence in prep Warren P H 1996 Dispersal and destruction in a multiple habitat system an experimental approach using protist communities Oikos 77 317 325 125 Supplementary Information Altermatt et al 2015 Methods in Ecology and Evolution DOI 10 1111 2041 210X 12312 3 6 Temperature manipulation Supplementary information for Altermatt et al Methods in Ecology and Evolution DOI 10 1111 2041 210X 12312 Big answers from small worlds a user s guide for protist microcosms as a model system in ecology and evolution Altermatt F Fronhofer EA Garnier A Giometto A Hammes F Klecka J Legrand D Machler E Massie TM Pennekamp F Plebani M Pontarp M Schtickzelle N Thuillier V amp Petchey OL 3 6 Temperature manipulation Introduction Manipulating the temperature of microcosms is relatively straightforward with the most important considerations concerning good experimental design E g avoiding or accounting for pseudoreplication avoiding systematic non independence of other
103. YBR Green I as described above and analyled at an appropriate dilution Figure 2A shows the green and red fluorescence intensities arbitrary units of ca 1500 bacterial cells in a clear cluster separated from background and instrument noise with electronic gating Figure 2B shows the forward and sideward scatter intensities of the same cells which are indicative of cell size again forming a relatively homogenous cluster B04 growthCurve Bact rep4 B04 growthCurve Bact rep4 Gate No Gating Gate Bacteria l 1 I 1 I I 1 1 I i i I Bacteria 5 5 3 E 5 6 FL1 A FL1 A Figure 2 Flow cytometric density plots of an undefined bacterial community stained with SYBR Green I FL1 green fluorescence 530 nm FL3 red fluorescence 2610 nm FSC forward scatter SSC sideward scatter References Giometto A Carrara F Rinaldo A amp Altermatt F 2014 Emerging predictable features of replicated biological invasion fronts Proceedings of the National Academy of Sciences 111 297 301 Hammes F amp Egli T 2010 Cytometric methods for measuring bacteria in water advantages pitfalls and applications Analytical and Bioanalytical Chemistry 397 1083 1095 Limberger R amp Wickham S 2011 Competition colonization trade offs in a ciliate model community Oecologia 167 723 732 Prest E I Hammes F K6tzsch S van Loosdrecht M C M amp Vrouwenvelder J S 2013 Monitoring microbiological chang
104. a Chloroplastida Robinson amp Edgemon 1988 Kneitel amp Perrault 2006 genus Li amp Stevens 2010 CommEcol Bretthauer 1980 Filip et al 2012 Filip et al 2012 Limberger amp Wickham 2011 PLoSOne Limberger amp Wickham 2010 Fox et al 2000 McGrady Steed et al 1997 McGrady Steed amp Morin 2000 Fitter amp Hildebrand 2009 Jin et al 1991 Robinson amp Edgemon 1988 Gross 2000 Dickerson amp Robinson 1985 Dickerson amp Robinson 1986 Robinson amp Edgemon 1988 Bretthauer 1980 Limberger amp Wickham 2011 Oecologia Limberger amp Wickham 2012 Robinson amp Edgemon 1988 Robinson amp Edgemon 1988 Hiltunen et al 2013 Fox et al 2000 Krumins et al 2006 Li amp Stevens 2010 CommEcol Robinson amp Edgemon 1988 Have 1993 DeLong amp Vasseur 2012 Fox 2008 Luckinbill 1973 Petchey 2000 Altermatt et al 2011 Cadotte 2006 Ecol Vandermeer 1969 Violle et al 2011 EcoLet Fellous et al 2012 PLoSOne Duncan et al 2011 Fels et al 2008 Lunn et al 2013 Dickerson amp Robinson 1986 Naeem amp Li 1998 Robinson amp Dickerson 1987 Luckinbill amp Fenton 1978 Luckinbill 1979 AmNat Cohen et al 1998 Gonzales amp Holt 2002 Jiang amp Kulcycki 2004 Long amp Karel 2002 Ostman et al 2006 Livingston et al 2013 Robinson amp Edgemon 1988 Naeem amp Li 1998 Spencer amp Warren 1996 Oikos Dickerson amp Robinson 1985 Fox 2008 genus Robinson amp Edgemon 1988 genus Spen
105. a progressive and controlled cooling down Thawing also requires specific precautions to limit the thermic shock and ensure cells go rapidly back to normal reproduction All solutions and material in contact with the cell cultures must be sterile Freezing This protocol has been optimized for Tetrahymena by Nicolas Schtickzelle Linda Dhondt both Universit catholique de Louvain Biodiversity Research Centre Belgium and Mich le Huet Station d Ecologie Exp rimentale du CNRS Moulis France on the basis of the protocol described by Cassidy Hanley 2012 but is likely a good basis for many protists It spans a period of 13 days optimized weekday for each step is indicated to avoid working during weekends The quantities given allow the preparation of 8 cryotubes per culture sample As revival success cannot be 100 guaranteed for each thawed tube we strongly advise against decreasing the number of cryotubes per culture sample If more cryotubes are desired adapt the quantities but be sure to respect the filling amount per recipient for optimal cell survival for example to make 16 cryotubes perform two 50 mL cultures each in a separate 500 mL Erlenmeyer instead of one single 100 mL culture To avoid variation between lots these cultures can be mixed together to get one single homogeneous culture and then divided back at step 3 and again at step 5 Timing information is indicative given for one culture frozen as a set of 8 cryotubes and
106. a sufficient depth of field such that all individuals are in the focal plane They do however restrict the volume sampled which may be problematic if species are at low abundance Sampling several samples or taking repeated samples from different areas of the counting slide would mitigate this limitation Condensation on the walls of the disposable chambers might impede the recording of videos To avoid such inconvenience the use of cell culture flasks with ventilated top is recommended Sampling in situ using transparent culture vessels such as Petri dishes or cell culture flasks may be used for non invasive sampling of the cultures if the depth of field can be extended for example due to the use of diaphragms build into the microscope or customized solutions Software Many software solutions for image and video analysis exist however ImageJ Image Processing and Analysis in Java developed at the National Institutes of Health is among the most popular ImageJ is a widely used open source solution which is fast user friendly and well supported by a user community Many cutting edge segmentation methods are quickly adopted and plug ins for specific tasks such as tracking are readily available For video tracking Dell et al 2014 provide an overview of software ranging from commercial to open source solutions In addition software to automate the merging of results and following analysis is generally advised Computer hardware and disk s
107. ady Steed et al 1997 genus Fox et al 2000 genus Have 1993 genus Gross 2000 Gross 2000 Bretthauer 1980 Have 1990 Livingston er al 2013 Violle et al 2011 Jiang amp Patel 2008 Gross 2000 Gross 2000 Dickerson amp Robinson 1985 Dickerson amp Robinson 1986 Fox 2004 Livingston et al 2013 Have 1993 Jiang et al 2009 Livingston et al 2013 Violle et al 2010 McGrady Steed et al 1997 genus Davies et al 2009 Fox et al 2000 Have 1993 Have 1993 Jiang et al 2009 Cadotte amp Fukami 2005 genus Gross 2000 Fukami 2001 Ostman et al 2006 Have 1990 Clements et al 2013 JAnimEcol genus Jiang amp Morin 2005 genus Steiner 2005 genus Have 1993 Supplementary Information Altermatt et al 2015 Methods in Ecology and Evolution DOI 10 1111 2041 210X 12312 1 1 Species used Mallomonas caudata Mayorella sp Micrasterias rotata Monas sp Nassula sorex Navicula pelliculosa Netrium sp Nitzschia sp Nonion commune Ochromonas danica Ochromonas sociabilis Onychodromopsis flexilis Oocystis apiculata Ophiocytium maius Oxyrrhis marina Oxytricha sp Pandorina morum Paradileptus sp Paramecium aurelia Paramecium bursaria Paramecium caudatum Paramecium multimicronucleatum Paramecium primaurelia Paramecium tetraurelia Paramecium trichium Pediastrum sp Pelomyxa carolinensis Peranema trichophorum Peridinium cinctum f ovoplanum Petalomonas sp Phac
108. ak 2011 the significance of trade offs e g Cadotte 2007a Violle Pu amp Jiang 2010 synchrony in population dynamics e g Vasseur amp Fox 2009 effects of environmental change on food web structure and species interactions e g Petchey et al 1999 Fox amp Morin 2001 the study of predator prey interactions and inducible defences Kratina et al 2009 Kratina Hammill amp Anholt 2010 the regulatory effects of biodiversity on ecosystem processes e g McGrady Steed Harris amp Morin 1997 invasion dynamics e g Machler amp Altermatt 2012 Giometto et al 2014 the significance of spatial dynamics on diversity and species interactions e g Holyoak amp Lawler 1996 Carrara et al 2012 scaling laws in ecology e g Fenchel 1974 Giometto et al 2013 epidemiological dynamics e g Fellous et al 2012 and evolutionary and eco evolutionary dynamics e g Dallinger 1887 Schtickzelle et al 2009 Hiltunen et al 2014 Table S1 List of species used in protist microcosm experiments alphabetically sorted from higher to lower taxonomic levels The name of each species as well as its higher and lower taxonomic classification after Adl et al 2012 is given For each species we give one or few representative references of studies that have been using it SAR is a clade including the groups Stramenopiles Alveolata and Rhizaria Species name Higher Lower Reference examples taxonomic taxonomic group gro
109. al Standing Water in Costa Rica Ecology 53 291 293 Vasseur D A amp Fox J W 2009 Phase locking and environmental fluctuations generate synchrony in a predator prey community Nature 460 1007 1010 Veilleux B G 1979 An Analysis of the Predatory Interaction Between Paramecium and Didinium Journal of Animal Ecology 48 787 803 Violle C Nemergut D R Pu Z amp Jiang L 2011 Phylogenetic limiting similarity and competitive exclusion Ecology Letters 14 782 787 Violle C Pu Z amp Jiang L 2010 Experimental demonstration of the importance of competition under disturbance Proceedings of the National Academy of Sciences 107 12925 12929 Warren P H 19962 Dispersal and destruction in a multiple habitat system an experimental approach using protist communities Oikos 77 317 325 Warren P H 1996b The effects of between habitat dispersal rate on protist communities and metacommunities in microcosms at two spatial scales Oecologia 105 132 140 Worsfold N T Warren P H amp Petchey O L 2009 Context dependent effects of predator removal from experimental microcosm communities Oikos 118 1319 1326 eT Supplementary Information Altermatt et al 2015 Methods in Ecology and Evolution DOI 10 1111 2041 210X 12312 1 2 Culture medium Supplementary information for Altermatt et al Methods in Ecology and Evolution DOI 10 1111 2041 210X 12312 Big answers from small worlds a user s guide
110. alic gt Tetrahymena lt italic gt Species Reveals Mutation Hot Spots and Accelerated Nonsynonymous Substitutions in italic Y mf italic Genes PLoS ONE 2 e650 Nassonova E Smirnov A Fahrni J amp Pawlowski J 2010 Barcoding amoebae comparison of SSU ITS and COI genes as tools for molecular identification of naked lobose amoebae Protist 161 102 115 86 Supplementary Information Altermatt et al 2015 Methods in Ecology and Evolution DOI 10 1111 2041 210X 12312 2 7 DNA sequencing and barcoding Pawlowski J Audic S p Adl S Bass D Belbahri L d Berney C d Bowser S S Cepicka I Decelle J Dunthorn M Fiore Donno A M Gile G H Holzmann M Jahn R Jirk M Keeling P J Kostka M Kudryavtsev A Lara E Lukez J Mann D G Mitchell E A D Nitsche F Romeralo M Saunders G W Simpson A G B Smirnov A V Spouge J L Stern R F Stoeck T Zimmermann J Schindel D amp de Vargas C 2012 CBOL Protist Working Group Barcoding Eukaryotic Richness beyond the Animal Plant and Fungal Kingdoms PLoS Biol 10 e1001419 Prescott D M 1994 The DNA of ciliated protozoa Microbiol Rev 58 233 267 Slapeta J Moreira D amp Lopez Garcia P 2005 The extent of protist diversity insights from molecular ecology of freshwater eukaryotes Proc Biol Sci 272 2073 2081 Stern R F Horak A Andrew R L Coffroth M A Andersen R A Kupper F C Jam
111. alled X L and Y connectors are used to create different network connectivities 122 Supplementary Information Altermatt et al 2015 Methods in Ecology and Evolution DOI 10 1111 2041 210X 12312 3 5 Spatial structure 2 Make sure that the total amount of connectors length of tubing and subsequently volume of medium in the landscapes are identical across treatments and that only the network structure differs 3 Use vertically placed T connectors to insert sampling localities Silicon stoppers are used to close them 4 Landscapes need to be fixed on a completely horizontal shelf or on a sheet but can only be moved when all openings are closed 5 Fill the landscape with medium all connectors open such that the medium can flow across the whole system and fill it Filling through one opening T connector prevents formation of air bubbles in the tubing e g happens when filled from two sites simultaneously Air bubbles need to be removed This can be done with a syringe and sterile needles whereby air bubbles are sucked out by inserting the needles into the silicon tubing at the place the air bubble formed 6 Close all T connector openings for filling in species or sampling Therefore remove first the amount of medium that will be replaced by medium containing species Always make sure that sampling adding medium happens when all openings except the one being sampled are closed and make sure that there is a zero net change i
112. ang W E Gibson C M Fowler P W amp Jousset A 2013 Stable Isotope Probing and Raman Spectroscopy for Monitoring Carbon Flow in a Food Chain and Revealing Metabolic Pathway Analytical Chemistry 85 1642 1649 Wagner M 2009 Single Cell Ecophysiology of Microbes as Revealed by Raman Microspectroscopy or Secondary Ion Mass Spectrometry Imaging Annu Rev Microbiol 63 411 429 80 Supplementary Information Altermatt et al 2015 Methods in Ecology and Evolution DOI 10 1111 2041 210X 12312 2 7 DNA sequencing and barcoding Supplementary information for Altermatt et al Methods in Ecology and Evolution DOT 10 1111 2041 210X 12312 Big answers from small worlds a user s guide for protist microcosms as a model system in ecology and evolution Altermatt F Fronhofer EA Garnier A Giometto A Hammes F Klecka J Legrand D Machler E Massie TM Pennekamp F Plebani M Pontarp M Schtickzelle N Thuillier V amp Petchey OL 2 7 DNA Sequencing and Barcoding Introduction DNA sequencing of protist species is done to analyse population dynamics Hajibabaei et al 2011 Zufall Dimon amp Doerder 2013 or genetic diversity of species complex e g Catania et al 2009 for comparative studies Gray et al 1998 or to understand the evolution of gene and genomes Brunk et al 2003 Chen Zhong amp Monteiro 2006 Moradian et al 2007 DNA barcoding is a special case of sequencing focusing on a short and conserved p
113. anley D M 2012 Tetrahymena in the laboratory strain resources methods for culture maintenance and storage Methods in Cell Biology Tetra hymena Thermophila ed K Collins pp 239 276 Academic Press Amster dam Catania F Wurmser F Potekhin A A Przybos E amp Lynch M 2009 Genetic diversity in the Paramecium aurelia species complex Molecular Biol ogy and Evolution 26 421 431 Clements C F Collen B Blackburn T M amp Petchey O L 2014 Effects of directional environmental change on extinction dynamics in experimental microbial communities are predicted by a simple model Oikos 123 141 150 Dallinger W H 1887 The president s address Journal of the Royal Microscopi cal Society 7 185 199 Davies K F Holyoak M Preston K A Offeman V A amp Lum Q 2009 Fac tors controlling community structure in heterogeneous metacommunities Journal of Animal Ecology 78 937 944 Dell A I Bender J A Branson K Couzin I D de Polavieja G G Noldus L P J J et al 2014 Automated image based tracking and its application in ecology Trends in Ecology amp Evolution 29 417 428 DeLong J P amp Vasseur D A 2012 Coexistence via resource partitioning fails to generate an increase in community function PLoS ONE 7 406 411 Drake J amp Kramer A 2012 Mechanistic analogy how microcosms explain nature Theoretical Ecology 5 433 444 Duharcourt S Lepere G amp Mey
114. aramecium aurelia and its predator Didinium nasutum Since then several hundred studies have used such protist microcosm systems with dozens of studies being published every year over the last decade Research areas include the phylogenetic limiting similarity hypothesis e g Violle Pu amp Jiang 2010 effects of disturbance and pro ductivity on diversity e g Haddad et al 2008 Altermatt Schreiber amp Holyoak 2011b the significance of trade offs e g Cadotte 2007 Violle Pu amp Jiang 2010 synchrony in population dynamics e g Vasseur amp Fox 2009 effects of environmental change on food web structure and species interactions e g Petchey et al 1999 Fox amp Morin 2001 the study of predator prey interactions and inducible defences e g Kratina et al 2009 Kratina Hammill amp Anholt 2010 the regulatory effects of biodiversity on ecosystem processes e g McGrady Steed Harris amp Morin 1997 invasion dynamics e g M chler amp Altermatt 2012 Giometto et al 2014 the significance of spatial dynamics on diversity and species interactions e g Holyoak amp Lawler 1996b Carrara et al 2012 scaling laws in ecology e g Fenchel 1974 Gio metto et al 2013 epidemiological dynamics e g Fellous et al 2012b and evolutionary and eco evolutionary dynam ics e g Dallinger 1887 Schtickzelle et a 2009 Hiltunen et al 2014 In almost all of the above mentioned studies variations of the basic methods
115. are common experimental habitats Care needs to be taken when making habitats as for example silicone glue even if recommended for aquaria use often contains antifouling chemicals e g Altermatt amp Holyoak 2012 1 5 LABORATORY PRACTICES A clean and tidy laboratory can make the difference between success and failure of protist experiments Thus reproducible and standardized laboratory routines are highly recommended Experiments with pro tists may or may not be carried out in sterile conditions e g Fellous et al 2012b Pennekamp et al 2014b depending on the variables that need to be measured and or kept under control An important practice is to avoid the spread escape of protists from laboratory cultures into natural ecosystems thus all material used in the laboratory should be disposed of appropriately e g autoclaving or rinsing with bleach 1 6 LONG TERM MAINTENANCE OF STOCK CULTURES Keeping stock cultures over long periods of time e g years is often desirable as it allows using the same strains and species across different experiments e g Section 3 8 A classical example are protist species isolated by the laboratory of Peter Morin McGrady Steed Harris amp Morin 1997 which have been subsequently used in dozens of studies over many years e g Fox amp Morin 2001 Petchey et al 2002 Jiang amp Morin 2005 Haddad er al 2008 Altermatt Schreiber amp Holyoak 2011b Depending on the species stock culture
116. arren P H amp Beckerman A P 2005 The combined effects of energy and disturbance on species richness in protist microcosms Ecology Letters 8 730 738 Sonneborn T M 1950 Methods in the general biology and genetics of paramecium aurelia Journal of Experimental Zoology 113 87 147 25 Supplementary Information Altermatt et al 2015 Methods in Ecology and Evolution DOI 10 1111 2041 210X 12312 1 3 Bacteria Supplementary information for Altermatt et al Methods in Ecology and Evolution DOT 10 1111 2041 210X 12312 Big answers from small worlds a user s guide for protist microcosms as a model system in ecology and evolution Altermatt F Fronhofer EA Garnier A Giometto A Hammes F Klecka J Legrand D Machler E Massie TM Pennekamp F Plebani M Pontarp M Schtickzelle N Thuillier V amp Petchey OL 1 3 Bacteria Introduction Bacteria to add For non axenic cultures it is advised to add a set of known bacteria as food source Generally this happens in a two step process In a first step bacteria cultures are individually grown to carrying capacity in medium to be used in the experiment From these stock cultures a small inoculum is then transferred to the actual medium used in the experiment where bacteria are allowed to grow for a short time e g 12 to 24 hours before the medium is then used to cultivate protists We recommend individually growing an extensive volume e g 1 L of each bacterium s
117. at the Waste Container is empty and fill the Storage container with clean CAS Yton 3 Fit the desired capillary and the external electrode on the main unit 4 Place a CASYcup with 10 mL of CASYton on the sample platform with both the capillary and the external electrode in the solution 5 Setup Select the appropriate measuring setup under File Setup Management and click Activate or manually change the measurement and display parameters in the Measure and Display menus Refer to the user manual to save user defined measuring setups 6 Background measurement Perform a measurement to check the background counts If the total counts are too high gt 100 counts mL for the 150 um 200 69 Supplementary Information Altermatt et al 2015 Methods in Ecology and Evolution DOI 10 1111 2041 210X 12312 2 4 Particle counter um measuring capillaries and gt 200 counts mL for the 60 um capillary refer to user manual for the 45 um capillary perform a 3x Clean cycle and replace the CASYcup with one containing clean CASYton Repeat the measurement until the background is below the threshold Please refer to the troubleshooting section or the user manual for typical errors displayed by the CASY in this step 7 Sample preparation Pipette 10 mL of CASYton in a clean CASYcup Mix the sample and pipette the desired volume of the cell suspension in the CASYcup Close the CASYcup with the provided lid and mix gently The aliquot of sample de
118. atify characteristically in sufficiently high unstirred vials This can be due to oxygen availability for example Consequently the vertical positioning of patch connections can lead to differential dispersal and severe artefacts Especially in continuous time and space setups the flow of medium has to be exactly controlled and limited to a minimum if the effect is not intended Often this can be achieved by constructing microcosm landscapes that are completely air tight If landscapes are not moved this reduces the unintended exchange of individuals to a minimum References Altermatt F Bieger A Carrara F Rinaldo A amp Holyoak M 2011 Effects of connectivity and recurrent local disturbances on community structure and population density in experimental metacommunities PLoS ONE 6 e19525 Altermatt F amp Holyoak M 2012 Spatial clustering of habitat structure effects patterns of community composition and diversity Ecology 93 1125 1133 Altermatt F Schreiber S amp Holyoak M 2011 Interactive effects of disturbance and dispersal directionality on species richness and composition in metacommunities Ecology 92 859 870 Bell G amp Gonzalez A 2011 Adaptation and Evolutionary Rescue in Metapopulations Experiencing Environmental Deterioration Science 332 1327 1330 Cadotte M W 2007 Competition colonization trade offs and disturbance effects at multiple scales Ecology 88 823 829 Cadotte M W
119. ating abundances by eye Microscopy Datasheet for recording information Such a sheet should report the information as follows Date deteotoose ctun madd Sampler name o orecce ud Experiment 2e det tel Me DER UH C RR ERR e e eds Experimental Time Species Volume 1 Volume 2 Volume 3 Cell Notes Unit unique count ID 200 ul pipette and 1000 ul pipette Gilson type with their sterile tips or balance accurate to 0 01g sterile Pasteur pipettes with teats Reagents Ethanol 70 Immersion oil Protist Pellet Medium PPM for dilution the diluent in a jar must not contain any protists Procedure Counting protists with a dissecting microscope can be done using two different methods using a Gilson type pipette or using a balance Counting protists using a Gilson type pipette 1 Enter onto the datasheet that you are using this method Do not switch between methods 2 Ensure that microcosms are out of the experimental environment for as short a time as possible Get a plastic Petri dish ready to receive a sample Loosen the lid of the microcosm so it can be removed with one hand Get a pipette with sterile tip ready in one hand Swirl the microcosm to well mix the contents Remove lid with one hand do not put down the lid withdraw a sample with the pipette that you have in your other hand replace the lid The volume of ND RU this sample is Volu
120. ation as required If the drops contain few enough individuals count 57 Supplementary Information Altermatt et al 2015 Methods in Ecology and Evolution DOI 10 1111 2041 210X 12312 2 2 Estimating abundances by eye Microscopy 12 13 14 15 16 17 now using a clicker counter to make a running total across all the drops you need record only the total number of individuals in all drops not the number in each drop Move from one drop to the other to avoid missing any If the drops contain too many individuals to count you need to dilute Put a suitable amount of diluent into the Petri dish and mix well with the sample by squirting in and out of the pipette Put the dish onto the balance again and record the new weight due to the volume of diluent plus the original amount of volume in column Volume 2 on the datasheet Get a fresh plastic Petri dish ready to receive a sample of the diluted sample put it onto the balance tare the balance put the dish back on the desk Mix the diluent well with the sample by squirting in and out of the pipette Now do steps 9 10 11 on this diluted liquid except the volume in step 9 is now Volume 3 on the datasheet Withdraw a new sample from this diluted liquid and put it in small drops onto a new Petri dish The new sampling volume is now Volume 3 on the datasheet Make sure on the datasheet you have written the number of cells observed in column Cell count
121. atistical analysis e g R or Mathworks Matlab Subtraction of the debris peak is required when the body size distribution of the study species overlaps with the debris peak The debris peak is typically found to be exponentially decaying in the region adjacent to the viable cells peak An exponential fit of the debris size distribution in such region allows the extraction of the species size distribution 10 Fill a CASYcup with clean CAS Yton place it in the sample platform and perform a Clean cycle 11 To perform another measurement repeat from step 7 Please note that the above procedure is a typical one Details of the measurement e g number of cycles per measurement volume per cycle number of measurements per sample depend on the concentration and body size distribution of the sample Abundant organisms e g density gt 10 mL and equivalent diameter gt 10 um with 710 Supplementary Information Altermatt et al 2015 Methods in Ecology and Evolution DOI 10 1111 2041 210X 12312 2 4 Particle counter measuring capillary 150 um and 200 um like Euglena gracilis see Fig Sla are ideal for use with the CASY and one measurement per sample usually suffices to measure a smooth body size distribution Less abundant species e g density 10 mL and equivalent diameter gt 10 um with measuring capillary 150 um and 200 um like Euplotes aediculatus might require more than one measurement per sample to obtain a sm
122. be used directly and the only crucial and organism dependent step is molecule extraction Although stan dard protocols of DNA see Section 2 7 or RNA isolation can be used in protists e g silica column methods Xiong ef al 2012 slightly adapted protocols result in more accurate results Cultured cell protein extraction kits e g Protein extraction from Tissues and Cultured Cells using Bioruptor Diagenode Denville NJ USA can be very useful in protists some of them providing directly usable samples for mass spec trometry methods Pierce Mass Spec Sample Prep Kit for Cultured Cells Thermo Scientific Waltham MA USA Epigenetic phenomena have long been described Strahl et al 1999 Gutierrez et al 2000 Swart et al 2014 and studies mostly concentrate on the role of small RNAs on the macronuclear development in the cili ate two nucleus group Duharcourt Lepere amp Meyer 2009 Common techniques consist of a gel based excision of small RNAs from total RNA extractions that are further used to construct libraries e g Singh et al 2014 Although not yet used in experimental protist microcosms such libraries could serve as basis to assess the role of epigenetic changes in protist adaptation to environmental changes In analogy DNA methylation in the context of environmental change can be stud ied using sodium bisulfite conversion or immunoprecipitation Bracht Perlman amp Landweber 2012 2 9 RESPIROMETER A key variable
123. being made Microcosms are fitted with a guide to ensure the fibre optic cable is correctly placed Photos by Owen Petchey Polagraphic electrode dissolved oxygen sensors can also be used to measure dissolved oxygen concentrations which could then also be transformed into measures of gas production consumption Polargraphic oxygen sensors consist of anode cathode and electrolyte solution separated from the sample liquid by a semi permeable membrane These are standard instruments for measuring dissolved oxygen and require that the sensor is dipped into the culture medium therefore care must be taken to prevent contaminations 100 Supplementary Information Altermatt et al 2015 Methods in Ecology and Evolution DOI 10 1111 2041 210X 12312 2 9 Respirometry Manometer based measures Manometer based measures involve placing the sample in a gas tight apparatus that include a compound that absorbs carbon dioxide Because carbon dioxide is absorbed respiration results in reduced pressure within the apparatus Therefore the measurement of pressure changes for example with a manometer rube allows measuring respiration More sophisticated apparatuses include a transducer for converting pressure into an electrical signal that is sent to a computer As well as providing a digital measure of pressure change this signal can be used to trigger oxygen production so that the pressure and oxygen concentration in the apparatus remains consta
124. below need to be performed in a sterile environment if it is important to avoid the presence of bacteria other than those inoculated during step 1 adding bacteria to the sterile PPM from the microcosm vessels 1 Clear and wipe down an appropriately large amount of desk space 2 Put the flasks of bacterized medium at hand If you re being very careful and have multiple large flasks of bacterized media mix these up so to minimize any existing difference between flasks 3 Pour the appropriate volume of PPM in each of the microcosm vessels MV This can be done in two ways A By means of a precision scale i Take one empty MV and put it on the scale ii Tare the scale so that it reports zero weight with the empty MV on it iii Pour the exact volume of PPM required by means of a pipette iv Write down the weight shown by the scale as distilled water has a density of 1 g ml the number of grams shown should be very close to the number of ml poured v For all other MVs put them on the scale tare the scale and pour PPM until the scale shows the same value noted at step iv CRITICAL STEP tare the scale for each and every MV used B Using a MV as a reference for all the others This method is less precise but faster to execute than the one at point A 36 Supplementary Information Altermatt et al 2015 Methods in Ecology and Evolution DOI 10 1111 2041 210X 12312 1 5 Laboratory practices i Take one MV and put in
125. ble and accurate image and video analysis relies on an opti mized workflow regarding magnification illumination observation chamber image video processing and analysis algorithms and analysis of acquired data detailed protocols and code are given in Appendix SI to Section 2 3 and references therein Images can describe individ uals in terms of cell size cell shape coloration or movement e g Pennekamp amp Schtickzelle 2013 Fronhofer Kropf amp Altermatt 2014 Giometto et al 2014 A focus of video analysis has been to quantita tively describe the movement behaviour of microbes e g Fenchel 2001 Giometto et al 2014 but it is also a promising tool to describe and quantify how individuals react to intra and interspecific interactions Fig 1 ii Dell et al 2014 An R package tailored to automatically extract such information from videos of protist microcosms was recently developed Pennekamp Schtickzelle amp Petchey 20142 2 4 PARTICLE COUNTERS Both the number of individuals as well as their body size are important traits in population biology community and evolutionary ecology and thus of high interest to be measured Table 1 Besides image and video analysis Section 2 2 particle counters such as the commonly used CASY Model TT Cell Counter and Analyzer Roche detailed step by step protocols are given in Appendix S1 Section 2 4 can be used to measure size distributions and density of protist species both in
126. ccessful application of image and video analysis in protist microcosm experiments include measures of population dynamics in constant and fluctuating environments Laakso Loytynoja amp Kaitala 2003 Fjerdingstad et al 2007 dispersal Pennekamp et al 2014 movement Fronhofer amp Altermatt 2014 Fronhofer Kropf amp Altermatt 2014 Giometto et al 2014 morphology Fjerdingstad et al 2007 Pennekamp et al 2014 and behaviour Schtickzelle et al 2009 Chaine et al 2010 spanning levels of organization from the individual to the community level Digital image analysis is especially suited when more than abundance data is to be collected Dell et al 2014 for instance morphological or behavioural data on a large number of individuals across many treatments and replicates It is also highly convenient to scan large numbers of protist genotypes for ecologically important life history variation including traits like dispersal Fjerdingstad et al 2007 Pennekamp et al 2014 which is of high relevance for the field of phenomics and was used for instance with nematodes Yemini et al 2013 Because the experimenter will only take image and video samples from the experimental cultures the subjective component of manual counts which depends on the experience and skills of the experimenter is reduced Thus a number of people with different degrees of experience can collect data for a single experiment without observer bias and images video
127. ce this is in large part determined by the population density in the microcosm What if we need to have accurate counts of rare species We then have to sample a larger volume We could withdraw 5 ml place it into a sterile Petri dish count individuals in it and put it back into the media If we are fine with replacing 5 ml of fresh media at each sample we do not have to worry about sterility here What if my communities contain multiple species Use the same method but be ready to count some species in the undiluted sample and others in the diluted sample Two different dilutions may be required It may even be useful to couple sampling of small volumes for abundant species with larger volumes for rare species All this adds lots of time to the processes Sampling a community with 10 or more species can take over 15 minutes e You may find it useful to remove samples from multiple microcosms in the room with the incubator and then count them elsewhere This avoids lots of going back and forth or removing multiple microcosms from incubators for prolonged periods e Ifno dilution was necessary the mean cell density per ml equals to e Ifa dilution was necessary the mean cell density per ml is estimated as follows Cell count Volume 3 Volume 1 Volume 2 Anticipated results Reliable estimates of cell densities References Gause G F 1934 The Struggle for Existence Dover Publications Mineaola N Y Luckinbill L S
128. cedure is advised 1 Adda combination of 250 ug ml penicillin G 250 ug ml streptomycin sulfate and 1 25 ug ml amphotericin B Fungizone GIBCO to the focal protist culture kept in any type of media 2 Subsequently maintain sterile working procedures all work done in a sterile bench and cultures only opened after sterilizing caps with a Bunsen burner only use sterile equipment pipette tips jars etc 3 Let the culture grow at general maintenance conditions section 1 6 for four days 4 Check in a subsample for the presence of bacteria with a confocal microscope at 500 to 1000 fold magnification 28 Supplementary Information Altermatt et al 2015 Methods in Ecology and Evolution DOI 10 1111 2041 210X 12312 1 3 Bacteria 5 Additionally plate a subsample onto sterile agar plates to check for the formation of bacteria colonies 6 If there are still bacteria found in the culture add 2 ul ml Normocin InvivoGen to successfully eliminate bacteria Asai amp Forney 2000 and repeat steps 2 to 5 Timing 1 2 h for step 1 2 4 days for steps 2 and 3 culture growing 1 2 h for steps 4 24 h for step 5 growing phase 1 h for step 6 References Altermatt F Schreiber S amp Holyoak M 2011 Interactive effects of disturbance and dispersal directionality on species richness and composition in metacommunities Ecology 92 859 870 Asai D L amp Forney J D 2000 Tetrahymena thermophila Academic
129. cells Therefore to store 41 Supplementary Information Altermatt et al 2015 Methods in Ecology and Evolution DOI 10 1111 2041 210X 12312 1 7 Long term preservation 1 mL of sample about 5 microliters of Lugol s solution have to be added to have a final concentration 0 5 1 Take an empty vial and add the right amount of Lugol s solution 2 Add the sample with protists that you want to preserve Adding the Lugol s solution to an empty vial and then adding the sample ensures that it mixes properly 3 Close the vial and gently turn it upside down and back to mix the sample do not shake it too much 4 Remember that you cannot store samples in Lugol s solution indefinitely Storage up for several weeks to a few moths is usually fine Important Lugol s solution is light sensitive Store samples in the dark or better in brown glass bottles in the dark B Cryopreservation Introduction There are several reasons why long term storage of protist cultures using cryopreservation or cryoconservation i e storage at ultra cold temperatures below 130 C usually in liquid nitrogen LN2 is desired McAterr amp Davis 2002 Day amp Stacey 2007 Cassidy Hanley 2012 Firstly cryopreserved stocks act as a renewal backup cell banking from which standard liquid cultures of strains with a specific interest can be recreated when needed This is the primary raison d tre of protist culture collections see section
130. cer amp Warren 1996 Oikos Fox et al 2000 Gross 2000 Dickerson amp Robinson 1985 Livingston et al 2013 Kneitel amp Perrault 2006 Kadowaki et al 2012 Saleem et al 2012 genus Saleem et al 2013 genus Ostman et al 2006 terHorst 2010 AmNat terHorst 2010 JEB Gross 2000 Gross 2000 Fitter amp Hillebrand 2009 Gross 2000 Limberger amp Wickham 2011 Oecologia Gross 2000 Livingston et al 2013 Jin et al 1991 Li amp Stevens 2010 ComEcol Li amp Stevens 2010 Oikos Li amp Stevens 2012 Supplementary Information Altermatt et al 2015 Methods in Ecology and Evolution DOI 10 1111 2041 210X 12312 1 1 Species used Scenedesmus quadricauda Archaeplastida Chloroplastida Dickerson amp Robinson 1985 Dickerson amp Robinson 1986 Robinson amp Edgemon 1988 Selenastrum capricornutum Archaeplastida Chloroplastida Jin et al 1991 Sellaphora pupula SAR Stramenopiles Livingston et al 2013 Spathidium sp SAR Alveolata Fukami 2001 McGrady Steed amp Morin 1996 Sphaerocystis schroeteri Archaeplastida Chloroplastida Robinson amp Edgemon 1988 Spirogyra occidentalis Archaeplastida Chloroplastida Livingston et al 2013 Robinson amp Edgemon 1988 genus Spiroplectinella wrightii SAR Foraminifera Gross 2000 Spirostomum ambiguum SAR Alveolata Have 1990 Kratina et al 2007 Krumins et al 2006 Naeem amp Li 1998 Spencer amp Warreb 1996 Oikos Spirostomum teres SAR Alveolata Holt et al 2004 Vi
131. complex landscapes either linear setups or large networks of patches are possible A central choice the experimenter has to be aware of is the spatial theoretical framework should the experiment be carried out in a patch matrix setup or is continuous space more appropriate This has important implications for comparisons with theory and potential parametrisation and model fitting A similar decision has to be made for connectivity is a continuous time setup in which connections are never closed more suitable or does the experimenter prefer to impose discrete dispersal and reproduction phases All approaches have been used so far reaching from discrete time patch matrix to continuous time continuous space setups Materials Equipment Most microcosm landscapes will include building blocks such as vials that have already been described elsewhere in detail see section 2 Methods overview In order to avoid contamination with fungi or bacteria all materials including connections between vials patches must be either autoclavable or previously sterilized and for single use only As these materials especially metal and plastic parts may contain substances that are toxic for protists all materials have to be thoroughly tested before use This should happen in a controlled design and involve for instance the recording of growth curves to exclude that materials have deleterious effects on growth or on other variables of interest see sec
132. conservator and must not be neglected For safety reasons it is often recommended especially by companies selling cryogenic equipment to use vapour phase storage Indeed this limits the risks associated to LN2 entering the tubes when submerged which may lead to cryotube explosion during thawing see safety note above and or cross contamination between samples if contaminants float in the LN2 this latter risk is extremely important when working with biologically hazardous organisms However storage in the vapour phase is accompanied by a trade off limiting either cryoconservator capacity big liquid phase amp small vapour phase or its autonomy small liquid phase amp big vapour phase because autonomy straightly depends on the quantity of LN2 in the liquid phase Furthermore temperature is less stable and forms a vertical gradient in the vapour phase from 180 C to 140 C which might be critical for some protist species Recently a specific type dry phase of cryoconservator has been developed where LN2 circulates into a closed circuit with thermal transfer elements ensuring cryotubes are maintained at appropriate low temperature this technology ensures cryotubes are not in direct contact with LN2 either liquid or vapour Despite attractive in its principle this design may have two major disadvantages for some laboratories dry phase cryoconservators are largely more costly than liquid vapour phase ones and their autonomy in the
133. counting for pressure temperature salinity and pH Materials Equipment Oxygen cells and infrared CO sensors 97 Supplementary Information Altermatt et al 2015 Methods in Ecology and Evolution DOI 10 1111 2041 210X 12312 2 9 Respirometry These technologies provide a measurement of the concentration of oxygen or carbon dioxide in a sample of gas This sample of gas typically comes from the headspace above the liquid in a culture vessel The gas composition and changes in gas composition of the headspace reflect production and consumption of gases by the organisms in the liquid Rates of evolution of oxygen are calculated from the rate of change of oxygen in the headspace Devices employing this approach need some method of sampling the headspace and often this must involve the headspace being sealed from the atmosphere Sealing the headspace for long periods can cause large changes in dissolved oxygen and carbon dioxide concentrations An example device is the Micro Oxymax Closed Circuit Respirometer manufactured by Columbus Instruments This device has many settings including the option to refresh the headspace with atmospheric gas to avoid large deviations in dissolved oxygen and carbon dioxide concentrations The system automatically compensates for changes in pressure and temperature It also has the option to multiplex multiple vessels up to 80 into one respirometer so that respiration of multiple microcosms can be simultaneo
134. cs proteomics and epigenomics ecologists but Next Generation Sequencing NGS platforms and analytic tool developers generally provide help or services to achieve the task Omics have been proven very informative and powerful in a large number of recent studies but one can keep in mind that some strong limitations exist to these methods Troubleshooting may appear at each step of the workflow sample contaminations non reproducible results between techniques biases during amplification and or detection of the data divergent results in function of analytical and bioinformatic tools To overcome these limitations users often multiply the number of techniques and analyses and keep only concordant conclusions There is a series of general reviews on omics e g Ge Walhout amp Vidal 2003 Quackenbush 2004 Joyce amp Palsson 2006 Jex et al 2013 evolution of community composition chorecterization of intra specific diversity motecular boves of adaptotion ro eeviroemental changes processes of econysnem functioming ee ecological evolutionary quevtion determination of experimental design choice of sample and molecule DNA ANA protein epigenetic foctor an experimental procedure extraction and treatment of molecules 7 choles tripol kits etc pw Potion construction of Nbeeries Prem umapre cipstution etc microarroyx NGS MS HPLC etc Qs
135. ctrophotometer microplate reader Samples must be taken and placed in the device and provide an estimate of the respiration rate of organisms in that sample Any changes in composition or abundance of organisms during the colorimetry will cause deviation between the respiration in the microcosms and that measured by colorimetry Fig S2 A MicroResp starter kit image from http www microresp com micro_order html 99 Supplementary Information Altermatt et al 2015 Methods in Ecology and Evolution DOI 10 1111 2041 210X 12312 2 9 Respirometry Optode sensors Optodes also called chemical optical sensors are a relatively new tool measuring environmental variables such as gas concentration in liquids and gases The optode is stuck on the inside surface of a culture vessel and is read by a fibre optic cable placed on the outside of the culture vessel The fluorescence read by the fibre optic cable is related to the concentration of dissolved gas e g oxygen carbon dioxide Measurements are relatively fast a couple of seconds and require minimal training of personnel Apart from the presence of the optode there need be no disturbance associated with measurements Calculations are required to transform gas concentrations into measures of rates of gas production consumption Fig S3 Left A sensor optode by PreSens GmbH glued to the inner surface of a standard culture vessel Right A measurement of oxygen saturation
136. cts 4 Start the experiment 5 Remove microcosms from CTEs on when needed and for as short periods as possible e g for sampling 6 Monitor temperature in the CTEs during the experiment ideally with an independent probe in a dummy microcosm 7 Finish the experiment 8 Check the actual temperatures in the CTE closely match the desired temperatures Troubleshooting Microcosms can experience significant evaporation even with caps on if these are not tightened Be aware of and monitor for differential evaporation across temperatures with higher evaporation rates at higher temperatures Replace evaporate with distilled or reverse osmosis water If microcosms are not covered or if the CTE has strong air circulation evaporation will be faster References Beveridge O S Petchey O L amp Humphries S 2010 Mechanisms of temperature dependent swimming the importance of physics physiology and body size in determining protist swimming speed Journal of Experimental Biology 213 4223 4231 Fenchel T amp Finlay B J 1983 Respiration rates in heterotrophic free living protozoa Microbial Ecology 9 99 122 Fussmann K E Schwarzmueller F Brose U Jousset A amp Rall B C 2014 Ecological stability in response to warming Nature Climate Change 4 206 210 Jiang L amp Kulezycki A 2004 Competition predation and species responses to environmental change Oikos 106 217 224 Leary D J amp Petch
137. cts of space and enrichment on a predator prey system Ecology 55 1142 1147 Luckinbill L S 1979 Selection and the r K continuum in experimental popula tions of protozoa American Naturalist 113 427 437 M chler E amp Altermatt F 2012 Interaction of species traits and environmen tal disturbance predicts invasion success of aquatic microorganisms PLoS ONE 7 e45400 Magalon H Nidelet T Martin G amp Kaltz O 2010 Host growth con ditions influence experimental evolution of life history and virulence of a parasite with vertical and horizontal transmission Evolution 64 2126 2138 Massie T M Blasius B Weithoff G Gaedke U amp Fussmann G F 2010 Cycles phase synchronization and entrainment in single species phytoplank ton populations Proceedings of the National Academy of Sciences USA 107 4236 4241 McGrady Steed J Harris P M amp Morin P J 1997 Biodiversity regulates eco system predictability Nature 390 162 165 Moradian M M Beglaryan D Skozylas J M amp Kerikorian V 2007 Com plete mitochondrial genome sequence of three Tetrahymena species reveals mutation hot spots and accelerated nonsynonymous substitutions in Ymf genes PLoS ONE 2 e650 Novak M amp Wootton J T 2010 Using experimental indices to quantify the strength of species interactions Oikos 119 1057 1063 Patterson D J 2003 Free Living Freshwater Protozoa A Colour Guide Manson P
138. cultures and especially well suited to grow Tetrahymena sp under axenic conditions Cassidy Hanley 2012 196 296 Proteose peptone medium is rich enough to promote high cell densities The medium must be autoclaved and not filtered for sterilization as some particulate matter is required to induce formation of food vacuoles in Tetrahymena Cassidy Hanley 2012 Sterilized medium can be frozen in aliquots at 20 C for storage To get 1 L of total medium at pH 6 8 the following procedure is advised Asai amp Forney 2000 Cassidy Hanley 2012 1 Fill 950 mL of ready made Bristol medium into an autoclavable beaker with a minimum volume of 1 5 L 2 Fora 1 Proteose Peptone medium add 10 mL proteose peptone For a 2 Proteose Peptone medium add 20 mL proteose peptone Add 100 jl FeCl solution Facultative add 0 296 yeast extract e g Becton Dickinson Bring total volume to 1 L by adding Bristol medium Cover the beaker and autoclave the medium at 121 C for 15 20 minutes Before use the medium must cool down to the temperature used in the YH NM BuU experiment usually around 20 C ud Supplementary Information Altermatt et al 2015 Methods in Ecology and Evolution DOI 10 1111 2041 210X 12312 1 2 Culture medium 8 Label the medium bottle with the name of the medium type the initials of the person who made it and the date when it was made 9 The medium can be stored at 4 C for a few weeks it should be discarde
139. d when contaminations with bacteria are observed i e when medium gets cloudy Timing Preparation of medium 1 2 h autoclaving 0 5 h cooling down 12 h Protozoan pellet medium This medium is among the less defined media but very commonly used due to its simple preparation and suitability for relatively many species This medium is generally only used for bacterized cultures It can be used for a very wide range of protozoa cultures For long term or stock cultures heterotrophic cultures can additionally receive two autoclaved wheat seed per 100 ml medium The content of the Protozoan pellet medium and Protozoan pellets themselves is not very well defined Protozoan pellets are supposedly made of dried compressed organic material alfalfa The chemical composition with respect to nutrients of Protozoan Pellet medium is described in table S3 To get 1 L of total medium the following procedure is advised 1 Fill 1 L of deionized tap water or ready made Chalkley s medium into an autoclavable beaker with a minimum volume of 1 5 L 2 Add 0 44 g L ground up Protozoan pellets Cover the beaker and autoclave the medium at 121 C for 15 20 minutes 4 Before use the medium must cool down to the temperature used in the experiment usually around 20 C 5 Label the medium bottle with the name of the medium type the initials of the person who made it and the date when it was made 6 The medium can be stored at 4 C for a few weeks i
140. d be lowered to avoid reflections and uncontrolled illumination Next to the microscopes a calendar is given to reserve slots for individual work projects Photo by Florian Altermatt Materials Equipment Dissecting microscope with dark field illumination Multiple lens compound optical microscope Inverted optical microscope Vials many types are available Commonly used are i disposable Petri dishes used for counting protists with dissecting microscopes keep at hand at least three times as many 5 cm diameter plastic Petri dishes as microcosms to count in a plastic tub or box ii microscope slides which allow the observation of individual cells in detail ili Sedgewick Rafter cell counters they consist of a vial holding 1 ml of volume 1 mm deep with a reference grid with units of 1 mm x 1 mm They are useful for characterizing the micro plankton from field samples iv Haemocytometers and other counting chambers see photograph c they are provided with a reference grid with units of 1 um x 1 um allowing the count of very small protists and of bacteria A plastic tub to put used Petri dishes in Some paper towels Clicker counter Container for disposing of pipette tips or Pasteur pipettes About 1m of bench space Tissue for cleaning microscope optics Pen for writing on datasheet 55 Supplementary Information Altermatt et al 2015 Methods in Ecology and Evolution DOI 10 1111 2041 210X 12312 2 2 Estim
141. d distribution of copper in an aquatic microcsom under different alkalinity and hardness Chemosphere 22 577 596 Limberger R amp Wickham S 2012 Disturbance and diversity at two spatial scales Oecologia 168 785 795 Machler E amp Altermatt F 2012 Interaction of Species Traits and Environmental Disturbance Predicts Invasion Success of Aquatic Microorganisms PLoS ONE 7 e45400 Petchey O L McPhearson P T Casey T M amp Morin P J 1999 Environmental warming alters food web structure and ecosystem function Nature 402 69 T2 Scholes L Warren P H amp Beckerman A P 2005 The combined effects of energy and disturbance on species richness in protist microcosms Ecology Letters 8 730 738 Sousa W P 1984 The role of disturbances in natural communities Annual Review of Ecology and Systematics 15 353 392 Violle C Pu Z amp Jiang L 2010 Experimental demonstration of the importance of competition under disturbance Proceedings of the National Academy of Sciences 107 12925 12929 Warren P H 1996 Dispersal and destruction in a multiple habitat system an experimental approach using protist communities Oikos 77 317 325 Worsfold N T Warren P H amp Petchey O L 2009 Context dependent effects of predator removal from experimental microcosm communities Oikos 118 1319 1326 114 Supplementary Information Altermatt et al 2015 Methods in Ecology and Evolution DOI 10 11
142. d for Chalkley s medium Component Amount Concentration stock solution NaCl 5 mL L 2 g 100mL dH20 KCl 5 mL L 0 08 g 100mL dH20 CaCD 5 mL L 0 12 g 100mL dH20 Proteose peptone medium Bristol medium proteose peptone e g from BD Diagnostic Systems No 211684 or BD Diagnostic Systems No 212750 Available through retailers like Fisher Scientific FeCl Solution at a concentration of 270 mg FeCl 6H 0 per 10 ml 10 yM FeCl Facultativly 0 2 yeast extract e g Becton Dickinson or Oxoid L21 Protozoan pellet medium tap well water or Chalkley s solution Protozoan Pellet provided by Carolina Biological Supply Company Burlington NC Wheat hay wheat lettuce medium tap well water or Chalkley s solution organic wheat seeds or dry organic hay straw or dried baked organic lettuce Procedure Bristol medium To get 1 L of total medium the following procedure is advised 1 Fill about 900 mL of deionized water dH O into an autoclavable beaker with a minimum volume of 1 5 L 2 Add each of the components of table S1 in the order specified while stirring continuously 3 Bring total volume to 1 L by adding dH O 4 Cover the beaker and autoclave the medium at 121 C for 15 20 minutes 5 Before use the medium must cool down to the temperature used in the experiment usually around 20 C 6 Label the medium bottle with the name of the medium type the initials of the person who made it and the date whe
143. d to the tremendous amount of force that can be generated if LN2 is rapidly vaporised inside any closed space such as a cryotube The liquid to gas expansion ratio of nitrogen is 1 694 at 20 C and this will rapidly lead to explosion of sealed vials This safety risk must be particularly controlled when cryotubes are stored in the liquid phase of LN2 because LN2 can enter the cryotube Whereas this risk of explosion is relatively limited in the case of plastic cryotubes with screwtop closure because accumulating pressure will lead to leaks in the seal that will relieve the pressure dangers associated to LN2 spraying out of the tube injury or dissemination of the cryotube content must be taken into account To thaw cryotubes kept in the liquid phase a good practice is to move them in the vapour phase for 24 h to allow any trapped LN2 to slowly evaporate an easy way to apply this procedure in a liquid phase cryoconservator see below is to keep the top box of a rack above the maximal level of the liquid phase Materials Equipment We list here the standard equipment needed for successful cryopreservation of protists in LN2 Basic material to work with protist cultures under sterile conditions e g flow hood autoclave see section 1 4 Basic material to prepare culture media see section 1 2 and handle cultures such as beakers pipettes etc A centrifuge to concentrate cultures fitted with an appropriate rotor accepting large tube
144. directly controlled by the experimenter using a predefined pipetting scheme in an active dispersal setup connectivity patterns are controlled physically by the geometry of the setup including the number of physical connections between patches and the distances between these patches Alternatively instead of manipulating distance the time a given connection is open can be varied Both methods are roughly equivalent yet varying connection 119 Supplementary Information Altermatt et al 2015 Methods in Ecology and Evolution DOI 10 1111 2041 210X 12312 3 5 Spatial structure lengths may lead to complications during the landscape building process as setups may become highly complex While pipetting and passive dispersal allow for a high degree of control and environmental conditions such as gradient in solutes can be easily maintained some experiments may require actively dispersing organisms Active dispersal may be necessary either because the variable of interest is movement or dispersal behaviour Fjerdingstad et al 2007 Fellous et al 2012 Giometto et al 2014 Pennekamp et al 2014 or because potential trade offs for instance competition colonization trade offs Cadotte et al 2006 Cadotte 2007 Seymour Fronhofer amp Altermatt 2014 should not be disrupted Experimenters have a nearly unlimited flexibility in designing microcosm landscapes The simplest landscapes consist of two connected vials patches Evidently more
145. ditions However most of the species thrive better when bacteria see section 1 3 or microflagellates are present The selection of species is often a combination of practical reasons such as distinctness cultivability or availability and the respective question of interest e g functional types or size All species can in principle be collected directly from natural populations in ponds phytotelmata or other aquatic habitats see detailed protocol below This approach allows the use of co evolved potentially genetically diverse populations of natural co occurring species However the difficulties faced during the isolation cultivation and identification of naturally collected species often preclude this approach Many studies have thus been based on species either already available in laboratory stocks or commonly available from culture collections The most commonly used sources to order protist species are e UTEX culture collection of algae University of Texas Austin http web biosci utexas edu utex media aspx Culture Collection of Algae and Protozoa CCAP Scottish Marine Institute OBAN Argyll http www ccap ac uk e American Type Culture Collection Georgetown University in Washington DC http www lgcstandards atcc org en Products Cells and Microorganisms Protozoa aspx e Tetrahymena stock center University of Cornell Ithaca https tetrahymena vet cornell edu recipes php Scandinavian Cultur
146. diversity Research Centre Universit catholique de Louvain Croix du Sud 4 L7 07 04 B 1348 Louvain la Neuve Belgium Summary 1 Laboratory microcosm experiments using protists as model organisms have a long tradition and are widely used to investigate general concepts in population biology community ecology and evolutionary biology Many variables of interest are measured in order to study processes and patterns at different spatiotemporal scales and across all levels of biological organization This includes measurements of body size mobility or abundance in order to understand population dynamics dispersal behaviour and ecosystem processes Also a variety of manip ulations are employed such as temperature changes or varying connectivity in spatial microcosm networks 2 Past studies however have used varying methods for maintenance measurement and manipulation which hinders across study comparisons and meta analyses and the added value they bring Furthermore application of techniques such as flow cytometry image and video analyses and in situ environmental probes provide novel and improved opportunities to quantify variables of interest at unprecedented precision and temporal resolution 3 Here we take the first step towards a standardization of well established and novel methods and techniques within the field of protist microcosm experiments We provide a comprehensive overview of maintenance mea surement and manipulation methods
147. dricum Entosiphon sulcatum Eremosphaera viridis Eudorina elegans Euglena gracilis Euglena mutabilis Euplotes aediculatus Euplotes affinis Euplotes cf eurystomus Euplotes daidaleos Euplotes eurystomus Euplotes octocarinatus Euplotes patella Euplotes plumipes Euplotes surystomus Fragilaria capucina Frontonia angusta Gavelinopsis praegeri Gavelinopsis translucens Glaucoma myriophylli Glaucoma scintillans Glaucoma sp Globobulimina affinis Globocassidulina subglobosa Gonium pectorale Haematococcus lacustris Halteria grandinella Heliozoa sp Keronopsis sp Lacrymaria olor Lenticulina cultrata Leptopharynx sp Litonotus sp Loxocephalus simplex Loxophyllum helus Cryptophyta SAR SAR SAR SAR Archaeplastida SAR SAR SAR Archaeplastida Excavata Archaeplastida Archaeplastida Excavata Excavata SAR SAR SAR SAR SAR SAR SAR SAR SAR SAR SAR SAR SAR SAR SAR SAR SAR SAR Archaeplastida Archaeplastida SAR SAR SAR SAR SAR SAR SAR SAR SAR Cryptophyta Alveolata Alveolata Stramenopiles Alveolata Chloroplastida Alveolata Alveolata Alveolata Chloroplastida Discoba Chloroplastida Chloroplastida Discoba Discoba Alveolata Alveolata Alveolata Alveolata Alveolata Alveolata Alveolata Alveolata Alveolata Stramenopiles Alveolata Foraminifera Foraminifera Alveolata Alveolata Alveolata Forami
148. e Collection of Algae and Protozoa Marine Biological Section University of Copenhagen Copenhagen http www sccap dk Carolina Biological Supply Company Burlington NC http www carolina com e Sciento Company Manchester http www sciento co uk A difficulty shortcoming of field collected species strains is the often imprecise vague identification of species Most ecologists and evolutionary ecologists conducting protist microcosm experiments have relatively little taxonomic expertise regarding protists and thus identifications and naming of species has to be taken with care A set of identification manuals Foissner amp Berger 1996 Lee Leedale amp Bradbury 2000 Patterson 2003 as well as genetic barcoding techniques Pawlowski et al 2012 which are nowadays commonly available should allow an identification at least to the genus level The advantage of the use of a common set of species across studies and laboratories is the availability of prior information such as species traits Table S2 and the possibility to link findings across studies In this context some species from a set of about 20 protist species originally isolated by Peter Morin from a pond at Rutgers University McGrady Steed Harris amp Morin 1997 have been very widely used across gt 50 studies exemplifying the use of model organisms in ecology The wider range of phylogeny traits and trophic levels covered allows to select species for
149. e FISH adds detailed information about the spatial structure of a cell the combination with RMS Raman FISH gives an interesting tool for single cell structure function analyses in protist populations communities Huang et al 2007 The herein given protocol includes all necessary steps after the sampling procedure and preparations needed before analysis with RMS This comprises the cleaning of protists and bacteria as well as the transfer to quartz slides used later for RMS that is we cover all preparation steps specific to protists We do not provide a protocol for the RMS analysis itself since highly specific expertise is known such that RMS should be performed in collaboration with individuals that have the expertise and the devices to analyse samples of microorganisms 78 Supplementary Information Altermatt et al 2015 Methods in Ecology and Evolution DOI 10 1111 2041 210X 12312 2 6 RAMAN microspectroscopy Materials Equipment e MgF or CaF microscope slides Crystran Limited Plastic Petri dishes 60 x 15 mm e Micropipettes 10 100 1 000 uL e Stereomicroscope magnification 10 50 times depending on organism size e Eppendorf tubes Reagents e Bacterial buffer or similar liquid to clean protists This liquid should not contain any of the elements that may be part of the later analysis such as carbon when using stable isotope probing SIP Procedure Isolate and clean ciliates from culture liquid Th
150. e convergences The use of protists in ecology and evolutionary biology can be traced back to Gause 1934b 1934a and Dallinger 1878 1887 who looked at ecological and evolutionary dynamics respectively Both of them have been very much inspired by the work of Charles Darwin 1859 and are among the first experimental studies testing Darwin s ideas In the 1950ies to 1970ies a whole school of American Ecologists used protist experiments and especially Paramecium aurelia to address questions of species coexistence population dynamics and predator prey interactions e g Sonneborn 1950 Nelson 1958 Nelson amp Kellermann 1965 Nelson 1967 Salt 1967 Gill 1972a Gill 1972b Gill amp Nelson 1972 Vandermeer et al 1972 Luckinbill 1973 Luckinbill 1974 Luckinbill amp Fenton 1978 Luckinbill 1979 Veilleux 1979 This work was later on revived especially by Peter Morin and colleagues e g Lawler amp Morin 1993 McGrady Steed Harris amp Morin 1997 Petchey et al 1999 McGrady Steed amp Morin 2000 Fox amp Morin 2001 Fukami amp Morin 2003 Jiang amp Morin 2004 Morin amp McGrady Steed 2004 Jiang amp Morin 2005 Steiner et al 2006 It has been ever since used by a growing number of ecologists and evolutionary biologists e g Lawler amp Morin 1993 Warren 1996b Warren 1996a Fox amp Smith 1997 Petchey et al 1999 Fox McGrady Steed amp Petchey 2000 Holyoak 2000b Holyoak 2000a Petchey 2000 Fukami 2001 Dona
151. e likely to be more accurate and precise compared to before after snapshot experiments Combined with model fitting procedures such as trajectory matching time series enable inferring not only qualitative but also quantitative information such as parameter values e g intrin sic growth rate r carrying capacity K or half saturation constant Ky 2 12 INTERACTION STRENGTHS Intra and interspecific interactions Fig ii are key to under standing population dynamics and community structure Fig 1 iii and iv Measurements of interaction strengths are usually done by measuring population growth in single species versus pairwise A user s guide for protist microcosms 225 two species settings for a comparison of methods and data requirement see Novak amp Wootton 2010 Carrara et al 2014 The strength of competition can be measured as difference in equi librium population density between single species and two species cultures or by competitive exclusion Furthermore competition coefficients can be estimated by fitting a Lotka Volterra competi tion model to the growth curves Predation rates can be measured by direct observation of a single predator feeding on a known number of prey individuals in a small drop of medium over a short period of time Otherwise functional response experiments can be used Counting individual protists for functional response experiments is time consuming moreover short generation time of most protis
152. e nucleic acid content of the bacteria often related to the cell size Finally an array of fluorescent dyes exist that can be used to interrogate the bacterial sample with respect to activity and viability Hammes amp Egli 2010 The value of FCM comes from the use of highly defined staining and analysis protocols Prest et al 2013 resulting in a high reproducibility In the context of protist experiments flow cytometric FCM analysis can be used to 1 accurately quantify the density of bacteria in a microcosm or similar experimental environment and if required 2 estimate the average cell size of bacteria For this purpose a set of experimental procedures is described based on the work of Prest et al 2013 and SLMB 2012 In recent protist experiments FCM has 2735 Supplementary Information Altermatt et al 2015 Methods in Ecology and Evolution DOI 10 1111 2041 210X 12312 2 5 Measuring bacteria density Flow cytometry been used to measure bacteria density e g Limberger amp Wickham 2011 however we here give for the first time a detailed standardized protocol The described methods can be used on commercially available FCM instrumentation discussed below Standard laboratory safety precautions e g protective clothing gloves etc are advised 10000 Tetrahymena culture bacteria in Tetrahymena cultur B bacteria in control 6000 8000 4000 Tetrahymena density ml b bacterial density 1E
153. e this Often the isolation process is not 100 perfect and other species bacteria and mostly protists smaller than 10 jm such as microflagellates are inadvertently isolated together with the focal species To remove bacteria the use of antibiotics is needed see axenic cultures in section 1 2 while to remove microflagellates steps 4 to 8 need to be repeated for another 5 to 10 times It is important to switch to new sterilized pipettes for each serial dilution washing step However the same pipette may be used multiple times to independently isolate several individuals species in parallel That is use one pipette for each serial step but the same pipette can be used multiple times for parallel isolations at the same step During the isolation process individuals may die or get lost e g get stuck to the glass of the pipette thus to isolate one new species it is generally necessary to go through the whole isolation process multiple times with independent individuals The above described procedure can also be used to create monoclonal populations of already established and well running laboratory cultures which may have accumulated genetic diversity by mutations over time Anticipated results The goal is to have a well growing culture of the isolated species which can then be added to the stock culture collection section 1 3 and for which species traits etc can be measured It is important to remember that a culture is
154. effects of temperature on the population dynamics and ecosystem functioning of aquatic microbial ecosystems Journal of Animal Ecology 79 1324 1331 Beveridge O S Petchey O L amp Humphries S 2010b Mechanisms of tempera ture dependent swimming the importance of physics physiology and body size in determining protist swimming speed Journal of Experimental Biology 213 4223 4231 Beyers R J amp Odum H T 1993 Ecological Microcosms Springer New York Bo chat I G amp Adrian R 2006 Evidence for biochemical limitation of popula tion growth and reproduction of the rotifer Keratella quadrata fed with fresh water protists Journal of Plankton Research 28 1027 1038 Bracht J R Perlman D H amp Landweber L F 2012 Cytosine methylation and hydroxymethylation mark DNA for elimination in Oxytricha trifallax Gen ome Biology 13 R99 Brown J H Gillooly J F Allen A P Savage V M amp West G B 2004 Toward a metabolic theory of ecology Ecology 85 1771 1789 Brunk C F Lee L C Tran A B amp Li J 2003 Complete sequence of the mitochondrial genome of Tetrahymena thermophila and comparative meth ods for identifying highly divergent genes Nucleic Acids Research 31 1673 1682 Buckling A Kassen R Bell G amp Rainey P B 2000 Disturbance and diver sity in experimental microcosms Nature 408 961 964 Cadotte M 2006 Metacommunity influences on community richness at m
155. elf homogeneous light sources are installed note the insulation above each light to avoid warming of the shelf above it Photo by Florian Altermatt 32 Supplementary Information Altermatt et al 2015 Methods in Ecology and Evolution DOI 10 1111 2041 210X 12312 E 1 4 Apparatus Fig S5 Two working spaces equipped with zoom stereomicroscopes and cameras Microscopes are equipped with dark field illumination Note for working on the microscopes blinds of the windows would be lowered to avoid reflections and uncontrolled illumination Next to the microscopes a calendar is given to reserve slots for individual work projects Photo by Florian Altermatt 33 Supplementary Information Altermatt et al 2015 Methods in Ecology and Evolution DOI 10 1111 2041 210X 12312 1 5 Laboratory practices Supplementary information for Altermatt et al Methods in Ecology and Evolution DOT 10 1111 2041 210X 12312 Big answers from small worlds a user s guide for protist microcosms as a model system in ecology and evolution Altermatt F Fronhofer EA Garnier A Giometto A Hammes F Klecka J Legrand D Machler E Massie TM Pennekamp F Plebani M Pontarp M Schtickzelle N Thuillier V amp Petchey OL 1 5 Laboratory practices Introduction Experiments with protists might or might not be carried out in sterile conditions depending on what needs to be measured and or kept under control regardless a clean and tidy laboratory
156. ents assuming that their dynamics are on a much faster scale than protist dynamics and thus not limiting This however may be oversimplifying Fig S1 especially as bacteria nowadays can be measured using flow cytometry FCM with at least at the same if not higher temporal resolution than protists We thus postulate that ecologists using protist microcosm experiments should consider also measuring bacteria FCM has been used extensively in aquatic microbiology during the last decades and the ongoing development of affordable and easy to use instrumentation has generalized the application thereof FCM allows rapid quantification and characterization of suspended particles on single bacteria cell level The method is fast 1 min per sample and thus enables high throughput measurements The method is highly reproducible with a typical error of below 596 on replicate measurements Moreover FCM analysis of a sample usually measures several thousands of individual events thus providing a strong statistical relevance for the obtained data A FCM measurement collects multi variable data for each particle including light scatter signals and fluorescence The former is indicative of the size of the particles while fluorescence is used in the simplest form for distinguishing bacteria from abiotic background This is achieved through labelling the cells with a fluorescent dye such as SYBR Green or DAPI Such staining can also provide information on th
157. er E 2009 Developmental genome rear rangements in ciliates a natural genomic subtraction mediated by non coding transcripts Trends in Genetics 25 344 350 Fellous S Duncan A Coulon A L amp Kaltz O 2012a Quorum sensing and density dependent dispersal in an aquatic model system PLoS ONE 7 e48436 Fellous S Duncan A B Quillery E Vale P F amp Kaltz O 2012b Genetic influence on disease spread following arrival of infected carriers Ecology Let ters 15 186 192 Fenchel T 1974 Intrinsic rate of natural increase the relationship with body size Oecologia 14 317 326 Fenchel T 2001 How dinoflagellates swim Protist 152 329 338 Fenchel T amp Finlay B J 1983 Respiration rates in heterotrophic free living protozoa Microbial Ecology 9 99 122 Fenchel T amp Finlay B J 2004 The ubiquity of small species patterns of local and global diversity BioScience 54 771 784 Foissner W amp Berger H 1996 A user friendly guide to the ciliates Protozoa Ciliophora commonly used by hydrobiologists as bioindicators in rivers lakes and water waters with notes on their ecology Freshwater Biology 35 375 482 Fox J W amp Morin P J 2001 Effects of intra and interspecific interactions on species responses to environmental change Journal of Animal Ecology 70 80 90 Fox J W amp Smith D C 1997 Variable outcomes of protist rotifer competition in laboratory microc
158. erest organization What measured Examples of disciplines Measurement methods examples Individual Morphology and species identity Evolutionary Ecology Ecology Microscopy image analysis Individual level behaviour Evolutionary Ecology Behavioural Ecology Image and video analysis e g movement Physiology chemical composition Ecophysiology Evolutionary Ecology RAMAN microspectroscopy Genes gene expression Ecological Genetics Evolutionary Ecology Genomics transcriptomics Population Population density Population Ecology Macroecology Microscopy image analysis number of individuals Population dynamics r K Population Ecology Microscopy image analysis Size distribution Biomass Population Ecology Macroecology Particle counter image analysis Use of resources Population Ecology Behavioural Ecology Plating optical density bacteria population flow cytometer Intraspecific interactions Behavioural Ecology Microscopy image analysis Extinctions time to extinctions Population Ecology Viability analyses Microscopy Dispersal Metapopulation Metacommunity and Microscopy image analysis Spatial Ecology Evolutionary change Evolutionary Ecology Microscopy image analysis respirometer Community Diversity species identification Community Ecology Macroecology Microscopy image analysis Types of species interactions Community Ecology Functional Ecology Microscopy image analysis Species interaction strengths Community Ecology Microscopy image anal
159. es are physically not connected and part of the popu lation community is pipetted from one patch to another patch see for example Warren 1996 Altermatt Schreiber amp Holyoak 2011b Carrara et al 2012 and active dispersal patches physically con nected through tubing and protist swim actively between patches see for example Holyoak amp Lawler 1996a Cadotte 2006 2007 Fellous et al 2012a Passive dispersal allows a much higher con trol of dispersal timing direction and rate but possibly disrupts trade offs for example between colonization and competition Ca dotte 2007 and neglects that dispersers are often not a random fraction of the population The choice of dispersal method may also depend on the linking to theoretical models which may either assume discrete or continuous phases of growth and dispersal sub sequently simplifying the comparison parameterization and or fit ting of models with experimental data The choice of possible landscape structures is large and includes sin gle patch systems of varying sizes simple two patch landscapes linear star like or dendritic landscapes see also Holyoak amp Lawler 1996a Cadotte 2006 Schtickzelle et al 2009 Altermatt Schreiber amp Holy oak 2011b Carrara et al 2012 Fellous et al 2012a Pennekamp et al 2014b While most work has been done on landscapes that are dis crete e g have discrete patches surrounded by non habitat matrix or connected by small corridors
160. es in drinking water systems using a 76 Supplementary Information Altermatt et al 2015 Methods in Ecology and Evolution DOI 10 1111 2041 210X 12312 2 5 Measuring bacteria density Flow cytometry fast and reproducible flow cytometric method Water Research 47 7131 7142 SLMB 2012 Determining the total cell count and ratios of high and low nucleic acid content cells in freshwater using flow cytometry Analysis method 333 1 The Swiss Food Codex Schweizerische Lebensmittelbuch ed S Federal Office of Public Health Van Nevel S Koetzsch S Weilenmann H U Boon N amp Hammes F 2013 Routine bacterial analysis with automated flow cytometry Journal of Microbiological Methods 94 73 76 egy Supplementary Information Altermatt et al 2015 Methods in Ecology and Evolution DOI 10 1111 2041 210X 12312 2 6 RAMAN microspectroscopy Supplementary information for Altermatt et al Methods in Ecology and Evolution DOT 10 1111 2041 210X 12312 Big answers from small worlds a user s guide for protist microcosms as a model system in ecology and evolution Altermatt F Fronhofer EA Garnier A Giometto A Hammes F Klecka J Legrand D Machler E Massie TM Pennekamp F Plebani M Pontarp M Schtickzelle N Thuillier V amp Petchey OL 2 6 RAMAN microspectroscopy Introduction Raman microspectroscopy RMS yields information about the chemical composition of individual cells Raman spectra result from the i
161. esent the species is now present in a pure monoclonal culture and can be used for further experiments 13 Add it to your long term stock culture collection section 1 6 Timing Collection of the sample gt 1 h reparation all equipment 0 5 h isolating 1 h growing the isolated individuals for 24 to 48 h checking for success 0 5 h Troubleshooting Tips and Tricks The two most common problems are 1 the isolated species does not grow 2 the isolation procedure was not successful and the isolated species is contaminated with other mostly very small protists species It is advised to independently isolate at least 5 to 10 individuals to ensure a higher success Sometimes isolated species grow better when they are initially placed in relatively little medium 1 mL use microwell plates and only later on be transferred into more medium volume when the populations have reached a few dozen cells Some species may not be cultivable within the chosen medium or the chosen medium concentration laboratory conditions Try different media section 1 2 and different laboratory conditions staying as close l Supplementary Information Altermatt et al 2015 Methods in Ecology and Evolution DOI 10 1111 2041 210X 12312 1 1 Species used to the natural environmental conditions as possible When using bacterized medium ensure that the bacteria concentrations are not so high that anoxic conditions occur Using 10 fold diluted medium may solv
162. eson I Hoppenrath M Veron B Kasai F Brand J James E R amp Keeling P J 2010 Environmental barcoding reveals massive dinoflagellate diversity in marine environments PLoS ONE 5 e13991 Valentini A Pompanon F amp Taberlet P 2009 DNA barcoding for ecologists Trends Ecol Evol 24 110 117 Walsh P S Metzger D A amp Higuchi R 1991 Chelex 100 as a medium for simple extraction of DNA for PCR based typing from forensic material Biotechniques 10 506 513 Zufall R A Dimon K L amp Doerder F P 2013 Restricted distribution and limited gene flow in the model ciliate Tetrahymena thermophila Molecular Ecology 22 1081 1091 RT Supplementary Information Altermatt et al 2015 Methods in Ecology and Evolution DOI 10 1111 2041 210X 12312 2 8 Genomics proteomics and epigenomics Supplementary information for Altermatt et al Methods in Ecology and Evolution DOT 10 1111 2041 210X 12312 Big answers from small worlds a user s guide for protist microcosms as a model system in ecology and evolution Altermatt F Fronhofer EA Garnier A Giometto A Hammes F Klecka J Legrand D Machler E Massie TM Pennekamp F Plebani M Pontarp M Schtickzelle N Thuillier V amp Petchey OL 2 8 Genomics proteomics and epigenomics Introduction The aim of omics approaches genomics transcriptomics proteomics epigenomics is to characterize whole molecular content in a sample DNA RNA pro
163. eturned to the microcosm Smaller samples generally need not be e g 1 ml or less and their equivalent volume can be replaced with fresh culture media Larger samples can be replaced but care should be taken not to introduce contaminants e g by using disposable vials to place the sample while making measurements or by disinfecting the non disposable ones with ethanol followed by rinsing them with deionized water How often to sample This will depend on how fast are the dynamics and recording of any transient dynamics is required Some experiments may require only recording of the end state while others may require highly resolved time series Whether to homogenise before sampling for example by swirling depends on whether disturbance in spatial heterogeneity are acceptable If they are not acceptable perhaps because the experiment concerns the consequences of small scale spatial heterogeneity population densities should be estimated at a fixed position in the microcosm or at several fixed positions There is relatively little evidence that swirling as often as every other day has large effects on population dynamics Anticipated results A sample ready to take measurements from 53 Supplementary Information Altermatt et al 2015 Methods in Ecology and Evolution DOI 10 1111 2041 210X 12312 2 2 Estimating abundances by eye Microscopy Supplementary information for Altermatt et al Methods in Ecology and Evolution DOT 1
164. experiments Fig S1 Furthermore general laboratory glassware is needed Protists cultures can be maintained and handled with general laboratory equipment Importantly all equipment used must be inert with respect to chemical leaking into the medium e g using silicon tubes or glass jars Jars and pipettes used must be rinsed with deionized water before autoclaving use to get rid of detergents For experiments glass jars or polystyrol multiwell plates have been proven successful Care needs to be taken when vessels are self made as for example silicone glue used to seal containers mostly contains antifouling chemicals that leak into the medium and kill protists even from silicone glue recommended for aquaria use Materials Equipment For general lab procedures the following equipment is needed Labcoat Disposable gloves Labelling tape and water proof pens Autoclave bags to autoclave dispose biohazard waste 80 denaturated alcohol to clean surfaces 2 bleach to dispose cultures For the general procedures involving medium preparation experimental set up and analyses of basic protist microcosm experiments the following equipment is needed Microbalances precision 0 1 mg Autoclave Fig S2 Incubators temperature range 5 to 40 C light controlled Fig S3 or temperature controlled walk in chamber Fig S4 pH meter Stereomicroscopes with zoom and dark field illumination i e dissection
165. ey O L 2009 Testing a biological mechanism of the insurance hypothesis in experimental aquatic communities Journal of Animal Ecology 78 1143 1151 Nelson G H amp Kellermann S L 1965 Competition between Varieties 2 and 3 of Paramecium Aurelia The Influence of Temperature in a Food Limited System Ecology 46 134 139 Petchey O L 2000 Environmental colour affects aspects of single species population dynamics Proceedings of the Royal Society B 267 747 754 Petchey O L McPhearson P T Casey T M amp Morin P J 1999 Environmental warming alters food web structure and ecosystem function Nature 402 69 72 127 Supplementary Information Altermatt et al 2015 Methods in Ecology and Evolution DOI 10 1111 2041 210X 12312 3 7 Manipulation of the biotic environment Supplementary information for Altermatt et al Methods in Ecology and Evolution DOI 10 1111 2041 210X 12312 Big answers from small worlds a user s guide for protist microcosms as a model system in ecology and evolution Altermatt F Fronhofer EA Garnier A Giometto A Hammes F Klecka J Legrand D Machler E Massie TM Pennekamp F Plebani M Pontarp M Schtickzelle N Thuillier V amp Petchey OL 3 7 Manipulation of the biotic environment Overview Many aspects of the biotic environment can be manipulated Thereby the composition and dynamics of the biotic environment are not only studied as response variables e g number of species
166. f a generator a converter and a horn also known as probe Ice bath e g measuring beaker with crushed ice Reagents No specific reagents beyond what is described in sections 1 2 to 1 4 are needed Procedure Replacing medium Depending on the level of disturbance a large part of the medium 50 99 Warren 1996 Fukami 2001 Scholes Warren amp Beckerman 2005 Haddad et al 2008 Altermatt et al 2011 Altermatt Schreiber amp Holyoak 2011 Altermatt amp Holyoak 2012 Limberger amp Wickham 2012 containing protists is replaced with freshly autoclaved medium Replacing less than 3096 of the medium has generally very little effects on the population and community dynamics of protists and is sometimes even used as a standard procedure during long term maintenance It is very important that all handling procedure e g mixing before disturbance except the disturbance itself is also applied to the controls 1 Take the vessel with the protist community to be disturbed 2 Thoroughly mix it shaking or with pipette 3 Remove the proportionate content that should be disturbed Note in case of very high disturbance levels e g 9996 it may be easier to remove the content that should be maintained with a pipette temporarily keep it in the pipette tip discard all of the rest and add it back to the vessel 112 Supplementary Information Altermatt et al 2015 Methods in Ecology and Evolution DOI 10 1111 2041 210X 12312
167. f movement behaviour and morphology e g Hamamatsu Orca Flash 4 0 SCMOS Camera to powerful customer cameras e g Canon Mark III 5D that can be coupled to microscopes via adaptors which capture relevant variation on the individual level but do not allow for sub individual measurements For some setups high end web cams may be sufficient and provide a better price to usability ratio If colour is used for protist detection species classification cameras need to have colour capability 64 Supplementary Information Altermatt et al 2015 Methods in Ecology and Evolution DOI 10 1111 2041 210X 12312 2 3 Image and video analysis Larger sensors usually allow capturing a larger area of the viewing field increasing the total volume sampled Light Inhomogeneous illumination shadows due to unilateral light sources and changes in light during a sequence are to be avoided although techniques exist that can deal to a certain degree with such problems and certain segmentation approaches difference imaging can deal with changing light conditions However it is always better to avoid these nuisances in the first place by sufficiently testing the setup Chamber Images videos are acquired from samples either pipetted in re usable counting chambers e g Sedgewick Rafter or disposable chambers used for instance in urinary analyses which cannot be cleaned but allow for faster image acquisition These counting chambers usually guarantee
168. g simul taneously making it difficult to get a mechanistic understanding of the system Here combining statistical pro cess based modelling and experiments parameterization relating parameters to patterns will help revealing the critical 2014 The Authors Methods in Ecology and Evolution 2014 British Ecological Society Methods in Ecology and Evolution 6 218 231 links between patterns observed in the experiments and specific ecological and evolutionary processes Thirdly the advantages associated with microcosms while studying multiple spatiotem poral scales also pose challenges Processes that act on different spatiotemporal scales may for example be difficult to be teased apart especially in long term experiments on large spa tial scales An example is rapid evolution that acts on ecologi cal time scales which can be a few weeks in microcosm experiments depending on an organism s generation time Nevertheless protist microcosms are ideal systems to develop more mechanistic understanding of processes in ecol ogy and evolution Recent work highlights the utility of micro cosms in understanding the causality of ecological and evolutionary processes e g Drake amp Kramer 2012 A next step is to have access to the molecular mechanisms underlying these processes Our synthesis of the well established e g Sec tions 2 1 2 2 2 10 2 12 and recent techniques e g Sec tions 2 3 to 2 8 available for protist microc
169. ghly suitable or for 2 L medium 3 L Erlenmeyer glass beakers Aluminium foil to cover the lid of the medium container and maintain it sterile after autoclaving Spatula to handle chemicals Labelling tape and pen to label the medium bottle All glassware and tools used in the making of the medium should be rinsed with deionised ultrapure or equivalent water to ensure that no soap or acide residue remains on the surface of the glassware after it has been washed Reagents All media are made of either deionized or well water and chemicals and nutrients that are added either as solutions or solid particles For media in which different stock solutions are prepared we give the components of the stock solutions and concentrations therein for all other media we only list the reagents needed Bristol medium Deionized water dH O Stock solutions described in Table S1 Table S1 Stock solutions needed for Bristol medium Component Amount Concentration stock solution NaNO3 10 mL L 10 g 400mL dH20 CaCl2 2H20 10 mL L 1 g 400mL dH2O MgSO4 7H20 10 mL L 3 g 400mL dH2O K2HPO4 10 mL L 3 g 400mL dH2O KH2P04 10 mL L 7 g 400mL dH20 NaCl 10 mL L 1 g 400mL dH2O 20 Supplementary Information Altermatt et al 2015 Methods in Ecology and Evolution DOI 10 1111 2041 210X 12312 1 2 Culture medium Chalkley s solution Deionized water dH O Stock solutions described in Table S2 Table S2 Stock solutions neede
170. h it since this is critical Add the species to these MVs Do this for each species separately Adding prey and predator protist species Add the prey as described wait a day or two then add the predator to allow for time for prey to increase in density somewhat Adding species from a mixed stock culture You might need for example to add a predator without putting in the prey from the stock culture You need to use a micropipette to count out individual predators It really helps to have a stock culture where the predators are as numerous as possible and the prey as rare as possible this can be obtained by simply giving time to the predator to reduce the prey density before collecting it Anticipated results A laboratory running smoothly microcosms accurately set up 38 Supplementary Information Altermatt et al 2015 Methods in Ecology and Evolution DOI 10 1111 2041 210X 12312 1 6 Long term maintenance of stock cultures Supplementary information for Altermatt et al Methods in Ecology and Evolution DOT 10 1111 2041 210X 12312 Big answers from small worlds a user s guide for protist microcosms as a model system in ecology and evolution Altermatt F Fronhofer EA Garnier A Giometto A Hammes F Klecka J Legrand D Machler E Massie TM Pennekamp F Plebani M Pontarp M Schtickzelle N Thuillier V amp Petchey OL 1 6 Long term maintenance of stock cultures Introduction Stock cultures of microorganisms kept
171. hands on guide Methods in Ecology and Evolution 4 483 492 P rez Escudero A Vicente Page J Hinz R C Arganda S amp de Polavieja G G 2014 idTracker tracking individuals in a group by automatic identification of unmarked animals Nature Methods advance online publication Schtickzelle N Fjerdingstad E Chaine A amp Clobert J 2009 Cooperative social clusters are not destroyed by dispersal in a ciliate BMC Evolutionary Biology 9 Sieracki C K Sieracki M E amp Yentsch C S 1998 An imaging in flow system for automated analysis of marine microplankton Marine Ecology Progress Series 168 285 296 Van Nevel S Koetzsch S Weilenmann H U Boon N amp Hammes F 2013 Routine bacterial analysis with automated flow cytometry Journal of Microbiological Methods 94 73 76 Yemini E Jucikas T Grundy L J Brown A E X amp Schafer W R 2013 A database of Caenorhabditis elegans behavioral phenotypes Nature Methods 10 877 879 561 Supplementary Information Altermatt et al 2015 Methods in Ecology and Evolution DOI 10 1111 2041 210X 12312 2 4 Particle counter Supplementary information for Altermatt et al Methods in Ecology and Evolution DOT 10 1111 2041 210X 12312 Big answers from small worlds a user s guide for protist microcosms as a model system in ecology and evolution Altermatt F Fronhofer EA Garnier A Giometto A Hammes F Klecka J Legrand D Machler E
172. hue Holyoak amp Feng 2003 Kneitel amp Miller 2003 Laakso Loytynoja amp Kaitala 2003 Jiang amp Kulczycki 2004 Kneitel amp Chase 2004 Holyoak amp Lawler 2005 Cadotte et al 2006 Ostman Kneitel amp Chase 2006 Cadotte 2007b Fjerdingstad et al 2007 Friman et al 2008 Haddad et al 2008 Jiang amp Patel 2008 Davies et al 2009 Schtickzelle et al 2009 Worsfold Warren amp Petchey 2009 Chaine et al 2010 Hammill Petchey amp Anholt 2010 Petchey Brose amp Rall 2010 TerHorst 2010 Violle Pu amp Jiang 2010 Altermatt et al 2011 Altermatt Schreiber amp Holyoak 2011 Friman amp Laakso 2011 Limberger amp Wickham 2011 Violle et al Supplementary Information Altermatt et al 2015 Methods in Ecology and Evolution DOI 10 1111 2041 210X 12312 1 1 Species used 2011 Altermatt amp Holyoak 2012 Carrara et al 2012 Limberger amp Wickham 2012 Machler amp Altermatt 2012 Clements et al 2013a Clements et al 2013b Giometto et al 2013 Pennekamp amp Schtickzelle 2013 Carrara et al 2014 Clements et al 2014 Fronhofer Kropf amp Altermatt 2014 Giometto et al 2014 Pennekamp et al 2014 Seymour amp Altermatt 2014 and the types of questions addressed diversified extensively Research areas now include the phylogenetic limiting similarity hypothesis e g Violle Pu amp Jiang 2010 effects of disturbance and productivity on diversity e g Haddad et al 2008 Altermatt Schreiber amp Holyo
173. iate References Davies K F Holyoak M Preston K A Offeman V A amp Lum Q 2009 Factors controlling community structure in heterogeneous metacommunities Journal of Animal Ecology 78 937 944 McGrady Steed J Harris P M amp Morin P J 1997 Biodiversity regulates ecosystem predictability Nature 390 162 165 Petchey O L McPhearson P T Casey T M amp Morin P J 1999 Environmental warming alters food web structure and ecosystem function Nature 402 69 T2 Ribblett S G Palmer M A amp Coats D W 2005 The importance of bacterivorous protists in the decomposition of stream leaf litter Freshwater Biology 50 516 526 103 Supplementary Information Altermatt et al 2015 Methods in Ecology and Evolution DOI 10 1111 2041 210X 12312 2 12 Interaction strengths Supplementary information for Altermatt et al Methods in Ecology and Evolution DOI 10 1111 2041 210X 12312 Big answers from small worlds a user s guide for protist microcosms as a model system in ecology and evolution Altermatt F Fronhofer EA Garnier A Giometto A Hammes F Klecka J Legrand D Machler E Massie TM Pennekamp F Plebani M Pontarp M Schtickzelle N Thuillier V amp Petchey OL 2 12 Interaction strengths Introduction Measuring the strength of competition predation and host parasite interactions is often needed Direct observations can be done in some cases but measuring carrying capacities in
174. iations in the content of protein classes known to play roles in organisms stress response such as heat shock proteins Major steps are Isolate stressed individuals Extract total protein content Isolate classes of proteins using 2 dimensional gel electrophoresis Complete protein characterization using Mass Spectrometry Analyse the target classes of proteins and determine their qualitative and quantitative content differences under stressful conditions versus control conditions There exist both publications on detailed protocols e g Jacobs et al 2006 Smith et al 2007 Gould et al 2010 Xanthopoulou et al 2010 Le Bihan et al 2011 Oehring et al 2012 Yano et al 2012 Chen et al 2014 as well as review articles e g Tyers amp Mann 2003 Yates et al 2005 Beck Claassen amp Aebersold 2011 Dowd 2012 Gotelli Ellison amp Ballif 2012 Armengaud et al 2014 Editorial 2014 Changes in DNA methylations Epigenetics refers to stimuli triggered changes in gene expression due to processes that arise independently of changes in the underlying DNA sequence Gomez Diaz et al 2012 Rapid responses to intense environmental changes are supposed to occur most often through epigenetic mechanisms Flores Wolschin amp Amdam 2013 Among described non genetic factors there are DNA methylation histone modification and small non coding RNAs Efficient new techniques have been recently developed to determine whole epigenomes f
175. ient dynamics and litter bags 4 Weigh individual seeds or groups of seeds depending on the decision made in step 1 5 Place each seed or group of seeds into a foil bag labelled uniquely 6 Autoclave all the foil bags 7 Place the wheat seeds into the microcosms noting the id of the bag that was put into each microcosm 8 Remove the wheat seeds from the microcosms taking care to minimise chance of contamination and taking care to remove material not part of the wheat seed e g bacterial masses surrounding the wheat seed 9 Carefully rinse the wheat seeds again to remove material that was not originally part of the wheat seed 10 Dry the wheat seeds taking care to know which microcosm they came from the unique id of the foil bag they came from 11 Weigh the wheat seeds over several days at 40 C until their weight stabilises Timing Allow up to one week for drying before and after Allow several hours for initial and final weighing depending on the number of microcosms in the experiment Troubleshooting Tips and Tricks Use preliminary experiments to ensure that treatments do not reach close to 100 weight loss during the experiment This is to avoid lack of variation among treatments due to complete decomposition in all treatments Anticipated results Rate of decomposition measured either as percentage weight loss or the rate of exponential decline in weight the latter is likely to be more generally appropr
176. ify the structure resources and function of ecosystems during a discrete event on both large and small scales Disturbances can either be a temporary change in the environment that affects the community i e a pulse perturbation but where eventually the envi ronmental conditions return to the initial state or be a permanent change in the environment i e a press perturbation or somewhere on the continuum between pulse and press The consequences of natu ral disturbances on natural communities are often hard to study as catastrophic disturbances are either impractical or unethical to be applied at large scales whereas they can be easily applied to micro cosm experiments A commonly applied disturbance in microcosm experiments is den sity independent mortality where either a part of the community is replaced by autoclaved medium e g Warren 1996 Haddad et al 2008 Altermatt et al 2011a or where a part of the community is killed by heating or sonication but the medium retained in the culture such that chemical and nutritional conditions remain as constant as possible e g Jiang amp Patel 2008 Violle Pu amp Jiang 2010 Machler amp Altermatt 2012 This type of pulsed disturbance is easy to apply but does not allow species specific resistance to disturbance but rather reflects dif ferent recoveries from disturbances strongly determined by a species growth rate Disturbances as persisting changes in the environmental co
177. ile giving no information on cell size OD measurements are fast and indicative of biomass but are limited to high cell densities may suffer from artefacts e g abiotic turbidity and are bulk sample measurements incapable of distinguishing cell size or viability on single cell level An alternative is flow cytometry FCM e g recently used by Limberger amp Wickham 2011 DeLong amp Vasseur 2012 FCM allows rapid quantification and characterization of suspended particles at the single bacteria cell level The method is fast 1 min per sample and thus enables high throughput measurements a detailed protocol for a highly standardized approach is given in Appendix SI Section 2 5 The method is highly reproducible with a typical error of below 5 on replicate measurements and usually measures several thou sands of individuals per sample Furthermore FCM collects multi variable data for each particle including light scatter signals and fluorescence which can distinguish bacteria from abiotic back ground and be combined with fluorescent labels for interrogating the bacterial sample with respect to activity and viability Hammes amp Egli 2010 2 6 RAMAN MICROSPECTROSCOPY While image and video analysis yields information on optical features of individual cells Raman microspectroscopy RMS yields informa tion about their chemical composition and allows identifying different cell types physiological states and variable phenotype
178. ility of measuring body size distributions of organisms that are too small to be observed with a stereomicroscope e g Bodo saltans Possible applications of the CASY include the study of cell size regulation and the plasticity of body size in the presence of predator prey species or in different environmental conditions Materials Equipment The following equipment is needed for the measurement of protist body size distributions CASY Model TT Cell Counter and Analyzer CASY measuring capillary tubes Available diameter sizes 45 um 60 um 150 um 200 um the 200 um capillary is currently out of production The choice of capillary is related to the size spectrum of the sample Capillaries can get clogged if the sample contains particles larger than the diameter of the capillary CASYcups Measurement cups with lid Micropipettes to handle the sample and the CASYton see Reagents Reagents CASYton an electrolyte used for cell suspension The CASYton is used to dilute the sample below the maximum concentration processed by the CASY We suggest filtering the CASYton with a 0 2 um filter before use to reduce debris counts If the 45 um capillary is used CAS Yton should be de gassed with an ultrasonic bath and a vacuum pump CASYclean solution for the weekly cleaning of CASY see user manual Procedure The following procedure is advised for the measurement of body size distributions 1 Switch on the CASY 2 Check th
179. ily be extended to the context of protist microcosms in which experimenters aim at following the species composition of complex communities over situations and time both qualitatively and quantitatively In this case a good strategy is to choose a sufficiently discriminant marker that will allow the clear distinction of each species see section 2 7 which details the markers of interest in protist barcoding studies Major steps are Choose and characterize the DNA marker to be sequenced for each species of the tested community Normalize samples to be extracted Perform total DNA extraction Construct DNA libraries adapted to the sequencer type Sanger Next Generation sequencer Sequence libraries Determine the prevalence of each species in the original sample There exist both publications on detailed protocols for metagenomic work e g Debroas et al 2009 Ghai et al 2012 Steffen et al 2012 as well as a series of review papers e g Mardis 2008 Dawson amp Fritz Laylin 2009 Gilbert amp Dupont 2011 Temperton amp Giovannoni 2012 Single cell genomics The recently developed single cell genomic approach consists in the sequencing of the whole DNA content in a single cell Therefore it allows capturing the entire genome of an individual nuclear and mitochondrial genomes but also the genomic content of its endo parasites or ingested preys This technique appears promising in the context of protist microcosms becau
180. imming the importance of physics physiology and body size in determining protist swimming speed Journal of Experimental Biology 213 4223 4231 Bolton T F amp Havenhand J N 1998 Physiological versus viscosity induced effects of an acute reduction in water temperature on microsphere ingestion by trochophore larvae of the serpulid polychaete Galeolaria caespitosa Journal of Plankton Research 20 2153 2164 Cadotte M W Mai D V Jantz S Collins M D Keele M amp Drake J A 2006 On Testing the Competition Colonization Trade Off in a Multispecies Assemblage The American Naturalist 168 704 709 Fox J W 2007 Testing the mechanisms by which source sink dynamics alter competitive outcomes in a model system American Naturalist 170 396 408 117 Supplementary Information Altermatt et al 2015 Methods in Ecology and Evolution DOI 10 1111 2041 210X 12312 3 4 Nutrient concentration and viscosity of the medium Friman V P amp Laakso J 2011 Pulsed Resource Dynamics Constrain the Evolution of Predator Prey Interactions The American Naturalist 177 334 345 Friman V P Hiltunen T Laakso J amp Kaitala V 2008 Availability of prey resources drives evolution of predator prey interaction PROCEEDINGS OF THE ROYAL SOCIETY B BIOLOGICAL SCIENCES 275 1625 1633 Haddad N M Holyoak M Mata T M Davies K F Melbourne B A amp Preston K 2008 Species traits predict the effects of distu
181. in a laboratory provide the organisms required for conducting experiments Fig S1 As such the stock cultures are extremely important resources and should be maintained in a manner that ensures their long term persistence The most important method to ensure long term persistence is regular sub culturing whereby a number of individuals are transferred from an existing stock culture into a new microcosm containing abundant resources for the species being sub cultured Frequency of sub culturing needs to be tailored to the dynamics of each species usually every two to four weeks is sufficient Long term access to protist strains is not usually achieved by freezing in contrast to bacteria for example but see section 1 7 though some species are maintained long term as cysts and revived when required This method is not described below Fig S1 Stock cultures in 250 ml glass jars with aluminium caps Each row is a single species with the most recent subculture in the front and later ones towards the back Photo by Owen Petchey Materials Equipment Sterile culture vessels Labels and a pen 39 Supplementary Information Altermatt et al 2015 Methods in Ecology and Evolution DOI 10 1111 2041 210X 12312 1 6 Long term maintenance of stock cultures A sterile pipette or pipette tip and pipette Reagents Fresh culture medium containing appropriate high abundance resources for the species being sub cultured
182. in the Oxygen light and dark bottle method Limnology and Oceanography 4 328 334 Puppels G J Demul F F M Otto C Greve J Robertnicoud M Arndtjo vin D J amp Jovin T M 1990 Studying single living cells and chromosomes by Confocal Raman Microspectroscopy Nature 347 301 303 Quinn G P amp Keough M J 2002 Experimental Design and Data Analysis for Biologists Cambridge University Press Cambridge UK Ribblett S G Palmer M A amp Coats D W 2005 The importance of bacteriv orous protists in the decomposition of stream leaf litter Freshwater Biology 50 516 526 Risse Buhl U Karsubke M Schlief J Baschien C Weitere M amp Mutz M 2012 Aquatic Protists Modulate the Microbial Activity Associated With Min eral Surfaces and Leaf Litter Inter Research Oldendorf Luhe A user s guide for protist microcosms 231 Scholes L Warren P H amp Beckerman A P 2005 The combined effects of energy and disturbance on species richness in protist microcosms Ecology Let ters 8 730 738 Schtickzelle N Fjerdingstad E Chaine A amp Clobert J 2009 Cooperative social clusters are not destroyed by dispersal in a ciliate BMC Evolutionary Biology 9 251 Seymour M amp Altermatt F 2014 Active colonization dynamics and diversity patterns are influenced by dendritic network connectivity and species interac tions Ecology and Evolution 4 1243 1254 Singh D P Saudemont B
183. interfere with the measurements and result in erroneous counts without giving a warning message Typical devices that can generate such fields in laboratories are fluorescent lamps and water baths References Giometto A Altermatt F Carrara F Maritan A amp Rinaldo A 2013 Scaling body size fluctuations Proceedings of the National Academy of Sciences 110 4646 4650 Machler E amp Altermatt F 2012 Interaction of Species Traits and Environmental Disturbance Predicts Invasion Success of Aquatic Microorganisms PLoS ONE 7 e45400 a um Supplementary Information Altermatt et al 2015 Methods in Ecology and Evolution DOI 10 1111 2041 210X 12312 2 5 Measuring bacteria density Flow cytometry Supplementary information for Altermatt et al Methods in Ecology and Evolution DOT 10 1111 2041 210X 12312 Big answers from small worlds a user s guide for protist microcosms as a model system in ecology and evolution Altermatt F Fronhofer EA Garnier A Giometto A Hammes F Klecka J Legrand D Machler E Massie TM Pennekamp F Plebani M Pontarp M Schtickzelle N Thuillier V amp Petchey OL 2 5 Measuring bacteria density Flow cytometry Introduction Bacteria are the basic food resource for many protists and commonly added in protist microcosm experiments see section 1 3 However in most studies bacteria have either been not or only crudely measured e g using plating or optical density measurem
184. ironmental fluctuations generate synchrony in a predator prey community Nature 460 1007 1010 Violle C Pu Z amp Jiang L 2010 Experimental demonstration of the impor tance of competition under disturbance Proceedings of the National Academy of Sciences USA 107 12925 12929 Violle C Nemergut D R Pu Z amp Jiang L 2011 Phylogenetic limiting simi larity and competitive exclusion Ecology Letters 14 782 787 Volterra V 1926 Fluctuations in the abundance of a species considered mathe matically Nature 118 558 560 Vrede K Heldal M Norland S amp Bratbak G 2002 Elemental composition C N P and cell volume of exponentially growing and nutrient limited bacte rioplankton Applied and Environmental Microbiology 68 2965 2971 Wagner M 2009 Single cell ecophysiology of microbes as revealed by Raman microspectroscopy or secondary ion mass spectrometry imaging Annual Review of Microbiology 63 411 429 Warren P H 1996 Dispersal and destruction in a multiple habitat system an experimental approach using protist communities Oikos 77 317 325 Worsfold N T Warren P H amp Petchey O L 2009 Context dependent effects of predator removal from experimental microcosm communities Oikos 118 1319 1326 Xiong J Lu X Zhou Z Chang Y Yuan D Tian M et al 2012 Tran scriptome analysis of the model protozoan Tetrahymena thermophila using deep RNA sequencing PLoS ONE
185. is has to be done to remove influences that might potentially disturb influence the spectra obtained from RMS This is especially true when labelling individuals by stable isotope probing and or fixation chemicals However we do not recommend the use of fixation chemicals since they might influence the RMS output when being absorbed adsorbed by a cell Put 3 mL of bacterial buffer in a plastic Petri dish 5 cm in diameter 2 Select the protists under the stereomicroscope with a micropipette out of the sample volume and put the individuals in the Petri dish containing bacterial buffer Take care that as little as possible is transferred from the rest of the culture to guarantee a high dilution and cleaning E g if 100 wL of culture liquid are transferred together with twenty ciliates the dilution is 100 3 000 3 3 3 Select the protists out of this Petri dish as described in the previous step and put them in another Petri dish containing bacterial buffer 4 Repeat step 3 several times to make sure that the protists are well cleaned The number of repetitions depends on the volume of culture liquid transferred which each ciliate The larger the volume the more repetitions it takes to get properly cleaned protists Isolate and clean bacteria from culture liquid Be aware that other organisms might get destroyed during centrifugation 1 Take 1 mL of experimental volume and put this in an Eppendorf tube 2 Centrifuged this volume at 3000
186. isolating the target organism through serial transfers or dilution to eliminate unwanted contaminating organisms prior to an experiment see Section 1 1 ii Experiments may require larger num bers of individuals or volumes of media than are available in long term stocks iii Disturbances of stock cultures should be minimized iv Experimental environmental conditions may be different from those of long term maintenance such that some acclimation is required Hence for experiments it is usual to set up separate experimental stock cul tures from the stock cultures devoted to long term maintenance 1 7 LONG TERM PRESERVATION Many of the described methods to quantify and measure protist cul tures yield the best results with recently subcultured live protists How ever in many cases long term storage is desirable This may be advantageous when a large number of samples are taken at a time pre venting processing all samples immediately Dead protists can be stored in Lugol s solution for longer time periods and subsequent identifica tion or counting Section 1 1 Risse Buhl et al 2012 Lee amp Soldo 1992 though note that individuals preserved in Lugol s solution can change their size and shape For long term preservation with respect to genetic analyses see Section 2 7 A second long term storage is cryopreservation whereby individuals are stored alive at very low temperatures such that they can be revived at a later time poin
187. kami 2009 Vasseur amp Fox 2009 Tetrahymena thermophila SAR Alveolata Fjerdingstad et al 2008 Fryxell et al 2005 Chaine et al 2009 Laakso et al 2003 Nakajima et al 2009 Tetrahymena vorax SAR Alveolata Fox 2008 Holyoak amp Sachdev 1998 Jiang amp Patel 2008 Livingston et al 2013 Textularia porrecta SAR Rhizaria Gross 2000 Tillina magna SAR Alveolata Scholes et al 2005 Warren amp Weatherby 2006 Holt et al 2004 genus McGrady Steed amp Morin 1996 genus Trachelomonas grandis Excavata Discoba Dickerson amp Robinson 1985 Dickerson amp Robinson 1986 Trachelomonas hispida Excavata Discoba Robinson amp Edgemon 1988 Robinson amp Dickerson 1987 genus Trochammina shannoni SAR Rhizaria Gross 2000 Urocentrum turbo SAR Alveolata Have 1993 Uroleptus sp SAR Alveolata Kneitel amp Perrault 2006 Uronema sp Archaeplastida Chloroplastida Cadotte 2006 Kuppardt et al 2010 Lawler 1993 Livingston et al 2013 Urostyla grandis SAR Alveolata Limberger amp Wickham 2012 PLoSOne Fox et al 2000 genus Lawler 1993 genus Uvigerina mediterranea SAR Foraminifera Gross 2000 Vischeria helvetica SAR Stramenopiles Livingston et al 2013 Volvox aureus Archaeplastida Chloroplastida Li amp Stevens 2012 Oikos Robinson amp Edgemon 1988 Volvox carteri Archaeplastida Chloroplastida Li amp Stevens 2010 CommEcol Li amp Stevens 2010 Oikos Volvox rousseletti Archaeplastida Chloroplastida Livings
188. l weeks or months Some cells can be damaged during the procedure so it is important to pay attention to the concentration of the Lugol s solution you use and not to store the samples for too long The literature on the effect of the concentration of Lugol s solution on the proportion of cells damaged during the procedure is inconsistent varying across a few percentage A specific feature of Lugol s solution is that the protists are stained they turn to red brown color they can be easily seen and counted under a microscope in a bright field and they are heavy so they sink to the bottom of the vial Thereby one can concentrate the sample by removing part of the liquid above them or use an inverted microscope to count observe them However Lugol s solution can slightly affect the cell size and shape due to shrinking which can invalidate comparisons between preserved and unpreserved cells regarding these features Materials Equipment Brown glass vials with screw tops to store Lugol s solution and samples Pipettes Reagents Lugol s solution also known as Lugol s iodine at 5 iodine potency This solution can be made of 5 weight volume iodine and 10 weight volume potassium iodid KI mixed in deionized water resulting in a total iodine content of 126 5 mg mL Procedure The aim is to have a 0 5 concentration of Lugol s solution in the stored sample higher concentrations lead to the loss of larger percentages of
189. ldo A Giometto A amp Altermatt F 2014 Complex interaction of dendritic connectivity and hierarchical patch size on biodiversity in river like landscapes American Naturalist 183 13 25 Chaine A S Schtickzelle N Polard T Huet M amp Clobert J 2010 Kin based recognition and social aggregation in a ciliate Evolution 64 1290 1300 Clements C F Collen B Blackburn T M amp Petchey O L 2014 Effects of directional environmental change on extinction dynamics in experimental microbial communities are predicted by a simple model Oikos 123 141 150 Clements C F Warren P H Collen B Blackburn T Worsfold N amp Petchey O 2013a Interactions between assembly order and temperature can alter both short and long term community composition Ecology and Evolution 3 5201 5208 Clements C F Worsfold N T Warren P H Collen B Clark N Blackburn T M amp Petchey O L 2013b Experimentally testing the accuracy of an extinction estimator Solow s optimal linear estimation model Journal of Animal Ecology 82 345 354 Dallinger W H 1878 On the Life History of a Minute Septic Organism With an Account of Experiments Made to Determine Its Thermal Death Point Proceedings of the Royal Society of London 27 332 350 Dallinger W H 1887 The President s Address Journal of the Royal Microscopical Society 7 185 199 Darwin C 1859 On the Origin of Species by Means of Natural Selectio
190. lemental stoichiometry of bacterial prey influences ciliate grazing selectivity Journal of Eukaryotic Microbiology 56 466 471 Gutierrez J C Callejas S Borniquel S amp Martin Gonzalez A 2000 DNA methylation in ciliates implications in differentiation processes International Microbiology 3 139 146 Haddad N M Holyoak M Mata T M Davies K F Melbourne B A amp Preston K 2008 Species traits predict the effects of disturbance and produc tivity on diversity Ecology Letters 11 348 356 Hajibabaei M Shokralla S Zhou X Singer G A C amp Baird D J 2011 Environmental barcoding a next generation sequencing approach for bio monitoring applications using river benthos PLoS ONE 6 e17497 Hammes F amp Egli T 2010 Cytometric methods for measuring bacteria in water advantages pitfalls and applications Analytical and Bioanalytical Chemistry 397 1083 1095 Hiltunen T Hairston N G Hooker G Jones L E amp Ellner S P 2014 A newly discovered role of evolution in previously published consumer resource dynamics Ecology Letters 17 915 923 Holyoak M amp Lawler S P 1996a Persistence of an extinction prone preda tor prey interaction through metapopulation dynamics Ecology 77 1867 1879 Holyoak M amp Lawler S P 1996b The role of dispersal in predator prey meta population dynamics Journal of Animal Ecology 65 640 652 Holyoak M amp Lawler
191. ling of LN2 that can be important and should not be minimized despite they can be largely controlled by enforcing clear procedures and a limited extra equipment 43 Supplementary Information Altermatt et al 2015 Methods in Ecology and Evolution DOI 10 1111 2041 210X 12312 1 7 Long term preservation LN2 is extremely cold 196 C and immediately burns skin or eyes in case of contact Never touch or immerge body parts into LN2 and wear adequate protection equipment coats full face visor and use insulated gloves at all times whilst handling vessels containing LN2 or manipulating cold items A very important safety consideration is the potential risk of asphyxiation when escaped nitrogen vaporises and displaces atmospheric oxygen Oxygen depletion can very rapidly cause loss of consciousness without any sensation or prior warning because nitrogen is odourless colourless and tasteless Vessels containing LN2 should be kept in well ventilated areas in order to minimize this risk In particular if a pressurized LN2 vessel must be moved between levels for example for refilling at an external LN2 source never go in the lift with the vessel to avoid being trapped in a confined space in case of lift malfunction Large volume LN2 vessels should be accompanied with an oxygen detector triggering an alarm in case oxygen level drops below 19 or a mechanical ventilation installed in the room holding the LN2 vessel A third risk is associate
192. llowing to consequently track the movement of the individuals through time using dedicated tracking software Dell et al 2014 So far automated image video analysis systems are mainly used in single species microcosms Efforts to develop systems for automated sampling in marine environments and activated sludge of water treatment 63 Supplementary Information Altermatt et al 2015 Methods in Ecology and Evolution DOI 10 1111 2041 210X 12312 2 2 Image and video analysis facilities have shown some success e g Amaral et al 2004 and should be facilitated by the low species numbers in microcosms and the availability of high quality data to calibrate the classification algorithms used e g artificial neural networks or random forest classification A variety of measurements can be taken from images and videos see Fig S1 for a general overview of the process of sampling processing and analysis Several recent publications describe in detail how to setup an image video acquisition and processing pipeline in ecology and evolution e g K hl amp Burghardt 2013 Mallard Le Bourlot amp Tully 2013 Mesquita Amaral amp Ferreira 2013 Pennekamp amp Schtickzelle 2013 Dell et al 2014 providing scripts for the automated image analysis Pennekamp amp Schtickzelle 2013 or plug ins for software like ImageJ Mallard Le Bourlot amp Tully 2013 Therefore we here focus on giving an overview of the equipment required and point
193. lous et al 2012b or rye leaves Cerophyll Cassidy Hanley 2012 Only use plant material grown without pesticide i e from organic farming This medium is generally only used for bacterized cultures To get 1 L of total medium the following procedure is advised 1 Hill 1 L of deionized tap water or ready made Chalkley s medium into an autoclavable beaker with a minimum volume of 1 5 L 2 Add carbon sources there are 3 options to add carbon sources A Add 20 wheat seeds B Alternatively add 20 wheat seeds and 1 g of dry straw C Alternatively add 1 g of dried baked lettuce dried baked at 110 C for multiple hours discard dark brown black portions 3 Cover the beaker and autoclave the medium at 121 C for 15 20 minutes This step can be skipped for hay or dried lettuce and is even common practice to revive dormant stages of protists Wheat seeds need to be autoclaved as they otherwise germinate in the medium 4 Before use the medium must cool down to the temperature used in the experiment usually around 20 C 5 Label the medium bottle with the name of the medium type the initials of the person who made it and the date when it was made 6 Generally the wheat seeds or hay lettuce particles remain in the medium vessel 7 The medium can be stored at 4 C for a few weeks it should be discarded when contaminations with bacteria are observed i e when medium gets cloudy Timing Preparation of medium 1 2 h au
194. mation Altermatt et al 2015 Methods in Ecology and Evolution DOI 10 1111 2041 210X 12312 1 1 Species used Altermatt F Bieger A Carrara F Rinaldo A amp Holyoak M 2011 Effects of connectivity and recurrent local disturbances on community structure and population density in experimental metacommunities PLoS ONE 6 e19525 Altermatt F amp Holyoak M 2012 Spatial clustering of habitat structure effects patterns of community composition and diversity Ecology 93 1125 1133 Altermatt F Schreiber S amp Holyoak M 2011 Interactive effects of disturbance and dispersal directionality on species richness and composition in metacommunities Ecology 92 859 870 Cadotte M W 2007a Competition colonization trade offs and disturbance effects at multiple scales Ecology 88 823 829 Cadotte M W 2007b Concurrent niche and neutral processes in the competition colonization model of species coexistence PROCEEDINGS OF THE ROYAL SOCIETY B BIOLOGICAL SCIENCES 274 2739 2744 Cadotte M W Mai D V Jantz S Collins M D Keele M amp Drake J A 2006 On Testing the Competition Colonization Trade Off in a Multispecies Assemblage The American Naturalist 168 704 709 Carrara F Altermatt F Rodriguez Iturbe I amp Rinaldo A 2012 Dendritic connectivity controls biodiversity patterns in experimental metacommunities Proceedings of the National Academy of Sciences 109 5761 5766 Carrara F Rina
195. mbining flow cytometry with automated image analysis such as FlowCAM Fluid Imaging Technologies Sieracki Sieracki amp Yentsch 1998 The former can quantify morphological traits such as cell size and cell shape and be combined with fluorescence staining to yield information on DNA contents Van Nevel et al 2013 but cannot identify more complex shapes and no behavioural interactions can be measured due to its invasive nature and its measurement technique see section 2 8 for details Whereas the above applications are well developed for characterizing traits and abundance of single species systems complex communities with many species with overlapping morphologies are still a considerable challenge but recent work on digital video analysis shows that it is feasible given sufficient differentiation in morphology and or behaviour especially movement behaviour which is often a distinct feature of protist species Work with microcosms is insofar easier that usually a limited and known number of species inhabits a community and reference data for the different morphologies and behaviours is readily available from monocultures After individuals of each species can be reliably distinguished from videos of a complex community the next step is the automated quantification of interspecific interactions such as predation or interference competition Delgado et al 2014 These applications however require powerful tracking algorithms that can deal wi
196. me 1 on the datasheet 8 Put the lid back onto the microcosm and move the microcosms to a safe place We are finished with it and don t want to risk knocking it over or putting something back into it 56 Supplementary Information Altermatt et al 2015 Methods in Ecology and Evolution DOI 10 1111 2041 210X 12312 2 2 Estimating abundances by eye Microscopy 10 11 12 13 14 15 Place the withdrawn medium in small drops on a Petri dish dispose the drops in lines and rows see picture a Make sure that the counter is set to zero Look at the drops under the dissecting microscope see photograph b c Adjust illumination and magnification as required If the drops contain few enough individuals count now using a clicker counter to make a running total across all the drops you need to record only the total number of individuals in all drops not the number in each drop Move from one drop to the other to avoid missing any Dilute the sample if the cells are too many to be counted reliably Use the 1000 ul pipette to put a suitable amount of diluent into the Petri dish and mix well with the sample by squirting in and out of the pipette Record the new volume the sum of the original volume and the volume of diluent added in column Volume 2 of the datasheet Now withdraw a fraction of the diluted volume and repeat steps 9 to 11 The new sampled volume is now Volume 3 on the datasheet Write on the
197. metacommunities of Sarracenia purpurea inquilines American Naturalist 162 165 171 Kratina P Hammill E amp Anholt B R 2010 Stronger inducible defences enhance persistence of intraguild prey Journal of Animal Ecology 79 993 999 Kratina P Vos M Bateman A amp Anholt B R 2009 Functional responses modified by predator density Oecologia 159 425 433 Laakso J Loytynoja K amp Kaitala V 2003 Environmental noise and population dynamics of the ciliated protozoa Tetrahymena thermophila in aquatic microcosms Oikos 102 663 671 Lawler S P amp Morin P J 1993 Food web architecture and populatio dynamics in laboratory microcosms of protists American Naturalist 141 675 686 Lee J J Leedale G F amp Bradbury P 2000 Illustrated guide to the Protozoa Society of Protozoologists Lawrence Kansas Limberger R amp Wickham S 2011 Competition colonization trade offs in a ciliate model community Oecologia 167 723 732 Limberger R amp Wickham S 2012 Disturbance and diversity at two spatial scales Oecologia 168 785 795 Luckinbill L S 1973 Coexistence in laboratory populations of Paramecium aurelia and its predator Didinium nasutum Ecology 54 1320 1327 tss Supplementary Information Altermatt et al 2015 Methods in Ecology and Evolution DOI 10 1111 2041 210X 12312 1 1 Species used Luckinbill L S 1974 The effects of space and enrichment on a predator prey system
198. microscope Fig S5 Sterile bench 30 Supplementary Information Altermatt et al 2015 Methods in Ecology and Evolution DOI 10 1111 2041 210X 12312 1 4 Apparatus For the handling and culturing of protists in microcosms the following equipment is needed 200 mL glass jars e g Erlenmeyer jars to grow protist cultures 2 L autoclavable containers to prepare the medium Measuring glass beakers Micropipettes 1 10 uL 10 100 uL 100 1000 uL 1 5 mL Petridishes Polystyrol Small vials to take subcultures e g scintillation vials 10 or 50 mL PP tubes Fig S1 An exemplary laboratory in which protist microcosm experiments can be conducted Photo by Florian Altermatt Fig S2 Autoclave used to sterilize protist medium and equipment used for protist experiments Photo by Florian Altermatt 3 Supplementary Information Altermatt et al 2015 Methods in Ecology and Evolution DOI 10 1111 2041 210X 12312 1 4 Apparatus Fig S3 Example of an incubator with individual protist microcosms showing the experiment by M chler amp Altermatt 2012 The incubator is temperature controlled 20 C and has constant fluorescent lighting The position of the replicates of each treatment is randomized across the incubator to avoid biases due to position in the incubator Photo by Elvira M chler Fig S4 Temperature controlled walk in chambers in which protist experiments can be conducted At each sh
199. mon set of species across studies and laboratories is the availability of prior infor mation such as species traits and the possibility to link findings across studies McGrady Steed Harris amp Morin 1997 Altermatt Schreiber amp Holyoak 2011b Carrara et al 2012 The selection of species is often a combination of practical reasons such as morphological distinctness cultivability or availability and the respective question of interest e g including different trophic levels or not All species can in principle be collected directly from natural pop ulations in ponds tree holes or other aquatic habitats This approach allows the use of co evolved potentially genetically diverse populations of natural co occurring species However the difficulties faced during the isolation cultivation and identification of naturally collected species often preclude this approach see also Lee amp Soldo 1992 A set of iden tification manuals Foissner amp Berger 1996 Lee Leedale amp Bradbury 2000 Patterson 2003 as well as genetic barcoding techniques Sec tion 2 9 Pawlowski et al 2012 should allow identifications at least to the genus level even to non taxonomists Nevertheless many studies used species either already available in laboratory stocks or species from culture collections 1 2 CULTURE MEDIUM The chemical composition of the nutrient medium is a major environ mental feature Fig 1 7 affecting growth and reproduction
200. n or the Preservation of Favoured Races in the Struggle for Life John Murray London Davies K F Holyoak M Preston K A Offeman V A amp Lum Q 2009 Factors controlling community structure in heterogeneous metacommunities Journal of Animal Ecology 78 937 944 Donahue M J Holyoak M amp Feng C 2003 Patterns of Dispersal and Dynamics among Habitat Patches Varying in Quality The American Naturalist 162 302 317 ed3 Supplementary Information Altermatt et al 2015 Methods in Ecology and Evolution DOI 10 1111 2041 210X 12312 1 1 Species used Fellous S Duncan A B Quillery E Vale P F amp Kaltz O 2012 Genetic influence on disease spread following arrival of infected carriers Ecology Letters 15 186 192 Fenchel T 1974 Intrinsic rate of natural increase The relationship with body size Oecologia 14 317 326 Fjerdingstad E Schtickzelle N Manhes P Gutierrez A amp Clobert J 2007 Evolution of dispersal and life history strategies Tetrahymena ciliates BMC Evolutionary Biology 7 133 Foissner W amp Berger H 1996 A user friendly guide to the ciliates Protozoa Ciliophora commonly used by hydrobiologists as bioindicators in rivers lakes and water waters with notes on their ecology Freshwater Biology 35 375 482 Fox J W McGrady Steed J amp Petchey O L 2000 Testing for local species saturation with nonindependent regional species pools Ecology Letter
201. n Amoebae Cob cytochrome b SSU of rDNA ribosomal small sub unit Slapeta Moreira amp Lopez Garcia 2005 Chantangsi et al 2007 Nassonova et al 2010 Kher et al 2011 or in fast evolving nuclear portions e g ITS1 2 internal transcribed spacer 1 2 in Carchesium polypinum diatoms and Tetrahymena thermophila SSU rDNA 5 8S in Paramecium aurelia or LSU rDNA ribosomal large sub unit Chen Zhong amp Monteiro 2006 Catania et al 2009 Gentekaki amp Lynn 2009 Moniz amp Kaczmarska 2010 The PCR conditions and primers used are described in the corresponding publications New barcodes could also be designed with Primer3 software http bioinfo ut ee primer3 0 4 0 that helps to design primers in association with NCBI database A classical procedure for the PCR Chen Zhong amp Monteiro 2006 could be tested and modified if necessary knowing that the Tm melting point temperature has a strong influence 82 Supplementary Information Altermatt et al 2015 Methods in Ecology and Evolution DOI 10 1111 2041 210X 12312 2 7 DNA sequencing and barcoding on the PCR functioning An optimal PCR protocol can be achieved by testing across a temperature magnesium gradient Finally the PCR products could be sequenced by Sanger Sequencing method or Next Generation Sequencing NGS lumina Solexa Solid see Valentini Pompanon amp Taberlet 2009 The use of Sanger method is favoured when the number of sequences and barcodes are limited N
202. n density larger samples will give better estimates Sam pling greater volumes reduces the sampling error but can be more time demanding and also represents a larger disturbance if the sam pling involves medium removal How frequently to sample depends on the goals of the experiment and on the variables of interest It is often possible and desirable to make multiple measurements from the same sample such as abundance of different protist species and bacteria and chlorophyll concentration e g Sections 2 2 2 3 and 2 5 For reasons of practicality and sterility the volume sampled is dis carded and replaced with the same volume of sterile culture medium However when larger volumes must be sampled e g 5 mL from a 100 mL microcosm they can be returned to the microcosms in order to minimize disturbance provided that adequate steps are taken to avoid contamination For some questions such as those concerning extinction times or the detection of rare large protists in a community of abundant small protists e g Carrara et al 2012 Clements et al 2014 sampling the entire microcosm is highly desirable This can be achieved by using a vessel with a transparent bottom that can be placed directly under a dissecting microscope 2 2 ESTIMATING ABUNDANCES BY EYE MANUAL MICROSCOPY Protist ecology has used optical microscopes for estimating protist den sities and for observing cell features since its very beginning Gause 1934 Luckinbill
203. n it was made ene se Supplementary Information Altermatt et al 2015 Methods in Ecology and Evolution DOI 10 1111 2041 210X 12312 1 2 Culture medium 7 The medium can be stored at 4 C for a few weeks it should be discarded when contaminations with bacteria are observed i e when medium gets cloudy Timing Preparation of medium 1 2 h autoclaving 0 5 h cooling down 12 h Chalkley s solution To get 1 L of total medium the following procedure is advised 1 Fill about 900 mL of deionized water dH O into an autoclavable beaker with a minimum volume of 1 5 L 2 Add 5 mL each of the stock solutions of table S2 in the order specified while stirring continuously 3 Bring total volume to 1 L by adding dH O 4 Cover the beaker and autoclave the medium at 121 C for 15 20 minutes 5 Before use the medium must cool down to the temperature used in the experiment usually around 20 C 6 Label the medium bottle with the name of the medium type the initials of the person who made it and the date when it was made 7 The medium can be stored at 4 C for a few weeks it should be discarded when contaminations with bacteria are observed i e when medium gets cloudy Timing Preparation of medium 1 2 h autoclaving 0 5 h cooling down 12 h Proteose peptone medium Proteose peptone medium is a modified Bristol s medium and generally 1 or 2 proteose peptone medium is used This medium is generally used for axenic
204. n medium volume as otherwise laminar flow occurs Fig S1 Examples of protist microcosm landscapes A 100 mL glass jar patches connected by passive dispersal pipetting along a linear landscape example from Altermatt et al 2011 B 100 mL Nalgene vials connected by tubing i e discrete system with active dispersal in which active dispersal between high and low nutrient patches was manipulated example from Altermatt amp Holyoak 2012 C 10 mL multi well plate landscape connected by passive dispersal comparing dispersal along complex network structures and subsequent effects on diversity dendritic vs 2D lattice networks example from Carrara et al 2012 Carrara et al 2014 D Continuous landscapes with active dispersal in silicon tubing example from Seymour amp Altermatt 2014 Seymour Fronhofer amp Altermatt 2014 123 Supplementary Information Altermatt et al 2015 Methods in Ecology and Evolution DOI 10 1111 2041 210X 12312 3 5 Spatial structure Trouble shooting Tips and Tricks Two patch systems as well as more complex landscapes may have to be adapted to the specific study organism or set of study organisms Vial volume may have to be increased for species with very low carrying capacities for example see section 2 1 Similarly for very large species the diameter of connecting tubes or the volume pipetted for passive dispersal setups has to be increased Furthermore different species may str
205. n rates in heterotrophic free living protozoa Microbial Ecology 9 99 122 Petchey O L McPhearson P T Casey T M amp Morin P J 1999 Environmental warming alters food web structure and ecosystem function Nature 402 69 12 Pratt D M amp Berkson H 1959 Two sources of error in the Oxygen light and dark bottle method Limnology and Oceanography 4 328 334 101 Supplementary Information Altermatt et al 2015 Methods in Ecology and Evolution DOI 10 1111 2041 210X 12312 2 10 Nutrient dynamics and litter bags Supplementary information for Altermatt et al Methods in Ecology and Evolution DOT 10 1111 2041 210X 12312 Big answers from small worlds a user s guide for protist microcosms as a model system in ecology and evolution Altermatt F Fronhofer EA Garnier A Giometto A Hammes F Klecka J Legrand D Machler E Massie TM Pennekamp F Plebani M Pontarp M Schtickzelle N Thuillier V amp Petchey OL 2 10 Nutrient dynamics and litter bags Introduction Most microcosm studies manipulate the food availability by the concentration of the medium Less frequently is the nutrient composition or elemental balance i e stoichiometry between carbon nitrogen and phosphorus taken into account Decomposition is a critical ecosystem process due to its influence on nutrient cycling and availability Ribblett Palmer amp Coats 2005 Microcosm studies of decomposition rate include the effects of biodiversi
206. n split into aliquots and stored at 80 C Subsequently the same set of bacteria can be used from these stocks to start experiments with protists Removing bacteria 26 Supplementary Information Altermatt et al 2015 Methods in Ecology and Evolution DOI 10 1111 2041 210X 12312 1 3 Bacteria The advantage of axenic cultures is the higher level of standardization and reproducibility To maintain axenic cultures or to transform non axenic cultures into axenic ones the medium needs to be treated with antibiotics and subsequently sterile techniques need to be used continuously To remove bacteria a combination of 250 ug ml penicillin G streptomycin sulfate and 1 25 ug ml amphotericin B Fungizone GIBCO is added to cultures kept in any type of media If this is not successful the addition of 2 ul ml Normocin InvivoGen has been reported to successfully eliminate bacteria Asai amp Forney 2000 Axenic cultures are often used for single species experiments especially Tetrahymena sp e g Asai amp Forney 2000 Fjerdingstad et al 2007 Pennekamp amp Schtickzelle 2013 while almost all experiments containing multiple species of protists are done under non axenic conditions e g Petchey et al 1999 Haddad et al 2008 Altermatt Schreiber amp Holyoak 2011 Importantly an often diverse but undocumented diversity of bacteria and microflagellates may persist in non axenic conditions It is not uncommon to notice that
207. n the environmental conditions and possible species specific resistance to the disturbance itself include change in temperature e g to mimic global warming Petchey et al 1999 Scholes Warren amp Beckerman 2005 and change of the medium with respect to pH or chemical composition e g Jin Zhang amp Yang 1991 When studying disturbances perturbations most interest is on different aspects of the regime e g pulse press frequency magnitude on population and community dynamics In principle disturbances or perturbations in general can be achieved through manipulations of many aspects of the abiotic environment Sousa 1984 For example this includes temperature acidity or toxins However manipulations of these are mostly general e g manipulation pH or not very commonly done with protists e g effect of toxins and so we do not cover each of them in detail The probably most commonly applied disturbance in microcosm experiments is density independent mortality where either a part of the community is replaced by autoclaved medium e g Warren 1996 Haddad et al 2008 Altermatt et al 2011 or where a part of the community is killed by heating or sonication but the medium retained in the culture such that chemical and nutritional conditions remain constant e g Jiang amp Patel 2008 Violle Pu amp Jiang 2010 Machler amp Altermatt 2012 This type of disturbance is easy to apply but does not allow species specific
208. ndance Different numbers of protist pellets were used by Holyoak 2000 1 2 and 4 each with a weight of 0 57 g translating to 0 57 1 14 and 2 28 g per litre for low intermediate and high concentrations whereas Orland amp Lawler 2004 manipulated the amount in grams of the protist pellet directly low 0 2 g l high 1 g l Cadotte et al 2006 used levels of 1g 0 1g and 0 01g of protist pellet per litre for high intermediate and low nutrient levels respectively in addition to different vitamin provisions Haddad et al 2008 manipulated nutrient levels by replacing part of the medium with nutrient free sterile spring water compared to a nutrient treatment that replaced the original medium with fresh medium of the same type Luckinbill 1978 and Luckinbill amp Fenton 1979 varied the amount of nutrients available directly via changes in bacterial abundance as well as indirectly via nutrient availability Friman et al 2008 manipulated low and high nutrient concentrations by two versus eightfold dilution of the cerophyll medium to study the effects of productivity on the ecological and evolutionary dynamics of a predator prey interaction Besides seeds that slowly release nutrients are used to manipulate the carbon sources available to bacteria which in turn feedback to higher abundances of bacteria as protist prey These are often added to stabilize the dynamics of the communities 115 Supplementary Information Altermat
209. nditions and possible species specific resistance to the disturbance itself include change in temperature e g to mimic global warming Pet chey et al 1999 Laakso Loytynoja amp Kaitala 2003 Scholes Warren amp Beckerman 2005 and changes of the medium with respect to pH or chemical composition e g Jin Zhang amp Yang 1991 3 4 MANIPULATION OF NUTRIENT CONCENTRATION AND VISCOSITY OF THE MEDIUM The availability of resources as well as time energy spent collecting them is an important ecological variable Nutrient concentration in protist microcosms is commonly manipulated e g Luckinbill 1974 Li amp Stevens 2010 by dilution of the medium see Section 1 2 and or adding sources of slow nutrient release such as seeds e g autoclaved wheat or millet seeds e g Altermatt amp Holyoak 2012 While for pro teose peptone medium the concentration of the proteose peptone and additions of limiting nutrients such as iron via yeast extract directly determines the food available to protists manipulations of available bacteria are indirect via the concentration of nutrients avail able to the bacteria To manipulate the speed of movement dispersal the viscosity of the medium can be increased The viscosity can be manipulated by adding methyl cellulose e g Luckinbill 1973 or Ficoll GE Healthcare com pany affects viscosity independent of temperature Beveridge Petchey amp Humphries 2010b A higher viscosity directly decrease
210. ndividual species at low density to measure growth curves to estimate growth rate r and carrying capacity K You can skip this step if you already have reliable measurements of these parameters 104 Supplementary Information Altermatt et al 2015 Methods in Ecology and Evolution DOI 10 1111 2041 210X 12312 2 12 Interaction strengths 3 Take a sample of the two cultures at carrying capacity and estimate population density in these particular cultures 4 Take 5 ml of the culture of one species and put it to a suitable bottle volume at least 20 ml 5 Add 5 ml of the second species 6 Create several replicates at least four preferably six to eight 7 Note the time of the beginning of the experiment and the density of the starting cultures see point 3 above 8 Keep the mixed culture in a climate chamber with controlled temperature and suitable illumination for at least 10 days 9 Measure population density of both species at the end of the experiment You can also do repeated measurements to get a two species time series this is not necessary but can decrease uncertainty 10 Fit a Lotka Volterra model to the experimental measurements You need to know r K initial density of both species and final density of both species to estimate competition coefficients See also Carrara et al 2014a Carrara et al 2014b Predation The procedures described below apply to predators feeding strictly on other protists and n
211. nelastic scattering of photons from a sample Raman effect That is the scattered photons posses a wavelength energy that is different from that of the incident light monochromatic laser The change in wavelength energy during the scattering process is caused by the interaction of the photon with vibrational modes of the various chemical bonds of the molecules within a sample e g C O or C H Wagner 2009 Raman scattering provides detailed information about the chemical composition of a sample molecular structure cellular composition or physiological state of the sample which is summarized in the Raman spectrum Huang et al 2010 Two extensions of RMS are of special interest for experiments with microorganisms First a combination with stable isotope probing SIP Li et al 2013 2013 demonstrated that RMS is able to detect isotopic shifts to higher wavelengths or lower wavenumbers wavelength so called red shifting in the Raman spectra when replacing C with C carbon The calculated red shift ratio RSR is highly correlated with the C content of the cells Thus combining SIP with RMS bears great potential for ecological experiments such as tracking the flow of elements through food webs on a single cell basis Abraham 2014 Moreover using SIP with RMS is non invasive which stays in contrast to destructive methods such as 16S rRNA sequencing Second a combination with fluorescence in situ hybridization FISH Becaus
212. nferring species interactions in ecological communities a comparison of methods at different levels of complexity Methods in Ecology and Evolution in review Delong J P amp Vasseur D A 2013 Linked exploitation and interference competition drives the variable behavior of a classic predator prey system Oikos 122 1393 1400 Hammill E Petchey O L amp Anholt B R 2010 Predator Functional Response Changed by Induced Defenses in Prey American Naturalist 176 723 731 Harrison G W 1995 Comparing Predator Prey Models to Luckinbill s Experiment with Didinium and Paramecium Ecology 76 3577 374 Jost C amp Arditi R 2001 From pattern to process identifying predator prey models from time series data Population Ecology 43 229 243 107 Supplementary Information Altermatt et al 2015 Methods in Ecology and Evolution DOI 10 1111 2041 210X 12312 3 2 Density manipulation Supplementary information for Altermatt et al Methods in Ecology and Evolution DOT 10 1111 2041 210X 12312 Big answers from small worlds a user s guide for protist microcosms as a model system in ecology and evolution Altermatt F Fronhofer EA Garnier A Giometto A Hammes F Klecka J Legrand D Machler E Massie TM Pennekamp F Plebani M Pontarp M Schtickzelle N Thuillier V amp Petchey OL 3 2 Density manipulation Introduction Density manipulations are an important technique used in microcosm studies using protist
213. ng You will be quite slow at first but will speed up a lot For a monoculture this process should take a couple of minutes for one microcosm Cleaning up after the sampling session could take about 15 minutes Troubleshooting Tips and Tricks Remember that the total magnification of a microscope is the product of the magnification offered by the objective in use and of the magnification due to the eyepiece fixed either 2x 10x or less commonly 50x Switch the microscope on then dime the illumination up dime the illumination down before switching the microscope off What volume to sample Often removing 0 5ml is a good option However when population sizes are low this may result in high sampling error e g zero counts when individuals are present When population sizes are high considerable diluent will be required a couple of ml With experience you will be able to adjust the volume sampled and the volume of diluent to get good counts What is a good count You should aim at sampling a volume that allows counting a least ten individuals minimum across the whole sample and not 59 Supplementary Information Altermatt et al 2015 Methods in Ecology and Evolution DOI 10 1111 2041 210X 12312 2 2 Estimating abundances by eye Microscopy more than about 15 per drop maximum We control the maximum number of individuals by dilution We can t always have so much control over the minimum number of individuals sin
214. nifera Foraminifera Chloroplastida Chloroplastida Alveolata Chromista Alveolata Alveolata Foraminifera Alveolata Alveolata Alveolata Alveolata Bretthauer 1980 Elstad 1986 Fox 2004 Ostman et al 2006 Fukami 2001 Giometto et al 2013 Fox 2007 Davies et al 2009 genus Kneitel amp Perrault 2006 genus Krumins et al 2006 Giometto et al 2013 Riblett et al 2003 Dickerson amp Robinson 1985 Dickerson amp Edgemon 1988 Veilleux 1979 Holyoak amp Sachdev 1998 Luckinbill 1979 Warren 1996 Oikos Davies et al 2009 Petchey 2000 Jiang et al 2011 Livingston et al 2013 Dickerson amp Robinson 1986 Robinson amp Edgemon 1988 Fitter amp Hillebrand 2009 Holt et al 2004 genus Scholes et al 2005 genus Warren amp Weatherby 2006 genus Robinson amp Edgemon 1988 Dickerson amp Robinson 1985 Altermatt amp Holyoak 2012 Davies et al 2009 Dickerson amp Robinson 1985 Kawambata et al 1995 Giometto et al 2013 Altwegg et al 2004 Carrara et al 2012 Jiang amp Morin 2005 Kratina et al 2007 Bretthauer 1980 Mata et al 2013 Filip et al 2012 Li amp Stevens 2010 Oikos Li amp Stevens 2012 Naeem amp Li 1998 Altwegg et al 2004 Balciunas amp Lawler 1995 Fox et al 2013 Holyoak amp Sachdev 1998 Spencer amp Warren 1996 Oecologia Altwegg et al 2004 Li amp Stevens 2010 CommEcol Filip et al 2012 Fitter amp Hillebrand 2009 Filip et al 2012 McGr
215. nisms by fluorescence microscopy and digital image analysis Applied Microbiology and Biotechnology 75 237 248 Delgado M d M Penteriani V Morales J M Gurarie E amp Ovaskainen O 2014 A statistical framework for inferring the influence of conspecifics on movement behaviour Methods in Ecology and Evolution 5 183 189 Dell A I Bender J A Branson K Couzin I D de Polavieja G G Noldus L P J J P rez Escudero A Perona P Straw A D Wikelski M amp Brose 66 Supplementary Information Altermatt et al 2015 Methods in Ecology and Evolution DOI 10 1111 2041 210X 12312 2 3 Image and video analysis U 2014 Automated image based tracking and its application in ecology Trends in Ecology amp Evolution 29 417 428 Fjerdingstad E Schtickzelle N Manhes P Gutierrez A amp Clobert J 2007 Evolution of dispersal and life history strategies Tetrahymena ciliates BMC Evolutionary Biology 7 133 Fronhofer E A amp Altermatt F 2014 Eco evolutionary dynamics at the edge experimental invasions reveal fundamental shifts in life history strategies Fronhofer E A Kropf T amp Altermatt F 2014 Density dependent movement and the consequences of the Allee effect in the model organism Tetrahymena Journal of Animal Ecology DOI 10 1111 1365 2656 12315 Giometto A Rinaldo A Carrara F amp Altermatt F 2014 Emerging predictable features of replicated biological i
216. nstructed to the use of the autoclave at hand should use it and during the handling of chemicals Wearing lab coats and protective glasses is advised Fig S1 Autoclaved bottle with protozoa pellet medium ready to use Note the black stripes on the autoclave tape indicating that it was autoclaved and also giving date and initials of when and by whom the medium was made The sediments at the bottom are remains of dissolved protozoa pellets and are generally discarded 19 Supplementary Information Altermatt et al 2015 Methods in Ecology and Evolution DOI 10 1111 2041 210X 12312 1 2 Culture medium Materials Equipment For the making of all media the following equipment is needed Autoclave to sterilize the medium as well as beakers etc used to handle the final medium Microbalance with a precision of at least 0 01 g to weigh the chemicals used for the different media Graduated beakers to measure different volumes of liquid We recommend a set of graduated beakers with the following maximum volume 10 mL 20 mL 100 mL 500 mL 1000 mL and 2000 mL Micropipettes to handle solutions in the range of 0 1 to 10 mL Containers flasks to make autoclave and temporarily store the medium We recommend using containers with a volumetric content about 50 larger than the actual medium volume to be made in order to avoid spilling during autoclaving For making 1 L of medium 1 5 L Erlenmeyer glass beakers have been proven hi
217. nt One limitation of this method is that organisms that require carbon dioxide will be negatively affected within the apparatus Procedure for Optodes 1 Choose culture vessels that are compatible with the optode technology e g pyrex with thin enough walls 2 Glue the optodes to the inside surface of the culture vessels at a specific position Ensure that the glue is non toxic for the organisms Calibrate individual optodes following manufacturers guides and methods Autoclave the vessels optodes are unaffected Prepare the samples as required Place the culture vessels inside an incubator to ensure constant temperature throughout the measurement NM KW 7 Take a measurement as per the manufacturers instructions ensuring that the microcosms are not moved before a measurement is made Even small movements can affect measured dissolved oxygen 8 Perform calculations to transform measures of dissolved oyxgen into measures of oxygen production rate References Campbell C Chapman S amp Davidson M 2003 MicroResp Technical Manual pp 40 Macaulay Scientific Consulting Ltd Abderdeen Campbell C D amp Chapman S J 2003 A Rapid Microtiter Plate Method To Measure Carbon Dioxide Evolved from Carbon Substrate Amendments so as To Determine the Physiological Profiles of Soil Microbial Communities by Using Whole Soil Applied and Environmental Microbiology 69 3593 3599 Fenchel T amp Finlay B J 1983 Respiratio
218. nvasion fronts Proceedings of the National Academy of Sciences 111 297 301 K hl H S amp Burghardt T 2013 Animal biometrics quantifying and detecting phenotypic appearance Trends in Ecology amp Evolution 28 432 441 Laakso J Loytynoja K amp Kaitala V 2003 Environmental noise and population dynamics of the ciliated protozoa Tetrahymena thermophila in aquatic microcosms Oikos 102 663 671 Lard M B ckman J Yakovleva M Danielsson B amp Hansson L A 2010 Tracking the Small with the Smallest Using Nanotechnology in Tracking Zooplankton PLoS ONE 5 Mallard F Le Bourlot V amp Tully T 2013 An automated image analysis system to measure and count organisms in laboratory microcosms PLoS ONE 8 McGill B J Enquist B J Weiher E amp Westoby M 2006 Rebuilding community ecology from functional traits Trends in Ecology amp Evolution 21 178 185 Mesquita D P Amaral A L amp Ferreira E C 2013 Activated sludge characterization through microscopy A review on quantitative image analysis and chemometric techniques Analytica Chimica Acta 802 14 28 Pennekamp F Mitchell K A Chaine A amp Schtickzelle N 2014 Dispersal propensity in Tetrahymena thermophila ciliates a reaction norm perspective Evolution 68 2319 2330 Pennekamp F amp Schtickzelle N 2013 Implementing image analysis in laboratory based experimental systems for ecology and evolution a
219. o in the following the term protist covers free living unicellular eukaryotes that are not purely autotrophic Fig S1 This mostly includes species within the Cryptophyta Foraminifera Alveolata Chloroplastida and Tubulinea incl Amoebozoa Adl et al 2005 Adl et al 2012 Very typical and commonly used representatives are species of the genera Paramecium Tetrahymena and Colpidium all Alveolates used in gt 80 studies as well as species of the genera Bodo Colpoda Euplotes and Spirostomum all used in at least 30 50 studies These species cover different trophic levels purely bacterivorous heterotrophs mixotrophs and predatory heterotrophs feeding also or exclusively on other protists Table S1 gives a comprehensive list of species that have been used in microcosm experiment studies as discussed here Many of the methods described in the following are also not restricted to protists but can and have been also applied to single celled autotrophic species i e algae or metazoans of similar size and ecological functional e g rotifers Fig S1 Examples of different protist species used in microcosm experiments A Blepharisma sp B Euglena gracilis C Paramecium bursaria D Colpidium sp All pictures by F Altermatt R Illi Supplementary Information Altermatt et al 2015 Methods in Ecology and Evolution DOI 10 1111 2041 210X 12312 1 1 Species used Some of the species used can be cultivated in axenic con
220. o larger and more stable populations of protists but are less standardized Many of the protists can still survive and reproduce in the above mentioned media at 10 to 20 fold dilutions e g Altermatt amp Holyoak 2012 1 3 BACTERIA Many protists are primarily or exclusively bacterivorous and thus many experiments involve bacteria as a food source for the protists Next to the chemical composition of the medium the availability of a common set of bacteria as a food source is a critical step towards standardization Bacteria may be a central component of protist experi ments and can potentially affect ecological and evolutionary dynamics 2014 The Authors Methods in Ecology and Evolution 2014 British Ecological Society Methods in Ecology and Evolution 6 218 231 222 Altermatt et al as they are both part of the environment Fig 1 7 as well as involved in ecological interactions predation Fig 1 ii While different non pathogenic bacteria species have been successfully added and used in protist microcosm experiments e g Bacillus subtilis B brevis B cereus Enterobacter aerogenes Serratia fonticola or S marcescens the bacterial community is often the least understood and controlled element of the microcosm due to the invasion and establishment of cryptic species in the community A better control of the bacterial com munities in protist microcosm experiments would be a desired improve ment for future work
221. ock M C 2012 Experimental evolution Trends in Ecology amp Evolution 27 547 560 Kneitel J M amp Miller T E 2003 Dispersal rates affect species composition in metacommunities of Sarracenia purpurea inquilines American Naturalist 162 165 171 Kratina P Hammill E amp Anholt B R 2010 Stronger inducible defences enhance persistence of intraguild prey Journal of Animal Ecology 79 993 999 Kratina P Vos M Bateman A amp Anholt B R 2009 Functional responses modified by predator density Oecologia 159 425 433 Laakso J Loytynoja K amp Kaitala V 2003 Environmental noise and popula tion dynamics of the ciliated protozoa Tetrahymena thermophila in aquatic microcosms Oikos 102 663 671 Lawler S P 1998 Ecology in a bottle using microcosms to test theory Experi mental Ecology Issues and Perspectives eds W J J Resetarits amp J Bernardo pp 236 253 Oxford University Press New York Lawler S P amp Morin P J 1993 Food web architecture and population dynamics in laboratory microcosms of protists American Naturalist 141 675 686 Lee J J Leedale G F amp Bradbury P 2000 I ustrated Guide to the Protozoa Society of Protozoologists Lawrence Kansas Lee J J amp Soldo A T 1992 Protocols in Protozoology Society of Protozoology Lawrence Kansas Legrand D Guillaume O Baguette M Cote J Trochet A Calvez O et al 2012 The Metatron an e
222. of going back and forth or removing multiple microcosms from incubators for prolonged periods Lids should be off for as little time as possible Best practice is to never put a lid down I e take it off keep it in your hand and put it back on Don t put lids down on the bench Don t attempt to carry more than one microcosm sample in either hand Don t attempt to carry three or more at once If you have to move microcosms between rooms either carry only one you need your other hand to open doors or move them on a trolley or a tray During an experiment ensure that the volume of medium in each microcosm is correct This may mean topping up perhaps during any removal and replacement of media that may be occurring The top up can be done with fresh medium to deal with medium removal or with sterile deionized water to deal with evaporation 37 Supplementary Information Altermatt et al 2015 Methods in Ecology and Evolution DOI 10 1111 2041 210X 12312 1 5 Laboratory practices Troubleshooting Tips and Tricks Put one person in charge of dealing with emergencies such as power failures instrument faults and equipment breakdown keep the contact details of repair technicians at hand When setting up microcosms How to avoid errors adding the correct species to the correct MV Add one species at a time Separate on the desk all the MVs that require this species then double check this even triple checking is wort
223. olated from one single cell is initially a monoclonal population and may only accumulate genetic diversity over time by mutations An initially potentially higher genetic diversity can be achieved by isolating several individuals a time However it is then not known if this includes different cryptic species or different cells that are genetically identical as they originated from the same mother cell in the natural environment already References Adl S M Simpson A G B Farmer M A Andersen R A Anderson O R Barta J R Bowser S S Brugerolle G Fensome R A Fredericq S James T Y Karpov S Kugrens P Krug J Lane C E Lewis L A Lodge J Lynn D H Mann D G McCourt R M Mendoza L Moestrup O Mozley Standridge S E Nerad T A Shearer C A Smirnov A V Spiegel F W amp Taylor M 2005 The new higher level classification of eukaryotes with emphasis on the taxonomy of protists Journal of Eukaryotic Microbiology 52 399 451 Adl S M Simpson A G B Lane C E Luke J Bass D Bowser S S Brown M W Burki F Dunthorn M Hampl V Heiss A Hoppenrath M Lara E le Gall L Lynn D H McManus H Mitchell E A D Mozley Stanridge S E Parfrey L W Pawlowski J Rueckert S Shadwick L Schoch C L Smirnov A amp Spiegel F W 2012 The Revised Classification of Eukaryotes Journal of Eukaryotic Microbiology 59 429 514 12 Supplementary Infor
224. olle et al 2011 Warren amp Gaston 1997 Spumella sp Archaeplastida Chloroplastida J rgens amp Sala 2000 Riblett et al 2008 Staurastrum gladiosum Archaeplastida Chloroplastida Livingston et al 2013 McGrady Steed et 231 1997 genus Davies et al 2009 genus Fox 2008 genus Staurastrum pingue Archaeplastida Chloroplastida Robinson amp Edgemon 1988 Steinia sp SAR Alveolata Lawler 1993 Stentor coeruleus SAR Alveolata Bretthauer 1980 Cadotte amp Fukami 2005 Jiang amp Morin 2005 Spencer amp Warren 1996 Oecologia Stentor polymorphus SAR Alveolata Have1993 Ostman et al 2006 Stephanodiscus sp SAR Stramenopiles Robinson amp Edgemon 1988 Stichococcus sp Archaeplastida Chloroplastida Scraff amp Bradley 2002 Stigeoclonium sp Archaeplastida Chloroplastida Jin et al 1991 Stylonychia mytilus SAR Alveolata Bretthauer 1980 Fox et al 2000 genus McGrady Steed et al 1997 genus Filip et al 2009 genus Stylonychia pustulata SAR Alveolata Limberger amp Wickham 2012 Oecologia Limberger amp Wickham 2011 PLoSOne Suctoria sp SAR Alveolata Fukami 2001 Synedra sp SAR Stramenopiles Robinson amp Edgemon 1988 Synura sp SAR Stramenopiles Robinson amp Edgemon 1988 Tachysoma pellionellum SAR Alveolata stman et al 2006 Limberger amp Wickham 2012 PLoSOne McGrady Steed amp Morin 1996 genus Tetrahymena pyriformis SAR Alveolata Amezuca amp Holyoak 2000 Glaser 1988 Olito amp Fu
225. ols Finally we also provide at the end of each example a list of general and sometimes protist specific review papers Omics general framework applied to experimental protist microcosms High throughput methods have rapidly spread in the field of ecology and evolution because they allow capturing massive molecular data on a specific sample The general workflow of these methods is presented in Figure S1 Depending on the question raised two strategies can be adopted to collect information The first consists in performing random shotguns to capture all environmental molecules in a sample In microcosms this strategy can be used to assess the physiological responses of communities to changing or stressful environmental conditions to determine the 88 Supplementary Information Altermatt et al 2015 Methods in Ecology and Evolution DOI 10 1111 2041 210X 12312 2 8 Genomics proteomics and epigenomics changes in magnitude or rates of material and energetic fluxes within and between recreated ecosystems Gotelli Ellison amp Ballif 2012 or else to reconstruct the global molecular content of target individuals whole genome transcriptome proteome or epigenome The second strategy consists in performing single molecule surveys within a sample This can be particularly useful to follow the species composition within a community to determine the role of target molecules in organisms adaptation to perturbations e g specific
226. ompared on phenotypic or genetic aspects such as evolved versus non evolved strains Kawecki et al 2012 Standard protocols for the cryopreservation of protists are published McAterr amp Davis 2002 Day amp Stacey 2007 Cassidy Hanley 2012 or are readily available at webpages of culture collections e g http web biosci utexas edu utex protocols aspx Freezing implies a phase of culturing the protists under specific conditions to prepare the cells and ensure the highest cell viability the use of specific cryoprotectants and a progressive and controlled cooling down before long term storage in liquid nitrogen Cryopreservation in principle works for all protists species but we focus here mostly on Tetrahymena as a well developed example We use it to detail the material reagents and protocols necessary to implement long term cryopreservation in LN2 in a laboratory We go beyond the mere description of freezing thawing protocols by delivering information about key points for successful establishment of LN2 cryopreservation in the research laboratory such as consequences of material choice or the importance of a reliable inventory system For a given protist species changes in the protocol will likely reside in specific points only such as culture conditions prior to adding the cryoprotectant or centrifugation force and duration We advise searching the literature and the internet using species or genus names associated to keywo
227. on DOI 10 1111 2041 210X 12312 3 3 Disturbance and perturbation manipulations 5 During sonication the medium can considerably warm and get hot To avoid a temperature effect e g also compared to the control the sample vial with the medium to be sonicated should be placed in an ice bath 6 Put the sonicated medium back to the undisturbed fraction of the sample References Altermatt F Bieger A Carrara F Rinaldo A amp Holyoak M 2011 Effects of connectivity and recurrent local disturbances on community structure and population density in experimental metacommunities PLoS ONE 6 e19525 Altermatt F amp Holyoak M 2012 Spatial clustering of habitat structure effects patterns of community composition and diversity Ecology 93 1125 1133 Altermatt F Schreiber S amp Holyoak M 2011 Interactive effects of disturbance and dispersal directionality on species richness and composition in metacommunities Ecology 92 859 870 Fukami T 2001 Sequence effects of disturbance on community structure Oikos 92 215 224 Haddad N M Holyoak M Mata T M Davies K F Melbourne B A amp Preston K 2008 Species traits predict the effects of disturbance and productivity on diversity Ecology Letters 11 348 356 Jiang L amp Patel S N 2008 Community assembly in the presence of disturbance A microcosm experiment Ecology 89 1931 1940 Jin HJ Zhang Y M amp Yang R 1991 Toxicity an
228. on of molecules to the post extraction treatments needed to the analytical step The choice of post extraction treatments will then depend upon the molecule type and the desired coverage of the data For example deep and high resolution proteomes will be obtained by the cross use of 2 dimensional gel electrophoresis and high performance liquid chromatography mass spectrometry Wright et al 2012 which means that the protein extract loaded on a gel will be treated with trypsin after excision Another example of a post extraction treatment is the purification of mRNA from total RNA extraction with oligo dT magnetic bead that will be further fragmented amplified and ligated with adaptators specific to the Next Generation Sequencer used to obtain transcriptomes Once massive data are generated they are analysed using bioinformatics tools In non model organisms the challenge is the de novo assemblage and characterization of the data while model organisms have published biological molecules accessible on web databases e g NCBI and Swiss Prot Some databases are taxon specific species specific and or marker specific e g EnsemblProtists Tetrahymena Genome Database TGD Protist Ribosomal Reference Database Paramecium Database PDB The bioinformatic treatment of massive data is not trivial for most evolutionary 89 Supplementary Information Altermatt et al 2015 Methods in Ecology and Evolution DOI 10 1111 2041 210X 12312 2 8 Genomi
229. ooth size distribution see Fig S1b When measuring samples containing multiple species one might need to use different sized measuring capillaries to correctly resolve the whole community size distribution 2000 a Euglena gracilis 60 4 b Euplotes aediculatus 50 2 1500 2 40 S 1000 5 30 O O 20 500 10 0 0 O 10 20 30 40 50 O 20 40 60 80 100 Equivalent diameter um Equivalent diameter um Fig S1 Body size distributions measured with CASY in each panel the leftmost peak is the Debris peak and the rightmost peak is the peak relative to the study species Straight lines join data points a Body size distribution not normalized of Euglena gracilis Shown are the total counts in 3 measurements from the same sample with measured density 1 4 x 10 mL measuring capillary 200 um cycles 12 measurement volume 400 mL dilution 5 b Body size distribution not normalized of Euplotes aediculatus Shown are the total counts in 9 measurements from the same sample with measured density 300 mL measuring capillary 200 um cycles 12 measurement volume 400 mL dilution 5 Timing The typical measurement time is 15 s to 60 s per sample depending on the measuring capillary and the number of cycles However the identification of the proper dilution required and the necessity to perform several measurements per sample might increase considerably the processing time The cleaning procedure 3x Clean cycle last
230. oplastida Chloroplastida Chloroplastida Chloroplastida Chloroplastida Chloroplastida Chloroplastida Cryptophyta Glaucophyta Foraminifera Chloroplastida Chloroplastida Discoba Alveolata Collodictyonid ae Alveolata Alveolata Alveolata Alveolata Alveolata Alveolata Alveolata Alveolata Alveolata Chloroplastida Cryptophyta Cryptophyta al 2006 Livingston et al 2013 Olito amp Fukami 2009 Clements et al 2013 JAnim Ecol Holt et al 2004 Law et al 2000 Spencer amp Warren 1996 Oecologia Weatherby et al 1998 Fitter amp Hillebrand 2009 Burkey 1997 genus Cochran Strafira amp von Ende 1998 genus Scarff amp Bradley 2002 genus Giometto et al 2013 Jiirgens amp Sala 2000 Kneitel amp Perrault 2006 Ostman et al 2006 Livingston et al 2013 Gross 2000 Livingston et al 2013 Gross 2000 Balciunas amp Lawler 1995 Burkey 1997 Holt et al 2004 Naeem amp Li 1998 Warren amp Gaston 1997 Scholes et al 2005 Giometto et al 2013 PNAS McGrady Steed et al 1997 Davies et al 2009 Fox et al 2000 Robinson amp Dickerson 1987 Jin et al 1991 Dickerson amp Robinson 1985 Dickerson amp Robinson 1986 Rboinson amp Edgemon 1988 Fox amp Olson 2000 Fox 2004 Livingston et al 2013 Naeem amp Li 1998 Filip et al 2012 Hiltunen et al 2013 Fox 2008 genus Hulot et al 2001 genus Kurihara 1978 genus Li amp Stevens 2012 genus Jin et al 1991 Fox 2004
231. ortion of the genome in order to disentangle the phylogenetic relationships between taxa Pawlowski et al 2012 The use of DNA barcoding or sequencing enables to estimate nucleotide diversity and fixation indices Fst consequently to access the genetic structure and gene flow within and among populations The genetic variability can also be compared to life history traits or phenotypic plasticity resulting from local adaptation Krenek Petzoldt amp Berendonk 2012 in order to understand the pattern of evolution DNA barcoding has been of great interest in phylogenetics to discover morphospecies or cryptic species and to identify the species composition in a particular environment Barcodes have been used to study the composition and interaction between species coming from the same environment like soil Blaxter 2004 or water column Stern et al 2010 Hajibabaei et al 2011 and identify cryptic or morpho species frequent in protists e g Barth et al 2006 The choice of the gene or barcode of interest should be carefully made depending on the taxonomic level and species one works on Knowing that the mitochondrial genome evolves faster the accumulation of sequence variability between organisms would be higher enabling to discriminate the intraspecific relationships or recent phylogenetic splits Many barcodes have been previously developed Nassonova et al 2010 Pawlowski et al 2012 either on the mitochondrial genome e g Cox 1 Cob
232. osm experiments shows that this system is ideal to achieve such a causal under standing Tools exist to characterize the chemical composition and the whole biological molecular content of medium and individuals e g Section 2 6 with characterized phenotypes and experimental conditions can be set with a high degree of control and repeatability see Sections 3 1 to 3 7 Promising directions can include the exploration of stress molecules implied in the response to environmental perturbations the determination of the biological molecules implied in interindi vidual or interspecies communication or else to the determina tion of the molecular bases of adaptation with the possibility of using functional genetic tools in ciliate model species Turkewitz Orias amp Kapler 2002 We acknowledge that the study of protists in natural systems still remains challenging and work on how to bridge protist microcosm to natural sys tems is a worthy direction of future research see pioneering work by Addicott 1974 Furthermore only few but influen tial studies used protists to study macroecological patterns for example comparing the abundance of cosmopolitan vs local species Fenchel amp Finlay 2004 Still there is much potential for research beyond metacommunities For microcosms to further claim their role as valuable research tools in ecology and evolution see Table 1 Beyers amp Odum 1993 Jessup et al 2004 Srivastava et al 2004 Cado
233. osms Oikos 79 489 495 Fronhofer E A Kropf T amp Altermatt F 2014 Density dependent movement and the consequences of the Allee effect in the model organism Tetrahymena Journal of Animal Ecology doi 10 1111 1365 2656 12315 Fukami T amp Morin P J 2003 Productivity biodiversity relationships depend on the history of community assembly Nature 424 423 426 Fussmann K E Schwarzmueller F Brose U Jousset A amp Rall B C 2014 Ecological stability in response to warming Nature Climate Change 4 206 210 Gause G F 1934 The Struggle for Existence Dover Publications Mineaola NY Gill D E amp Nelson G H 1972 The dynamics of a natural population of Para mecium and the r le of interspecific competition in community structure Jour nal of Animal Ecology 41 137 151 Giometto A Altermatt F Carrara F Maritan A amp Rinaldo A 2013 Scal ing body size fluctuations Proceedings of the National Academy of Sciences USA 110 4646 4650 Giometto A Rinaldo A Carrara F amp Altermatt F 2014 Emerging predict able features of replicated biological invasion fronts Proceedings of the National Academy of Sciences USA 111 297 301 Gotelli N J amp Colwell R K 2001 Quantifying biodiversity procedures and pit falls in the measurement and comparison of species richness Ecology Letters 4 379 391 Gruber D F Tuorto S amp Taghon G L 2009 Growth phase and e
234. ot been possible before This is 2014 The Authors Methods in Ecology and Evolution 2014 British Ecological Society Methods in Ecology and Evolution 6 218 231 228 Altermatt et al Natural ecosystem Fig 3 Protist microcosm experiments are used to address questions in ecology and evo lutionary biology derived from natural sys tems For example in a complex natural Ecological questions ecosystem such a river ecosystem a ques tions of interest are how interactions of species with other species or the environment affect behaviour or ecosystem processes b how spatial connectivity affects diversity c or how to predict the occurrence and sequence of extinctions d The questions are usually not system specific and often based on fundamen Empirical tests with protist microcosms especially true for methods that allow integrating traits behaviour and physiology of single cells individuals into gen eral ecological questions at the population community or eco system level see Sections 2 3 2 5 2 6 and 2 8 Researchers working with microcosms should be aware of these improve ments enabling them to address questions within their field of research at an unprecedented precision and replication We here give the first comprehensive overview of methods used for protist microcosm experiments in the fields of ecology and evolutionary biology We provide a comprehensive list of methods and protocols in
235. ot on bacteria e g Didinium Some species feed on both bacteria and other protists In such cases predation rate as a single parameter can be estimated by fitting a Lotka Volterra model described in the section for competition In such case one species will have a negative value and the other a positive value of the interaction coefficient This approach can be also used when screening for potential predators among species whose diet is not well known On the other hand in predators feeding only on protists and not on bacteria conducting functional response measurements is desirable Direct measurement of a functional response Detailed settings need to be adjusted according to the species used Here we provide two examples of protocols used previously a An example based on Hammill et al 2010 using Paramecium as a prey and a small flatworm Stenostomum as a predator 1 Add a known number of prey individuals from the range of 1 to 60 can be increased further to make sure that the functional response converges to an asymptote to 500 microL of protist medium in a well plate Instead of counting and transferring prey individuals one by one you can prepare a series of cultures diluted to a varying degree and take a drop from the culture count the number of prey individuals and use this drop as a source of prey for the experiment 2 Add one predator individual 105 Supplementary Information Altermatt et al 2015 Methods in
236. ot our goal to cover all of these media types but rather identify the most commonly used Useful websites summarizing a wider range of media recipes include e UTEX culture collection of algae University of Texas Austin http web biosci utexas edu utex media aspx e Tetrahymena stock center University of Cornell Ithaca https tetrahymena vet cornell edu recipes php Culture Collection of Algae and Protozoa CCAP Scottish Marine Institute OBAN Argyll http www ccap ac uk media pdfrecipes htm Generally the water used for the medium is either deionized water in which micro and macronutrients are added to reach a reasonable osmolarity or tap water or commercial well water Deionized water has the advantage that the chemical composition of the final medium is well known and highly reproducible However this approach is generally more laborious and often less defined media made of tap water are used Local tap water should only be used when it is of constant quality and 18 Supplementary Information Altermatt et al 2015 Methods in Ecology and Evolution DOI 10 1111 2041 210X 12312 1 2 Culture medium not chlorinated Before use the tap water can be aged to gas out any chlorine Nutrients and carbon sources are added to the water All media are autoclaved at 121 C prior to the use Autoclaving for 20 minutes is recommended for a volume of 2L larger volumes may take longer Before use the medium must cool
237. pace for storage The analysis of digital images and videos can be a computationally demanding task depending on the resolution and number of images to process and the complexity of the image analysis task Especially the sophisticated tracking algorithms can require considerable time to connect a large number of individuals through lengthy video sequences Therefore powerful computer hardware especially the availability of large amounts of RAM gt 8 GB and fast CPU are a requirement In addition large 65 Supplementary Information Altermatt et al 2015 Methods in Ecology and Evolution DOI 10 1111 2041 210X 12312 2 2 Image and video analysis amounts of disk space are required to store videos which often need to be in an uncompressed format to be processed by image analysis software e g ImageJ and therefore can quickly accumulate to terabytes of storage space for long term storage we recommend to compress files with lossless formats to reduce space requirements but still allow re analysis at the original quality if needed Reagents Usually video analysis does not require any reagents however adding methylcellulose may help to slow down dynamics such they can be capture by video equipment which lacks very high frame rates see also section 3 4 Individual marking of protists is difficult and sophisticated image analysis approaches to distinguish individuals by subtle differences in their appearance fingerprinting
238. pecies to carrying capacity and then make mL aliquots of inocula These can then be frozen in glycerol and be used across experiments for a standardized set up of bacteria populations While different non pathogenic bacteria species have been successfully added and used in protist microcosm experiments the control of the bacterial community is often not very extensive Thus while the experimenter usually incoulates the microcosms with a few known bacteria species there may be other species present in the protist stock cultures or subsequentely invade the experiment A better control of the bacterial communities in protist microcosm experiments would thus be a desired improvement for future work Commonly used freshwater bacteria species include Bacillus subtilis B brevis parabrevis B cereus Enterobacter aerogenes Proteus vulgaris Serratia fonticola or S marcescens Generally two to three species are used in a mixture Please be aware that even the non pathogenic strains of some of these species are only allowed to be used in Biohazard level 2 labs in some countries It is advised to use non pathogenic and Biohazard level 1 strains species only Adding bacteria in standardized aliquots For standardized experiments and to allow a consistency in bacterial resources it is advised to add the same set of bacteria to the experiments cultures over time Thereby bacteria species are initially grown in isolation to high densities the
239. pends on its concentration and the measuring capillary Typical values are 1 mL of sample diluted in 10 mL of CAS Yton with the 150 um and 200 um measuring capillaries Always prepare the sample just before performing the measurement 8 Measurement Place the CASYcup containing the cell suspension on the sample platform Perform a measurement and visualise the body size distribution on screen see Fig 1 If the concentration of the sample is high enough two peaks will appear on the CASY display the leftmost peak is due to debris in the solution and possibly smaller organisms which might be resolved using a smaller measuring capillary while the rightmost peak or peaks if more than one species is present is relative to the study species Although the instrument measures cell volume body size is displayed on screen in terms of the Equivalent Diameter that is the diameter of a cell assuming it is spherical Please note that the Equivalent Diameter is generally smaller than what is commonly reported as a typical linear size such as cell length thus reporting the cell volume instead of the Equivalent Diameter is suggested In the Display Analysis menu cursors can be set to compute cell density mean body size and other information Note however that these calculations do not subtract the background due to the debris 9 Exporting data and analysis The measurement can be exported in TXT format and imported in the desired software for st
240. phic stochasticity 5 Adda known number of predator individuals within the range observed in stock cultures and close the bottle do not close the lid firmly to allow exchange of gases between the bottle and the surrounding air 6 Create several replicates at least four preferably six to eight 7 Note the exact time of the beginning of the experiment and the density of the starting cultures see points 3 and 5 above 8 Keep the mixed culture in a climate chamber with controlled temperature and suitable illumination for at least 10 days 9 Measure population density of both species at regular intervals during the experiment to obtain a two species time series see section 2 11 for details 10 The suitable frequency depends on the generation time of your predator measuring population density every 24 hours would be suitable for Didinium 11 Fit a suitable predator prey model to your time series to estimate the parameters of the functional response As this goes beyond the focus of our work we recommend looking up the details for doing so in the relevant literature Jost amp Arditi 2001 References Carrara F Giometto A Seymour M Rinaldo A amp Altermatt F 2014a Experimental evidence for strong stabilizing forces at high functional diversity in aquatic microbial communities Ecology in press http dx doi org 10 1890 14 1324 1 Carrara F Giometto A Seymour M Rinaldo A amp Altermatt F 2014b I
241. r iments in close analogy to mathematical models e g Altermatt et al 2011a Carrara et al 2012 Giometto et al 2014 Replication ran domization blocking and independence are key as with any good experiment e g Quinn amp Keough 2002 The ease of high replication can result in statistical significances that need to be carefully interpreted with respect to biologically relevant effect sizes That is effect size and not only statistical significance should be studied An important advantage of protist microcosms is that the experi mental units are closed populations communities in which for exam ple the number and identity of species at start are known Thereby estimates of species richness or the potential occurrence of specific species interactions is a priori well known an advantage compared to the often open communities in natural systems Gotelli amp Colwell 2001 3 2 MANIPULATION OF DENSITY Many ecological processes show density dependence Thus manipulat ing density is of interest to study the direct effect of density on processes such as dispersal e g Fellous et al 2012a Pennekamp et al 2014b as well as indirect effects such as the sensitivity of dynamics to small 2014 The Authors Methods in Ecology and Evolution 2014 British Ecological Society Methods in Ecology and Evolution 6 218 231 226 Altermatt et al changes in initial density conditions e g Worsfold Warren amp Petchey 20
242. r experiments are logistically or ethically prohibitive Experimental microcosms reflecting small worlds offer a possibility to test concepts in ecology and evolution see Table 1 Beyers amp Odum 1993 Jessup et al 2004 Srivastava et al 2004 Cadotte Drake amp Fukami 2005 Benton et al 2007 and various groups of organisms including bacteria algae and arthropods have been used as model systems Protist microcosms Fig 2 Lawler 1998 Petchey er al 2002 2014 The Authors Methods in Ecology and Evolution 2014 British Ecological Society Individual characteristics 1 Ecological interactions 447 Population community structure 4 a NN Ecosystem A user s guide for protist microcosms 219 e T Population community dynamics processes Fig 1 Causalities between environmental factors individuals and populations on structure and dynamics across different levels of biological orga nization see also Table 1 Green and yellow arrows illustrate ecological and evolutionary causalities respectively Individual properties i such as traits behaviour and physiology dictate ecological interactions ii such as competition and predation These ecological interactions in turn affect population and community structure iii population and community dynamics iv and ecosystem processes v arrows 1 6 on ecological time scales arrows 1 6 Furthermore the abiotic envi
243. rable Estimating the parameters of a functional response from two species time series Measuring interaction strength this way is more uncertain than measuring the functional response in short term experiments described above However it can be used in predators with very low predation rates As long as one is interested in fitting predator prey models e g Lotka Volterra this method is more precise because it allows fitting the interaction strength Thus the two methods differ in the quantities that they allow to measure 1 Prepare a bottle of suitable medium see section 1 2 for details 2 Setup cultures of the prey species at low density to measure growth curves to estimate growth rate r and carrying capacity K see section 2 2 for details You can skip this step if you already have reliable measurements of these parameters 3 Take a sample of the prey culture at carrying capacity and estimate population density in this particular culture see section 2 2 or 2 3 for details 4 Take 10 ml of culture of the prey species and put it to a suitable bottle volume at least 20 ml Use larger volume if the predator occurs at low density in 106 Supplementary Information Altermatt et al 2015 Methods in Ecology and Evolution DOI 10 1111 2041 210X 12312 2 12 Interaction strengths cultures For example for Didinium Paramecium species combination using 100 ml of medium would be preferable to decrease the effect of demogra
244. rbance and productivity on diversity Ecology Letters 11 348 356 Holyoak M 2000 Effects of nutrient enrichment on predator prey metapopulation dynamics Journal of Animal Ecology 69 985 997 Laakso J Loytynoja K amp Kaitala V 2003 Environmental noise and population dynamics of the ciliated protozoa Tetrahymena thermophila in aquatic microcosms Oikos 102 663 671 Loiterton B Sundbom M amp Vrede T 2004 Separating physical and physiological effects of temperature on zooplankton feeding rate Aquatic Sciences 66 123 129 Luckinbill L S 1973 Coexistence in Laboratory Populations of Paramecium Aurelia and Its Predator Didinium Nasutum Ecology 54 1320 1327 Luckinbill L S 1979 Selection and the r K Continuum in Experimental Populations of Protozoa The American Naturalist 113 427 437 Luckinbill L S amp Fenton M M 1978 Regulation and Environmental Variability in Experimental Populations of Protozoa Ecology 59 1271 1276 Orland M C amp Lawler S P 2004 Resonance inflates carrying capacity in protist populations with periodic resource pulses Ecology 85 150 157 Sleigh M A 1991 Protozoa and Other Protists Cambridge University Press Sonneborn T M 1950 Methods in the general biology and genetics of paramecium aurelia Journal of Experimental Zoology 113 87 147 Veilleux B G 1979 An Analysis of the Predatory Interaction Between Paramecium and Didinium Journal of Animal
245. rds such as cryopreservation cryoconservation cryogenic freezing or liquid nitrogen to gather more specific information It is important to recognize that reviving protists after cryopreservation does not always work and may be less straightforward than with bacteria We thus recommend testing survival rates for each specific protist species strain and cryopreservation method before using it as a routine Extra general information on cryopreservation technique safety and material especially recent advances in cryogenic material can also be obtained from companies selling cryogenic equipment such as Thermo Scientific http www thermoscientific com Thaylor Wharton http www taylorwharton com or Air liquide http www airliquide com The preferred storage for long term cryopreservation is in liquid nitrogen 196 C because viability of frozen cells can tremendously decrease in case temperature increases above 130 C even for a short period of time At 196 C metabolic reactions are slowed down so extensively that living cells can be maintained for very long time potentially indefinitely Handling liquid nitrogen needs careful training of staff and the necessary precautions CAUTION Safety note associated to use and handling of liquid nitrogen LN2 It is important that staff is trained in the use of LN2 and associated equipment Indeed there are several safety risks associated to the use and hand
246. reby the following procedure is advised 1 Using a sterile workbench add each bacteria species received from the stock centre individually to 500 mL sterile culture medium To transfer bacteria sterilize the tube cap and spatula used for the transfer using a Bunsen burner Maintain sterile working conditions throughout all subsequent working steps 2 Grow the bacteria monocultures to carrying capacity about 2 4 days at 20 C 3 Make as many mL aliquots of the bacteria culture as desired for long term comparisons this is ideally hundreds of aliquots Therefore 1 n mL of each bacteria monoculture with n being the total number of bacteria monocultures are added individually to 3 mL micro test tubes e g Eppendorf 4 Mix the bacteria culture with 50 glycerol 50 glycerol 50 bacteria inoculum i e mL glycerol to 1 mL total bacteria inoculum 5 Store at 80 C 6 For use in experiment slowly defrost one mixed bacteria culture and add to 100 mL of sterile culture medium 7 Let the bacteria grow for 24 h 8 Mix this bacteria culture with the respective total amount of culture medium needed for the experiment We recommend adding 5 of this bacteria inoculum to the total medium volume 9 Start experiment immediately Timing 1 2 h for step 1 2 4 days for step 2 culture growing 1 2 h for steps 3 to 5 24 h for step 6 and 7 growing phase Removing bacteria To get axenic cultures the following pro
247. resistance to disturbance but rather reflects different recoveries from disturbances strongly determined by a species growth rate and we discuss the different types in the following Density independent mortality via sonication works through a generator providing high voltage pulses of energy at frequency of about 20 kHz to piezoelectric converter The converter transforms the electrical energy to mechanical vibration through the specific characteristics of internal piezoelectric crystals The vibration is subsequently amplified and then transmitted to the horn probe The horn s tip is subsequently expanding and contracting longitudinally The amplitude is 111 Supplementary Information Altermatt et al 2015 Methods in Ecology and Evolution DOI 10 1111 2041 210X 12312 3 3 Disturbance and perturbation manipulations defined by the distance the tip expands and contracts and can be set by the user The energetic waves created by the vibration have disrupting effects on biological membranes and other biological structures e g cell walls proteins such that they physically disintegrate Materials Equipment Replacing medium Pipettes or measuring beakers Heat disturbance Pipettes or measuring beakers Microwave Cooler or box with ice to cool medium after treatment Heat protecting gloves to hold vessels after microwaving Sonication disturbance Pipettes or measuring beakers Sonicator system composed o
248. rifugation tube 2 Centrifuge the tubes for 2 minutes at appropriate rpm g 3 Quickly remove the supernatant 4 Re suspend protist cells in the remainder of medium or some replacement liquid depending on the goal 5 Quickly proceed with the processing of the cultures given that a small medium volume with high individual numbers will quickly deplete the remaining oxygen Reverse Filtration 1 Place medium with the protists into an appropriate tube e g 50 mL of protist culture 2 Start removing medium by putting the tip of the filter into the medium and creating a vacuum pressure either with vacuum pump or with the disposable syringe such that medium is sucked through the filter out of the protist culture 3 Importantly the process of filtration needs to be done carefully and slowly generally gt 30 s for removing 50 of the medium in a 50 mL culture such that protists do not get stuck on the filter but remain in the supernatant 4 Dispose the filtrate and keep the supernatant with the protists at a concentrated density 5 The total volume of medium of initial culture divided by volume of the supernatant gives the level of concentration e g 50 mL of initial culture 12 5 mL of supernatant and 37 5 mL of discarded filtrate give a 4 fold concentration of the culture 109 Supplementary Information Altermatt et al 2015 Methods in Ecology and Evolution DOI 10 1111 2041 210X 12312 3 2 Density manipulation
249. rom samples In experiments aiming at determining the adaptive responses to stressful conditions the DNA methylation profiles of individuals showing phenotypic adaptations can be compared with profiles of controlled individuals Major steps are Choose the appropriate method or the combination of methods to use Isolate DNA from target samples Reveal methylated sites with for example immunoprecipitation or bisulfite sequencing Determine the methylation profiles of selected phenotypes There exist both publications on detailed protocols e g Karrer amp VanNuland 2002 Bracht Perlman amp Landweber 2012 as well as review articles e g Suzuki amp Bird 2008 Nowacki amp Landweber 2009 Croken Nardelli amp Kim 2012 Gomez Diaz et al 2012 Flores Wolschin amp Amdam 2013 References Armengaud J Trapp J Pible O Geffard O Chaumot A amp Hartmann E M 2014 Non model organisms a species endangered by proteogenomics J Proteomics 105 5 18 93 Supplementary Information Altermatt et al 2015 Methods in Ecology and Evolution DOI 10 1111 2041 210X 12312 2 8 Genomics proteomics and epigenomics Beck M Claassen M amp Aebersold R 2011 Comprehensive proteomics Curr Opin Biotechnol 22 3 8 Blainey P C amp Quake S R 2014 Dissecting genomic diversity one cell at a time Nat Methods 11 19 21 Bracht J R Perlman D H amp Landweber L F 2012 Cytosine methylation and
250. rongly recommend to use develop a system specifically designed for it combining the use of barcodes for individual error proof cryotube labelling and a database system allowing both to record all important information associated to cryosamples date content exact position in the cryoconservator etc and to ensure the integrity of the inventory Commercial systems exist to implement such a referencing solution from one hand to another from barcoded tubes to specialized laboratory software for inventory database e g Labcollector www labcollector com However it is also possible to create a customized and cheaper solution based on a general database management e g Microsoft Access or FileMaker Pro or spreadsheet software connected to a printer to create custom wrap around LN2 resistant labels e g Brady 800537 and a barcode scanner Prefer 2D barcodes e g matrix over 1D barcodes as they are smaller and fitted with error correction preventing reading errors A key point for data integrity whatever the system is to develop a carefully thought set of practices and rules to limit human errors as much as possible by having the system enforcing preventing specific actions For example letting the database system automatically allocate an empty space vs user chosen for each new cryotube and print it on a label to be affixed on the tube allows for easier and less error prone placement of the cryotube and recording of its
251. ronment plays a major role in shaping the causalities From an ecological point of view green part of arrow 7 the environment influences the properties of individuals 1 through for example environmental filtering and plastic responses Environ mental effects also have the potential to change population and community structure through stochastic events that may cause for example abun dance decline or extinctions 8 Environmental effects can induce evolutionary change yellow part of 7 in traits due to selection Such trait changes will change the ecological interactions which in turn can induce further evolutionary change 9 which ultimately affects structure iii dynamics iv and ecosystem processes v Finally ecosystem processes may feedback on to the environment 10 Holyoak amp Lawler 2005 have long been used to study eco logical processes based on pioneering work of Dallinger 1887 Gause 1934 Vandermeer 1969 Gill amp Nelson 1972 Luckinbill 1973 and many others for a more exten sive literature overview see Section 1 1 of Appendix SI in the Supporting Information Gause s study is exemplary of how protist microcosms can bridge empirical case studies and the oretical work Indeed Gause experimentally linked theoreti cal concepts of predator prey dynamics Lotka 1910 Volterra 1926 and fluctuations observed in natural popula tions developing and using a protist microcosm system con taining the ciliate P
252. ruggle for Existence Dover Publications Mineaola N Y Giometto A Rinaldo A Carrara F amp Altermatt F 2014 Emerging predictable features of replicated biological invasion fronts Proceedings of the National Academy of Sciences 111 297 301 Hanski I 1999 Metapopulation ecology Oxford University Press Oxford Hanski I amp Gaggiotti O E 2004 Ecology genetics and evolution of metapopulations pp 696 Elsevier Academic Press Amsterdam Holyoak M amp Lawler S P 1996 The role of dispersal in predator prey metapopulation dynamics Journal of Animal Ecology 65 640 652 Holyoak M amp Lawler S P 2005 The contribution of laboratory experiments on protists to understanding population and metapopulation dynamics Advances in ecological research 37 245 271 Leibold M A Holyoak M Mouquet N Amarasekare P Chase J M Hoopes M F Holt R D Shurin J B Law R Tilman D Loreau M amp Gonzalez A 2004 The metacommunity concept a framework for multi scale community ecology Ecology Letters 7 601 613 Levins R 1970 Extinction Some Mathematical Problems in Biology ed Gerstenhaber pp 77 107 American Mathematical Society Providence Loreau M Mouquet N amp Holt R D 2003 Meta ecosystems a theoretical framework for a spatial ecosystem ecology Ecology Letters 6 673 679 Pennekamp F Mitchell K A Chaine A amp Schtickzelle N 2014 Dispersal propensity in
253. s 3 198 206 Fox J W amp Morin P J 2001 Effects of intra and interspecific interactions on species responses to environmental change Journal of Animal Ecology 70 80 90 Fox J W amp Smith D C 1997 Variable outcomes of protist rotifer competition in laboratory microcosms Oikos 79 489 495 Friman V P amp Laakso J 2011 Pulsed Resource Dynamics Constrain the Evolution of Predator Prey Interactions The American Naturalist 177 334 345 Friman V P Hiltunen T Laakso J amp Kaitala V 2008 Availability of prey resources drives evolution of predator prey interaction PROCEEDINGS OF THE ROYAL SOCIETY B BIOLOGICAL SCIENCES 275 1625 1633 Fronhofer E A Kropf T amp Altermatt F 2014 Density dependent movement and the consequences of the Allee effect in the model organism Tetrahymena Journal of Animal Ecology in press Fukami T 2001 Sequence effects of disturbance on community structure Oikos 92 215 224 Fukami T amp Morin P J 2003 Productivity biodiversity relationships depend on the history of community assembly Nature 424 423 426 Gause G F 1934a Experimental analysis of Vito Volterra s mathematical theory of the struggle for existence Science 79 16 17 Gause G F 1934b The Struggle for Existence Dover Publications Mineaola N Y Gill D E 1972a Density dependence and population regulation in laboratory cultures of Paramecium Ecology 53 701 708 Gill
254. s RMS is a non invasive and label free method for biochemical cell analysis RMS combines Raman spectroscopy RS with optical microscopy Puppels et al 1990 Wagner 2009 and Huang et al 2010 provide an excellent and detailed description of RMS and its extensions and its use in microbiology RMS can be combined with other methods such as stable isotope probing SIP and fluorescence in situ hybridiza tion FISH to reveal feeding relations and functional characters of cells e g Huang et al 2007 Li et al 2013 RMS is a rather novel method in general and especially to ecological research So far it has not been broadly used in microcosm experiments although its poten tial is immense enabling to measure the chemical composition on a single cell basis RMS could be used to precisely quantify trophic interactions or to measure the impacts of abiotic and biotic influences on ecological dynamics e g food shortage competition predation pressure 2 7 DNA SEQUENCING BARCODING While ecologist have been focusing on the phenotype of organisms for a long time it is nowadays possible to work at the genotype level and by that to study ecological and evolutionary dynamics or set the research in a phylogenetic context e g Violle et al 2011 Many DNA sequencing methods are available to analyse protist community com position Hajibabaei et al 2011 Zufall Dimon amp Doerder 2013 to characterize genetic diversity of species complexe
255. s e g Catania et al 2009 or to understand the evolution of genes and genomes e g Brunk et al 2003 Moradian et al 2007 DNA barcoding is a special case of sequencing which focuses on the study of a short and conserved por tion of the genome owing the property to disentangle the phylogenetic relationships between taxa Pawlowski et al 2012 Depending on the protist taxa barcodes have been developed either on the mitochondrial genome or in the nuclear genome and the best choice of genes depends on the specific protist taxa Pawlowski et al 2012 In some protists ribosomal genes have been duplicated from the mitochondrial genome to the nuclear genome potentially creating some noise in the data It may thus be necessary to separate the nuclear from the mitochondrial materials for example by migration on agarose gel In ciliates the two nuclei macronucleus and micronucleus can be isolated by gradient separations like Percoll gradients 2 8 GENOMICS PROTEOMICS AND EPIGENOMICS All omics methods aim at characterizing and quantifying the whole biological molecule content in a sample DNA RNA proteins and also allow addressing the subindividual level similar to RMS Section 2 4 Due to their small size living conditions and underestimated diversity protists are ideal study organisms for metagenomics and metaproteo mics project While not specifically developed for microcosm experi ments most omics methods can
256. s such as 50 mL conical tubes A vacuum pump to aspirate the supernatant after centrifugation A water bath to heat up medium and cryosamples for fast thawing A set of tweezers to safely manipulate cryotubes when they float in LN2 44 Supplementary Information Altermatt et al 2015 Methods in Ecology and Evolution DOI 10 1111 2041 210X 12312 1 7 Long term preservation A system allowing a controlled 1 C min cooling rate The best is a cooling unit that can be programmed for such a precise cooling rate If such a device is not available a semi controlled alternative system that proved very efficient combines a 80 C freezer with special cryoboxes for cooling down the samples e g isopropyl alcohol filled Thermo Scientific Nalgene Cryo 1 C Mr Frosty or alcohol free Biocision Coolcell ALN2 cryoconservator which is essentially a deeply insulated jar where LN2 is stored creating a liquid phase down and a vapour phase up often the limit between the two phases can be adjusted by the user to favour one or the other phase An extensive range of sls in available with smaller ones having capacities of 80 to 90 cryotubes placed on aluminium canes to huge vessels with a capacity gt 20 000 cryotubes placed in cryoboxes Cryotubes can be either stored in the vapour or the liquid phase of LN2 each with advantages and disadvantages This choice has important consequences for the selection of an appropriate cryo
257. s approximately 20 s The change of measuring capillary takes approximately 1 min The weekly cleaning takes at least 4 h Troubleshooting Tips and Tricks Step Problem Possible reason Solution Background Error message Impurities in the Place a CASYcup measurement Concentration too high system with clean CAS Yton on the sample platform and perform cleaning cycles until the counts are 7 Supplementary Information Altermatt et al 2015 Methods in Ecology and Evolution DOI 10 1111 2041 210X 12312 2 4 Particle counter low Measurement Error message Concentration too high The concentration of the sample is too high Further dilute the sample or choose a larger capillary Background Error message The wrong Choose the correct measurement The measurement time is capillary is selected measuring capillary or too short in the setup in the setup Measurement Background Error message Air bubble in the Remove the measurement Large air bubble detected calibrated vertical sample place a or tube CASYcup filled Measurement with clean CASYton and perform a cleaning cycle If the error persists perform a weekly cleaning cycle Avoid the formation of bubbles or foam while mixing the CASYcup containing the cell suspension Important Do not place the CASY in the proximity of strong electromagnetic or electrostatic fields as this can strongly
258. s from different experiments can be easily compared as long as the experimental settings remained fixed However these advantages come at the cost of setting up and fine tuning such an automated system which requires some financial investment in the appropriate hardware and time of a skilled technician or lab member to mould hardware and 61 Supplementary Information Altermatt et al 2015 Methods in Ecology and Evolution DOI 10 1111 2041 210X 12312 2 2 Image and video analysis software into a validated workflow Accordingly one shot experiments to answer a specific question may be still be solved faster by manual observations and measurements In addition the resolution of cameras collecting abundance and morphological behavioural data simultaneously is generally too low for measurements at the sub individual level such as specific organelles or features such as the buccal cavity of certain protist species However taking images videos at different magnifications would circumvent this problem without major modifications 1 Sampling video acquisition and image video processing 2 Data analysis and interpretation Abundance Colpium Paramecium Tetrahymena 10 0 E A o 1 E 75 M d oft tnt S f LI gt 3 f a NS gt 50 li N E x lc 9 25 li 991 Lt 0 10 20 30 0 10 20 300 10 20 30 Days since start 0 2 4 6 16 20 23 2 F F P r r Wi Coipidium J Paramecium E Tetrah
259. s should be subcultured every 2 weeks to 2 months especially predatory species e g Didinium need more frequent daily or weekly subculturing Stock cultures of 100 mL medium in glass jars of approximately 250 mL volume are ideal for long term maintenance e g glass Erlenmeyer jars covered with a loose fitting lid To protect against accidental loss of species 4 8 replicate cultures of each species should be kept in two separate incubators Stock cultures should be maintained at large population sizes including the transfer of cultures during the regular maintenance procedures to avoid loss of genetic diversity accumulation of mutations due to bottlenecks or increased drift processes in general Environmental conditions should be controlled Population density should be recorded at each subcul ture to provide a long term record of changes such as impending extinction Experimenters should document the origin and collection date of the study species and use a common nomenclature across stud ies Cryopreservation as another long term storage is described in Sec tion 1 7 Long term stock cultures should not be used directly to start experi ments for several reasons i stock cultures often contain organisms other than those desired in experiments for example stock cultures of predators are often kept with multiple prey species as this can increase the persistence of the predator Petchey 2000 Stocks must therefore be cleaned i e
260. s the speed of protists which can be advantageous for direct microscopy see Sec tion 2 1 but also to manipulate community dynamics for example by influencing the movement behaviour of predators and prey This can for example stabilize ecological dynamics via its influence on the func tional response e g Luckinbill 1973 3 5 MANIPULATION OF SPATIAL STRUCTURE OF THE LANDSCAPE The importance of spatial structure for population dynamics has been appreciated since the very beginnings of ecological research and became an independent area of study with the birth of biogeography Subsequently space has been added to community ecology meta community ecology reviewed by Leibold et al 2004 and more recently to ecosystem ecology meta ecosystem ecology Loreau Mouquet amp Holt 2003 Protist microcosms are particularly well suited to test concepts in spatial ecology as they allow the building of complex landscapes and the manipulation of relevant parameters e g patch sizes connectivity spatio temporal dynamics or correlations of patch characteristics for an overview of examples see figures in Appendix S1 Section 3 5 with a very high degree of replication compared to semi natural or natural systems e g Legrand et al 2012 Particularly the entire dispersal process emigration transition immigration can be manipulated independently There are two basic types of dispersal used namely passive dis persal patch
261. s to answer questions related to population dynamics Gause 1934b Gause 1934a and density regulation Luckinbill amp Fenton 1978 but also dispersal Hauzy et al 2007 Fellous et al 2012 Fronhofer amp Altermatt 2014 Fronhofer Kropf amp Altermatt 2014 Pennekamp et al 2014 life history evolution Luckinbill 1979 and cooperative behaviours and sociality in microbes Chaine et al 2010 As long as densities are manipulated within the range zero to carrying capacity K it is sufficient to grow cultures to K and subsequently dilute them In case of density manipulations beyond K or if reaching K takes a long time for slowly growing species there are two methods to concentrate cells namely centrifugation and reverse filtration Centrifugation of cultures is the standard procedure to concentrate cells if necessary to levels far beyond carrying capacity orders of magnitude Luckinbill amp Fenton 1978 used hand centrifugation for their tests of population regulation whereas Warren amp Spencer 1996 concentrated cultures of various bacterivorous protists using centrifugation at 1000 rpm for 5 min Fjerdingstad et al 2007 used centrifugation to concentrate cultures and remove nutrients from the culture for a starvation experiment They centrifuged cultures of T thermophila at 2000 rpm for three minutes and repeated this procedure four times Unfortunately most studies so far state rotations per minute which translate however in
262. sactions of the Royal Society B Biological Sciences 365 2081 2091 Petchey O L McPhearson P T Casey T M amp Morin P J 1999 Environmental warming alters food web structure and ecosystem function Nature 402 69 72 16 Supplementary Information Altermatt et al 2015 Methods in Ecology and Evolution DOI 10 1111 2041 210X 12312 1 1 Species used Salt G W 1967 Predation in an Experimental Protozoan Population Woodruffia Paramecium Ecological Monographs 37 113 144 Schtickzelle N Fjerdingstad E Chaine A amp Clobert J 2009 Cooperative social clusters are not destroyed by dispersal in a ciliate BMC Evolutionary Biology 9 Seymour M amp Altermatt F 2014 Active colonization dynamics and diversity patterns are influenced by dendritic network connectivity and species interactions Ecology and Evolution 4 1243 1254 Sonneborn T M 1950 Methods in the general biology and genetics of Paramecium aurelia Journal of Experimental Zoology 113 87 147 Steiner C F Long Z T Krumins J A amp Morin P J 2006 Population and community resilience in multitrophic communities Ecology 87 996 1007 TerHorst C P 2010 Experimental evolution of protozoan traits in response to interspecific competition Journal of Evolutionary Biology no no Vandermeer J Addicott J Andersen A Kitasko J Pearson D Schnell C amp Wilbur H 1972 Observations of Paramecium Occupying Arbore
263. se experimenters can directly analyse genome genome associations of host parasites or prey predators interactions Major steps are 91 Supplementary Information Altermatt et al 2015 Methods in Ecology and Evolution DOI 10 1111 2041 210X 12312 2 8 Genomics proteomics and epigenomics Isolate the target cell to analyse Perform total DNA extraction Construct whole genome DNA libraries adapted to the chosen NGS sequencer Sequence libraries Assemble whole genomes of the isolated cells and the ones of its preys and or parasites There exist detailed published protocols for single cell genomics e g Raghunathan et al 2005 Hongoh et al 2008 Swan et al 2011 Yoon et al 2011 Mason et al 2012 as well as review papers e g Kalisky Blainey amp Quake 2011 Kalisky amp Quake 2011 Lasken 2012 Stepanauskas 2012 Blainey amp Quake 2014 Transcriptomics The aim of transcription profiling is to develop a complete overview of all the genes in a genome that are up regulated or down regulated in response to some factor of interest in comparison with a designated reference expression van Straalen amp Roelofs 2011 Transcriptomic studies have rapidly spread in ecology and evolution because they allow tackling the first level of the functional response of organisms to environmental changes The most frequent application including under the fully controlled conditions imposed within microcosms is to search for
264. stom built which allows researchers a virtually unlimited flexibility in their experimental design The spatial structure can refer both to spatial structure within a patch versus spatial structure between patches Spatial structure within a patch is often referred to as habitat heterogeneity and can for example be achieved by adding tiles or glass pearls to microcosms such that protists can escape hide from predators Spatial structure between patches is covered by the metapopulation concept Levins 1970 which explicitly considers the effects of linking local populations through rare dispersal events Hanski amp Gaggiotti 2004 Using Didinium nasutum and Paramecium caudatum as a predator prey system already Gause 1934 could demonstrate the importance of space for stabilizing predator prey dynamics For further examples including the study of source sink systems for instance see the review by Holyoak amp Lawler 2005 More recently diversity patterns in dendritic networks Carrara et al 2012 Seymour amp Altermatt 2014 as well as the predictability of invasion dynamics Giometto et al 2014 or evolutionary processes Fronhofer amp Altermatt 2014 during invasions have been studied in protist microcosm landscapes Two basic setups exist one with passive dispersal dispersal achieved by pipetting small amount of media and one with active dispersal patches connected by tubes While in a passive dispersal setup connectivity is
265. t This is also an alternative to maintaining liquid cultures using serial transfer see Section 1 6 Cryopreservation allows the recreation of strains in case of loss in liquid cultures preserves geno types from evolutionary changes and allows the sampling of cultures at specific time points for later reference e g for studies on experimental evolution see Section 3 8 and Kawecki et al 2012 The preferred stor age for long term cryopreservation is in liquid nitrogen 196 C Standard protocols for the cryopreservation of protists have been developed especially for Tetrahymena Cassidy Hanley 2012 but also many other protist species Lee amp Soldo 1992 and detailed protocols are given in Appendix SI Section 1 7 This involves a phase of cultur ing cells under specific conditions before freezing to ensure a high recovery rate after thawing the use of specific cryoprotectants and a progressive and controlled cooling down before long term storage in liquid nitrogen Thawing requires specific precautions to limit the 2014 The Authors Methods in Ecology and Evolution O 2014 British Ecological Society Methods in Ecology and Evolution 6 218 231 thermic shock and allowing cells going back to normal reproduction The basic principle of cryopreservation is slow freeze and quick thaw 2 Measurement methods Many measurements of ecologically and evolutionarily relevant vari ables are possible at all levels of organization
266. t 72 C 4 Final extension step at 72 C for 10 min Classical procedure for the PCR Chen Zhong amp Monteiro 2006 5 Initial denaturation step of 94 C for 10 min 6 Followed by 30 cycles consisting of each cycle 1 min at 94 C 1 min at Tm 1 min at 72 C 7 Final extension step at 72 C for 10 min References Allen S L 1999 Chapter 8 Isolation of Micronuclear and Macronuclear DNA Methods in Cell Biology eds J A David amp D F James pp 241 252 Academic Press Asai D L amp Forney J D 2000 Tetrahymena termophila Academic Press San Diego Barth D Krenek S Fokin S I amp Berendonk T U 2006 Intraspecific genetic variation in Paramecium revealed by mitochondrial cytochrome C oxidase I sequences J Eukaryot Microbiol 53 20 25 Blaxter M L 2004 The promise of a DNA taxonomy Philos Trans R Soc Lond B Biol Sci 359 669 679 Brunk C F Lee L C Tran A B amp Li J 2003 omplete sequence of the mitochondrial genome of Tetrahymena thermophila and comparative methods for identifying highly divergent genes Nucleic Acids Research 31 1673 1682 Catania F Wurmser F Potekhin A A Przybos E amp Lynch M 2009 Genetic Diversity in the Paramecium aurelia Species Complex Molecular Biology and Evolution 26 421 431 Chantangsi C Lynn D H Brandl M T Cole J C Hetrick N amp Ikonomi P 2007 Barcoding ciliates a comprehensive study of 75 isolates of the genus
267. t boil This kills all protists but minimize evaporation cover lids but do not use aluminium foil but glass cover lids and chemical reactions in the medium due to heat Let the disturbed i e heated medium cool down as quickly as possible using an ice bath to the exact same temperature as the remaining i e undisturbed part and put it back The heating and cooling should be done as quickly as possible ideally in less than 1 h to avoid time lag effects For the control treatments also remove the same part of the medium as being disturbed store it temporarily at room temperature conditions the replicates are handled and only put it back to the replicate after the same time as the disturbed ones are put back Sonication disturbance I 2s 3 Take the vessel with the protist community to be disturbed Thoroughly mix it shaking or with pipette The intensity of disturbance can be set in two ways A a proportion of the medium is sonicated such that all protists die B the duration of the sonication process can be varied such that part of the protists can survive when sonicated for only short periods or at low intensities usually a few seconds Remove the content that should be disturbed We recommend sonicating at maximum amplitude over a short time span e g 30 to 60 s for a sonicator with 700 W and 20 KHz maximum working power 113 Supplementary Information Altermatt et al 2015 Methods in Ecology and Evoluti
268. t et al 2015 Methods in Ecology and Evolution DOI 10 1111 2041 210X 12312 3 4 Nutrient concentration and viscosity of the medium e g Haddad et al 2008 Altermatt Schreiber amp Holyoak 2011 but also to manipulate nutrient concentration e g Fox 2007 Manipulating viscosity of the medium Methyl cellulose is well known for increasing the viscosity of liquid media Sonneborn 1950 A higher viscosity slows down the movement speed ability of protists and this is often used to slow down protists for microscopy purposes Sleigh 1991 However it can also be used to manipulate the movement behaviour in the context of behavioural experiments e g to affect the outcome of predator prey dynamics or the costs of movement dispersal due to increased drag in liquid medium According to Beveridge et al 2010a 2010b and references therein the most suitable compound for adjusting the viscosity of microcosm media is Ficoll GE Healthcare companies Winet 1976 Bolton amp Havenhand 1998 Abrus n 2004 Loiterton Sundbom amp Vrede 2004 Ficoll has broadly the same effect as methyl cellulose however the handling of the substance is easier than that of methyl cellulose Ficoll dissolves in water regardless of the temperature methyl cellulose dissolves better at low temperatures shows Newtonian fluid properties in solution and only requires small quantities to change the viscosity without being toxic Materials Equipment Manipulating
269. t should be discarded when contaminations with bacteria are observed i e when medium gets cloudy W Timing Preparation of medium 1 2 h autoclaving 0 5 h cooling down 12 h Table S3 Physio chemical description of Protozoan Pellet medium made with local nutrient poor well water Mean and standard deviation sd values of 4 replicates are given Component Value meanzsd DOC mg C L 259 6x7 4 TOC mg C L 407 6 DN mg N L 24 9 0 2 TN mg N L 33 7 0 4 Chloride mg L 72 4 0 4 Nitrate mg N L 10 8 0 1 Sulfate mg L 101 2 0 1 Conductivity uS cm 20 C 1424 3 5 pH 34 4 0 1 Alcalinity mmol L 10 840 23 c Supplementary Information Altermatt et al 2015 Methods in Ecology and Evolution DOI 10 1111 2041 210X 12312 1 2 Culture medium Total hardnes mmol L 6 9 0 Silicic Acid mg L 137 4 1 6 o P ug P L 225 19 8 DP ug P L 1216 48 1 TP ug P L 2660458 2 Na mg L 42 4 0 3 K mg L 54 0 1 Ca mg L 189 0 6 Mg mg L 45 8 0 2 Ammonium ug L 150129 1 Nitrite ug N L 7 8 0 1 Mn ug L 8 740 4 Wheat hay wheat lettuce Cerophyll medium This is the least standardized type of medium consisting of an organic nutrient source dried plant material suspended in water The amount type and origin of the plant material may vary and includes wheat seeds e g Haddad et al 2008 Altermatt Schreiber amp Holyoak 2011 straw hay dried baked lettuce e g Sonneborn 1950 Fellous et al 2012a Fel
270. teins epigenetic factors A sample may refer to a part of an individual organ tissue organelle etc an entire individual a population a community or an environmental sample Omics approaches are largely used by ecologists and evolutionary biologists because they may inform on the diversity of environmental samples on the molecular bases of organism adaptations on the modality of genome evolution on organism environment interactions and on the processes of ecosystem functioning Vandenkoomhuyse et al 2010 Gilbert amp Dupont 2011 Although the general framework is the same for all taxa and all omics see below the variety of molecules and applications of these approaches implies that it exists a huge number of available methods and protocols even in the restricted protist group Thus it is an important decision to choose the most appropriate methods from all available ones in order to answer the question of interest Rather than providing an exhaustive and surely incomplete list of detailed protocols in this supplement we have chosen first to briefly present the general framework of omics methods Then we present relevant examples of specific methodologies within each omics that we think of particular interest to study protist microcosms For these selected examples we detail the main steps required to obtain the data and refer to published manuscripts in which readers will be able to find the detailed protoc
271. tetraurelia J Proteomics 78 113 122 Yates J R 3rd Gilchrist A Howell K E amp Bergeron J J 2005 Proteomics of organelles and large cellular structures Nat Rev Mol Cell Biol 6 702 714 Yoon H S Price D C Stepanauskas R Rajah V D Sieracki M E Wilson W H Yang E C Duffy S amp Bhattacharya D 2011 Single cell genomics reveals organismal interactions in uncultivated marine protists Science 332 714 717 96 Supplementary Information Altermatt et al 2015 Methods in Ecology and Evolution DOI 10 1111 2041 210X 12312 2 9 Respirometry Supplementary information for Altermatt et al Methods in Ecology and Evolution DOT 10 1111 2041 210X 12312 Big answers from small worlds a user s guide for protist microcosms as a model system in ecology and evolution Altermatt F Fronhofer EA Garnier A Giometto A Hammes F Klecka J Legrand D Machler E Massie TM Pennekamp F Plebani M Pontarp M Schtickzelle N Thuillier V amp Petchey OL 2 9 Respirometry Introduction Respirometers are devices that measure respiration rates of individual organisms or collections of organisms e g community respiration They can also be used to measure gross photosynthetic rates when used in conjunction with light bottle dark bottle experiments e g Petchey et al 1999 Respirometers are regularly used for microbial respiration often of environmental soil and water research food science and preser
272. th so called occlusions the overlapping of two cells without loosing track of the individual identities morphological properties and species identity Dell et al 2014 Such tracking algorithms become increasingly available e g Ctrax Branson et al 2009 or idTracker P rez Escudero et al 2014 but no demonstrations are so far available for protists Another issue with video tracking is that except for some sophisticated 3D systems most tracking is still performed in two dimensions This is a simplification which is likely to disappear in the coming years as both hardware and software are becoming available to do such tasks efficiently Dell et al 2014 For an optimal use the illumination during image video acquisition should be fixed and optimized to yield the best contrast between the protists and the experimental arena Measurements are taken in counting chambers or directly in situ in culture vessels The resulting images videos are then processed to separate protists foreground from the experimental arena background in a step called segmentation Different algorithms are available whose performance depends on the properties of the protists e g movement and the nature of the surrounding medium e g debris particles in the medium After segmentation the number and morphological properties and spatial position of all identified individuals are extracted from each image For videos this information is available for each frame a
273. that some of the experiments can also include rotifers and tem in ecology and evolution The scope of the methods cov algae We focus on semi continuous batch cultures which can ered includes experimentation with unicellular freshwater be highly replicated hundreds of replicates We highlight that eukaryotes that are at least partly heterotrophic and often experiments with protists can also be conducted under 2014 The Authors Methods in Ecology and Evolution 2014 British Ecological Society Methods in Ecology and Evolution 6 218 231 semi natural conditions in pitcher plant communities or in other phytotelmata and there is an extensive literature on experiments therewith e g Addicott 1974 Kneitel amp Miller 2003 Experimental systems including other micro organisms such as batch cultures of bacteria and phages e g Buckling et al 2000 Bell amp Gonzalez 2011 or chemostats containing autotrophs are only excluded here for reasons of space and cer tainly not because we believe them to be in any way less valuable experimental systems Many of them share similarities with protist microcosms with respect to scientific questions addressed Methods overview in an eco evolutionary framework In the following we use an eco evolutionary framework of causalities between individual properties environmental factors eco evolutionary processes dynamics structure and ecosystem processes Fig 1 to describe methods commonly used
274. the necessary time to carefully select the appropriate cryotube for placement in the cryobox No hurry means no mistake Put each cryotube in the cryobox at the exact position indicated in the label When all tubes are placed into the cryobox put the cryobox back into the cryoconservator and proceed by loading remaining cryotubes into the next cryobox until all are placed 13th day Monday 0 5 h Viability check 17 Take out one tube per series and thaw it see procedure below to check the success of the freezing procedure i e a viable culture is obtained Thawing 0 5 h l Use the inventory system to locate tubes to be thawed and plan in which order they will be removed from the cryoconservator so as to minimize the time frozen cryosamples are out of the LN2 If cryotubes are conserved in the liquid phase move them into the vapour phase during 24 h to minimize risks of explosion see safety note above Use procedure with two expanded polystyrene boxes described at step 15 of freezing protocol if cryotubes from several cryoboxes need to be gathered and placed into a single cryobox to be stored in vapour phase ensuring no cryotube cryobox is left out of LN2 for more than 30 seconds Prepare all the material pipettes tweezers to ensure no delay will subsequently happen during the thawing procedure 49 Supplementary Information Altermatt et al 2015 Methods in Ecology and Evolution DOI 10 1111 204
275. tion 2 10 time series Nevertheless all experiments performed subsequently should include an appropriate number of controls which reflect the relative amount and spatial arrangement of all materials used in the experimental treatments Previous testing of materials seems especially important if novel techniques such as 3D printing which imply novel materials are used to build landscapes 120 Supplementary Information Altermatt et al 2015 Methods in Ecology and Evolution DOI 10 1111 2041 210X 12312 3 5 Spatial structure Equipment for passive dispersal Vials to make the patches Commonly used vials are polypropylene centrifugation tubes e g 20 or 50 mL size 125 ml Nalgene square Polycarbonate wide mouth bottle or multiwall plates e g 10 mL wells Pipettes of varying sizes 10 100 1 100 1000 x1 1 5 mL to sample as well as to do the dispersal treatment Equipment for active dispersal discrete landscapes Vials to make the patches Commonly used vials are polypropylene centrifugation tubes e g 20 or 50 mL size or 125 ml Nalgene square Polycarbonate wide mouth bottle Drill to make holes in the vials holes need to be a bit smaller than outer diameter of silicon tubing such that it tightly fits without leaking Connectors to connect the silicon tubing to the vials not needed when silicon tubing is directly inserted into the hole Silicon tubing recommended inner diameter is between 2 to 5 mm
276. tly for c 30 s Take the cryotube out of the water bath and wipe it with an alcohol soaked tissue prior to opening under the hood to minimize the risk of contamination Add 1 5 mL of culture medium from the 42 C prewarmed tube and shake gently to ensure the pellet is fully dissolved Transfer the content of the tube into the appropriate labelled 50 mL tube containing 5 mL of culture medium and culture at 30 C Repeat steps 6 to 10 for each cryotube to be thawed 13 14 After 24 to 48h check the presence of live cells Update the inventory system indicating the tube s that were thawed and whether thawing was successful or not References Cassidy Hanley D M 2012 Tetrahymena in the Laboratory Strain Resources Methods for Culture Maintenance and Storage Methods in Cell Biology Tetrahymena thermophila ed K Collins pp 239 276 Academic Press Amsterdam Day J G amp Stacey G N 2007 Cryopreservation and freeze dyring protocols Sprinegr Berlin Kawecki T J Lenski R E Ebert D Hollis B Olivieri I amp Whitlock M C 2012 Experimental evolution Trends in Ecology amp Evolution 27 547 560 McAterr J A amp Davis J M 2002 Basic cell culture and the maintenance of cell lines Basic cell culture a practical approach ed J M Davis pp 135 189 Oxford University Press Oxford 50 Supplementary Information Altermatt et al 2015 Methods in Ecology and Evolution D
277. to different g forces according to the diameter of the rotating axis and the different types of centrifuges swing head versus fixed Reporting g forces is therefore recommended to guarantee comparisons among studies Centrifugation exposes cells to considerable physical stress Thus care has to be taken that the manipulation does not introduce artefacts into the experimental design or has other unwanted side effects that may be confounded with the effect of the density manipulation An alternative for concentration is reverse filtration whereby the medium is filtered out and where the supernatant containing the cells is retained This method has the advantage that it is less stressful to the cells but only about 2 to 4 fold concentrations are possible 108 Supplementary Information Altermatt et al 2015 Methods in Ecology and Evolution DOI 10 1111 2041 210X 12312 3 2 Density manipulation Material Equipment for centrifugation e Appropriate tubes for centrifugation resisting the physical forces acting on the tubes during the procedure e Centrifuge Equipment for reverse filtration e Vacuum aspirator or disposable hand held syringes e Filters with pore sizes smaller than the protists of interest e g x1 pm that can be attached to a vacuum aspirator or to disposable hand held syringes Reagents e Medium water to re suspend cell pellet Procedure Centrifugation 1 Place medium with the protists into the appropriate cent
278. toclaving 0 5 h cooling down 12 h 24 Supplementary Information Altermatt et al 2015 Methods in Ecology and Evolution DOI 10 1111 2041 210X 12312 1 2 Culture medium Troubleshooting Tips and Tricks In some protist microcosm studies vitamin powder e g 0 06 g L Herpetivite powdered vitamin supplement Research Labs Los Gatos California USA has been added to the medium to improve performance and well being of the cultures Donahue Holyoak amp Feng 2003 Fukami 2004 Also in several studies soil or soil extracts have been added to the medium McGrady Steed amp Morin 2000 Scholes Warren amp Beckerman 2005 Altermatt et al 2011 However even when autoclaving the medium thoroughly contaminations by microbes from this soil from dormant and often very persistent spores is a problem and soil additions are hard to standardize References Altermatt F Bieger A Carrara F Rinaldo A amp Holyoak M 2011 Effects of connectivity and recurrent local disturbances on community structure and population density in experimental metacommunities PLoS ONE 6 19525 Altermatt F amp Holyoak M 2012 Spatial clustering of habitat structure effects patterns of community composition and diversity Ecology 93 1125 1133 Altermatt F Schreiber S amp Holyoak M 2011 Interactive effects of disturbance and dispersal directionality on species richness and composition in metacommunities Ecology 92 859 870
279. ton et al 2013 Vorticella campanula SAR Alveolata Ollason 1977 Fox 2008 genus Fukami 2001 Supplementary Information Altermatt et al 2015 Methods in Ecology and Evolution DOI 10 1111 2041 210X 12312 1 1 Species used genus Kneitel amp Perrault 2006 genus Vorticella convallaria SAR Alveolata Ollason 1977 Vorticella microstoma SAR Alveolata Ostman et al 2006 Vorticella similis SAR Alveolata Spencer amp Warren 1996 Oikos Zygnema circumcarinatum Archaeplastida Chloroplastida Livingston et al 2013 Table S2 Overview on traits of some of the most commonly used species The trait measurements for individual species may depend on the specific experimental conditions e g temperature and nutrient levels affecting both growth rates as well as size This table however is mostly aiming at showing overall patterns in traits and exemplifying the range of trait values often over orders of magnitudes The original source of the trait value is given for each trait Size gives the diameter If not indicated differently trait values on size growth rate and carrying capacity are from Carrara et al 2012 and velocity is from Altermatt et al 2012 When possible mean and standard deviations of trait values are given Species name Size um Growth Carrying Velocit Trophic status rater capacity K y 1 d Ind ml p m s Blepharisma sp 471 3 x 0 67 0 07 59 5 4 7 predator 57 1 Chilomonas sp 233423 0 98 0 13 1572 4 168
280. trient enrichment on predator prey metapopulation dynamics Journal of Animal Ecology 69 985 997 Holyoak M 2000b Habitat Patch Arrangement and Metapopulation Persistence of Predators and Prey The American Naturalist 156 378 389 Holyoak M amp Lawler S P 1996 The role of dispersal in predator prey metapopulation dynamics Journal of Animal Ecology 65 640 652 Holyoak M amp Lawler S P 2005 The contribution of laboratory experiments on protists to understanding population and metapopulation dynamics Advances in ecological research 37 245 271 Jiang L amp Kulezycki A 2004 Competition predation and species responses to environmental change Oikos 106 217 224 Jiang L amp Morin P J 2004 Temperature dependent interactions explain unexpected responses to environmental warming in communities of competitors Journal of Animal Ecology 73 569 576 Jiang L amp Morin P J 2005 Predator Diet Breadth Influences the Relative Importance of Bottom Up and Top Down Control of Prey Biomass and Diversity The American Naturalist 165 350 363 Jiang L amp Patel S N 2008 Community assembly in the presence of disturbance A microcosm experiment Ecology 89 1931 1940 Kneitel J M amp Chase J M 2004 Disturbance predator and resource interactions alter container community composition Ecology 85 2088 2093 Kneitel J M amp Miller T E 2003 Dispersal rates affect species composition in
281. ts can be a confounding factor unless the duration of the experiments is very short An alternative is to estimate predation strength by measuring population dynamics in a predator prey system and inferring predation rates by fitting a suitable model such as a Lotka Volterra predator prey model to a time series of the two populations 3 Manipulation methods A considerable advantage of microcosm experiments is the high flexi bility in doing various manipulations Lawler 1998 Holyoak amp Lawler 2005 covering manipulations of both abiotic as well as biotic condi tions Manipulations can cover almost all aspects of ecology and evolution Fig 1 and see also the extensive list of references in Appen dix SI Section 1 1 and are often highly specific to the question of interest Table 1 Thus in the following it is not our goal to give all possible manipulations or to give a strict standardization as this is nei ther wanted nor practicable Rather we give an overview of the com mon manipulations pitfalls and opportunities and a selection of examples 3 1 GENERAL EXPERIMENTAL DESIGN One of the most significant strengths of protist microcosm is the varied and relatively straightforward manipulations that are possible Lawler 1998 Another strength is the ease with which unmanipulated variables can be controlled such as species composition environmental condi tions and system openness which also allow the design of protist expe
282. tte Drake amp Fukami 2005 Benton et al 2007 researchers have to embrace the full range of experimental techniques available and should rely not only on what they already know but rather what set of tools is most suitable to tackle their question We believe that our synthesis of established as well as novel tech niques is important and needed Together with the detailed pro tocols provided in the supplement and maintained in an online repository it may help to significantly improve standardization and quality of research employing microcosm experiments Acknowledgements We thank Y Choffat P Ganesanandamoorthy and R Illi for help during the laboratory work Funding is from the Swiss National Science Foundation Grants 31003A 135622 and PPOOP3_ 150698 to F A Eawag to E A F University of A user s guide for protist microcosms 229 Zurich and Swiss National Science Foundation Grant 31003A_137921 to O P University of Zurich University Research Priority Program Global Change and Biodiversity to A Ga Sciex fellowship 12 327 to J K F R S FNRS ARC 10 15 031 and UCL FSR to N S F R S FNRS Research Associate D L F R S FNRS Postdoctoral Researcher and V T FRIA PhD student whose contribution in this work at UCL Biodiversity Research Centre is referenced as BRC326 Three anonymous reviewers made helpful comments on a previous manuscript version Data accessibility This paper does not use data References
283. ty of non decomposers affects McGrady Steed Harris amp Morin 1997 effects of temperature change Petchey et al 1999 or spatial habitat structure and composition of leave litter Davies et al 2009 Decomposition rate is estimated by measuring the weight loss of organic matter e g of a wheat seed or leaf litter over a specific amount of time similar to use of leaf litter bags for measuring decomposition in terrestrial ecosystems Individual wheat seeds can be identified if required by placing them in small labelled bags Since this may rarely be required the protocol below is for measuring decomposition without identifying individual wheat seeds Materials Equipment Microbalance at least 0 001 g precision Drying oven Reagents Wheat seeds or leaf litter e g Alnus sp Procedure 1 Decide how many wheat seeds leaf litter pieces are required per microcosm and decide the period s over which decomposition will be measured for time estimates see Ribblett Palmer amp Coats 2005 This will determine the number of wheat seeds required in total and per microcosm per measurement period 2 Select wheat seeds that are similar in size and weight and that are not physically compromised 3 Dry the wheat seeds at 40 C until their weight is stable i e all moisture is removed 102 Supplementary Information Altermatt et al 2015 Methods in Ecology and Evolution DOI 10 1111 2041 210X 12312 2 10 Nutr
284. ublishing Ltd London Pawlowski J Audic S P Adl S Bass D Belbahri L D Berney C D et al 2012 CBOL protist working group barcoding eukaryotic richness beyond the animal plant and fungal kingdoms PLoS Biology 10 e1001419 Pennekamp F amp Schtickzelle N 2013 Implementing image analysis in labora tory based experimental systems for ecology and evolution a hands on guide Methods in Ecology and Evolution 4 483 492 Pennekamp F Schtickzelle N amp Petchey O L 2014a Bemovi software for extracting BEhaviour and MOrphology from VIdeos bioRxiv doi 10 1101 011072 Pennekamp F Mitchell K A Chaine A amp Schtickzelle N 2014b Dispersal propensity in Tetrahymena thermophila ciliates a reaction norm perspective Evolution 68 2319 2330 Petchey O L 2000 Prey diversity prey composition and predator population dynamics in experimental microcosms Journal of Animal Ecology 69 874 882 Petchey O L McPhearson P T Casey T M amp Morin P J 1999 Environ mental warming alters food web structure and ecosystem function Nature 402 69 72 Petchey O L Morin P J Hulot F D Loreau M McGrady Steed J amp Nae em S 2002 Contributions of aquatic model systems to our understanding of biodiversity and ecosystem functioning Biodiversity and Ecosystem Function ing Synthesis and Perspectives pp 127 138 Pratt D M amp Berkson H 1959 Two sources of error
285. ulti ple spatial scales a microcosm experiment Ecology 87 1008 1016 Cadotte M W 2007 Competition colonization trade offs and disturbance effects at multiple scales Ecology 88 823 829 Cadotte M W Drake J A amp Fukami T 2005 Constructing nature labora tory models as necessary tools for investigating complex ecological communi ties Advances in Ecological Research 37 333 353 Campbell C D amp Chapman S J 2003 A rapid microtiter plate method to mea sure carbon dioxide evolved from carbon substrate amendments so as to deter mine the physiological profiles of soil microbial communities by using whole soil Applied and Environmental Microbiology 69 3593 3599 Campbell C Chapman S amp Davidson M 2003 MicroResp Technical Man ual pp 40 Macaulay Scientific Consulting Ltd Abderdeen Carrara F Altermatt F Rodriguez Iturbe I amp Rinaldo A 2012 Dendritic connectivity controls biodiversity patterns in experimental metacommunities Proceedings of the National Academy of Sciences USA 109 5761 5766 2014 The Authors Methods in Ecology and Evolution 2014 British Ecological Society Methods in Ecology and Evolution 6 218 231 230 Altermatt et al Carrara F Giometto A Seymour M Rinaldo A amp Altermatt F 2014 Experimental evidence for strong stabilizing forces at high functional diversity in aquatic microbial communities Ecology doi 10 1890 14 1324 1 Cassidy H
286. ults section below 4 Visualise the sample on a two dimensional density plot of green fluorescence 520 nm and red fluorescence 2610 nm and optionally a second two dimensional plot of green fluorescence and sideward scattered SSC light 5 Distinguish between bacterial cells and background with electronic gating 6 Distinguish between small low nucleic acid LNA content bacteria and large high nucleic acid content HNA bacteria with electronic gating 7 Extensive details on the FCM methodology are supplied in PREST and SLMB Timing 15 minutes for sample preparation 2 minutes for measuring Can be automated for high throughput measurements see Van Nevel et al 2013 eL UA CS Supplementary Information Altermatt et al 2015 Methods in Ecology and Evolution DOI 10 1111 2041 210X 12312 2 5 Measuring bacteria density Flow cytometry Troubleshooting Tips and Tricks Cell concentrations Most commercial FCM instruments measure accurately in the range of 10 000 1 000 000 cells mL The method description included several dilution steps that should suffice to reach this range of cells However the dilution steps can be adapted if the required concentrations range is not reached Extensive details on the FCM methodology are supplied in Prest et al 2013 and SLMB 2012 Anticipated results Figure 2 shows FCM density plots of a bacterial culture during a protist growth experiment The bacteria were stained with S
287. up Adercotryma glomerata SAR Foraminifera Gross 2000 Allogromia sp SAR Foraminifera Gross 2000 Ammonia beccarii SAR Foraminifera Gross 2000 Ammoscalaria SAR Foraminifera Gross 2000 pseudospiralis Amoeba proteus Amoebozoa Tubulinea Davies et al 2009 Holt et al 2002 Holyoak 2000 Lawler amp Morin 1993 Livingston et al 2013 Naeem amp Li 1998 Amoeba radiosa Amoebozoa Tubulinea Ostman et al 2006 Fox et al 2000 Krumins et al 2006 Amphicoryna scalaris SAR Foraminifera Gross 2000 Ankistrodesmus falcatus Archaeplastida Chloroplastida Jin et al 1991 McGrady Steed et al 1997 genus Davies et al 2009 genus Fox et al 2000 genus Arcella vulgaris Amoebozoa Tubulinea Li amp Stevens 2010 Oikos Li amp Stevens 2010 CommEcol Askenasia sp SAR Alveolata Lawler 1993 McGrady Steed amp Morin 1996 Aspidisca sp SAR Alveolata Fox et al 2000 Kneitel amp Perrault 2006 McGrady Steed amp Morin 2000 Warren et al 2003 Asterionella formosa SAR Stramenopiles Fox 2004 Robinson amp Edgemon 1998 genus Atractomorpha echinata Archaeplastida Chloroplastida Livingston et al 2013 Bigenerina nodosaria SAR Foraminifera Gross 2000 Blepharisma americanum SAR Alveolata Fox amp Morin 2001 Holyoak 2000 Krumins et Supplementary Information Altermatt et al 2015 Methods in Ecology and Evolution DOI 10 1111 2041 210X 12312 1 1 Species used Blepharisma japonicum Bodo designis Bodo saltans Boldia erythrosiphon
288. us sp Planorbulina mediterranensis Platydorina sp Pleodorina californica Polytomella sp Poterioochromonas malhamensis Poterioochromonas stipitata Pseudocyrtolophosis alpestris Pyrgo murrhina Quuinequeloculina lamarckiana Rhynchomonas nasuta Rosalina cf bardyi Rubrioxytricha ferruginea Saccammina sp Scenedesmus gladiosum Scenedesmus obliquus Scenedesmus opoliensis SAR Amoebozoa Archaeplastida SAR SAR Archaeplastida Archaeplastida Archaeplastida SAR Archaeplastida Archaeplastida SAR Archaeplastida SAR SAR SAR Archaeplastida SAR SAR SAR SAR SAR SAR SAR SAR Archaeplastida Amoebozoa Excavata SAR Excavata Excavata SAR Archaeplastida Archaeplastida Archaeplastida SAR SAR SAR SAR SAR Excavata SAR SAR SAR Archaeplastida Archaeplastida Archaeplastida Stramenopiles Tubulinea Chloroplastida Chromista Alveolata Stramenopiles Chloroplastida Chloroplastida Foraminifera Stramenopiles Stramenopiles Alveolata Chloroplastida Stramenopiles Alveolata Alveolata Chloroplastida Alveolata Alveolata Alveolata Alveolata Alveolata Alveolata Alveolata Alveolata Chloroplastida Archamoebae Discoba Alveolata Discoba Discoba Foraminifera Chloroplastida Chloroplastida Chloroplastida Stramenopiles Stramenopiles Alveolata Rhizaria Foraminifera Discoba Rhizaria Alveolata Foraminifera Chloroplastida Chloroplastid
289. usly recorded Oxygen cells have limited life must be regularly calibrated should not be exposed to moist gases Care must be taken to assure there are no leaks in gas pipes We have found that a closed circuit respirometer is the type of device that performs best if one lab member has sole responsibility to maintain and operate it but requires considerable training for each user Consumables include oxygen sensors and compounds for extracting moisture from gas Fig S1 A Columbus mova Micro Oxymax Closed Circuit Respirometer Culture vessels are in the wooden tray lower left Yellow tubes take gas from the headspace of the culture vessels through the black guide box to the silver and blue striped pump dryer and measurement boxes The blue gas cylinder contains calibration gas Photo by Owen Petchey 98 Supplementary Information Altermatt et al 2015 Methods in Ecology and Evolution DOI 10 1111 2041 210X 12312 2 9 Respirometry Colorimetry This technology involves oxygen or carbon dioxide causing a chemical reaction that then results in colour change in a substance This colour change is quantified and transformed into a measure of respiration rate Several chemical reactions can be used and these are embedded into various devices An example is the microplate based respiration MicroResp device which can measure respiration rate in 96 samples simultaneously The device consists of disposable 96 well plates and a spe
290. utotrophy among ubiquitous bacteria lineages in the dark ocean Science 333 1296 1300 Temperton B amp Giovannoni S J 2012 Metagenomics microbial diversity through a scratched lens Curr Opin Microbiol 15 605 612 Tyers M amp Mann M 2003 From genomics to proteomics Nature 422 193 197 van Straalen N amp Roelofs D 2011 An introduction to Ecological Genomics Oxford University Press Oxford van Straalen N M amp Roelofs D 2012 Introduction to Ecological Genomics Oxford University Press Vandenkoornhuyse P Dufresne A Quaiser A Gouesbet G Binet F Francez A J Mahe S Bormans M Lagadeuc Y amp Couee I 2010 Integration of molecular functions at the ecosystemic level breakthroughs and future goals of environmental genomics and post genomics Ecology Letters 13 776 791 Wright P C Noirel J Ow S Y amp Fazeli A 2012 A review of current proteomics technologies with a survey on their widespread use in reproductive biology investigations Theriogenology 77 738 765 e752 Xanthopoulou A G Anagnostopoulos D Vougas K Anagnostopoulos A K Alexandridou A Spyrou G Siafaka Kapadai A amp Tsangaris G T 2010 A two dimensional proteomic profile of Tetrahymena thermophila whole cell lysate In Vivo 24 443 456 Yano J Rajendran A Valentine M S Saha M Ballif B A amp Van Houten J L 2012 Proteomic analysis of the cilia membrane of Paramecium
291. vation insect respiration tissue and skin respiration plant primary production and a wide range of other applications Various technologies exist though most rely on the consumption of oxygen and or production of carbon dioxide that accompanies respiration and that rates of consumption are linearly related to rate of respiration Indeed respiration rates are usually given in units of amount of oxygen per time e g Fenchel amp Finlay 1983 Technologies for measuring gas concentrations include oxygen cells infrared CO sensor colorimetry optodes polargraphic electrode dissolve oxygen sensors and manometry A respirometer is one of these technologies which embeds a sensor for gas concentration measurement in a sample containing a culture of organisms Many such devices exist For measuring dissolved O concentration with electrochemical sensors see Pratt amp Berkson 1959 For measuring CO concentration within four to six hours based on colorimetric detection using MicroResp see Campbell Chapman amp Davidson 2003 Campbell amp Chapman 2003 This document may develop into a list of detailed protocols for each technology and device in which there would be some overlap with the device s manufacturer manuals Here we provide an overview of different available technologies and mention some of the devices that adopt them listing their advantages and disadvantages Note that measuring gas concentrations often requires ac
292. ve the lid and place it on the bench only move the lid aside and keep it in hand 7 Squirt the sampled volume into the appropriate vessel 8 Ifnecessary replace the same volume of removed media with fresh media following general good practices cross reference to these 9 Replace the microcosms as soon as possible in the experimental environment 10 Make whatever measurements are required Figure S1 A sample being taken from a microcosm Photo by Florian Altermatt and Owen Petchey Timing Preparation of fresh media for replacement takes at least two days Steps 1 11 with good organization and practice take as little as one minute 52 Supplementary Information Altermatt et al 2015 Methods in Ecology and Evolution DOI 10 1111 2041 210X 12312 2 1 Sampling and counting Troubleshooting Tips and Tricks What volume to sample This will depend on the population densities of the species to be sampled Lower population densities required larger samples higher population sizes required smaller samples If microcosms have been homogenized before sampling and this has distributed individuals randomly one can assume the observed number of individuals in a sample is Poisson distributed with mean of the population density in the microcosm Low population sizes and small samples can easily result in zero individuals counted which should be avoided if possible as zeros can make some analyses problematic Should samples be r
293. xperimental system to study dispersal and metaeco systems for terrestrial organisms Nature Methods 9 828 833 Leibold M A Holyoak M Mouquet N Amarasekare P Chase J M Hoo pes M F et al 2004 The metacommunity concept a framework for multi scale community ecology Ecology Letters 7 601 613 Li W amp Stevens M H H 2010 High community dissimilarity at low productiv ity causes the productivity richness relation to vary with observational scale Community Ecology 11 27 34 Li M Huang W E Gibson C M Fowler P W amp Jousset A 2013 Stable isotope probing and Raman spectroscopy for monitoring carbon flow in a 2014 The Authors Methods in Ecology and Evolution 2014 British Ecological Society Methods in Ecology and Evolution 6 218 231 food chain and revealing metabolic pathway Analytical Chemistry 85 1642 1649 Limberger R amp Wickham S 2011 Competition colonization trade offs in a cil iate model community Oecologia 167 723 732 Loreau M Mouquet N amp Holt R D 2003 Meta ecosystems a theoret ical framework for a spatial ecosystem ecology Ecology Letters 6 673 679 Lotka A J 1910 Contribution to the theory of periodic reactions Journal of Physical Chemistry 14 271 274 Luckinbill L S 1973 Coexistence in laboratory populations of Paramecium aur elia and its predator Didinium nasutum Ecology 54 1320 1327 Luckinbill L S 1974 The effe
294. ymena Fig S1 Overview of the different steps in an automated image video analysis work flow 1 microcosms are sampled A and a fixed volume transferred to a counting chamber B The chamber is placed on the microscope stage and videos are taken via a camera coupled to the microscope which can be controlled remotely from a computer C Image video analysis software such as ImageJ is then used to process segment and extract the information on images videos and transformed into quantitative data in a machine readable format D 2 The data stored in a database is then ready for further processing analysis and interpretation Two examples are shown illustrating the identification of target individuals the abundance of protists can be estimated from a photo and up scaled to the density in the microcosm E By sampling on multiple occasions through time the population dynamics of different species are captured The second example is the re construction of movement trajectories from videos F Using video behavioural traits such as movement speed are captured and trait distributions in communities can be analysed 62 Supplementary Information Altermatt et al 2015 Methods in Ecology and Evolution DOI 10 1111 2041 210X 12312 2 3 Image and video analysis Alternative methodologies that provide abundance and trait data simultaneously include flow cytometry see section 2 5 particle counters see section 2 4 and integrated systems co
295. ysis Resilience Disturbance ecology Microscopy image analysis Invasion resistance Invasion biology Microscopy image analysis Phylogenetics Community Ecology Community Phylogenetics DNA Sequencing Barcoding Ecosystem Nutrient Carbon cycling Ecosystem Ecology Meta ecosystem Ecology Respirometer litter bags Decomposition rate Energy fluxes O5 consumption Ecosystem Ecology Meta ecosystem Ecology Respirometer CO production Stoichiometry Ecosystem Ecology Meta ecosystem Ecology Nutrient analysis 1 Maintenance methods 2 Measurement methods 3 Manipulations e g species used e g respiration e g spatial network structure Fig 2 Experiments with protist microcosms have the advantage that general maintenance methods can be highly standardized e g a d showing four species which have been commonly used and for which trait data are readily available a Blepharisma sp b Euglena gracilis c Paramecium bur saria d Colpidium sp that there exists a wide set of measurement tools covering individuals to ecosystem processes e respirometer to measure ecosystem functioning and that many types of experimental manipulation are possible f experiment in which the spatial connectivity of patches and availability of nutrients is manipulated simultaneously We provide a synthetic and comprehensive overview of summarized under the term protists Adl et al 2012 note methods Table 1 for using protist microcosms as a model sys

Download Pdf Manuals

Related Search

Related Contents

  Table of Contents What`s in the Box  1 - Telanor AG  manual teste combustivel  HiPath 3000 Bedienungsanleitung  7 - Classic Industries  Brochure - Scoota Mart  Manual de Prestador - Fonasa  

Copyright © All rights reserved. Failed to retrieve file