Home
[Phytophthora infestans (Mont) de Bary] EN CHAPINGO, MÉXICO
Contents
1. con la adici n de 45 uL de acetato de sodio 3 M y 1 mL de etanol a 95 96 v v por 60 min se centrifug la mezcla a la misma velocidad por 5 min y el precipitado se resuspendi en 100 uL de amortiguador TE pH 7 5 Haplotipos mitocondriales Para determinar haplotipos se realizaron las amplifica ciones con los iniciadores propuestos por Griffth y Shaw 1998 Pl 5 GCAATGGGTAAATCGGCT CAA 3 Reverse 5 AAACCAT AAGGACCACACAT 3 P2 Forward 5 TTCCCTTTGTCCTCTACCGAT 3 Reverse 5 TTACGGCGGTTTAGCACATACA 3 P3 Forward 5 ATGGTAGA GCGTGGGAATCAT 3 Reverse 5 AATAC CGCCTTTGGGTCCATT 3 gt y P4 5 T GGTCATCCAGA GGTTTATGT 3 Integrated DNA Technologies USA Las condiciones de amplificaci n para la reacci n en cadena de la polimerasa fueron las siguientes dNTP s 200 uM MgCl 2 75 mM 10 picomoles de cada iniciador alb mina de suero de bovi no BSA 160 ug mL amortiguador de PCR 1x Go Taq DNA polimerasa 1U Promega ADN 20 ng en un volumen final de Forward 25 uL el programa de PCR fue un ciclo a 94 C por 1 5 min se guido de 35 ciclos de 94 C 40 s 55 C 60 s 72 C 90 s con una extensi n final a 72 C por 5 min Applied Byosistems 9700 The second method was described by Goodwin er al 1992 The mycelium was macerated with 900 uL of extraction buffer EDTA 0 5 M Tris 1 M pH 8 NaCl 1 4 M SDS 20 and P mercaptoethanol After incubating 1 h at 65 C 450 uL of ammonium acetate 7 5 M were added and the mixture
2. mediante dos m todos Prime ro el propuesto por Griffith y Shaw 1998 El micelio crecido 10 d de cada aislamiento se macer con 800 uL de amortigua dor de extracci n NaCl 100 mM Tris HCl 100 mM pH 8 NaCl 1 4 M CTAB 2 96 EDTA 20 mM pH 8 se incub 1 h a 65 C se adicionaron 600 uL de cloroformo saturado con agua 596 VOLUMEN 47 N MERO 6 grow towards the center of the dish After two or three weeks at 21 C the presence of oospores in which mycelia were inter crossed with the type Al identified the unknown isolate as A2 and in the crossing with type A2 indicated that the unknown isolate was Al If the same isolate produced oospores when crossed with the two strains of known type it was considered homothallic Gilchrist et al 2009 Allozyme patterns Genotype identification by allozymes was obtained by the method described by Goodwin et al 1995a Mycelium of two or three weeks of active growth was transferred to a microcentrifuge tube with 30 uL of sterile distilled water and was macerated with a plastic drill After resting 5 min 10 uL were taken to place them on cellulose acetate plates Titan III Helena Laboratories Electrophoresis was ran in a Tris Glycine buffer pH 8 5 and each enzyme was revealed according to the methodology reported by Hebert and Beaton 1993 To determine the genotypic diversity the Shannon Wiener index was used which is based on the concept of equity takes values between zero wh
3. haplotipo mitocondrial la Pocos genotipos se pudieron ubicar con precisi n en alguna de las clasificaciones existentes por lo que se consideran nicos en el rea o no presentes en otras regiones Por su diversidad ge n tica es necesario una clasificaci n m s amplia que incluya a la mayor a de alelos multilocus detectados por aloenzimas y a la condici n homot lica Palabras clave Solanum tuberosum L haplotipo mitocondrial isoenzimas compatibilidad INTRODUCCI N hytophthora infestans Mont de Bary es un microorganismo perteneciente al reino Stra menopila Chromista Phylum Oomycota Autor responsable 4 Author for correspondence Recibido mayo 2012 Aprobado junio 2013 Publicado como ART CULO en Agrociencia 47 593 607 2013 593 ABSTRACT In the Mexican central highlands late blight Phytophthora infestans has high incidence severity and genotypic diversity due in part to its sexually derived progeny The objective of this study was to evaluate the mating type allozyme profile and mitochondrial haplotype of 88 isolates of P infestans obtained from simple random lesions of potato clones at the experimental agricultural station of the University of Chapingo M xico in 2008 2009 and 2010 Homothallic population A1 A2 predominated with a frequency of 0 761 Al and A2 frequencies were 0 125 and 0 114 respectively Twenty five allozyme genotypes were identified with alleles 100 and 122 for pepti
4. nwald ez al 2001 This decrease is explained by the homothallic character of clonal nature presented by most of the isolates of this study however the diversity doubled to 0 92 reported for Chapingo Goodwin 1996 Cuadro 2 Frecuencia de los genotipos de Phytophthora infestans identificados de acuerdo con el tipo de compatibi lidad y aloenzimas Pep y Gpi Table 2 Frequency of Phytophthora infestans genotypes identified according to the mating type and Pep and Gpi allozymes Genotipo TC Pep Gpi PRORA Frecuencia or de 1 Al 100 100 86 111 3 0 034 2 Al 100 100 100 111 122 3 0 034 3 Al 100 100 86 122 1 0 011 4 Al 100 100 86 100 111 1 0 011 5 Al 100 100 86 100 2 0 024 US 1 6 Al 92 100 100 100 1 0 011 US 5 US 6 7 A2 100 100 86 122 2 0 024 8 A2 100 100 86 100 4 0 045 CA 3 9 A2 100 100 100 122 2 0 024 US 14 10 A2 100 100 100 111 122 1 0 011 US 8 11 A2 100 122 86 100 122 1 0 011 12 A2 100 122 86 122 1 0 011 13 A1 A2 100 100 100 122 5 0 057 14 A1 A2 100 100 100 100 10 0 113 PE 3 15 A1 A2 100 100 86 100 111 5 0 057 16 A1 A2 100 100 86 100 122 12 0 136 17 A1 A2 100 100 86 100 19 0 216 18 A1 A2 100 100 86 111 2 0 024 19 A1 A2 100 100 86 122 1 0 011 20 A1 A2 100 100 90 100 4 0 045 a 21 A1 A2 100 122 86 100 122 3 0 034 22 A1 A2 100 122 86 100 1 0 011 23 A1 A2 100 122 86 100 111 1 0 011 24 A1 A2 92 100 100 122 3 0 034 TC tipo de apareamiento Pep peptidasa Gp glucosa fosfato isomerasa
5. se entrecruzaron los micelios con el tipo Al identific al aislamiento desconocido como A2 y en el cruza miento con el tipo A2 indic que el aislamiento desconocido era Al Si el mismo aislamiento formaba oosporas al cruzarse con las dos cepas de tipo conocido se consider homot lico Gilchrist et a 2009 Patrones aloenzim ticos La identificaci n de genotipos por aloenzimas se realiz con el m todo descrito por Goodwin et al 1995a Micelio de dos a tres semanas de crecimiento activo se transfiri a un tubo de microcentr fuga con 30 uL de agua destilada est ril y se macer con una broca de pl stico Despu s de reposar 5 min se tomaron 10 uL para colocarlos en placas de acetato de celulosa Titan III Helena Laboratories La electroforesis se realiz en amortiguador Tris Glicina pH 8 5 y cada enzima se revel de acuerdo con la metodolog a reportada por Hebert y Beaton 1993 Para determinar la diversidad genot pica se us el ndice de Shannon Wiener que se basa en el concepto de equidad adquiere valores entre cero cuando hay una sola especie y el logaritmo de S cuando todas las especies est n representadas por el mismo n mero de individuos Moreno 2001 H Y pln p donde p abundancia proporcional de la especie 7 es decir el n mero de individuos de la especie dividido entre el n mero total de individuos de la muestra In logaritmo base 10 Extracci n de ADN Esta extracci n se realiz
6. slices cv Alpha disinfested with sodium hypochlorite 2 96 in water v v in Petri dishes 10 cm diameter to allow mycelium growth through the tissue at room temperature Mycelial growth was observed with a microscope about three days later and the presence of the pathogen was confirmed by morphological observations in fixed preparations Purified mycelium was transferred to a solid rye agar medium and incubated at 21 C for characterization Grunwald et al 2001 Mating type Mating was determined by crossing isolates of P infestans with a strain of known mating type Al or A2 kindly provided by the International Cooperative Program of the Potato Late Blight PICTIPAPA A C at Metepec Mexico On an agar rye medium in a Petri dish 10 cm diameter the unknown type along with the known type were sown on opposite sides to ALARC N RODR GUEZ et al 595 AGROCIENCIA 16 de agosto 30 de septiembre 2013 Tipo de compatibilidad La compatibilidad se determin cruzando los aislamientos de P infestans con una cepa tipo de compatibilidad conocida Al o A2 proporcionada por el Programa Internacional Coo perativo del Tiz n Tard o de la Papa PICTIPAPA A C en Metepec M xico En medio agar centeno en caja petri 10 cm de di metro se sembraron la cepa desconocida y la del tipo conocido en lados opuestos para que crecieran hacia el centro de la caja Despu s de dos a tres semanas a 21 C la presencia de oosporas donde
7. was maintained 20 min on ice It was centrifuged at 12 300 xg for 10 min the supernatant was transferred and 800 uL of isopropanol were incorporated to precipitate on ice for 30 min centrifuged for 5 min at the same speed the isopropanol was decanted and the precipitate was washed with ethanol 70 96 v v and the pellet was dried by inverting the tube at room temperature The pellet was resuspended with 450 uL of buffer TE Tris 10 mM pH 8 EDTA 0 5 M and 1 uL of ARNase A and rested overnight at 4 C The next day 450 uL of the chloroform isoamyl alcohol 24 1 mixture was added It was centrifuged at 17 900 xg for 5 min the supernatant was precipitated by adding 45 uL of sodium acetate 3 M and 1 mL of ethanol at 95 96 v v for 60 min the mixture was centrifuged at the same speed for 5 min and the pellet was resuspended in 100 uL of buffer TE pH 7 5 Mitochondrial haplotypes For determining haplotypes obtained with primers proposed by Griffith and Shaw 1998 Pl Forward 5 GCAATGGGTAAATCGGCTCAA 3 Reverse 5 AAACCAT AAGGACCACACAT 3 P2 Forward 5 TTCCCTTTGTCCTCTACCGAT 3 Reverse amplifications were 5 TTACGGCGGTTTAGCACATACA 3 P3 Forward 5 ATGGTAGA GCGTGGGAATCAT 3 Reverse 5 AATACCGCCTTTGGGTCCATT 3 and P4 5 T GGTCATCCAGAGGTTTATGT 3 Integrated DNA Technologies USA The amplification conditions for the chain reaction of polymerase were dNTP s 200 uM MgCl 2 75 mM 10 pmol of each primer bovine serum albumi
8. 2002 La diversidad gen tica observada en este estudio constata lo reportado para la regi n central de M xi co en general y ahora para el rea de Chapingo don de predomina la reproducci n sexual del pat geno se observ la gran heterogeneidad de las poblaciones de P infestans en los 24 genotipos identificados a par tir de 88 aislamientos en el rea de estudio Esto es muy semejante a las 15 variantes reportadas por Ma tuszak et al 1994 a partir de 33 aislamientos de un solo campo de papa De los genotipos identificados en este estu dio se puede asociar el genotipo Al 86 100 Gps 100 100 Pep con el US 1 el genotipo Al 100 100 92 100 se asoci con el US 5 Gavino y Fry 2002 Wangsomboondee et al 2002 y con US 6 Forbes et al 1998 La diferenciaci n entre stos se basa en fragmentos de restricci n RFLP El genotipo identificado en Chapingo como A2 86 100 100 100 ser a el equivalente al CA 3 Otros genoti pos tipo A2 se pueden asociar con el US 14 y US 8 Goodwin et al 1998 Sin embargo la mayor a de genotipos no se integran a las clasificaciones actua les del pat geno Cuadro 2 porque tanto el sistema de clasificaci n norteamericano US como otros sistemas s lo integran a genotipos heterot licos which coincides with the statement of Gilchrist et al 2009 that as time goes by the diversity in pathogen populations increases Allele 122 of Gp is present in U S Goodwin er al 1995b wher
9. 400 ng uL con una calidad de 1 7 hasta 1 9 Abs 260 280 Por el contrario con el m todo de Goodwin et al 1992 se extrajo menor cantidad de ADN 11 a 200 ng uL 5 y la calidad vari de 1 4 hasta 1 8 Abs 260 280 Tambi n hubo mejores amplicones con el ADN obtenido con el primer m todo por lo cual en los estudios posteriores se us el m todo de Griffith y Shaw 1998 Haplotipos mitocondriales Para los iniciadores P1 se obtuvo una amplifica ci n monom rfica para todas las muestras y el resul tado fue un fragmento de 1118 pb Figura 1A Para realizar la digesti n del producto de P1 se emple la enzima Hha I El tama o de los fragmentos fue de 211pb y 907 pb Figura 1B Estos fragmentos fueron similares a lo reportado por Griffith y Shaw 1998 asoci ndose con el haplotipo Ia o Ib Para los iniciadores P2 F2 R2 hubo dos ban das una claramente definida de 1070 pb y otra poca intensa de 750 pb Figura 2A La digesti n del frag mento de 1070 pb se realiz usando la enzima de restricci n Msp I y se obtuvieron los fragmentos de 203 y 641 pb Figura 2B lo cual indic una relaci n con el haplotipo Ia Griffith y Shaw 1998 Botez e al 2007 Para lograr una mejor resoluci n de frag mentos de digesti n y verificar que no se presentara la banda de 79 pb que mencionan Griffith y Shaw 1998 como ausente para este haplotipo se hizo un 602 VOLUMEN 47 N MERO 6 Mitochondrial haplotypes DNA extrac
10. 96 p v en electroforesis con amortiguador de corrida Tris borato EDTA TBE a 50 V por 90 min Las im genes fueron fotodocumentadas con el programa Quanty One BioRad Para el fragmento P2 la digesti n se visualiz en gel de poliacrilamida al 8 96 p v y fue te ido con nitrato de plata 0 2 96 p v An lisis estad stico Los patrones aloenzim ticos se codificaron en una matriz de presencia y ausencia se analizaron con el m todo UPGMA lo cual permiti la agrupaci n de los genotipos a partir de la po blaci n total mediante el coeficiente Simple Matching SM o coincidencias simples en el programa NTSYS 2 2 RESULTADOS Y DISCUSI N Aislamiento del pat geno En los tres a os de recolecci n se seleccionaron 88 aislamientos Cuadro 1 y presentaron caracter s ticas morfol gicas t picas de la especie como mice lio cenoc tico morfolog a del esporangio evoluci n del anteridio y oogonio para formar la oos pora y las diferencias de los flagelos de las zoosporas plu ma y l tigo P rez y Forbes 2008 Jaimasit y Prakob 2010 En las pruebas realizadas en el ciclo 2008 no se photodocumented with Quanty One program BioRad For fragment P2 digestion was visualized on 8 polyacrylamide gel w v and stained with silver nitrate 0 2 w v Statistical analysis Allozyme patterns were coded in a presence absence matrix they were analyzed using the UPGMA method which allowed the grouping of genotypes from the
11. D GEN TICA DEL TIZ N TARD O DE LA PAPA Phytophthora infestans Mont de Bary EN CHAPINGO M XICO observaron diferencias entre los aislamientos de hoja y tallo por tanto en los siguientes ciclos solamente se hicieron aislamientos del follaje Tipo de compatibilidad Dos tipos de compatibilidad se presentaron con una frecuencia de 0 125 A1 y 0 114 A2 guardan do la proporci n 1 1 aunque predominaron las cepas homot licas A1 A2 con una frecuencia de 0 761 En el valle de Toluca predominan los Al y los A2 en la proporci n 1 1 sin homot licos Gr nwald ez al 2001 G mez Alpizar et al 2007 y en Michoac n su frecuencia fue 0 038 Fern ndez et al 2005 Las poblaciones homot licas son altamente virulentas y variables lo cual les permiti adaptarse a diferentes condiciones ambientales Silva ez al 2009 y pu dieran representar una ventaja selectiva porque se puede generar reproducci n sexual por s misma aunque con endogamia En la s ptima generaci n de reproducci n homot lica solamente permanece 1 96 de la heterocigosidad original Goodwin 1997 La causa de la abundancia de aislamientos homot licos en Chapingo se desconoce pero es posible que las lesiones se tomaran de plantas resistentes al pat ge no Estas plantas no son f cilmente infectadas por las variantes silvestres de P infestans La infectividad se reduce a una secci n de la poblaci n del pat geno que es altamente agresiva caracter stic
12. DIVERSIDAD GEN TICA DEL TIZ N TARD O DE LA PAPA Phytophthora infestans Mont de Bary EN CHAPINGO M XICO GENETIC DIVERSITY OF POTATO LATE BLIGHT Phytophthora infestans Mont de Bary AT CHAPINGO M XICO Norma M Alarc n Rodr guez H ctor Lozoya Salda a Ernestina Valadez Moctezuma Ma del Rosario Garc a Mateos Mar a T Colinas Le n Instituto de Horticultura Departamento de Fitotecnia Universidad Aut noma Chapingo 56230 Chapingo M xico picti87 gmail com RESUMEN En el altiplano central mexicano el tiz n tard o Phytophthora infestans presenta alta incidencia severidad y diversidad ge not pica debido en parte a sus progenies derivadas sexual mente El objetivo de este estudio fue evaluar el tipo de apa reamiento el perfil aloenzim tico y el haplotipo mitocondrial de 88 aislamientos de P infestans obtenidos de lesiones sim ples al azar de clones de papa en el campo agr cola experimen tal de la Universidad Aut noma Chapingo M xico durante 2008 2009 y 2010 Predomin la poblaci n homot lica A1 A2 con una frecuencia de 0 761 Las frecuencias de los tipos Al y A2 fueron 0 125 y 0 114 Se identificaron 25 genotipos de aloenzimas con los alelos 100 y 122 para las peptidasas Pep y 86 90 100 111 y 122 para glucosa fosfato isomerasas Gpi El genotipo m s com n fue A1 A2 Pep 100 100 y Gpi 86 100 frecuencia 0 216 El ndice de diversidad genot pica fue 1 8 y s lo se identific al
13. TC mating type Pep peptidase Gpi glucose phosphate isomerase 600 VOLUMEN 47 N MERO 6 DIVERSIDAD GEN TICA DEL TIZ N TARD O DE LA PAPA Phytophthora infestans Mont de Bary EN CHAPINGO M XICO Ninguno de los genotipos identificados se pue de ajustar a las clasificaciones actuales del pat geno aunque hay muchos perfiles La diversidad genot pica calculada para los aislamientos de Chapingo fue 1 8 usando el ndice de Shannon lo cual muestra una gran diversidad gen tica a pesar de ser un valor me nor al reportado para el valle de Toluca Gr nwald et al 2001 Esta disminuci n se explica por el car cter homot lico de ndole clonal presentado por la mayo r a de los aislamientos de este estudio sin embargo la diversidad duplic al 0 92 reportado para Chapin go Goodwin 1996 lo cual coincide con la afirma ci n de Gilchrist ez al 2009 de que al transcurrir el tiempo aumenta la diversidad en las poblaciones del pat geno El alelo 122 de Gpi est presente en EE UU Goodwin et al 1995b mientras que en M xico se encuentra en aislamientos heterot licos y homot licos Gr nwald er a 2001 Fern ndez el al 2005 Lozoya et al 2005 El genotipo A1 A2 90 100 para Gpi fue reportado en Polonia el genotipo A1 A2 100 100 Gpi y 100 100 Pep fue descrito para Saltillo Coahuila y el genotipo A1 86 100 100 100 se iden tific en Canad y Per todos ellos durante la d cada de 1980 a 1990 Gavino y Fry
14. a de homot licos Tambi n la ausencia de hospedantes silvestres no favoreci la heterogeneidad del oomiceto Lozoya et al 2006 Otra posible presi n de selecci n hacia la prevalencia de homot licos pudiera ser haber to mado lesiones simples tempranas esto es de inicio del ciclo sin oportunidad de intercambio gen tico con otras variantes comunes en epidemias avanzadas con m ltiples lesiones foliares Se ha reportado ma yor diversidad si hay dos o mas lesiones en una hoja Flier ez al 2003 Patrones aloenzim ticos Los genotipos obtenidos se describieron en t r minos de la movilidad relativa de las bandas en un campo el ctrico donde el alelo m s com n es el que presenta la movilidad de 100 Hern ndez y G mez 2005 En el presente estudio se observ una gran cantidad de genotipos de aloenzimas en los aislamientos identific ndose los alelos 92 100 the Valley of Toluca Al and A2 predominated in 1 1 ratio without homothallic Gr nwald ez al 2001 Gomez Alpizar ez al 2007 and in Michoac n their frequency was 0 038 Fern ndez et al 2005 Homothallic populations are highly virulent and variables which allowed them to adapt to different environmental conditions Silva ez al 2009 and could represent a selective advantage because they can generate sexual reproduction by themselves but with inbreeding In the seventh generation of homothallic reproduction remains only 1 96 of the original heterozygosi
15. a necrosis y muerte P rez y Forbes 2008 por tal motivo P infestans es uno de los organismos m s estudiados en su reproducci n fisiolog a y pro cesos infectivos Es necesario conocer la diversidad gen tica de las poblaciones de las regiones infectadas porque est relacionada con la eficacia y la eficiencia de los m todos de manejo Entre los m todos para caracterizar su diversidad est n los marcadores feno t picos y genot picos y los m s empleados son los pa trones aloenzim ticos de glucosa fosfato isomerasas Gpi y peptidasas Pep el tipo de apareamiento o compatibilidad Al A2 la sonda RG57 y la evalua ci n de haplotipos de ADN mitocondrial ADN mt Griffith y Shaw 1998 G mez Alpizar et al 2007 Jaimasit y Prakob 2010 Phytophthora infestans es un organismo heterot lico porque requiere los tipos de apareamiento Al y A2 para reproducirse sexualmente El grupo de compatibilidad Al se dispers por el mundo desde la hambruna irlandesa de mediados del siglo XIX y el tipo A2 se identific en M xico en la d cada de los cincuenta donde permaneci limitado por va rias d cadas m s En 1981 se encontr en Europa Oriente Medio Asia y Sur Am rica aumentando su importancia debido a su r pida dispersi n y alta vi rulencia adapt ndose a nuevas condiciones ambien tales y hospederos Spielman et al 1991 Goodwin et al 1995a Gilchrist et al 2009 En M xico se han identificado todos los haplotipo
16. apas where host and pathogen coexist and co evolve simultaneously A 2 3 45 6M E 2220 24 Banda 230 la Ib B 23 456 600 pb 500 pb 400 pb E 300 pb 200 pb 100 pb 1000 pb 750 pb 500 pb 250 pb 78 9 10 11121314 15 1617 18 1920 21 22 23 24 M LE LS E 04 LJ 604 Figura 3 Figure 3 VOLUMEN 47 N MERO 6 A Amplificaci n del producto P3 DNA mitocondrial 1308 pb M marcador de peso molecular 1Kb Fermentas B Di gesti n del fragmento P3 por la enzima Eco RI productos 230 y 1078 pb M marcador de peso molecular 100 pb Fermen tas En ambos casos 1 a 24 los distintos genotipos Geles de agarosa 2 96 A Amplification of product P3 mitochondrial DNA 1308 bp M molecular weight marker IKb Fermentas B Digestion of the fragment P3 by the enzyme Eco RI products 230 and 1078 bp M molecular weight marker 100 bp Fermentas In both cases 1 to 24 are the various genotypes Agarose gel 2 96 1000 pb 750 pb 500 pb 250 pb BEM 1234567 8 9 10 11 121314 15161718 19 20212223 24 800 pb 700 pb 600 pb 500 pb 400 pb E 300 pb 200 pb 100 pb 345 67 8 910 l1 12 13 l 1516 I7 18 19 20 21 22 2324 P4 Da e no mo CHOD Ch IE ulum 25 26 27 2829 amp m G o e tte T yy Figura 4 A Amplificaci n del producto P DNA mitocondrial COX 964 pb M marcador de peso molecular 1Kb Fermentas Carril 1 a 24 son los distintos genotipos B Digesti n del frag mento P4 por la
17. cuantificado Este nuevo co nocimiento puede servir para dise ar estrategias de manejo y control en la regi n si en estudios futuros se asocia la variabilidad del pat geno con su resis tencia a fungicidas Adem s se evidenci la necesi dad de establecer criterios de clasificaci n m s am plios e incluyentes que puedan ubicar a distintos genotipos detectados en el presente estudio y a los aislamientos homot licos debido a que los sistemas actuales US para EE UU EC para Ecuador CA para Canad no los incorporan porque no se tienen en los lugares geogr ficos o pa ses donde se dise a ron dichos sistemas CONCLUSIONES La poblaci n de Phytophthora infestans recolec tada en el presente estudio presenta gran diversidad gen tica en la zona de Chapingo M xico ndice de 1 8 correspondiente a 24 genotipos de aloenzimas con el haplotipo mitocondrial la y alta frecuencia de homotalismo La mayor a de los perfiles identificados no coinciden con los de clasificaciones establecidas en otros pa ses LITERATURA CITADA Adler N E L J Erselius M G Chac n W G Flier M E Ord nez L Kroon and G A Forbes 2004 Genetic diversity of Phytophthora infestans sensu lato in Ecuador provides new insight into the origin of this important plant pathogen Phytopathology 94 154 162 Botez C V Florian I Oroian and M Lecaci 2007 Analysis of genetic variability at mitochondrial DNA level in some Roumanian Phytoph
18. d Table 2 Of these just some non homothallic have been reported for the valley of Toluca Godwin et al 1992 Flier et al 2003 Lozoya et aL 2005 However for homothallic isolates no reports were found only the genotype ALARC N RODR GUEZ et al 599 AGROCIENCIA 16 de agosto 30 de septiembre 2013 y 122 para las peptidasas Pep y 86 90 100 111 y 122 para glucosa fosfato isomerasa Gp El geno tipo m s frecuente present bandas 100 100 para Pep y 86 100 para Gpi Al considerar el tipo de apa reamiento junto con los alelos aloenzim ticos re portados se identificaron 24 genotipos multilocus Cuadro 2 De estos s lo algunos no homot licos se han reportado para el valle de Toluca Godwin et al 1992 Flier et al 2003 Lozoya et al 2005 Sin embargo para los aislamientos homot licos no se encontraron reportes solamente el genotipo Gpi 100 100 y Pep 100 100 en Saltillo Coahuila el Gp 100 100 en Polonia y Gp 90 100 en Holanda Ga vino y Fry 2002 Gpi 100 100 and Pep 100 100 in Saltillo Coahuila the Gp 100 100 in Poland and Gp 90 100 in the Netherlands Gavino and Fry 2002 None of the genotypes identified can be adjusted to current classifications of the pathogen although there are many profiles Genotypic diversity calculated for isolates of Chapingo was 1 8 using the Shannon index which shows great genetic diversity despite being a value less than that reported for the Toluca Valley Gr
19. dase Pep and 86 90 100 111 and 122 for glucose phosphate isomerase Gpi The most common genotype was A1 A2 Pep 100 100 and Gpi 86 100 frequency 0 216 The genotypic diversity index was 1 8 and only the Ia mitochondrial haplotype was identified Few genotypes could be located accurately in any of the existing classifications so they are considered unique in the area or not present in other regions For their genetic diversity a broader classification is needed including most of multilocus alleles detected by alloenzymes and homothallic condition Key words Solanum tuberosum L mitochondrial haplotype isoenzymes compatibility INTRODUCTION hytophthora infestans Mont de Bary is a microorganism belonging to kingdom Stramenopila Chromista Phylum Oomycota http tarwi lamolina edu pe gligli OO pdf which has a large genetic plasticity and is an economically important pathogen in Solanaceae such as potato Solanum tuberosum L It is a threat to the world AGROCIENCIA 16 de agosto 30 de septiembre 2013 http tarwi lamolina edu pe gligli OO pdf que posee una gran plasticidad gen tica y es un pat ge no de importancia econ mica en solan ceas como la papa Solanum tuberosum L Es una amenaza para la seguridad alimentaria mundial por causar el tiz n tard o enfermedad de la papa responsable de la hambruna en Irlanda en el siglo XIX Causa manchas en hojas tallos pec olos y tub rculos que conducen
20. eas in M xico it is found in heterothallic and homothallic isolates Gr nwald er al 2001 Fernandez et al 2005 Lozoya et aL 2005 Genotype Al A2 90 100 for Gpi was reported in Poland genotype Al A2 100 100 Gpi and 100 100 Pep was described for Saltillo Coahuila and genotype Al 86 100 100 100 was identified in Canada and Peru all of them during the decade of 1980 1990 Gavino and Fry 2002 The genetic diversity observed in this study confirmed what was reported for the central region of M xico in general and now for Chapingo area where the sexual reproduction of the pathogen predominates the greatest heterogeneity of the populations of P infestans was observed in the 24 genotypes identified from 88 isolates in the study area This is very similar to the 15 variants reported by Matuszak e al 1995 from 33 isolates from just one potato field Of the genotypes identified in this study the genotype Al 86 100 Gpi 100 100 Pep may be associated with the US 1 genotype Al 100 100 92 100 was associated with the US 5 Gavino and Fry 2002 Wangsomboondee et al 2002 and with US 6 Forbes et al 1998 Differentiation between these is based on restriction fragments RFLP The genotype identified in Chapingo as A2 86 100 100 100 would be equivalent to CA 3 Other genotypes A2 type may be associated with the US 14 and US 8 Goodwin et al 1998 However the majority of genotypes are not integrated to current classifica
21. en there is a single species and the logarithm of S when all species are represented by the same number of individuals Moreno 2001 H Y p In p where p proportional abundance of the species that is the number of individuals of the species divided by the total number of individuals in the sample In logarithm base 10 DNA extraction This extraction was done by two methods First that by Griffith and Shaw 1998 Grown mycelium for 10 d of each isolate was macerated in 800 m L of extraction buffer NaCl 100 mM Tris HCl 100 mM pH 8 NaCl 1 4 M 2 96 CTAB EDTA 20 mM pH 8 incubated 1 h at 65 C 600 uL of chloroform saturated with water were added the mixture was stirred 15 s by inversion centrifuged 12 min at 17 900 xg the supernatant was transferred to a clean tube and ARNase 10 ug mL was added Then they were incubated 1 h at 37 C 400 uL of isopropanol were added incubating 20 min at 20 C centrifuged 12 min at 15 700 xg the supernatant was decanted and the pellet was washed with 500 uL of ethanol at 70 96 v v It was again centrifuged eliminating the supernatant and the precipitate was dried at room atmosphere It was resuspended in a buffer solution TE Tris HCl 10 mM pH 8 EDTA 1 mM pH 8 and stored at 20 C DIVERSIDAD GEN TICA DEL TIZ N TARD O DE LA PAPA Phytophthora infestans Mont de Bary EN CHAPINGO M XICO la mezcla se agit 15 s por inversi n se centrifug 12 min a 17 900 x
22. enzima Eco RI productos 209 394 750 y 800 pb M marcador de peso molecular 100 pb Fermentas Ca rriles de 1 a 24 los 24 distintos genotipos carril 25 a 29 repeti ci n de los genotipos 1 al 5 Geles de agarosa 2 Figure 4 A Amplification of product P4 mitochondrial DNA 964 bp COX M molecular weight marker 1Kb Fermentas Lane 1 24 are the different genotypes B Digestion of the fragment P4 by the enzyme Eco RI products 209 394 750 and 800 bp M molecular weight marker 100 bp Fermentas Lanes 1 to 24 24 different genotypes lane 25 and 29 repetition of geno DIVERSIDAD GEN TICA DEL TIZ N TARD O DE LA PAPA Phytophthora infestans Mont de Bary EN CHAPINGO M XICO Banda 209 pb la Ib Ila IIb types 1 through 5 Agarose gels 2 con el linaje EC 1 Silva et al 2009 Sin embargo aqu se present tanto para los tipos Al A2 como para homot licos A1 A2 con distintos genotipos aloenzim ticos Hay tres factores que favorecen y explican la gran diversidad gen tica de P infestans en el altiplano central mexicano 1 la presencia de grupos de com patibilidad sexual del microrganismo que favorece el intercambio gen tico Gr nwald er al 2001 2 la abundancia de especies silvestres del hospedante natural del oomiceto el g nero Solanum principal mente desde la sierra tarasca en Michoac n hasta los altos de San Crist bal de las Casas en Chia pas donde el hospedero y el pat geno co
23. g el sobrenadante se transfiri a un tubo limpio y se adicion ARNsa 10 ug mL Despu s se incubaron 1 h a 37 C se adicionaron 400 uL de isopropanol incub ndose 20 min a 20 C se centrifug 12 min a 15 700 xg el sobrenadante se decant y el sedimento se lav con 500 uL de etanol a 70 96 v v se volvi a centrifugar eliminando el sobrenadante y el precipitado se sec a temperatura ambiente Se resuspendi en soluci n amortiguadora TE Tris HCl 10 mM pH 8 EDTA 1 mM pH 8 y se guard a 20 C El segundo m todo fue el propuesto por Goodwin ef al 1992 El micelio se macer con 900 uL de amortiguador de extracci n EDTA 0 5 M Tris 1 M pH 8 NaCl 1 4 M SDS 20 y B mercaptoetanol Despu s de incubar 1 h a 65 C se adicionaron 450 uL de acetato de amonio 7 5 M y la mezcla se mantuvo 20 min en hielo Se centrifug 10 min a 12 300 xg el sobrenadante se transfiri y se incorporaron 800 uL de isopro panol para precipitar en hielo por 30 min se centrifug 5 min a la misma velocidad se decant el isopropanol y el precipitado se lav con etanol a 70 96 v v y la pastilla se sec invirtiendo el tubo a temperatura ambiente El precipitado se resuspendi con 450 uL de amortiguador TE Tris 10 mM pH 8 EDTA 0 5 M y luL de ARNsa A y repos toda la noche a 4 C Al otro d a se adicionaron 450 uL de la mezcla de cloroformo alcohol isoa m lico 24 1 Se centrifug 5 min a 17 900 xg el sobrenadante se precipit
24. gel 2 96 A 2 3 456728 9 10 Hl 12 I3 14 I5 16 17 18 19 20 21 2223 24 M bs Banda 79 147 203 la v Ib Ila IIb 1000 pb PA 750 pb DI 500 pb BM 2 37475 678 9101 12 1 HAMAS 192042180223 224981 600 pb 500 pb 400 pb 300 pb 200 pb Figura 2 A Amplificaci n del producto P2 DNA mitocondrial 1070 pb M marcador de peso molecular 1Kb Fermentas B Di gesti n del fragmento P2 por la enzima Msp 1 productos 203 y 641 pb M marcador de peso molecular 100 pb Fermentas En ambos casos 1 a 24 son los distintos genotipos Geles de agarosa 2 Figure 2 A Amplification of product P2 mitochondrial DNA 1070 bp M molecular weight marker 1Kb Fermentas B Di gestion of fragment P2 by enzyme Msp 1 products 203 and 641 bp M molecular weight marker 100 bp Fermentas In both cases 1 to 24 are the various genotypes Agarose gel 2 ALARC N RODR GUEZ et al 603 AGROCIENCIA 16 de agosto 30 de septiembre 2013 corrimiento en un gel de poliacrilamida al 8 en el que no se obtuvo dicha banda este gel no se presenta en los resultados La amplificaci n del producto de P3 F3 R3 tambi n fue monom rfica en todas las muestras El tama o del producto amplificado fue 1308 pb Figura 3A Para su digesti n se utiliz la enzima Eco RI y se obtuvieron bandas de 230 pb y 1078 pb Figura 3B las cuales se asociaron a los haplotipos la o Ib Por ltimo la amplificaci n del fragmento P4 F4 R4 f
25. h band was not obtained this gel is not presented in the results The amplification of product of P3 F3 R3 was also monomorphic in all samples The size of the amplified product was 1308 bp Figure 3A For its digestion the enzyme Eco RI was used and bands 230 bp and 1078 bp Figure 3B were obtained which were associated with haplotypes Ia or Ib Finally amplification of the fragment P4 F4 R4 was 964 bp Figure 4A Enzyme Eco RI was used for the digestion from which resulted four fragments of 209 bp 394 bp 750 bp and DIVERSIDAD GEN TICA DEL TIZ N TARD O DE LA PAPA Phytophthora infestans Mont de Bary EN CHAPINGO M XICO A IA CITA SALOU AA 15 16 17 1819 Banda 211 pb Haplotipo 1000 pb la 750 pb Ib Ila IIb B 345678 910111314 15 16 17 18 19 1000 pb f o DD o D noo 750 pb EZ 500 pb 250 pb Figura 1 A Amplificaci n del producto P1 DNA mitocondrial 1118 pb B Digesti n del fragmento P1 por la enzima Hha I pro ductos 211 pb y 907 pb En ambos casos M marcador de peso molecular 1Kb Fermentas 1 a 24 son los distintos genotipos y carril 25 repetici n del genotipo 24 Geles de agarosa al 2 Figure 1 A Amplification of the product P1 mitochondrial DNA 1118 bp B Digestion of fragment P1 by the enzyme Hha I pro ducts 211 bp and 907 bp In both cases M molecular weight marker 1Kb Fermentas 1 to 24 are the various genotypes and lane 25 repetition of genotype 24 Agarose
26. habitan y coevolucionan simult neamente Spooner et al 2004 3 el clima ideal de gran altitud m s de 1500 m con temperaturas entre 10 y 20 C y abundantes y confiables lluvias en el verano con humedad re lativa superior al 90 96 ideal para el desarrollo del tiz n Krause et al 1975 Spooner er al 2004 3 ideal climate of high altitude over 1500 m with temperatures between 10 and 20 C and abundant and reliable rainfall in the summer with relative humidity above 90 906 is ideal for blight development Krause et al 1975 Variability found in the pathogen population in Chapingo was predictable but this diversity has not been quantified This new knowledge can be used to design strategies for management and control in the region if in future studies variability of the pathogen is associated with its resistance to fungicides In addition there was a need to establish broader and inclusive classification criteria which may locate different genotypes detected in this study and homothallic isolates due to the fact that current systems U S for the U S EC to Ecuador CA for Canada do not incorporate them because they do not have them in their geographical places or countries where such systems were designed ALARC N RODR GUEZ et al 605 AGROCIENCIA 16 de agosto 30 de septiembre 2013 La variabilidad encontrada en la poblaci n del pat geno en Chapingo era predecible pero esta di versidad no se hab a
27. haw 1998 Gomez Alpizar et al 2007 Prakob and Jaimasit 2010 Phytophthora infestans is a heterothallic organism because requires the mating types Al and A2 for sexual reproduction The mating group Al was dispersed around the world since the Irish famine of the mid nineteenth century and type A2 was identified in M xico in the fifties where it remained limited for several decades In 1981 it was found in Europe Middle East and South America increasing its importance due to its rapid dispersion and high virulence adapting itself to new environmental conditions and hosts Spielman et al 1991 Goodwin et al 1995a Gil christ et al 2009 In M xico all mitochondrial haplotypes have been identified Fern ndez et al 2005 Gr nwald er al 2001 and Garay et al 2007 found the haplotype 1b in Tlaxcala The largest world genotypical diversity is found in the central Mexican highlands considered as the place of origin of P infestans Gr nwald e 4L 2001 Gr nwald and Flier 2005 being the Chapingo area on the west of the lake of Texcoco the second center of oomicete diversity after the Toluca Valley Goodwin 1996 This diversity has been evaluated with allozymes restriction fragment length polymorphism RFLP and the mating types as well as by biochemical and molecular methods Goodwin 1996 The use of these methodologies led to determine that populations of P infestans are sub structured from clonal lineages ofte
28. ld wide migration and population displacement of Phytophthora infestans Plant Pathol 40 422 430 Spooner D M R G van den Berg A Rodr guez J Bamberg R J Hijmans and S I Lara Cabrera 2004 Wild Potatoes Solanum Section Petota Solanaceae of North and Central America The American Society of Plant Taxonomists Systematic Botany Monographs 68 209 Wangsomboondee T C T Groves P B Shoemaker M A Cubeta and J B Ristaino 2002 Phytophthora infestans populations from tomato and potato in North Carolina differ in genetic diversity and structure Phytopathology 92 1189 1195 ALARC N RODR GUEZ et al 607
29. n BSA 160 ug mL 5 buffer PCRIx Go Taq DNA polymerase 1U Promega DNA 20 ng in a final volume of 25 mL the PCR program was one cycle at 94 C for 1 5 min followed by 35 cycles of 94 C 40 s 55 C 60 s 72 C 90 s with a final extension at 72 C for 5 min Applied Biosystems 9700 Amplicons were visualized on 1 2 96 agarose gels p v run buffer Tris HCl acetic acid EDTA TAE at 90 V for 90 min stained with ethidium bromide For digestion of each amplified 4 uL of the PCR product were taken as directed by the company Promega P1 products were digested with Cfol Promega for 1 h P2 fragment with MspI Promega for 16 h and the fragments obtained from P3 and P4 with EcoRI Promega for 1 h Then they were visualized on 1 8 96 agarose gels w v in electrophoresis with run buffer Tris borate EDTA TBE at 50 V for 90 min Images were ALARC N RODR GUEZ et al 597 AGROCIENCIA 16 de agosto 30 de septiembre 2013 Los amplicones se visualizaron en geles de agarosa a 1 2 p v amortiguador de corrida Tris HCl cido ac tico EDTA TAE a 90 V por 90 min te idos con bromuro de etidio Para la diges ti n de cada amplificado se tomaron 4 uL del producto de PCR seg n las indicaciones de la empresa Promega Los productos de Pl se digirieron con Cfol Promega por 1 h el fragmento P2 con MspI Promega por 16 h y los fragmentos obtenidos de P3 y P4 con EcoRI Promega por 1 h Despu s se visualizaron en geles de agarosa a 1 8
30. n referred to by the initials of the country where they were identified and by a numerical suffix representing lineages derived from the original For example it is considered that isolates participating in the first mass DIVERSIDAD GEN TICA DEL TIZ N TARD O DE LA PAPA Phytophthora infestans Mont de Bary EN CHAPINGO M XICO bioqu micos y moleculares Goodwin 1996 El em pleo de estas metodolog as llev a determinar que las poblaciones de P infestans est n subestructuradas a partir de linajes clonales frecuentemente denomina dos por las iniciales del pa s donde se identificaron y por un sufijo num rico que representa linajes deri vados del original Por ejemplo se considera que los aislamientos que participaron en la primera migra ci n masiva de P infestans de M xico hacia Europa y EE UU pertenecen al linaje US 1 mientras que aquellos reportados en Ecuador se denominan EC 1 EC 2 y EC 3 Adler ef al 2004 Debido a la relevancia del pat geno y a la necesi dad de relacionar criterios de clasificaci n el objetivo de esta investigaci n fue determinar la variabilidad gen tica de P infestans en poblaciones obtenidas de clones de papa en Chapingo M xico al oriente del lago Texcoco y al pie del cerro Tl loc y establecer su posible relaci n con clasificaciones existentes MATERIALES Y M TODOS Aislamiento del pat geno Durante los ciclos de cultivo de temporal de 2008 2009 y 2010 se recolectaron aislamient
31. nfestans in Central Mexico Plant Dis 91 909 Gavino P D and W E Fry 2002 Diversity in and evidence for selection on the mitochondrial genome of Phytophthora infestans Mycologia 94 781 793 Gilchrist R E V S Jaramillo K L A Afanador and I R E Arango 2009 Characterization of Phytothora infestans populations in Antioquia Colombia Rev Fac Nal Agr Medell n 62 5031 5037 G mez Alpizar L I Carbone and J B Ristaino 2007 An Andean origin of Phytophthora infestans inferred from mitochondrial and nuclear gene genealogies PNAS 104 3306 3311 Goodwin S B 1996 Origin and ecology of Phytophthora infestans Rev Mex Fitopatol 14 143 147 Goodwin S B 1997 The population genetics of Phytophthora Phytopathology 87 462 473 Goodwin S B L J Spielman J M Matuszak S N Bergeron and W E Fry 1992 Clonal diversity and genetic differentiation of Phytophthora infestans populations in northern and central M xico Phytopathology 84 1224 1227 Goodwin S B L S Sujkowski and W E Fry 1995a Rapid evolution of pathogenicity within clonal lineages of potato late blight disease fungus Phytopathology 85 669 676 Goodwin S B L S Sujkowski A T Dyer B A Fry and W E Fry 1995b Direct detection of gene flow and probable sexual reproduction of Phytophthora infestans in North America Phytopathology 85 473 479 Goodwin S B C D Smart R W Sandrock K L Deahl Z K Pu
32. nfestans population in potato crops from Chiang Mai and Tak Provinces J Agric Technol 1 117 125 Krause R A L B Massie and R A Hyre 1975 Blightcast A computerized forecast of potato late blight Plant Dis Rep 59 95 98 Lozoya S H G L Guzm n P S Fern ndez N J Gr nwald and E McElhinny 2005 Phytophthora infestans Mont de Bary I Host Pathogen specificity and resistance components Agrociencia 40 205 217 Lozoya S H D Perales Rosas S P Fern ndez Pav a and N J Gr nwald 2006 Characterization of Phytophthora infestans Mont de Bary II Subpopulations obtained from wild Solanum species Agrociencia 40 325 333 Matuszak J M E J Fernandez M Villareal G and W E Fry 1994 Sensitivity of Phytophthora infestans populations to metalaxyl in Mexico Distributions and dynamics Plant Dis 78 911 916 Moreno E C 2001 M todos para Medir la Biodiversidad M amp T Manuales y Tesis SFA vol 1 Zaragoza Espa a 84 p P rez W y G Forbes 2008 Manual t cnico El Tiz n tard o de la papa CIP Lima Per 39 p Silva B S Jaramillo y M Marin 2009 Caracterizaci n gen tica de aislamientos de Phytophthora infestans en las zonas productoras de papa de los departamentos de Antioqu a Boyac Cundinamarca y norte de Santander Colombia Actual Biol 31 5 20 Spielman L J A Drenth L C Davidse L J Sujkowski W Gu P W Tooley and W E Fry 1991 A second wor
33. nja and W E Fry 1998 Genetic change within populations of Phytophthora infestans in the United States and Canada during 1994 to 1996 Role of migration and recombination Phytopathology 88 939 949 Griffith G W and D S Shaw 1998 Polymorphisms in Phytophthora infestans four mitochondrial haplotypes are detected after PCR amplification of DNA from pure cultures or from host lesions Appl Environm Microbiol 64 4007 4014 Gr nwald N J and W G Flier 2005 The biology of Phytophthora infestans at its center of origin Ann Rev Phytopathol 43 171 190 Gr nwald N J W G Flier A K Sturbaum S E Garay T B M Van den Bosch C D Smart J M Matuszak H DIVERSIDAD GEN TICA DEL TIZ N TARD O DE LA PAPA Phytophthora infestans Mont de Bary EN CHAPINGO M XICO Lozoya L J Turkensteen and W E Fry 2001 Population structure of Phytophthora infestans in the Toluca Valley Region of central Mexico Phytopathology 91 882 890 Hebert P D and J M Beaton 1993 Methodologies for alloenzyme analysis using cellulose acetate electrophoresis A practical handbook Helena Laboratories Guelph Ontario 32 p Hern ndez G K eI G G mez 2005 Aplicaci n de marcadores bioqu micos y moleculares en el estudio de poblaciones de Phytophthora infestans Mont de Bary causante del tiz n tard o en papa y tomate Fitosanidad 9 39 50 Jaimasit P and W Prakob 2010 Characterization of Phytophthora i
34. os de P infestans al azar de lesiones simples j venes de hojas y tallos de lotes de 2500 genotipos pertenecientes a 100 clones de cada una de 25 fa milias de diversos progenitores cada a o 7500 clones de 75 familias por los tres a os del Departamento de Agricultura de EE UU USDA y de la variedad Alfa como testigo suscepti ble y fuente de in culo sin fase fenol gica espec fica tomando el tejido con la lesi n una vez que sta aparec a por la infec ci n natural del pat geno en el campo agr cola experimental de la Universidad Aut noma Chapingo UACh Municipio de Texcoco Estado de M xico M xico a 2240 m de altitud clima templado con temperatura media anual de 15 9 C y una precipitaci n pluvial superior a los 500 mm de junio a septiembre http www bvsde ops oms org bvsaar e proyec to generales casos texcoco html Los tejidos enfermos se co locaron sobre rodajas de papa sana var Alpha desinfestada con hipoclorito de sodio al 2 en agua v v en cajas petri 10 cm de di metro para permitir el crecimiento de micelio a tra v s del tejido a temperatura ambiente Al tercer d a se observ el crecimiento de micelio al microscopio y se confirm la pre sencia del pat geno mediante observaciones morfol gicas en preparaciones fijas El micelio purificado se transfiri a medio s lido agar centeno y se incub a 21 C para su caracterizaci n Gr nwald et al 2001 migration of P infestans from M xico
35. s mitocondriales Fern ndez et al 2005 Gr nwald et al 2001 y Garay et al 2007 encontraron el haplotipo lb en Tlaxcala La mayor diversidad genot pica mundial se encuentra en el altiplano central mexicano con siderado el lugar de origen de P infestans Gr nwald et al 2001 Gr nwald y Flier 2005 y el rea de Chapingo al oriente del lago de Texcoco es el se gundo centro de diversidad del oomiceto despu s del valle de Toluca Goodwin 1996 Esta diversi dad se ha evaluado con aloenzimas polimorfismo de fragmentos largos de restricci n RFLP y los ti pos de compatibilidad as como mediante m todos 594 VOLUMEN 47 N MERO 6 food security by causing late blight potato disease responsible for famine in Ireland in the 19 century It causes blight on leaves stems petioles and tubers leading to necrosis and death P rez and Forbes 2008 for this reason P infestants is one of the most studied organisms in breeding physiology and infectious processes It is necessary to know the genetic diversity of populations in infected regions because it is related to the effectiveness and efficiency of management methods Among the methods to characterize its diversity are phenotypic and genotypic markers and the most used are allozyme patterns of glucose phosphate isomerase Gpi and peptidase Pep mating type or compatibility AL A2 the probe RG57 and evaluation of mitochondrial DNA mtDNA haplotypes Griffith and S
36. thora infestans accessions Bull USAMV CN 63 127 132 Fern ndez P S P A G Rodr guez D C R Belmar A K Sturbaum W Flier y H Lozoya S 2005 Caracterizaci n de Aislamientos de Phytopthora infestans Mont de Bary provenientes de Michoac n M xico Rev Mex Fitopatol 23 191 197 Flier W G N J Gr nwald L P N Kroon A K Sturbaum T B M van den Bosh E Garay H Lozoya W E Fry and L J Turkensteen 2003 The population structure of Phytophthora infestans from the Toluca Valley of Central Mexico suggests genetics differentiation between populations from cultivated potato and wild Solanum spp Phytopathology 93 382 390 Forbes G S B Goodwin A Drenth P Oyarzun M E Ordofiez and W E Fry 1998 A global marker database for Phytophthora infestans Plant Dis 82 811 817 Garay S E P S Fern ndez A G Rodr guez W G Flier H Lozoya S R I Rojas M E M Goss and N J Gr nwald 606 VOLUMEN 47 N MERO 6 CONCLUSIONS The population of Phytophthora infestans collected in this study revealed high genetic diversity in the Chapingo area M xico 1 8 index corresponding to 24 genotypes of allozymes with mitochondrial haplotype Ia and high frequency of homothallism Most profiles identified do not coincide with the classifications established for other countries End of the English version M 2007 First report of haplotipe I b of Phytophthora i
37. tion Better results were obtained with the method described by Griffith and Shaw 1998 because it was extracted from 140 to 400 ng 4L 5 with a quality of 1 7 to 1 9 Abs 260 280 Less DNA was extracted 11 to 200 ng uL with the method of Goodwin et al 1992 and quality ranged from 1 4 to 1 8 Abs 260 280 Also there were better amplicons with DNA obtained with the first method whereby in subsequent studies it was used the method of Griffith and Shaw 1998 Mitochondrial haplotypes For Pl primers a monomorphic amplification for all samples was obtained and the result was a fragment of 1118 pb Figure 1A For the digestion of the product of P1 enzyme Hha I was used The size of the fragments was 211bp and 907 pb Figure 1B These fragments were similar to those reported by Griffith and Shaw 1998 associated with haplotype la or Ib There were two bands for primers P2 F2 R2 one clearly defined of 1070 bp and other of short intense of 750 bp Figure 2A Digestion of the fragment 1070 bp was performed using the restriction enzyme Msp I and fragments 203 and 641 bp were obtained Fig 2B which indicated a relation with haplotype Ia Griffith and Shaw 1998 Botez et al 2007 To achieve a better resolution of digestion fragments and verify that band 79 bp mentioned by Griffith and Shaw 1998 as absent for this haplotype was not present an electrophoresis running was carried out on 8 96 polyacrylamide gel in which suc
38. tions of the pathogen Table 2 because both the U S classification system U S as other systems integrate only heterothallic genotypes and although there are homothallics in the central region of M xico in Michoac n and Saltillo they have been mentioned for Poland and the Netherlands during the 1980s and 1990s Gavino and Fry 2002 Fernandez er al 2005 but not including isolates found in the present study Gpi Pep and mating type patterns were analysed by the Simple Matching coefficient SM or simple matches in the NTSYS 2 2 program which allowed the association of 24 groups genotypes from 88 isolates studied Table 2 ALARC N RODR GUEZ et al 601 AGROCIENCIA 16 de agosto 30 de septiembre 2013 y aunque hay homot licos en la regi n central de M xico en Michoac n y en Saltillo se han mencio nado para Polonia y Holanda durante la d cada de 1980 y 1990 Gavino y Fry 2002 Fern ndez et al 2005 pero sin incluir a los aislamientos encontra dos en el presente estudio Los patrones de Gpi Pep y grupos de compati bilidad se analizaron mediante el coeficiente Simple Matching SM o coincidencias simples en el pro grama NTSYS 2 2 el cual permiti la asociaci n de 24 grupos genotipos a partir de los 88 aislamientos estudiados Cuadro 2 Haplotipos mitocondriales Extracci n de ADN Resultados mejores se obtuvieron con el m todo descrito por Griffith y Shaw 1998 porque se extrajo 140 hasta
39. to Europe and the U S belong to the lineage US 1 whereas those reported in Ecuador are called EC 1 EC 2 and EC 3 Adler et al 2004 Due to the relevance of the pathogen and the need to relate classification criteria the objective of this research was to determine the genetic variability of P infestans populations from potato clones obtained in Chapingo Mexico east of Lake Texcoco and at the Tlaloc foothill and establish its possible relationship with existing classifications MATERIALS AND METHODS Pathogen isolation During the rainfed crops 2008 2009 and 2010 isolates of P infestans were randomly collected from young single lesions of leaves and stems from 2500 potato genotypes belonging to 100 clones each of 25 families from different parents each year 7500 clones of 75 families for three years from several breeding programs from the U S Department of agriculture USDA and of the Alpha variety as susceptible control and inoculum source without specific phenological phase taking the tissue with lesion once it appeared by natural infection of the pathogen at the experimental agricultural station of Chapingo University UACh Municipality of Texcoco Estado de Mexico Mexico at 2240 masl temperate climate with average annual temperature of 15 9 C and rainfall over 500 mm from June to September http www bvsde ops oms org bvsaar e proyecto generales casos texcoco html Disease tissues were placed on healthy potato
40. total population by the Simple Matching coefficient SM or simple matches in the program NTSYS 2 2 RESULTS AND DISCUSSION Pathogen isolation In the three years of collection 88 isolates were selected Table 1 and they showed morphological characteristics typical of the species such as coenocytic mycelium sporangium morphology evolution of the antheridium and oogonium to form the oospore and differences of pen and whip oospores flagella P rez and Forbes 2008 Jaimasit and Prakob 2010 In tests performed in the cycle 2008 there were no differences between isolates of leaf and stem therefore in subsequent field growing cycles only isolates of foliage were obtained Mating type Two mating types were presented with a frequency of 0 125 Al and 0 114 A2 keeping the ratio of 1 1 although homothallic strains A1 A2 predominated with a frequency of 0 761 In Cuadro 1 Aislamientos seleccionados de Phytophthora infestans obtenidos de los clones de papa del Programa de Mejoramiento Gen tico del USDA en el campo agr cola experimental de la Universidad Aut no ma Chapingo M xico Table 1 Phytophthora infestans selected isolates obtained from potato clones of the USDA Breeding Program at the agricultural experimental station of Universidad Aut noma Chapingo M xico A o Muestra N mero de aislamientos 2008 Tallo 6 2008 Hoja 26 2009 Hoja 40 2010 Hoja 16 Total 88 598 VOLUMEN 47 N MERO 6 DIVERSIDA
41. ty Goodwin 1997 The cause of the abundance of homothallic isolates in Chapingo is unknown but it is possible that the lesions were taken from the pathogen resistant plants These plants are not easily infected by wild variants of P infestans The infectivity is reduced to a section of the pathogen population that is highly aggressive characteristic of homothallic strains Also the absence of wild hosts did not favor oomycete heterogeneity Lozoya et al 2006 Another possible selection pressure towards homothallic prevalence could be the simple early lesions that were taken that is at the beginning of the cycle with no opportunity to genetic exchange with other common variants in advanced epidemics with multiple foliar lesions Greater diversity has been reported if there are two or more lesions on a leaf Flier ez al 2003 Allozyme patterns The genotypes obtained were described in terms of relative mobility of the bands on an electric field where the most common allele is the one that presents mobility of 100 Hern ndez and G mez 2005 In the present study a large amount of allozyme genotypes in the isolates was observed identifying alleles 92 100 and 122 for peptidase Pep and 86 90 100 111 and 122 for glucose phosphate isomerase Gp The most frequent genotype showed bands 100 100 Pep and 86 100 for Gpi By considering the type of mating with the allozyme alleles reported 24 multilocus genotypes were identifie
42. ue 964 pb Figura 4A La enzima Eco RI se us para la digesti n de la cual resultaron cuatro fragmentos de 209 pb 394 pb 750 pb y 800 pb Figura 4 B el primero es caracter stico del haplo tipo Ia De acuerdo con los patrones de restricci n de los cuatro fragmentos el haplotipo se identific como Ia ya reportado para el centro de M xico Gavino y Fry 2002 Flier e al 2003 Este haplotipo est rela cionado con el linaje EC 3 y el tipo de apareamiento Al y A2 Adler et al 2004 Gavino y Fry 2002 y 800 bp Figure 4B the former being characteristic of haplotype Ia According to the restriction patterns of the four fragments the haplotype was identified as Ia as reported for central M xico Gavino and Fry 2002 Flier et al 2003 This haplotype is associated with lineage EC 3 and the mating type Al and A2 Adler er al 2004 Gavino and Fry 2002 and lineage EC 1 Silva et al 2009 However it is present here for both types Al A2 and for homothallic A1 A2 with various allozyme genotypes There are three factors that promote and explain the great genetic diversity of P infestans in the Mexican central highlands 1 the presence of sexual mating types of the microorganism which favors genetic exchange Grunwald e al 2001 2 abundance of wild species of the natural host of the oomycete the genus Solanum mainly from the Tarascan hills in Michoac n to the heights of San Crist bal de las Casas in Chi
Download Pdf Manuals
Related Search
Related Contents
Hercules 256052 Use and Care Manual TAG SV-2003-X2 User's Manual GE ZSC1000 User's Manual ナンバー123 2月1日発行 [PDFファイル/439KB] Samsung Samsung Keystone 2 3.2 Accessing to Profile Management MPIE Website User Manual - Michigan Professional Insurance Copyright © All rights reserved.
Failed to retrieve file