Home

カイコ冬虫夏草による マウス脳機能改善効果に関する研究 2010.3 岩

image

Contents

1. AD
2. 1 AD Chen et al 2008
3. P tenuipes
4. 59 in vitro in vivo IM gt 21 DF CROAT IDI
5. 2008 REDA bu 38 WHS C amp S IV Z 2 u i yo EE P tenuipes PTE D gal 1 PTE id
6. Paecilomyces tenuipes OA abe aE el PTE D galactose
7. CERDD ARS AD QOL 60 2006 Modern Physician 26 2877 1881 Bok J W Lermer L Chilton J Klingeman H G and Neil Towers G H 1999 Antitumor sterols from the mycelia of Cordyceps sinensis Phytochemistry 51 891 898 Buffo A Rite L Tripathi P Lapier A Colak D Horn A P Mori T and G tz M 2008 Origin and progeny of reactive gliosis A source of multipotent cells in the injured brain Proc Natl Acad Sci USA 105 3851 3586 Chen H S Pellegrini J W Aggarwal S K Lei S Z Warach S Jensen F E and Lipton S A 1992 Open channel block of N methyl D aspartate NMDA responses by memantine therapeutic advantage against NMDA receptor mediated neurotoxi
8. OLYMPUS BH 2 X 4 X 20 44 IL X 1 RT PCR ChAT NC AC PTE ChAT Total RNA ZAER cDNA Forward Reverse RT PCR Fig 14 NC ChAT D gal NC ChAT AC PTE x 25 mg kg day 2
9. PTE 2 PTE x 25 mg kg day AC Iu PTE x 5 mg kg day AC AC 1 PTE x 5 mg kg day PTE x 25 mg kg day
10. 1999 100g 65 0 g BREROO T SEIS 40D 7 Y7EBICLOFIEB IAAL BRA 2008 PE T
11. Zeisel et al 1981 Coyle et al 1983 AR H 2007 In vivo
12. 2 3 E 6 000 2010 1926 2 500 2 000 2010 3 000 0 Bombyx mor Apis mellifera 2010 Gan et al 2006 Wahrendorf and Wink 2006 Pe h ERIC BH 3E Laccifer lacca
13. 2010 PTE 65 7 PTE Table 2 B K ESR 4 8X 10 unit g Wei et al 2005 Lu et al 2006 Ji et al 2009
14. Ji ez al 2009 C sinensis D lia RER CSE Ji et al 2009 PTE CA3 PTE CA3 Miller and O Callaghan 2005
15. A WHO COR 509 AD 0 20 she TIT TU cR JIuZ1 AD En ER 50 10 2008 AD D BEAT IS F 2006 3 8 aA AWE ER PTS 2 400 3096231 1 Hii rf f AD 54 J PES HE BPR IE F 20 200
16. HE NC Fig 15A AC Fig 15C PTE x 5 mg kg day Fig 15E PTE x 25 mg kg day Fig 15G CA3 Fig 15D PTE x 5 mg kg day CA3 Hig 15F PTE x 25 mg kg day NC CA3 45 Hig 15H B CA3 D gal COR PTE
17. 1 1 4 1 60 60 9 60 Crossing 4 DS RAA UA COWES 1 1 6 E JMP 8 SAS Institue Inc ANOVA
18. Paecilomyces tenuipes Paecilomyces farinosus 4 H Wil WE ow BRAND RCH GBE 2008 He BOR EMIX MAEL L P tenuipes EK B
19. PTE x 5 mg kg day 72 Oz PTE x 25 mg kg day PTE 53 nis aging senescence 2009 1999 AD 5 800 1999 2005 6 AD
20. 2 60 RE 1 30 18
21. RK 58 40 1 5 1 CuI 2009 PTE E
22. 2 0 EQ 39 oof KR KS OW 5 F WS a diesque a ere LE Be ar ees rae SOR Sry NU s ele SS per Sis E we avus er esa levels eels 9 S Sipe 1 yaa REH ORUA HADAT oM da EIER n n 8 I IIIA RH I Xt 11 1 11 25 P 7ezg7pes PTE 11 ME Se CI 16 NARA SN EE 16 CR 3 9 EL AS Eee ETE 16 3 D gal 3 E LEAF VY IADR e 17 4 PTE 17 4 ee 18 EE EE EE EA 18 SDs ER EN ES EE 18 Cae ee eee ee ee i edd ples 19 OR i LT SS A a ae 19 2 20 6 scc Sabie Sp MSE we fat 9e ue Nh Sh OE I EE i 2 Se ui i 20 II ER SE EEE NE DEE EE
23. amp dvCv 54343908 B25 OF Ryu et al SA 2002 t FOW E m3 E i Pereira et al 2003 SMMC 7721 Hu et al 2005
24. Tritsh et al 2009 AD 2002 neurofibrillary tangle NFT AD NFT 1999 2009 T AD 50 D gal
25. 46 NC AC PTEx5 PIEx25 ChAT Renal p actin bep Fig 14 Expression of ChAT in mouse brain by RT PCR This figure shows comparison of differentiation of D gal treated mice fed with PTEX at different doses or vehicle B actin was used for housekeeping gene 47 NC AC PTExS PTEx25 Fig 15 Effect of PTE on hippocampal structures of mice aged mice by D galactose Left column hippocampal structures A C E G stained with HE stain Bars 40 pm Right column CA3 areas of the hippocampus B D F H stained by Holzer stain Bars 4 um Arrowheads show gliosis A8 I 4 B D gal n RT PCR ChAT RAS Fig 14 ChAT RT PCR NC PTE x 25 mg kg day PTE x 5 mg kg day AC AD
26. Modern Physician 28 1435 1437 62 EAN AA 2006 24 p 164 Ji D B Ye J Li C L Wang Y H Zhao J and Cai S Q 2009 Antiaging effect of Cordyceps sinensis extract Phytother Res 23 116 122 FLARE 2008 Modern Physician 28 1477 1484 Kim D K Kang Y K Lee M Y Lee K G Yeo J H Lee W B Kim Y S and Kim S S 2005 Neuoprotection and enhancement of learning and memory by BF 7 J Health Sci 51 317 324 1999 ABER pp 23 27 Y s tt h ERT ERE 2006 88 No 3 192 196 Koh J H Kim J M Chang U J and Suh H J 2003 Hypocholesterolemic effect of hot water extract from mycelia of Cordyceps sinensis Biol Pharm Bull 26 84 87 DAR AE 2007
27. PCR 6 DNA 100V 7 Lic Pk f UV 312 nm 2 1 1 1 43 4 PFA PBS pH 7 4 4C overnight HEL NC AC PTE HE HE
28. 2005 Cordyceps sinensis Berkelley Saccardo BRICE VOX E mni FAM ascomycetes Clavicipitaceae Cordyceps genus X3 H 1999 BRICBET SAR Cordyceps 500 f8 300 Hemiptera Lepidoptera Coleoptera HB Hymenoptera Orthoptera Odonata H Diptera v TER fruit body veg
29. P tenuipes PTE 80C ULT790 5A REVCO 11 Fig 1 Photographs of Paecilomyces tenuipes found in a mountain field A and artificial culture of P tenuipes with dried and dead pupae of the silkworm Bombyx mori as a host B These photographs were given by Tohaku Nosan Corporate Union Fukushima Japan 12 Table 1 The amino acid composition in Paecilomyces tenuipes Free aspartic acid 0 16 0 37 Total of amino acids 43 11 100 Content ratio cre ro0 Lys 6 63 Phe 49 Tyr 6 00 Len 608 ne 380 Val 189 Ala 501 Gly 96 Pro 16s Gh 10 97 Ser 138 Thr Ti Asp 10 88 Trp 146 Cys s 1 81 Free arginine 3 83 Free Tryptophan 0 02 016 O oen Each content was equivalent to one hundred g Except for Tryptophan other all are based on amino acid automated analysis Tryptophan was analyzed by the high speed liquid chromatograph method These data was given by Tohaku Nosan Corporate Union Fukushima Japan Japan Food Research Laboratories Foundation Analysis number 105030683 Analysis day April 15 2005 13 Table 2 Nutrition content in Paecilomyces tenuipes calorie protein lipid carbohydrate dietary fiber Na moisuture ash content P Fe Ca K Mg Cu Zn Mn Se I total Cr thiamin vitamin Bj riboflavin vitamin B
30. lt Hamburger 2007 2005 P tenuipes Cordyceps P tenuipes Beauvericin 4 ah 60 Zik DPPH TREO UE LH Ly 5 Ah KARE H HE a Cordyceps I ai lt 2008 LH O gt 8 4 DOPA E Sakakura et al 2005 2009 P tenuipes
31. pp 15 19 2010 EER pp 15 264 Miller D B and O Callaghan J P 2005 Aging stress and the hippocampus Ageing Res Rev 4 123 140 Miyazawa N Ohga S and Okazaki M 2008 Antihypertensive effect of pleurotus nebrodensis in spontaneously hypertensive rats J Oleo Sci 57 675 681 Morris R G M 1981 Spatial localization does not require the presence of local cues Learn Motiv 12 239 260 1989 pp 25 27 Nakamura T Matsugo S Uzuka Y Matsuo S and Kawagishi H 2004 Fractionation and anti tumor activity of the mycelia of liquid cultured Phellinus linteus Biosci Biotechnol Biochem 68 868 872 64 Nakazawa K Quirk M C Chitwood R A Watanabe M Yeckel M Sun L D Kato A Carr C A Johnston D Wilspn M A and Tonegawa S 2002 Requirement for hippocampal CA3 NMDA receptors in associative memory recall Science 297 211 218 Orgogozo J M Rigaud A S Stoffler A Mobius H J and Forette F 2002 Efficacy and safety of memantine in patients with mild to moderate vascular dementia a randomized placebo controlled trial MMM 300 Stroke 33 1834 1839 Ohgushi Y Sakamoto M and Azuma
32. NGF Shindo ez al 2006 GAP43 Wang ez al 2009 BDNF Shindo ez al 2006 3 E HE 4 Fig 15A C E G AC H 49 Fig 15D D gal AC PTE x 5 mg kg day PTE x 25 mg kg day O 3 0 Fig 15D F H PTE x 25 mg kg day gt NC Hig 15B H 1 000 2 000 10
33. PTE Fig 9 4 Fig 9 24 AC NC PTE x 25 mg kg day P 0 05 AC PTE x 5 mg kg day gt 0 05 3 Fig 10 1 4 7 PTE x 5mg kg day
34. Pig 9 Figs 10 12 D gal 8 D gal 100 mg kg day C57BL 6J Fig 12 4 f E F 36 Wei 5 2005 D gal 100 mg kg day 4 D gal OR FU m E C sinensis CSE D PTE OM FH
35. P lt 0 001 95 8 PTE x 5 mg7 kg day AC P 0 0535 Fig 1D 4 Fig 12 Fig 13 PTEx 5 mg kg day 2 P lt 0 05 4 lt 0 001 1 PTE x 25 mg kg day 2 P lt 0 01 4 lt 0 01 1 NC AC 1 26 30 r f o 20 NC b BA AC 2 amp PTE x 5 mg kg day 2
36. Buffo et al 2008 PTE 52 IV Z D gal PTE id Ach ChAT RTPCR NC PTE x 25 mg kg day PTE x 5 mg kg day AC ChAT PTE D gal RT PCR FB D gal AC CAS
37. Stackman et al 2003 AD mus Polygalae Radix ChAT Wang et al 2000 AD Ms mS 2006 55
38. NC ACH 1 PTE D gal 39 BE 2006 Cornu Ammmonis dentate gyrus hippocampal formation CA1 CA2 d
39. Modern Physician 28 1453 1456 2008 pp 2 5 Gan M Wan D Qin X and Gao P 2006 Pharmacological study on Samia cynthia riciniin old female mice J Ethnopharmacol 105 210 214 Gong G and Xu F 1991 Study of aging model in mice J China pharm Univ 24 101 108 Hamburger M 2007 Comment on comparison of protective effects between cultured Cordyceps militaris and natural Cordyceps sinensis against oxidative damage J Agric Food Chem 55 7213 7214 JEFF 2002 19 51 pp 13 17 Ho S Liu J and Wu R 2003 Establishment of the mimetic aging effect in mice caused by D galactose Biogerontology 4 15 18 Hu D Liu Q Cui H Wang H Han D and Xu H 2005 Effects of amino acid from selenium rich silkworm pupas on human hepatoma cell Life Sciences 77 2098 2110 2008
40. 5 25 mg kg day gt PTE E NC AC REZ c fe A i 17 4 1 X Tu t E bmi 100 X 130 mm E 42 X 130 mm 90mm 100 X 160mm 42 X 160mm mS 90mm MEOR 2 0mm 6 0 mm m U i 15 W
41. PTE e Eriksson ez al 1998 1996 Th NMDA NR1 CA1 NR1 CA1 KO 1 HL CAL Long term potentiation LTP CA1 place cell Tsien et al 1996 2002 ES E
42. pp 142 144 Kuo Y C Tsai W J Wang J Y Chang S C Lin C Y and Shiao M S 2001 Regulation of bronchoalveolar lavage fluids cell function by the immunomodulatory agents from Cordyceps sinensis Life Sciences 68 1067 1082 Li Q Zeng W Yin D and Huang T 1998 A preliminary study on alternation of generations of Cordyceps sinensis Berkey Sacc Zhongguo Zhong Yao Za Zhi 23 No 4 210 254 63 Li W Wei F Fan M Zhang J Zhang B Ma X Yang W and Wei W 1995 Mimetic brain aging effect induced by D galactose in mice Chinese J pharm Toxico 9 93 95 Lu J Zheng Y Luo L Wu D Sun D and Feng Y 2006 Quercetin reverses D galactose induced neurotoxicity in mouse brain Behav Brain Res 171 251 260 Ma K Liu F Wu X Zeng W and Chen S 2007 Hepialus armoricanus 32 No 16 1712 1714 McGaugh J L and Landfield P W 1970 Delayed development of amnesia following electroconvulsive shock Physiol Behav 5 1109 1113 1999 11 99 106 2009
43. 140C 5 min 1331 6 B D 06 22 5 RAE ERED RAV 093 B GRE ZA SKTE H 100 g B 4 5 g 4 Table 2 ated 2B E A H PTE Ach ChAT
44. 41 80 2 Total RNA RNA LA PCR Kit AMV Ver 1 1 Takara Bio Inc Tokyo Japan 500 ng Total RNA 2ul 5 mM MgCl 1ul 10XPCR Buffer lul RNase Free dHzO 2 75 ul 10 mM ANTP Mixture 1 ul RNase Inhibitor 1 U ul 0 25 ul AMV Reverse Transcriptase XL 0 25 U ul 0 5 ul 0 125 ul Oligo dT Adaptor Primer 0 5 ul PCR Zi 25 ul ze PCR 42 CC 30 99C 5 5C 5 3 PCR 2 5 pl 2 5 mM MgCl L5 ul 10XLA PCR Buffer II 2 ul RNase Free dHzO 18 38 ul TaKaRa LA Taq 12 5 U 50 ul 0 125 ul 0 2 uM 0 25 ul PCR 183 25 ul PCR 94C 2
45. C sinensis 400 1 CSE PTE Paterson 2008 Cordyceps KOWD ES E C sinensis fei E tenuipes OPK FAH F HD DS EMERS
46. 2006 S Cordyceps sinensis NI Paterson 2008 Ji 2009 C sinensis D galactose mug
47. Orgogozo et al 2002 Reisberg et al 2003 ChE Galanthus nivalis Thomsen et al 1990 Kim et al 1005 Shih et al 2009 wH E 2006 Ginkgo biloba HY mRNA AD 1 Watanabe et al 2001
48. CA3 PTE x 5 mg kg day PTE PTE x 25 mg kg day NC CA3 ad D gal RPLE LC 2006 Wei et al 2005 Lu et al Ji et al 2009 D gal CA3 PTE
49. D gal H amb Ach g all mRNA H RT PCR O PTE 1f Wang et al 2009 HE PTE PTE H HL ChAT ER BEEN Ey Rk ASE CA3
50. KO E D galactose F D gal 50 100 mg kg D gal 3 Wei et al 2005 D gal Ht 2000 E Coeloglossum viride var bracteatum Dan et al 2006 Lu et al 2006 C sinensis H HA E d 1 2010 HE Jietal 2009
51. 1607 12 KKH 1979 2006 FE Endoclita excrescens Butler 2004 Oo ils J gt US ROME SRR HE in RH e LUC O A DRE OR AM FI E ED Z2 EET Choi ez al 2004 4 E 6 Cordyceps Paterson 2008 Cordyceps militaris DIK Yamaguchi et al 2000 E Kuo etal 2001 zn vivo C
52. 6 3 iX 3 5 2008 QOL AD 1 TOUR v N A SO 7 E OPAM Be REA REESE SO RIDERS Rod PET 2008 AD Ach
53. D gal Ji et al 2009 PTE Tigs 9 11 and 13 PTEx5mg kg day 25 mg kg day PTE x D gal Lu et al 2006 PTE 5 mg kg day 25 mg kg day CSE CSE a H T 2 4 g kg day PTE 5 25 mg kg day
54. E E 2009 LA AD 75 GU E Quality of life QOL 2006 MK 801 KAD 2001 Vespa simillima Fujiwara et al 2007 Lik
55. D galactose 2010 GEA 2008 Ek C sinensis
56. P tenuipes RY gt JOEL Rita Bae
57. fil D gal 100 mg kg day 8 AC PTE 5 AC 56 PTE x 25 mg kg day i PTE PTE x 5 mg kg day PTE PTE D gal 1 E D gal E H LA Af u4m mg mot ARE MICS Miyazawa et al 2008
58. 20 Tukey Kramer test Dunnett s test lt 0 05 91 Pre acquisition trial 1 week before acquisition trial Groups 10 days Daily subcutataneous injection Received water 3d 9 days of saline 8 weeks 5 weeks S Step through test Daily subcutataneous injection of Received water D gal 8 weeks 5 weeks Daily subcutataneous injection of Received PTEx 5 D gal 8 weeks 5 weeks PT E X 5 mg kg day Conditioning Received PTEx 25 Daily subcutataneous injection of 5 weeks D gal 8 weeks N Gc E LJ G s E o gt z 9 9 PT E X 25 mg kg day Fig 2 Experimental schedule of behavioral studies performed by step through passive avoidance and Morris water maze tests Brains were promptly dissected and used for assay after the two behavioral studies Dark chambar Bright chamber Grid floor Fig 3 An equipment of passive avoidance test The apparatus was a trapezoidal light dark box consisting of a light chamber 100 x 130 mm at the top 42 x 130 mm at the bottom and the height is 90mm and a dark chamber 100 x 160 mm at the top 42 x 160 mm at the bottom and the height is 90mm The floor of both chambers
59. ChE Coyle et al 1983 AD GERE 2008 AD 54 E 2008 NMDA SLT 2009 SS NMDA Chen et al 1992 AD
60. 19 00 23 00 10 MEQ 2 N Di 2 20 ml 70 60C D gal Sigma FOR TRE Tv 100 mg kg 16 3 D gal
61. D gal A Gong et al 1991 Li et al 1995 Ho et al 2003 1 Droge 2003 Fa C9 D gal Wei ez al 2005 Lu et al 2006 Ji et al 2009 Fig 2 AC PTE x 5 mg kg day PTE x 25 mg kg day 3 100 mg kg D gal 8 NC 4 AF AARP PTE 8 4 D gal 2 PTE
62. 0 3 mA X 4 2 24 180 5 1 Fig 4 100 em HE 30cm 80 cm 20 cm 25 1 FAN 10cm 19 cm 1 cm 100 cm CCD 0 5
63. CA3 NMDA NR1 NR1 CA3 KO CA3 LTP Nakazawa et al 2002 CA1 NMDA CAS NMDA PEW 2008 CAI CA3 BRO NMDA PTE CSE C sinensis ih 51
64. 2010 v Vet BR H ICGEVSD SHEE VEU AC 3 MQ H Ab KI H 3A HD BER RE 65 7 0 Ohgushi 5 2009 B IHE 100C 6h
65. 94 30 50C 830 72C 1 30 27 B actin Br 42 ChAT Wang et al 2009 forward primer 5 GGTGGCCCAGAAGAGCAGTATC 3 reverse primer 5 ATTGGAGGCAGGCGTTCATC 3 p actin Shindo et al 2006 forward primer 5 CCTGTACGCCAACACAGTGC 3 reverse primer 5 ATACTCCTGCTTGCTGATCC 3 4 FHA PRB PCR PCR Wylde IL 6X 2 ud Xp 1 XTAE 40 mM Tris 40 mM 1 mM EDTA 2 1 XTAE
66. Y Ach Ach RIZR ETO Ach ChAT Wang ez al 2009 AD Ach AD A PCR RT PCR 27 PCR ff DIR 1998 PTE Xn
67. NIH The U S National Institute of Health NIH Image Image WMH 2 08 Image WM 2 12 19 mH 1 1 1 TOM 10cm x E 60 15 60 15 2 8 HE
68. e PTE x 25 mg kg day 10 gt o ea 0 65 85 105 125 145 Age day Fig 5 Mean body weight in four groups mice from 47 to 149 days of ages It was measured everyday Weight was not significantly different among four groups by ANOVA p lt 0 05 7 10 8 oO gt o E 6 N D 4 42 amp 8 o 2 k PTE x 5 mg kg day LL PTE x 25 mg kg day 0 47 65 85 105 125 147 Age day Fig 6 Mean daily food intake in four groups mice from 47 to 149 days of ages Consumption was measured every other day Food intake was not significantly different among four groups by ANOVA p lt 0 05 Consumption was measured every other day 28 20 9 NC 18 B AC 16 amp PTEX 5 14 E A P uL A E 10 a j i we V f L 2 2 8 KU ad M AN v is H E 2 S 4 v e a zi py mw Haz d Fus OC 2 0 js 65 85 105 125 145 Age day Fig 7 Mean daily drink intake in four groups mice from 47 to 149 days of ages Consumption was measured every other day Drink intake was not significantly different among four groups by ANOVA p 0 05 99 E AC g day mouse PTE x 5 mg kg day Excretion amourt 6 PTE x 25 mg kg day 47 54 58 62 68 74 81 89 96 103 110 Age day Fig 8 Mean daily excretion amount in four groups mice from 4
69. EE DR EE EE E E 25 1 KEK EREB EUH 2 AF VT AN HS FA A WE SE GR ee ee ee ee ee ee ee eee 25 3 Es ws lens 25 Il E 18 ce d e eel e s Vez a Vie v lenem cele E Ple aimless e s E Me ad Se Mariela e OD TL S pete 36 IV Sore eco ie a E IN RE Re mm SR Nee ee to US de ine SS sa Se eu sy owe fe eee 39 BoM AAAAHA AK Wie SARE LO ERR ee 40 I Nr ce re ule quiete SS TE Re Twice wes gr acrerte et wie Fe as 41 1 RT PCR 41 1 Total RNA 41 2 wu WE XE Guess Re ev mie v RE ee TS etre Sh 42 3 PCR Crete Tasch Sala Oho aL eoa eere ctore Sto PUE ee St eicere TE RT Ge RIDE a i ve 49 4 Baas E PGS E Spe TP 8 IRE 43 2 43 1 DI NE NE EE EE 8 43 II Se eue mie 9 1 9 um 79e ie e role xe Qin er So EN se IS E rim OM 9 8 e 9 62 6 eie mra a e 7o P 0 6 45 1 RT PCR OBAT 45 2 NE RN Tee locas RU Ehe Te a e varie E ESI ET 97 iere 45 Ill
70. Es disset Re m led ke ie oe er DE SURE eR Sis Se ore wel othe Qe A E E E Se er I pes e E 49 IV NS Re I EE RR I T A EE S E v 53 EE NE a a ENE BE EE EE EE TCS EE tee 54 5 FH 3C lik Vos xau Ner a rete ce CE te tet s te ete Cade eR yok rie QUIS Se aite oer al eia Ce eS Se ea ae 61 iii 3 4 5 E 100 8 3 000 Eam E c oo r6 548 FH 3 10 2004
71. J 2009 Effects of microwave irradiation on water soluble polysaccharides of the fruiting body of Hericium erinaceum J Appl Glycosci 56 153 157 2001 26 30 1998 46 183 188 Pardridge W M 1983 Brain metabolism a perspective from the blood brain barrier Physiol Rev 63 1481 1535 Paterson R R M 2008 Cordyceps A traditional Chinese medicine and another fungal therapeutic biofactory Phytochemistry 69 1469 1495 Pereira N R Ferraese Filiho O Matsushita M and de Souza N E 2003 Proximate composition and fatty acid profile of Bombyx mori L chrysalis toast J Food Composition and Analysis 16 451 457 Rao Y K Fang S H and Tzeng Y M 2007 Evaluation of the anti inflammatory and anti proliferation tumoral cells activities of Antrodia camphorate Cordyceps sinensis and Cinnamomum osmophloeum bark extracts J Ethnopharmacology 114 78 85 65 Reisberg B Doody R Stoffler A Schmitt F Ferris S and Mobius H J 2003 Memantine in moderate to severe Alzheimer s disease N En
72. Morus atropurpurea L on senescence accelerated mice and prevention of Alzheimer s disease J Nutritional Biochem Published online 1979 51 ABER p 97 ay 66 Shindo T Matsumoto Y Wang Q Kawai N Tamiya T and Nagano S 2006 Differences in the neuronal stem cells survival neuronal differentiation and neurological improvement after transplantation of neural stem cells between mild and severe experimental traumatic brain injury J medical Investigation 53 42 51 Stackman R W Eckenstein F Frei B Kulhanek D Nowlin J and Quinn J F 2003 Prevention of age related spatial memory deficits in a transgenic mouse model of Alzheimer s disease by chronic Ginkgo biloba Proc Natl Acad Sci USA 98 6577 6580 2005 In pp 3 12 2006 QOL RR BEN AT y 7 75 97 102 Thomsen T and Kewitz H 1990 Selective inhibition of human ace tylcholinesterase by galanthamine zn vitro and in
73. RTPCR LOE RATE LE CO Ach Wang 2009 ChAT bike Lic AD Ach ML Lic RTLPCR AC PTE x 25 mg kg day lt PTE ChAT SRL PCR PTE LOC PTE zm CA3
74. Reagent 4 ml 5 0 8 ml HEIL 25 C 3 12 000 xg 4C 25 RNA DNA 3 RNA WML 2 ml 25C 10 0 f H RNA 12 600 xg 4C 10 4 ml 70 RNA 12 600 X g 4C 10 100 ul DEPO 60 10 H Total RNA Nano Drop 1000 Thermo Fisher Scientific Inc USA OD Kk Total RNA
75. vivo Life Sci 46 1553 1558 Tritsch D Chesnoy Marchais D Feltz A 2009 pp 36 37 Tsien J Z Huerta P T and Tonegawa S 1996 The essential role of hippocampal CA1 NMDA receptor dependent synaptic plasticity in spatial memory Cel 87 1327 1338 2009 pp 281 291 2004 pp 22 171 Wahrendorf M S and Wink M 2006 Pharmacologically active natural products in the defence secretion of Palembus ocularis Tenebrionidae Coleoptera J Ethnopharmacol 106 51 56 67 Wang F Chen H and Sun X 2009 Age related spatial cognitive impairment is correlated woth a decrease in ChAT in the cerebral cortex hippocampus and forebrain of SAMP8 mice Neuroscience letters 454 212 217 Wang Q Iwasaki K Suzuki T Arai H Ikarashi Y Yabe T Toriizuka K Hanawa T Yamada H and Sasaki H 2000 Potentiation of brain acetylcholine neurons by Kami Untan To KUT in aged mice implications for a possible antidementia drug Phytomedicine 7 253 258 Watanabe C M H Wolffram S Ade
76. 5 All values are expressed as means SEM P 0 05 vs AC group 31 60 50 40 30 20 Latency to platform s 10 r 9 NOC H AC A PTE x 5 mg kg day 6 PTE x 25 mg kg day xK 1 2 3 4 5 6 7 Training session day Fig 10 Effect of PTE on latency in the time taken for mice aged by D galactose to reach the platform in the Morris water maze test All values are expressed as means ESEM P lt 0 001 vs AC group on the same training day 32 NC 6 HAC j PTE x 5 mg kg day D5 IPTE x 25 mg kg day O 4 o 3 o E 2 1 0 D gal mg kg day 100 100 100 PTE x mg kg day 5 25 Fig 11 Effect of PTE on number of crossings made by mice aged by D galactose in the Morris water maze test on day 8th All values are expressed as meanstSEM P 0 05 vs AC group 33 N c1 ENC DAC 20 mmPTE x 5 mg kg day F PTE x 25 mg kg day 15 co y B0 E E F 5 0 D gal mg kg day 100 100 100 PTE x mg kg day 5 25 Fig 12 Effect of PTE on swimming speed in the Morris water maze test day 8th of mice aged by D galactose All values means SEM 34 40 Target 1 s S me in zone Ti 7 2 3 4 7 2 3 4 7 2 3 4 7 2 3 4 AC PTE x 5 PTE x 25 D gal mg kg day 100 100 100 PTE x mg kg day 5 25 Fig 13 Effect of PTE on time spent in the target an
77. 8 Zhang Y Shoyama Y Sugiura M and Saito H 1994 Effects of Crocus sativus L on the ethanol induced impairment of passive avoidance performances in mice Biol Pharm Bull 17 217 221 68
78. 9 to 149 days of ages Elimination was measured every third days Excretion amount was not significantly different among four groups by ANOVA p 0 05 Elimination was measured every third day 30 350 r NC O 300 HAC 2 250 OPTE x 5 mg kg day 2 WPTE x 25 mg kg day c 200 D o 150 E 100 D 50 0 acquisition trial post shock trial D gal mg kg day 100 100 100 100 100 100 PTE x mg kg day gt 5 25 5 25 Fig 9 Effects of PTE in step through passive avoidance testing of mice with aging induced by D galactose Mice were divided into four groups NC the normal control group n 8 served as vehicle control with injection of saline 0 9 only and was given plain water without PTE AC the aging control group n 8 received daily subcutaneous injection of D galactose at 100 mg kg day for 8 weeks and was given plain water without PTE The group given a hot water extract of Paecilomyces tenuipes PTE at 5 mg kg day n 8 received daily subcutaneous injection of D galactose at 100 mg kg day for 8 weeks and received PTE at 5 mg kg day in plain water for 5 weeks after the subcutaneous injections The PTE x 25 mg kg day group n 8 received daily subcutaneous injection of D galactose at 100 mg kg day for 8 weeks and received PTE at 25 mg kg day in plain water for 5 weeks after the subcutaneous injections These groups also apply to Figs 10 11 12 18 14 and 1
79. AK HHH ATE CIE in vivo COM H h PTE D gal McGaugh and Landfield 1970 Zhang et al 1994 Morris 1981 2 10 I 1 P tenuipes Fig 1A Sat
80. Ach ChAT PTE JE I 1 RT PCR 1 Total RNA ofi Ach ChAT 50 mM pH 7 0075 PBS RNA atere Solution Applied Biosystems Inc 80C TRIzol Reagent Invitrogen Co California USA Total RNA 250 mg TRIzol
81. QE 2008 A EREE Peet CBSE 3 1 WE 2008 GFAP glia fibrillary acidic protein T II
82. city J Neurosci 12 4427 4436 Chen J Long Y Han M Wang T Chen Q and Wang R 2008 Water soluble derivative of propolis mitigates scopolamine induced learning and memory impairment in mice Pharmacology Biochemisyrt and behavior 90 441 446 Choi S B Park C H Choi M K Jun D W and Park S 2004 Improvement of insulin resistance and insulin secretion by water extracts of Cordyceps militaris Phellinus linteus and Paecilomyces tenuipes in 90 pancreatectomized rats Biosci Biotechnol Biochem 68 2257 2264 Coyle J T Price D L and DeLong M R 1983 Alzheimer s disease a disorder of cortical cholinergic innervation Science 219 1184 1190 Dan Z Gengtao L Jiangong S and Jianjun Z 2006 Coeloglossum viride var bracteatum extract attenuates D galactose and NaNOs induced memory impairment in mice J ethnopharmacology 104 250 256 Droge W 2003 Oxidative stress and aging Advances in experimental medicine and biology 548 191 200 61 Eriksson P S Perfilieva E Bjork Eriksson T Alborn A M Nordborg C Peterson D A and Gage F H 1998 Neurogenesis in the adult human hippocampus Nature Med 4 1313 1317 Fujiwara Y Kobayashi H Kawai S and Suzuki K 2007 The effect of Vespa simillima extracts on long term memory and MK 801 induced learning disability in mice Int J Indust Entomol 15 39 45 2008
83. d other quadrants in the Morris water maze test day 8th of mice aged by D galactose All values are expressed as means SEM P 0 05 P 0 01 P 0 001 vs AC group 85 II 4 B E P tenuipe Table 1 BK OMe v qux Miyazawaetal 2008 MQ 1989 Pardridge 1983
84. etable wasps and plant worms Eb RAS Insecta Fa 7 A Lepidoptera a Hepialoidea Hepialidiae mimik Hepialus armoricanus Oberthur excrescens Butler Ma et al 2007 Li et al 1998 BINA HER 3 000 4 000 C sinennsis id Babe TAE
85. gl J Med 348 1333 1341 Ryu K S Ahn M Y Lee H S Kim I Kim J W Kim S H and Cjoi J H 2002 The tonic effect of the extract from male silkworm Bombyx mori pupae on rats Int J Indust Entomol 5 123 126 FOIL Sud 2008 8 33 38 Sakakura A Shioya K Katsuzaki H Komiya T Imamura T Aizono Y and Imai K 2009 Isolation structural elucidation and synthesis of a novel antioxidative pseudo di peptide Hanasanagin and its biogenetic precursor from the saria japonica mushroom Tetrahedron 65 6822 6827 Sakakura A Suzuki K Katsuzaki H Komiya T Imamura T Aizono Y and Imai K 2005 Hanasanagin a new antioxidative pseudo di peptide 3 4 diguanidinobutanoyl DOPA from the mushroom J saria japonica Tetrahedron Letters 46 9057 9059 Sato K Tanaka H Saito Y and Suzuki K 2002 Baculovirus mediated production and antifungal activity of a diapause specific peptide Diapausin of the adult leaf beetle Gastrophysa atrocyanea Coleoptera Chrysomelidae J Insect Biotechol Sericol 71 69 77 Shih P H Chan Y C Liao J W Wang M F and Yen G C 2009 Antioxidant and cognitive promotion effects of anthocyanin rich mulberry
86. hoi et al 2004 C sinensis 02 Koh et al 2003 Bok ez al 1999 fi ri Raoetal 2007 Phellinus linteus Nakamura et al 2004 Ji 2009 C sinensis D galactose tenuipes Isaria japonica E Paecilomyces tenuipes Isaria P tenuipes li Cordyceps YI HABA DICE 54H LA 4 FA Paecilomyces
87. o 5 2002 X 65 Hf 25 Fig 1B BONE FEAR ONC 308 100 g Table 1 Table 2 2 P tenuipes PTE P tenuipes 3 63g 8 W V 500 mL MQ 105 C 60 BS 245 10 000 X g 4 10 No 2 ADVANTEC a 8 MQ 2 1 EYELA A3S
88. r P Rimbach G Packer L Maguire J J Schulta P G and Gohil K 2001 The zn vivo neuromodulatory effects of the herbal medicine Ginkgo biloba Proc Matl Acad Sci USA 98 6577 6580 2008 pp 55 58 E ul Wei H Li L Song Q Ai H Chu J and Li W 2005 Behavioural study of the D galactose induced aging model in C57BL 6J mice Behav Brain Res 157 245 251 Yamaguchi Y Kagota S Nakamura K Shinozuka K and Kunimoto M 2000 Antioxidant activity of the extracts from fruiting bodies of cultured Cordyceps sinensis Phytother Res 14 647 649 2009 Clin Neurosci 27 328 330 F 2010 pp 1 60 Zeisel S Reinstein D Corkin S Growden J and Wurtman R 1981 Cholinergic neurons and memory Nature 293 187 18
89. t Note 1 The energy conversion coefficient by a nutrition labeling standard 2003 Ministry of Health Labour and Welfare notification No 176 protein 4 lipid 9 carbohydrate 4 dietary fiber 2 2 Nitrogen and a protein conversion factor 6 25 3 The energy conversion coefficient by a nutrition labeling standard 2003 Ministry of Health Labour and Welfare notification No 176 100 moisture protein lipidtash content dietary fiber 4 As thiamine hydrochloride 5 Use strain Saccharomyces cerevisiac S uvarum ATCC 9080 6 Use strain Lactobacillus delbrueckii subsp lactis L leichmannii ATCC 7830 7 a tocopherol 1 mg B tocopherol 2 5 mg y tocopherol 10 mg and 6 tocopherol 1001 mg were a tocopherol Eq 1 mg respectively 8 Use strain Lactobacillus rhamnosus L sase ATCC 7469 9 Use strain Lactobacillus plantarum ATCC 8041 10 Use strain Lactobacillus plantarum ATCC 8041 15 3 1 5 C57BL 6J KEV A 21 24 0 94 g SLC Normal Control NC Aging Control AC PTE x 5 mg kg day PTE x 25 mg kg day 4 1 5 6 E 23 25 C 12 07 00 19 00 12 Rm
90. vitamin Bg vitamin B vitamin D vitamin D Int Unit vitamin E tocopherol equiv a tocopherol B tocopherol y tocopherol 6 tocopherol Content 100g 392 kcal 65 0 g 10 3 g 14 7g 66 6 mg 2 6g 1 00g 7 17 mg 180 mg 1 07g 474 mg 1 74 mg 23 0 mg 2 54 mg 24 ug none detected none detected 0 14 mg 2 45 mg 0 59 mg none detected 26 1 ug 1 040 IU 1 2 mg 1 1 mg none detected 0 6 mg 0 3 mg Lm Da to amp Oo Oo detection limit 0 5 mg 100 g 0 05 mg 100 g 0 03 ug 100 g 0 1 mg 100 g note analysis method 2 Kjeldahl method acis decomposing method enzyme gravimetric method atomic absorption photometer Normal pressure heating drying method direct incineration method ICP emission spectrometry ICP emission spectrometry ICP emission spectrometry atomic absorption photometer ICP emission spectrometry atomic absorption photometer ICP emission spectrometry ICP emission spectrometry fluorometry gas chromatography ICP emission spectrometry 4 HPLC HPLC 5 micrological assay 6 micrological assay HPLC HPLC HPLC HPLC HPLC folic acid pantothenic acid niacin mann itol B glucan ergosterol Each content was equivalent to one hundred g These data were given by Tohaku Nosan Corporate Union Fukushima Japan Japan Food Research Laboratories Foundation Analysis number 4105030683 Analysis day April 15 2005 14 Table 2 Con
91. was made of 2 0 mm stainless steel rods spaced 6 mm apart the floor of the dark chamber could be electrified The chambers were connected by guillotine door The training trial was started by placing the animal inside the light chamber and raising the guillotine door When a mouse entered the dark chamber the door between the two chambers was closed and foot shock 0 3 mA 4 sec was delivered through the grill floor of the dark chamber The presence of the passive avoidance was 24 h later The mouse was placed on the illuminated chamber once more and the latency to enter the dark chamber was measured with the cutoff time of 180 sec 23 100 cm platf Fig 4 An equipment of Morris water 19cm zii cm M M orm maze The water pool was filled to depth of 20 cm so that the mouse could either escape over the edge of the tank nor balance its tail on the bottom of the task White paint was added into the water and the temperature controlled at 25 4 1 C A video camera was mounted above the tank Red rectangles indicate start location 94 IL X BRER k UHE E OHE 1 Figs 5 8 SNF 47 149 4 2

Download Pdf Manuals

image

Related Search

Related Contents

User Manual for the eService  OS X Tiger - Marcel Bresink Software  取扱説明書(固定タイプ)  to a copy of the DSSLog user manual in Adobe  TruVision Analog PTZ Camera Configuration Manual  Manual - MS Tecnopon  Gestão Documental Segura de Projectos de Urbanização e    MANUALE TELECOMANDO  

Copyright © All rights reserved.
Failed to retrieve file