DNA Sequencing Setup and Troubleshooting Reviewing
Contents
1. lengths increase n Wien iH MUI gn TO cul renti dre AAN MUR em INi p tinei e ad aa apprann e r n aiai dahaa Ratio of template primer dye terminator is incorrect check reaction components and ensure correct amounts are being used Template may be degraded 27 May 2009 2007 Applied Biosystems Sequencing AR bb Sms Overloading Spectral Pull up 30 1245 1660 1075 1430 1305 2320 2735 4150 4565 4930 295 5510 115 640 7055 7470 7885 200 215 lj TM Raw data showing overloaded data on an Applied Biosystems 3100 Genetic Analyzer In the areas where the signal is very strong you can start to see pull down negative peaks in the baseline on multi capillary instruments M JA di 28 May 2009 2007 Applied Biosystems Sequencing 14 AN BEEystems Overloading Spectral Pull up 3000 4000 5000 6000 7000 8000 3000 10000 11000 12000 13000 14000 15000 16000 17000 180 i h PA ANON M UM TM T ly W ll T Wi Wah A i i Mc Raw Data Peaks are off scale on the Applied Biosystems 3730 Instrument 29 May 2009 2007 Applied Biosystems Sequencing BSS SESS Overloading Pull Up Peaks Annotation Sequence Features Electropherogram Raw EPT Audit Electronic Signature 120 01 f1 3 21 02 3 28 PM WON oie Peaks appearing under peaks in a discernable pattern Similar pattern can also occur if the wrong spectral matrix is used or if the spectral needs to b2. spike in the data seen in the zoomed out view on the right Note that all 4 colors are present in a thin spike 41 May 2009 2007 Applied Biosystems Sequencing Ke Applied KS Biosystems n ni dl ilyze Annotation Sequence EPT Analyzed data view of a dust spike crossing the read region May 2009 2007 Applied Biosystems Sequencing 21 AB ains Bubbles nilo Pe 171 oan A KRAARICAEGUTCISZUTTGCIAAACET 341 345 349 353 357 361 a Jill T li MIT W i M WM Hy TN Um Wa LM a Mel AR Applied ns Bubbles Check for leaks on the system Polymer should be allowed to equilibrate and degas for 30 60 minutes prior to placing on the instrument Run the Bubble Remove Wizard on the Applied Biosystems 3100 3130 and 3730 series to remove bubbles Make sure all fittings are tight Make sure the Ferrule Tip area is clear of bubbles or microbubbles If bubbles persist in spite of all fittings being tight please call AB Technical Support for assistance May 2009 2007 Applied Biosystems Sequencing 27 Ke Applied KS Biosystems Electrophoresis Problem Electropherogram Raw Data 0 50 1004 1506 i008 510 23012 2514 4016 4515 5020 5522 6024 552b T7026 7530 022 524 3026 3528 10040 10542 11044 11546 12045 12550 123052 123554 14056 1 p ne tig ALT W xh Pt Med fo en breton iw jy uy T ee iini 45 May 2009 2
3. 007 Applied Biosystems Sequencing Ke Applied KS Bibsystems Electrophoresis Problem EPT Data 1022 1095 1168 1241 1314 1387 1460 46 May 2009 2007 Applied Biosystems Sequencing 23 Wed KS Bibsystems Analysis Troubleshooting 47 May 2009 O 2007 Applied Biosystems Sequencing Ke Beate LE KS Biosystems Dye Sets Virtual Filter Sets Dye set Filter set needs to be chosen before the run normally samples need to be re run if the wrong dye set is chosen Sequencing Dye Sets E BigDye Terminator v 1 1 Z BigDye Terminator v 3 1 Fragment Analysis Dye Sets D 6 FAM NED HEX ROX D 6 FAM NED VIC ROX F 5 FAM JOE NED ROX G5 6 FAM VIC NED PET LIZ E5 dR110 dR6G dTAMRA AROX LIZ 48 May 2009 2007 Applied Biosystems Sequencing 24 We Applied KS Bibsystems Analysis Problem Wrong Dye Set Primer File 158 1295 1332 1369 406 1443 1480 1517 1554 l 11 T TT 101 105 109 al a1 l 1c A TG C T 1C T The sample above was Analysed with the Dye Set Primer file for BDTv1 1 but the chemistry used to set up the reactions was BDTv3 1 Overlapping bases and poor quality values result 49 May 2009 2007 Applied Biosystems Sequencing Ke Weyer KS Biosystems Lil Ll A hy lt This is the same sample re analysed with the Dye Set Primer file for BDTv3 1 Note the improvement in the spacing and quality values This ts the on
4. Lara Cullen PhD Scientific Applications Specialist Australia and New Zealand BSS sibEystems We KS Biosystems Reviewing Sequencing Data Review the Electropherogram Review the Raw Data Signal intensity data start points baseline length of read artefacts Review the EPT Plot Review Data Analysis settings correct basecaller mobility file Is there any pattern to the problem eg specific capillary specific primer May 2009 2007 Applied Biosystems Sequencing Ke Applied KS Bibsystems Good Quality Sequencing Data Electropherogram 2008 11 12 DO1 1 Seq std 15 09 13 2184 2223 2262 230 IS LEE E M P E E NU GU UN T CCTCTTATAGAT 181 185 189 193 234 l CGG 1819 1712 1605 1498 1391 1284 1177 1070 963 856 749 642 535 428 321 214 107 s leeh elu a d nd deem ns Las lt Peaks should be evenly spaced not too broad and no tailing Read length QV 20 should be 600bp with POP6 on 50cm Array Baseline noise under the main peaks should be minimal May 2009 2007 Applied Biosystems Sequencing Ke Applied KS Biosystems Quality Values are an RUSE VOLES TOTO HOS pg indicator of the chance of Pe is probability of error KB basecaller generates QVs from 1 to 99 an incorrect basecall in Typical high quality pure bases will have QV 20 50 z Typical high quality mixed bases will have QV 10 50 your sequencing data Size and color of QVs bars are identical for
5. May 2009 O 2007 Applied Biosystems Sequencing 12 AB Bee Sems Sample Overloading e Can refer to too much template being present and or a very robust reaction resulting in a very strong signal e Inthe Raw Data if the signal exceeds the values below the Analysis Software may not analyze the data properly 8100 and 3130 3130xl Genetic Analyzers gt 8000 rfu 3730 3730xl Genetic Analyzers gt 32 000 rfu Note RFU values for overloading are based on software analysis values Sample overloading and miscalling may occur with rfu values much lower than listed Pull up peaks under peaks in the Sequencing data may occur with very strong overloaded signal 25 May 2009 2007 Applied Biosystems Sequencing Ke Applied KS Biosystems TM hs MT yt TN u Uy A n MR In TAE np y M M n xa A Pe nh Maru ANTA TN n angues A i tl If samples contain too much DNA the labelled ddNTPs can be incorporated early on creating a top heavy reaction where the data looks strong in the front and then gets weaker as the run progresses resulting in shorter reads Careful quantitation of the DNA template can usually avoid this 26 May 2009 2007 Applied Biosystems Sequencing 13 KS D Cd Ins t 405 1511 1415 un ors ELE 1615 fein ves sense 4033 MASI 10455 11870 1t475 12040 13605 14490 15435 Lele 15943 1y 10 1 Raw Data Peak profile is similar to a ski slope peak heights decrease as the fragment
6. Q s 50 99 xc QV 10 2 1 in 10 chance QV 20 1 in 100 chance QV 30 1 in 1000 chance QV 40 1 in 10000 chance T mE mI ca cR 53 Quality Values of 20 or 25 36 0 025 higher will give blue bars Dist when the default settings T are used in Sequencing More information available in Chapter 6 of Sequencing Analysis User Guide and Chapter 10 of SeqScape User Guide Analysis May 2009 2007 Applied Biosystems Sequencing AN BEEystems Good Quality Sequencing Data Raw Data 2008 11 12 O01 1 Seq std 15 09 13 4 1132 1430 1755 2056 i384 t st 2350 3278 3576 3874 114 i Ml ul i TR M di i M ill WW li Aim for signal strength in the range of a few hundred to a couple of thousand l There is no official spec for Signal to Noise Ratio but samples that have ratios gt 100 are generally considered to be good J WA 5 May 2009 2007 Applied Biosystems Sequencing Ke Applied KS Biosystems Good Quality Sequencing Data EPT Data 1005 1072 1139 1206 1273 1340 Check the current and voltage both have the normal profile anything unusual could indicate a reagent or instrument problem 6 May 2009 2007 Applied Biosystems Sequencing Ke Applied KS Biosystems Sequencing Troubleshooting Defining the Problem e Poor data can occur for many reasons Instrument Problem Array Problem Polymer Problem Sequencing Primer Problem Template DNA Quality Problem Sequencing Primer Problem Dat
7. a Analysis Problem Controls are an essential part of defining the problem 7 May 2009 2007 Applied Biosystems Sequencing Ke Applied KS Bibsystems BigDye Terminator v3 1 Sequencing Standard Lyophilized sequencing reactions that require only resuspension and denaturation before use Validate the instrument performance and rule out problems with common reagents and consumables such as polymer array buffer plasticware and septa 8 May 2009 O 2007 Applied Biosystems Sequencing Ke Applied KS Biosystems 4760 4800 4840 4880 4920 4960 5000 5040 5080 5120 5160 5200 5240 5280 5320 5360 5400 5440 5480 5520 5560 5600 5640 5680 ME A AO eee cal A A A O A eee Pee re Doi ATCAATATTCCATAAGGCATGATG GTTGCTCAGANGCAGGACAANANCAACGAATACNATCCTATAAAAGATAAAACAT I i 397 400 403 406 409 412 415 418 433 436 439 442 445 445 451 454 457 460 463 466 469 472 47 tM to e el Tailing peaks in all 4 colors or early occurrence of broad peaks LOH can indicate the array is starting to wear out and needs to be replaced or that the polymer needs to be replaced 9 May 2009 2007 Applied Biosystems Sequencing Wed KS Biosystems pGEMO 3Zf control DNA M13 forward primer High quality plasmid DNA and primer that can be used in a control reaction with BigDye Terminator ready reaction mix Aatll Ndel 2260 2509 PGEM 32H ise Run and clean up the pGEM eu Xbal reaction in the same way as you do your samples V
8. alidates the Chemistry BDT kit thermal cycling conditions thermal cycler and the sequencing reaction clean up 10 May 2009 2007 Applied Biosystems Sequencing We KS Bibsystems Tailing in the C peaks alone may indicate a problem with the BDT ready reaction mix BDT exposed to light during storage or excessive freeze thaw cycles may show this problem Samples loaded in water instead of Hi Di formamide may also be more prone to this problem 11 May 2009 O 2007 Applied Biosystems Sequencing We KS Biosystems Sequencing Reaction Setup Example Reaction Component Volume reaction BDT Ready Reaction Premix 2 5x 1 0 ul BigDye Sequencing Buffer 5x 3 5 ul Primer 3 2 pmol ul 1 0 ul Template DNA 10ng ul 1 0 ul W ater 13 5 ul Final Volume 1X 20 ul Sequencing Reactions contain only BDT Reaction premix buffer and your template DNA and primer If sequencing standard and pGEM controls give good quality data the problem may lie with the template DNA preparation method template DNA quantity or the primer quality 12 May 2009 2007 Applied Biosystems Sequencing Ke Beate liter KS Bibbystems Additional controls for DNA and Primer quality Are some samples giving good quality data and others bad with the same primer Are you sequencing the same template DNA with more than one primer eg forward and reverse and finding one works much better than the other Have you recently switched DNA p
9. e re done due to changes in the optics May 2009 2007 Applied Biosystems Sequencing 15 AN Estystems Sample Prep Issues Multiple Products oordinates x y 1500 1550 1600 1650 1700 1750 1800 1850 1300 1950 2000 2050 2100 CATGAATATATTTAT GT GGACCCGATGCAGCTGCCTTATGACTCAAGATGGGAGTTTCCAAGAGATG 125 130 135 140 145 150 155 160 165 170 175 180 185 yla 31 May 2009 O 2007 Applied Biosystems Sequencing We KS Biosystems lab A05_001 ab1 E AD1_A01 ab1 PFS 10_B1_170B _11DF_3396_SQ_B02 ab1 D Analyzed Raw Analyzed Raw Annotation Sequence EPT 32 May 2009 2007 Applied Biosystems Sequencing 16 Ke Applied KS Bibsystems Sample Prep Issues Multiple Products Multiple products can be caused by Non specific binding of the primer to the template during PCR or Cycle Sequencing Multiple clones or colonies present during sample prep or PCR products Heterozygous insertions or deletions HIM Contamination from water environment Re using Septa May 2009 2007 Applied Biosystems Sequencing Ke Applied KS Bibsystems Poor Sequencing Primer quality 672 704 736 768 300 832 364 396 928 960 992 1024 1056 1088 1120 1152 1184 L G ATT G G TCAACAG ACAC GG ACAA CACC TECEECE TTGCCTACA CGC G AG C 58 61 64 67 70 73 76 79 82 85 88 91 94 97 100 hA N 1 effect due to poor primer manufacturing May 2009 2007 Applied Biosystems Sequencing 17 Ke A
10. ly circumstance in which you can change the dye set after the run 50 May 2009 2007 Applied Biosystems Sequencing 25 We KS Bibsystems For any questions you have or assistance you need contact AB Technical Support anztechsupport appliedbiosystems com 1800 636 327 Aus 0800 636 327 NZ 51 May 2009 2007 Applied Biosystems 26
11. n on a gel PCR clean up kits or EXoSAP IT amp should work well if the PCR product is specific e Commercial plasmid miniprep kits generally give DNA of sufficiently high quality for sequencing Try not to overload the columns Some spin column based kits may leave residual resin that can interfere with injection and cause failed samples Centrifuge then take from the top of the sample for sequencing 16 May 2009 2007 Applied Biosystems Sequencing Ke Applied KS Biosystems Template DNA Quantity Tenpisis Quantity Too much DNA or too little will reduce the length of PCR product read and the quality of 100 200 bp 1 3 ng base calls 200 500 bp 3 10 ng 500 1000 bp 5 20 ng The suggested template 1000 2000 bp 10 40 ng DNA quantities should be gt 2000 bp 20 50 ng used as a guide however Single stranded 25 50 ng tal need to id 95 your own quantities in Double stranded 150 300 ng some cases Minds Quantitate your DNA by gel Bacterial genomic DNA electrophoresis or UV absorbance 17 May 2009 2007 Applied Biosystems Sequencing Ke Applied KS Biosystems DNA prep PCR om oC Sequencing amp Em Instrument PCR purification post purification BDT Sequencing Standard pGEM from the sequencing kit Laboratory internal DNA quality Control Running controls helps in focusing troubleshooting efforts and reduces time taken to determine the cause of the problem 18 May 2009 2007 Applied Biosystems Se
12. pplied KS Bibsystems Dye Blobs Problem with sequencing clean up Electropherogram showing Dye Blobs lab A05_001 ab1 a A01_A01 ab1 a 10 B1 170B4 11DF 3396 SQ BO2 abi a 1 H68529 Lys a BR2e11 8Fseq_C10_06 ab1 FFF BN4077_IMM_Al ab1 X D Tamsin Eades Documents AGRFISequencing Examples BN4077_IMM_A1 ab1 Coordinates O 750 800 ed Raw Analyzed Raw Annotation Sequence EPT 35 May 2009 2007 Applied Biosystems Sequencing Ke Weyer KS Biosystems Raw Data showing Dye Blobs labi 405_001 ab1 labi 401_A01 ab1 abl 10_B1_170B _11DF_3396_5Q_B02 ab1 aj 1 H68529 Lys a BR2ell 8Fseq C10 06 abl Lab BN4077 IMM Al abl X D Tamsin Eades Documents 4GRF Sequencing Examples BN4077 IMM A1 ab1 Coordinates x y 12259 420 D 500 1000 1500 2000 2500 3000 3500 4000 4500 5000 5500 6000 6500 7000 7500 8000 8500 9000 9500 10000 10500 11000 1500 12000 12500 13000 13500 14000 14500 MA AMRIT IPTE il VIE Ui iud AGAN 36 May 2009 2007 Applied Biosystems Sequencing AR Applied ns General Issues Hardware e Hazes Red Blue Green e Dust e Bubbles e Electrophoresis Problem 37 May 2009 2007 Applied Biosystems Sequencing Ke Applied KS Bibsystems Hazes Red Blue Green Hazes can appear in almost any color and are usually the result of some contaminant getting into the system 38 May 2009 2007 Applied Bio
13. quencing 19 Common Sequencing Problems May 2009 2007 Applied Biosystems Sample Prep Issues No Injection sample Overloading Too much template Spectral pull up Multiple Sequencing Products Poor Sequencing Primer quality Dye Blobs May 2009 2007 Applied Biosystems Ke Applied KS Bibsystems Sequencing We KS Biosystems Sequencing 10 NS Applied AS Biosystems Raw Data Unincorporated dyes Flat signal profile KB basecaller generated 5 Ns to indicate a Electropherogram possible failed sequencing sample 21 May 2009 2007 Applied Biosystems Sequencing Ke Applied KS Bibsystems No Injection sample e Failed Reaction Component left out of reaction Wrong primer used Enzyme not working Thermal cycler problem Not enough DNA Inhibitor in DNA e Labelled product lost during cleanup 22 May 2009 2007 Applied Biosystems Sequencing 11 Ke Applied KS Bibsystems Low signal throughout the entire sequence 24 E e GC CAG C GG T 665 G 33 35 37 39 43 a a B B B n B Electropherogram May 2009 2007 Applied Biosystems Sequencing We KS Bibsystems Low Signal Sequencing reaction failed Not enough primer tempate Big Dye Terminator Partial loss of product during cleanup Difficult template sequence Adding 5 DMSO or 1M Betaine to the reaction may help in some cases Salts in sample interfering with electrokinetic injection
14. reparation methods Do you quantitate your DNA before sequencing Do you have a sample that you know works well that you can use as a lab specific control May 2009 O 2007 Applied Biosystems Sequencing AB Bee stems Primer Design e Use Generic Sequencing primers if possible eg M13 Forward and M13 Reverse or T3 and T7 when sequencing plasmids e When designing primers for Sequencing keep in mind the following Primers should be at least 18bp and avoid runs of identical nucleotides to ensure they are specific to the intended target and hybridise well Avoid primers that have the potential to form dimers or have secondary structure GC content should be between 30 80 50 optimal May 2009 2007 Applied Biosystems Sequencing We KS Biosystems Primer Design In most cases PCR primers with Tm of about 60 C will work as sequencing primers If you are having problems primers with Tm of about 55 C may work better than higher or lower Tm since reaction conditions are as follows 96 C for 1 min J cycle 96 C for 10 J 50 C for 5 sec 25 cycles 60 C for 4 min 4 C Hold Dilute fresh primers from stocks regularly as they aren t as stable when stored at low concentrations 15 May 2009 2007 Applied Biosystems Sequencing Ke Applied KS Biosystems Template DNA Quality e When Sequencing PCR products ensure the PCR is specific High Tm primers 60 degrees or more One specific band when ru
15. systems Sequencing 19 Ke Applied KS Biosystems Annotation Sequence Features Electropherogram Raw EPT Audit Electronic Signature sale i Jd D al V vnde vg LD i b HY A Fn Mb e d n n hi ALL UN in b ere pp erowyoterne 21 Sequencing Ke Applied KS Biosystems Hazes Red Blue Green Potential Reasons Improper little maintenance Contaminant in the water used to clean the system Use of solvents or cleaners to clean instrument components Residual Carbon or Ozone from an Arcing event 40 May 2009 O 2007 Applied Biosystems Sequencing 20 ENS 5 PPS S E ji AE deed Raw Analyzed Raw Annotation Sequence EPT Raw Data view The figure on the left is a zoomed in view of the
Download Pdf Manuals
Related Search