RNAbrowse user manual - MulCyber
Contents
1. Available Applications Logs RnasegDenovo List Of Analyses rnasegDenovo list of analyses Search snpindelDenovo list of analyses Show 10 gt entries O F name DBversion Software 8 blastall annotation against our contigs Contigs annotation against refseq_protein RefseqProtein 2013 01 09 blastall e1e 5 FT v20 b2 annotation against refseq_rna RefseaRna 2013 01 09 blastall e1e 5 FT v20 b2 annotation against swissprot Swissprot 2013_01 blastall e1e 5 FT v2Z bZ annotation against unigene_ Danio rerio 126 Unigene 126 blastall annotation against unigene_Oryzias_latipes 30 Unigene 30 blastall annotation against unigene_Takifugu_rubripes 9 Unigene g blastall Illumina reads mapping against contigs bwa repeats prediction RepeatMasker e F Showing 1 to9 of 9 entries First Previous 1 Next Last The elements numbered in the screen shot above correspond to the general menu of the dataset the presentation block which can be customized according to the needs the application log menu the application log itself It includes all the processing steps the data has undergone including the database name and version when relevant the software packages used and the parameters as well as the dates of processing a A The bottom sections of the page aims at simplifying the material and method writing for the future articles using this dataset RNAbrowse user manual page 7 32 geno ez SI2. Saveto csv Showing 1 to 6 of 6 entries First Previous 1 Next Last Contigs List Of Your Favorites Contigs On the table bellow are listed all your favorite contigs This list has first been initialized with the longuest ones You can inorder toadd new ones O search using BioMart or O search using Blast Show 10 a entries Contig name S Length Depth BestHitDB Access Description E VGA BP513 13 13946 67 1 swissprot VGA_BPS13 VGA_BP513 sp PO7928 A protein OS e DE 100692129 ORENL2 4 4498 9 3 refseg rna XM 003459519 1 XM_003459519 1 PREDICTED Oreochromis niloticus period circac es LOC100692729 ORENI 1 1 2968 e ma XM_003450762 1 XM_003450762 1 PREDICTED Oreochromis niloticus Eet e LOC101063003 TAKRU 2 3 2922 6 m XM_003971923 1 XM_003971923 1 PREDICTED Takifugu rubripes DNA cytes me 5 O LOC100705067 ORENI 1 1 2449 20 9 refseg ma XM_003447077 1 A O O DH ia aces Oe eae eee Y EES With selected contigs W Delete from Favorites Copy Saveto CSV Showing 1 to5 of 5 entries First Previous 1 Next Last The elements numbered in the here over presented screen shot correspond to menu item to access the contig main page menu to access various global tables and graphics on the assembly and the annotations table and graphic display area library table enabling two analysis 1 Venn diagram RNAbrowse user manual page 8 32 geno 00 y YNE
3. bioinfo Assembly part Contigs From the dataset page the user can access the assembly and annotation results using the Contigs menu item sa i i D L DLabraxBrainLiver Contigs Variants Download i E 3 po a Statistics Available n istics General statistics Ur 1 produced 53832 contigs 90339128 bases witha N50 at 2632 and a N90 at 734 Contigs depth Contigs length 6 5 24 04 12 7 36644 8 1057 1678 17 2137 49393 Depth 0 Conti gs Best annotations Length 200 Species found as best annotation Libraries mapping overview Contigs expression per library Libraries Used In Your Experimentation On the table bellow are listed the libraries used for the rna seg de novo experiment You have access to 2 analysis the DDD digital diferential display or the venn diagram Show 25 entries Search Library name i lic i JEV vp Nb ofseq Sequencer Pooli Pool Pool Pool4 Pool5 DienJ_ACTTGA_LO06_R1 DienJ 1 diencephal unknown se 25740402 GAIX is WW WW C DienN GATCAG L006_R1 DienN 1 diencephal unknown Se 26946221 GAIX is C Gm FoieJ ATCACG LO06_R1 Foie 1 liver unknown se 24848149 GAIX EN ia WW FoieN TTAGGC LO06_R1 FoieN 1 liver unknown S 30858869 GAIX oe C a eo AA HypoJ 1 hypophyse unknown se 29371375 GAllx O O O i HypoN_GGCTAC LO06 R1 HypoN 1 hypophyse unknown se 28567049 GAIIx i i Performa Venn onthe selected libraries Run Copy
4. BPS13 Species Enterobacteria phage 513 Query start gt end 6121 gt 6327 Evalue 7e 13 gt identity 59 4 gt Scoverage 59 gt Oconserved 78 3 Export sequence A Delete from Favorites Export box Export annotations Export SNP Indels Database swissprot gt Score 192 gt Qcoverage gt Oidentities gt Description VGA BP513 sp PD7928 A protein O5 Enterobacteria phage 513 GN A PE 4 5V 1 Keywords 5 Alternative initiation Complete proteome gt DNA binding Endonuclease Hydrolase Metal binding b Nuclease gt Zinc Zinc finger Gene Ontology GO 0006259 GO 0006260 GO 0090305 Biological process GON GO 0003677 GO 0004518 GO 00167BB Molecular Function 4 Show more RNAbrowse user manual gt Gene VGA DI gt Subject start gt end 1 gt 64 T 72 5 uh i ai A ser DNA metabolit process nterPro DINA replication Inferred from EA Src nucleic acid phosphodiester bond hydrolysk Inferred From IEA Src DNA binding Interred from IEA Sre UniProtKB KW nuclease attwity hydrolase activity acting on ester bonds page 20 32 geno toul bioinfo Features Table Show 10 entries contig_034394 VGA_BP513 3 3 430 6 REPA BPPHX 1 1 1744 VGA_BP513 2 3 1682 VGA BP513 2 3 1616 VGF_BP513 1 1 1247 VGA BPS13 2 3 1104 EIF3K_DANRE 1062 Danio rerio LOC1010627
5. column indicating if the contig is part of the favourite star 2 this same column enables also to add 1t to the favourites by ticking the check box 3 the add to favourite button The table can be searched using the box located at the top right part and browsed using the button situated on the bottom right angle RNAbrowse user manual page 18 32 geno toul bioinfo Blast your guery against the contig database Query Form Blast Configuratior Enter query nucleotide or protein FASTA seguence s Parameters LAGLALDILAGLGbDGLLILGLAbDLIGI I Gb LAGbDADLLGILbDOLLAAAILALLIGI TGAGGAGGTGAAACCAGGGAATCTGGCGAGAGAGTGTGTCG AGGAAATCTGTGACCACGAAGAAGCCAGAGAGGTGTTCGAACAGACGGACAAAACAGAA Choose a BLAST algorithm blastn Filter query seguence gj AACTGCTGGACGAAATACCTIGACTOTGATGGOATCTACGAA GATAAGAACACAACAGAACATTGACATTGTCAGACAATGTATAGAAGGACAGAGTATAT TTCCGGTACAGGAGTGAACTATGAAGGAGACATCAACATCA CAGAATCGGGCCGACAGTGTCAGAACTGGAATCTCATATGTTCCCACATCCCAGAATAA GGGAGTTTAATGCTTGGAGCCAAACAGCAACCTGCACGAGA ACTTCTGICGAAACULCLCLGACACLLG CCGAG a GACCCTGG IG TT TCALCAAAGA Expect value 10 Output max hit 20 5 Clear Form Run Blast Result Blast Output Show 10 entries Search Subject 5 Query gd en dm Gap Ostai Oend e Ssiai Send e Evalue e VGA_BPS13 1 3 VGA_BPS13 1 3 100 00 2784 0 0 2784 1 2784 0 0 5364 VGA BPS13 1 3 VGA BP513 1 3 100 00 1341 3014 43594 3014 434 0 0 Quid S13 13 VGA BPS13 1 3 1000
6. entering the environment These page correspond to the home page of the website and the dataset pages which give individual access to each dataset loaded in RNAbrowse Home page The first screen shot hereunder presents the home page of the environment To see what it looks like in you web browser you can open http ngspipelines toulouse inra fr 9000 A tt eo 6 e D I PIPELINES NGSPIPELINES Dicentrarchus labrax day and night Your data summary goes here Dicentrarchus labrax brain and liver Dicentrarchus labrax antifooling Feel free to change the HTML as you see fit The elements numbered in the above presented screen shot correspond to 1 different datasets loaded in RNAbrowse 2 customizable page element in which global information on the project or the laboratory having produced the data can be displayed 3 link the the FAQ frequently asked questions 4 link to the home page and page tree location 5 OpenID login access biomart function not implemented yet NB The page header and footer dark gray are displayed on all pages RNAbrowse user manual page 6 32 geno Oe y AE PAN 3 toul 68 SIGENCE bioinfo Dataset page The dataset page gives different informations on the dataset which has been assembled and annotated D L DLabraxBrainLiver Contigs Variants Download dp A n Dicentrarchus Labrax The Project Uses 12 51 Gb On The Harddrive SeaBass 53832 contigs
7. the last page You can also move in the table by clicking on the page number buttons The table can be copied to the clipboard and saved as a csv file using the buttons above the navigation buttons presented in the previous paragraph RNAbrowse user manual page 9 32 eno OO e y gS gens o gt SIGE bioinfo Libraries Used In Your Experimentation On the table bellow are listed the libraries used For the rna seg de nove experiment You have access to 2 analysis the ODD digital diferential display or the venn diagram Show 25 entries Search Library name Samplename Replicat Tissue Dev stage Type Nb ofseq Sequencer Pooli Pool Pool3 DienJ ACTTGA LODG6 Ri Dien 1 diencephal unknown S 25740402 GA Lei DienN_GATCAG LOD6 Bi DienM 1 diencephal unknown se 26946221 GAIX ei E Foiel ATCACG LOD6_R1 FoieJ 1 liwer unknown se 24848149 GA Lei p m FoieM TTAGGC LO06_R1 FoieN 1 liver unknown 5e 30858869 GAIX 2 i a HypoJ_ TAGCTT_LOO6 R141 Hypo 1 hypophyse unknown se 29371375 GAIX a Lei HypoN_GGCTAC_LOO6 R1 Hypo 1 hypophyse unknown se 28567049 GAII CH CH Performa Venn onthe selected libraries E Run Copy Saveto csv Showing 1 to 6 of 6 entries First Previous 1 Next Last The table can also be used to launch two types of analysis Venn diagram e Digital Differential Display DDD Venn diagram analysis The Venn diagram shows the number of contigs shared between l
8. 0 118 0 0 2864 2981 2864 2981 1e59 234 i 5138 VGA BPS13 13 9946 1112 5 1 1673 2783 2144 3255 0 0 1994 a 725138 VGA BPS13 13 89 69 669 42 22 945 1599 1483 2138 3e174 615 O contig_025138 VGA BPS13 1 3 8843 432 34 14 a mm 805 1228 2e95 353 g 025138 VGA BPSI3 13 92 17 166 9 4 163 382 546 9e4B 194 E 5138 VGA BPS13 1 3 9357 140 7 2 795 933 1159 1297 1e46 190 205138 VGA BPS13 1 3 97 87 47 0 207 253 682 728 Gei 857 nig 022138 VGA BP513 1 3 86 21 J8 H 1 189 246 5569 625 0 020 44 1 With selected contigs r Add to favorite Showing 1 to 10 of 72 entries First Previous 1 2 3 4 5 Next Last close When you click on a contig from the favourite table or from the biomart query results you open the contig page which will be described in the next chapter Contig visualisation The contig page gives access to different pages including general information 1 2 seguence view 3 Jbrowse view 4 depth view The view are accessed through the menu located on the top of the page and presented in the next screen shot Contig general information page The first page of the contig section gives general informations about the contigs and 1ts RNAbrowse user manual page 19 32 M dl 0 0 C O cr O 0 0 annotation General Info D L D A Night Sequence View WGA_BP51 3 1 3 General Information gt Name VGA_BP513 1 3 gt Length 13946 gt Mean depth For all libraries 67 1 Best Hit Accession VGA
9. 1 The top page block presents the informations about the chosen library pools the selected significance threshold and the general figures about the number of contigs over expressed contigs in either pools or expressed in only one of the pools It also includes the links to download the complete results set containing eight files out of which three can be used to query GO terms at the Wego website http wego genomics org cn expressed only in pool2 wego expressed only in pooll wego expressed only in pool2 tsv overexpressed only in pooll wego overexpressed only in pool2 wego expressed only in pooll tsv overexpressed only in pooll tsv O Aa R e ae ES overexpressed only in pool2 tsv RNAbrowse user manual page 12 32 geno GER toul bioinfo QO The second block presents 20 contigs over expressed in pool 1 The third block presents 20 contigs over expressed in pool 2 The fourth block presents 20 contigs only expressed in pool 1 Aea e The fifth block presents 20 contigs only expressed in pool 2 Selected Libraries Alpha 0 05 sane 3 21257 contigs are overexpressed in both pools 8261 in Pooll and 12996 in Pool2 gt 265 contigs are expressed only in Pooli 3 2049 contigs are expressed only in Pool2 Digital Differencial Display 7 Values to print 20 i 3 21257 contigs are overexpressed in both pools 8261 in Pooll and 12996 in Poole Show 10 entries seem Showing 1 to
10. 10 of 20 entries First Previous 1 2 Next Last gt 265 contigs are expressed only in Pool Show 10 entres pen Contig Name Showing 1 to 10 of 20 entries Previous wm Lol gt 2049 contigs are expressed only in Poole Show 10 entries seem Wego Gene Ontology analysis RNAbrowse user manual page 13 32 bioinfo geno 00 y y Sr GE SIGENCE To perform a wego differential analysis first uncompress the all data zip file then go the wego website http wego genomics org cn and load the files using the wego native format Favorite contig table This table contains contigs of interest selected by the users Above the table Contigs ist Of Your F ites Contigs On the table bellow are listed all your Favorite contigs This list has first been initialized with the longuest ones You can in order to add newones O search using BioMart or O search using Blast entries Search Shaw 10 Length Depth BestHitDB Accession Description VGA BP513 VGA BP513 sp P07928 A protein OS XM_003459519 1 PREDICTED Oreochromis niloticus period circac swissprot 4498 33 refseg rna XM_003459519 1 M 003450762 Dreoch s niloticus i 2968 13 8 refsen ma XM_003450762 1 XM_003450762 1 PREDICTED Oreochromis niloticu iiaa LOC101063003 TAKRU 2 3 2822 6 5 refseg rna XM 0039719231 XM_003971923 1 PREDICTED Takifugu rubripes DNA cytosine 5 XM_003447077 1 PREDICT
11. 29 TAKRU 1 2 1060 contig_025138 1006 Showing 1 to 10 of 110 entries First SNPs Table No snps available The previous screen shot presents the contig menu general information section best hit section Uniprot Swissprot keyword section GO section annotation section 7 List of SNP Indels if contig contains it MD Definition Search contig_034394 length 9054 VGA _BP513 3 3 length 5548 REPA BPPHX 1 1 length 5276 VGA_BP513 2 3 length 5747 VGA_BP513 2 3 length 5747 VGF_BP513 1 1 length 5598 VGA BP513 2 3 length 5747 EIF3K_DANRE sp O567V6 Eukaryotic translation initiation Factor 3 subunit K OSzDanio rerio GN eif3k PE 2 5V 1 LOC101062729 TAKRU 1 2 length 2143 contig_ 025138 length 4296 Previous 1 2 3 4 5 T Database contigs contigs contigs contigs contigs contigs contigs swissprot contigs contigs Next Last At the bottom of this webpage you will also find the SNP Indel section not shown on the screen shot The general information section contains a button to remove this contig from the favourites a button to export the contig sequence in fasta format a button to export the annotation in GFF format A a A RNAbrowse user manual the name length and global expression value of the contigs a button to export the SNP INDEL of the contig in a tabulate file page 21 32 eno oul ioinfo 3 Go VGA_BPS1 3 1 3 General Informatio 67 1 1 gt Name VGA BP
12. 32 oO S toul ez bioinfo Conclusion and future work The RNAbrowse has been design to evolve with the users needs Some of them have already been defined including e micro satellite annotation storage to complete the variation section e Interproscan result storage There are still some functionalities which are not working as they should e openll e favourites for the logged users RNAbrowse user manual page 32 32
13. 513 1 3 gt Length 13946 Mean depth for all libraries 2 A Delete from favorites Export box E _ Export annotations Export SNP Indels J evo RNAbrowse user manual page 22 32 geno toul bioinfo Contig seguence view The next page of the contig visualisation part gives access to various informations about the contig sequence and some tools to analyse it D L Ta D A Night G H E ral A fo Seguence Informations gt Mame VGA BP513 1 3 Extract region from to 113946 Reverse complement Y gt Length 13946 gt GC 46 85 gt A 3882 27 84 gt T 3512 25 18 Get frame translation current all Define the space separator none 100bpbyrow 2 C 03256 23 35 gt G 3278 23 5 Search the ORFs in the frame 2 Search nucleotide sequence Others 18 0 13 fa Sasat gt Longest ORF 2 660bp View sequence View Longest ORF For the reverse strand in frame 2 660bp start 10265 end 10927 NNNNNNNNNNNNNNNNNNTACTG ECCTAAAAAUAATACAUATACAGGUATGTATTTGTTGTTTTTAGGGTCACTGCTAACAGTAACTACT TGAAGCAATACTGATACTGAATTTA TGITATATCAAGTTAGAATTTTTAAGAAAAAGATAGTAAGATGATTAAATGACTTTTGATTCTACCAGAC AGCCTTCCTTTAACATATCTCTGTTTCCTTTCCCTGCTCATTTGCCCTTCTGTTACATCACATTTCTCTCTTCTCTATTTGTCTGTCCCCCTTACTTCTT CTCTCTCATGGGTCAGTTACTCTGCCAATGAAGAGTGGCACATTTGCCCAGGTCACTCCACAGCAGCATGACAAAAGCCGCAGAGCAGAGAAGGAAGGGA AGAGCGAGAGAACGAGAGAGTGGTGACGGCTCCGGCCTCAACTCCTTGCTCGGTCAGGGCGAGGAAGGCCTCTGTGTCTGACTTCA
14. 7628 DANRE 1 LOC100329375 DANRE 5 LOC160334534 DANRE 4 LOC100373736 SACKO 1 LOC100689963 ORENT 16 21 L0C100689963 ORENI 18 21 LOC100696942 ORENT 9 17 LOC160692186 ORENI 11 13 LOC100692319 ORENI 3 6 LOC100692402 ORENI 5 7 L0C1060692515 ORENI 10 13 LOC100693197 ORENI LOC100693359 ORENI LOC100693845 ORENI LOCI66694811 ORENI LOC100695875 ORENT LOC100696699 ORENI LOC1 6699147 ORENT LOC166699167 ORENI LOC100700807 ORENI LOC100701222 ORENI LOC100701259 ORENI 12 23 LOC100701854 ORENT 7 1 LOC100702671 ORENT 1 3 Pool RA Ly A AO A A r RUE RR A AA A CR Digital differential display DDD From the library table it is also possible to launch a digital differential display analysis First select DDD in the bottom left menu This will limit the layout of the left columns of the table to two pools Libraries Used In Your Experimentation On the table bellow are listed the libraries used for the rna seg de novo experiment You have access to 2 analysis the DDD digital diferential display or the venn diagram Show 25 2 entries Search Po Library name d Replicat ISSUE eV Typ a G Pool Pool DienJ_ACTTGA_L006_R1 Dien 1 diencephal unknown se 25740402 GA Lx ei O DienWN_GATCAG_L006_R1 Dienh 1 diencephal unknown se 26946221 GAIX O Lei FoieJ_ ATCACG LO006_R1 Foie 1 liver unknown se 24848149 GAIX O O FoieN_TIAGGC_LOO6_R1 FoieN 1 liver unknown 5e 30858869 GAIL O O HypoJ_TAGCTT_LOO6_R1 HypoJ 1 hypophyse unk
15. CATACTCGCCCTC AI AGAGATACAAGCCATCCTTTATAACTCTTGTCGAGCCAGGCGGT AGAGCACTTATATCATTATCATTAAATGTC CAGGTGATGGCCGTTGAAGTGAATCAGTCTGAAATTGAGAGACAGGGCAGCTCCAGAGTGGAACC TATCACCCGGAGATTTGTGCATGATGAAAAGC TFAAABRARAARCAMPPRPPPACCPAARACAPFCCAAACPTACLPCOCCPLTALCAC PPA TECT TTA ATTIRA mp gt m A mirw KKEE TekTel felelelek elek KAk N dE akk deele The screen shot here over presents 1 the contig browsing menu 2 the sequence informations such as nucleotide content and longest open reading frame ORF 3 The view button presenting the longest ORF in the sequence view 4 the sequence view with possible starts in green stops in red and ORFs in blue 5 the guery form permitting different action on the seguence such as extraction reverse complementation translation in different frames ORF presentation and text search Contig jbrowse view To give a graphical view of the annotations and other features on the contigs browse a RNAbrowse user manual page 23 32 geno GER y NW q toull 955 SIGENOR genome browser has been included in the environment The jbrowse view uses the contig as reference and presents the features as different drawings on the reference The screen shot hereunder presents the different elements of the browse view the available tracks list presenting the features which can be displayed on the contig the reference ruler which enables to move on the reference by dragging the red rectangle the arrows to move to the left
16. ED Oreochromis niloticus CC LOC100705067 ORENI 1 1 2449 AM 003447077 1 With selected contigs w Delete from Favori Copy Saveto CSV Showing 1 to5 of 5 entries First Previous 1 Next Last Contig can be removed from the favourite table by ticking the checkbox in the first column and pressing the delete from favourites button The table can be copied to clipboard of downloaded as a CSV file Biomart guery Biomart http www biomart org is a query environment which permits to make multiple criteria gueries The search page can be access using the search using biomart button located at the top of the favourite contig table The layout of the search page is presented in the next screen shot The search page permits to guery all the databases assemblies and datasets contigs or SNP Indels of the website It includes 1 a database selection menu 2 a dataset selection menu 3 a filter block which 1s organised by data types To move from one data type to another use the selectors at the page top The filters are joined with and and 4 An attribute block enabling to select the attributes presented in the result table the GO button a the bottom of the page to launch the search On The following screen shot presents the top elements of the search page 1 a database selection menu RNAbrowse user manual page 14 32 eno oul ioinfo 3 O cr O 2 a dataset selection menu 3 filter tabs 4
17. MP24_ORENI 1 1_194 SNP General Information Delete from favorites Contig name MMP 4_ORENI 1 1 gt Position 194 gt Alleles A G gt Alleles of reference used for best annotation no annotation available gt Best annotation consequences no annotation available gt Previous Flanking sequence CGTCCGTACGTCAGACCTGCGGCAGGAGAAAGCCATGCAGTCCGCTGTGGCCGCCATGOCA Export box gt Next Flanking sequence CGLTTCTACGGCATTCCTGTGACGGGAATCCTGGACGAGACGACTATAGAGTGGATGAGG Export Flanking sequences RNAbrowse user manual page 28 32 geno 00 y YNE YI A toul 08c SIGENOL bioinfo Variants allele view For SNPs and Indels the allele view give allelic counts for the different libraries The counts are shown on the top of the page in table and in a graphical manner at the bottom Alleles rable malade 12 0 12 saine 13 5 18 Total 25 5 30 Alleles Distribution G h Depth VN Ee Variants feature view The SNP feature view is meant to show annotation information about the SNP It is often not functional for species not having closely related species with a genomic seguence 4 A M Old General Info Alleles View Features View Features Table all Your Feature In A Table Show 10 entries Search Hit accession Species Gene description ExonS limit Exon3 limit ENSDARP00000124776_4 70 Danio rerio gpmbab glycoprotein M6Ab Source 7FIN Acc 7 DB GENE 0307 10 8 184 H ENSDARP00000040279_3 70 Danio rerio g
18. NF R 7 E A A Ore ee ee ee een eee 8 Co ntis erapaics and able aaa aaa daa 9 rap mes don ala 6 da E Nu AED YN AN er GRE ONE NUN ADIO O OO 9 EE ee 10 Ke FRY io FFR FI FF FRO PO PP ee UU O A 11 DPU D a da 11 DDD SiS ee laca oeis 12 A EE 12 DO os 13 Pavone comes tana 14 Eiomat scarchdatasels ama SES tdi 15 Biomart Search Miter setting and TEMO BE 15 Biemarn TEE lee EE 16 Briomart ocan mO DONOR ri 16 Bomae Seat telas 17 Blast Le y TOL FENNI FARF E EEE AE TAE FAR EFFRO FFY NND ADF OF 18 EE nea 19 Conti penetra HO AM AO tte 20 Conti ec nr nic AM HO ee 21 Comte EE 22 EE EE 23 Conta TDTO E EE 24 Ben EE 25 Label panel of depth view 26 Label modification result OF depth VIS Woman 21 re 28 mc Len cr Un O O aras 29 PANN OUTS Eege 29 SNE EE MU aa 30 DO VO da rar rior rte 31 A e PIS POE COM ER o AM 32 Eeer eegene 32 RNAbrowse user manual page 4 32 eno OD e e e S vou R gt SIGENCE bioinfo Introduction The RNAbrowse is a user oriented web environment presenting analysis results performed after a de novo assembly of transcriptomic reads It 1s centred on two data types contigs and variations SNP amp Indels For each data types it displays different views presenting analysis results in a easily understandable form for final users wishing to extract biological meaningful knowledge The environment is build upon the biomart framework BioMart http www biomart org 1s a freely available open source federated database sy
19. Ni x Cie gS SIGENOE bioinfo 2 DDD Digital Differential Display 5 biomart on attributes or annotation search button 6 contigs sequence blast search button 7 favourite contig table Several of the previously listed elements are presented in the next sections Table and graphic display The top section of the page presents tables or graphics synthesizing information on the contigs The menu on the left side permits to select the element displayed on the right panel Statistics Available Contigs Best Annotations General statistics Contigs depth Contigs length Contigs Best annotations refseg_protein BEER FAE Ga 26 56 Ub Libraries mapping overview Contigs expression per library no annotation 43 24 Uh A refseq_rna swissprot 28 49 Yo 1 71 The graphics can be printed or downloaded Download PNG image in four different formats Download JPEG image Download PDF document fs Download SVG vector image 5 56 Un Library table The library table displays all the samples used in the assembly or alignment processing phases It includes informations about the replicate number the tissue the development stage the sequencer the read type singled ends or paired ends the number of reads If the library table has more than 20 lines they will be presented on several pages Four button at the bottom right side of the table enable to move from one page to the next the previous the first or
20. TCCAGAACCAGCTG CTCTTCCGGAGTAGAGGACACACAGGTTGGCGCTTTCGAACAGTGATGACAGTCCTAATTTCTTGAGCAGTACGTTCATGTCTGGCTGGACATCCAGCTT GATTTGGGGCAAAGGTGACCTCGAGAGGCTGAGGAGGCACCGTTTTCATTTGTTCTATCATTTGTTTCACAGCTCTGTCTCCGTCATCCTCTCCTCCAAC TGCTGCAGGTCAGACACTCTGTTTTGGAGCGAGGGAGCGGGATATAAAGGACTGCTGTCACCCGAGAGAGCAAACCCATCGCCACCTGTGACTTAAGCTC AATGACGTGCUGACATAACGGCCAGGTATTTGTTGATACAGGAGTGGGACCTTTACCACATCACCATTCAGTTTTGAGAAATGTCCTTTCTAAACUTTYTTGG AGAAATOTCCTTTCATGGACTTCGGGTCAAACCTTGATCTTOTH CTGACCATTAAAGGAGACACCGGTTGAGTAGGATCAGCTGTGTACCGGTGATACGG AGTCAAC EGAAATT TGTGATTC PGT IGT IGGTCTTA TE ACCCAGCTGT TGATCATACGTGTGC TTCCTCGCTGGTTTCCAGAAGCCTGAC GGGC TCCACATCATAGATCTGGATAGACTGGTTAGTAAAGGACGGACTAAGAGTCAGTTGTGGGTTATAGAAAGATCTGAGAAGCCATCTGCAACGAGCTGGCC ARCTTCTCTTTCAGCTTCTTCATCUTGGAAGTGAAU GCAGTAGAAGTCATGAGGCACACAGACAGCTGTCTCAATGGCTTTGCGGGTTGTGTAC CCCTT sg e ke A a A ke a ke Kb A enn d ka A l iy nd ny fan y ka a A yni y nu PA AMP ka A ka A ka A nu au f l ern yn A bd kek kd ka A A kd Ak o Pe ka Sa kee A A ke CCCTAGCAACALATGGGATAGTACACTGCTGATACTAATAGGAGAGAAGAGCAAGTTGGCAGACGGCTGTGATTCTCTGAGGTAAGCATACAGC TTCATG GAAANCTCCGCCATGGATTCCTGCAACAT a GCAGGGTTCCCATGCTGTGGTGTAGTTAAGTACAGGAGTAA GGAACCGGTGTAGGAGCAGCTTCAACAGTAATCTGTACAGTGCTCAGCTTCTGCUCCCTCAGCAGATTCACAAATGTAAAGTCCGGCATCCTCCATGACHR EE EE EE TCATGCCAGCAGCCGTCTCTTTGGACCAAAGTGCATTGGCACTGACTTGGCTGGAAAGTGGGAAATGGCACGGGAGAGATGAATGGTGGAGCCTTCAGT ACCCTAATAGTATAGGGAACTGATGCATATCGACTGTAATGCTGTATTTCCTTATTATGTCCATATCGGTCTCCTTTACCATACAGG
21. and right on the contig and the zoom in and out menu the browsed contig the location of the view on the contig the display panel A e e D L D A Night VGA_BPS13 1 3 B Available Tracks p 500 1 000 1 500 2 000 2 500 3 000 3 500 4 000 4 500 5 000 5 500 6 000 6 500 7 000 7 500 8 000 2 500 9 000 9 500 10 000 10 500 11 000 11 500 12 000 12 500 13 000 13 500 PT Browse Share Help CH e gt aea ac VGA BPS13 1 3 VGA BP513 1 3 5579 8468 2 79 Kb E EEN e 6 000 6 500 00 7 500 8 000 inde i protein swtssprot transom pt refseg rna YM AN ES T mie el T7 AAT en ai NM NCTED Oreochromis nilocicy al Option crwt Y reot niloticus signal recognition transcript ensembj e varsornot conties VGF BPS13 1 1 DienJ_ACTTGA_LO pul 360 VGF_BPS13 1 1 length 5596 DienN_GATCAG_L HypoJ_TAGCTT_L FoteW_TTAGGC_L E BE HypoN GGCTAC LOOS R1 l 1 1 E BPPHX 1 1 lergth 0996 oo es 33 S 3 a FoleJ_ATCACG_LOj WI jl To add a feature to the display panel simply drag and drop 1t from the available tracks list To remove a feature click on the cross located at the left of the feature name BEWARE the bam file features can be very long to be displayed because of the read depth RNAbrowse user manual page 24 32 geno 00 y YNE YI A toul 80 SIGENOL bioinfo Contig depth view The contig depth view enables to visualise the coverage of the reads of the different li
22. b gt Blast Indexation Of Contigs dei contigs fasta nhr 3 13 Mb dei contigs fasta nin 411 15 Kb dei contigs fasta nsg 19 90 Mb O Download all Getall URL RawData Files In Your Project Raw s 1_reference_1 1 50 Gb s 1_reference_1 1 52 Gb s 2 reference_2 1 43 Gb s 2 reference_2 1 50 Gb 5 3 reference_3 1 34 Gb 5 3_reference_3 1 40 Gb 5 4 reFerence_4 1 32 Gb O Download all Get all URL RNAbrowse user manual page 30 32 geno Oe y YNE YI q toul 08c SIGENCE bioinfo Frequently asked questions A frequently asked question page is available from the footer of all pages Links GenoToul Blointo platform Second generation sequencing platforms pre d gical phenomenons taking place in isualisation environment build upon Sigenae platform INRA National Institute for Agricultural Research The page gives an up to date list of questions and corresponding answers General Frequently Asked Questions Where is the list of all the performed analysis b How can I do Venn diagram with 5 pool Venny demo pa DN can t open a or file what is the problem pen a gz p RNAseqDeNovo Frequently Asked Questions How get Fasta of a list of contigs Use the martform and select sequence attribute as output How are named my contigs Which statistical test is behind DDD How can I do DEseg or EdgeR analysis b RNAbrowse user manual page 31
23. braries on the contig Each of the library has a colour in the table and on the graphic The screen shot hereunder presents the different elements of the depth view 1 the library table containing informations about the libraries such as average read depth and total number of seguences for the contig 2 The graphical depth overview presents a different locations of the contig the depth of aligned seguences for each library 3 the library can be removed or added to the graphical view by clicking on their name in the menu Sequence View JBrowse View Depth View Select Libraries You Want To Display In The Graphic Show 25 entries Search Sample name 5 Mean depth Nb of seg Diren diencephal unknown 196 24 4862 Dienh diencephal unknown 185 66 4601 a FoieJ liver unknown 4 32 107 C FoieN liver unknown 4 92 122 _ Hypo hypophyse unknown 47 01 1165 C HypoN hypophyse unknown 37 41 927 W Apply libraries Copy Save to CSW Showing 1 to6 of 6 entries First Prewious 1 Mext Last Depth Graph Based Upon Labeled Libraries A e SS i DienJ BT Ka 197 6bp at position 1237 5 Depth in bp Position on the contig Dien DienN EE Foie de FoieN 3 Hypo HypoN RNAbrowse user manual page 25 32 geno toul bioinfo 3 It is possible to modify the graphical layout by averaging different library depth 1 This is done by first ticking the check boxes in front of the libraries and the by click
24. e query as a bookmark SPARQL O Java 4 Download data the back button to come back to the search page with the selected options the result table including links in blue when available the page navigation bar 12 3 6 4 15 3 BEWARE of the fact that the download file contains a header describing the columns content This even if you ask for the fasta file of the contigs Blast query l on 3 The interface also provides a blast search button The blast is performed on the contig file The following screen shot presents the elements of the blast search page RNAbrowse user manual an entry field to paste the sequence s in fasta format to be blasted query the type of blast search blastn for nucleic sequences blastx for protein sequences the expected value filtering the blast results page 17 32 eno oul ioinfo 3 4 the maximum number of outputs to be shown 5 the clear and run buttons O cr O Blast your query against the contig database Query Form Blast Configuratio Enter query nucleotide or protein FASTA seguence s Parameters Choose a BLAST algorithm basin 2 Filter query sequence E Expect value 10 Output max hit 10 5 Clear Form 0 Run Blast The blast results are shown 1n a table added at the bottom of the search windows presented on the next page The blast result table includes the following elements 1 a
25. filter on the contig name This filter can be used by pasting a list of contig names in the entry field or by uploading a file using the link under the entry field SEARCH DATASETS Database Dicentrarchus labrax day and night bd Datasets rnasegDenowo e FILTER CONTIGS ON Contigs Annotations Gene ontology retrieved from best hit only Keyword retrieved from swissprot and trembl best hit only Expression SNPs CONTIG NAME Name one line per contig name Once a field has been used as a filter 1 a cross appears on the right hand side 2 Click on this cross to remove the filter LENGTH Length gt 1100 Length lt Once the filters have been set the user has to decide which data will be part of the output table produced by the search The data are presented in different blocks and chosen by ticking the check boxes located in from of the field names seen next screen shot The fields in the table will be in the order of selection To change the order you have to untick the boxes are restart the selection process RNAbrowse user manual page 15 32 ATTRIBUTES ATTRIBUTE COLUMNS TO VIEW CONTIGS GENERAL INFO Contig id key S Name Depth Length BEST ANNOTATION O Database C Accession O Species O Gene O Description O Enzyme code O Evalue O Score O hit identity O Query conserved O Query coverage O Query identity O Subject covera
26. ge Once the output data 1s selected the user has to click on the Go button to launch the search BEST ANNOTATION O Best annot species O Best annot gene O Best annot consequences O Best annot exon five prime limit O Best annot exon three prime limit Cl Best annot base on ref O Best annot snp on ref The search results are displayed as a table only the first 1000 lines can be browsed RNAbrowse user manual page 16 32 PreviewbD spiaying rows 1 20 out of 1000 ying rows of LA geno toul bioinfo o Contig id key 49501 49502 49504 49505 49508 49510 49511 49514 49521 49522 49524 49526 49527 49528 49532 49533 49535 49537 49538 49540 k Entries 28164 53832 e223 4 amp 6 7 8 9 10 Next Bookmark REST SOAP LOC101161546 OB LOC 10069594 LOC 101157355 contig_049505 SOMA_MORSA 3 3 LOC100707644_ORENI 1 1 LOC101063003_TAKRU 2 3 LOC 100705067_ORENI 1 1 ZBBX_PIG 1 1 LOC100692729 ORENI 1 1 LOC 100699946 ORENI 1 1 LOC 100708342 ORENI 1 1 LOC 100709383 ORENI 1 1 WU FB99D03 DANRE 3 3 LOC 100699516 ORENI 2 2 PR_ORENI 1 1 LOC 101061151 _TAKRU 1 1 LOC 101072939 TAKRU 2 3 LOC 100700214 ORENI 1 1 MKS1_ORENI 1 1 The previous screen shot presents the result table including 1 2 3 4 5 the corresponding REST SOAP guery the SPAROL code the java code the result tabulated text files different access means to the results of th
27. geno DO a a y S Fou oR SIGENCE ioinfo RNAbrowse user manual RNAbrowse user manual page 1 32 geno bioinfo Version table Version Authors Date Modifications Remarks 0 1 CK June 14th 2013 Initial version 0 2 CN amp CK July 17th 2013 Screen shots definitions 0 3 CK October 23rd 2013 New screen shots RNAbrowse user manual page 2 32 geno 00 y y bioinfo Table of content Ke re e Lo FFYNNU FFF E FYN FRY NE FFR FYR NYFED FYW FFF RYAN EY ERFYN HWN 2 Lu eaw PEO PO EI vesesecbe tdngniegausetentey cece 5 LACA A o O 6 PO RNS AS HY Y UY AT FFRWTI en A 6 leen 7 PAS HO DOE COROS ias 8 Table and Pra Mo a 9 ENEE 9 EE 10 lb ean Ree EC DDD AE 11 Wego Gene Ontology analvets rr 13 EE A I AA 14 IOMA Cy ee 14 ET 17 Conta E eg e tooo 19 Contig general information page tien 19 l cu SCC uo Le A o PO duct enon cues alonclecoe saa nuuancesvodeces 23 La A E E E a 23 Conti dept VICW cinesdasisscrahebavsaactoseendist ianodestunseabehsnbansbesuondissdaaciaadesteahalsinbenubesesedsctbensdaresncanieesidounes 25 SINE LINDA irritaci n 2 SNP eege 21 SNP Indol ocne e ee ee VIS Wii NN FFAN 28 Eeer 29 SNE ie Wie AUIS We AAA PP Po PO EI EEF EF SAY NF 29 DG VO ek 31 Erequentir asked Cr E 32 Conclusion and future work 33 RNAbrowse user manual page 3 32 geno O amp a y y bioinfo Screenshots cs o IA l A A E ro PO A 6 FO VAS RYN NT YA CEFN E AFF YRU OFN FFYN EFNF
28. ibraries and the ones which are specific to a library for which only sequences of this library are aligned on the contig To build a new diagram the user has to select the libraries he wants to have in each pool from two to five then select Venn in the bottom left menu and click the run button A new frame will appear In this frame a spinning wheel will inform you that the job is been processed Once the result is available it will be displayed as shown in the next screen shot The libraries used in each pool are listed in the table on the top of the frame with the corresponding colour in the diagram If you click on a figure in the graph the list of corresponding contigs will appear m the list box on the right hand side of the frame The contig names are links to the corresponding pages To close the frame light box use the cross located in the top right corner or the close button at the right side of the frame This is true for all frames RNAbrowse user manual page 10 32 geno 3 toul 4 bioinfo y Venn diagram analysis o Selected Libraries Used To Build The Venn Diagram DienJ ACTTGA L006_R1 DienN GATCAG L006_R1 FoieJ ATCACG LO06_R1 FoieN TTAGGC_L006_R1 HypoJ TAGCTT_L006_R1 Venn s Diagram Click On A Number To Display The Corresponding Elements Common elements in Pool Pool3 Pool4 APOl4KDA ORENT 7 16 APOA4A ORENT 1 1 DPSE 6422896 DROPS 2 2 FEP15 ORYLA 1 1 HEPC MORCS 2 6 HEPC MORCS 4 6 LOC10000
29. ing on the apply label button at the left bottom side of the table 2 The window present here will open and permit to select the name given to the previously select libraries or to create a new name using the add button 3 When the modification is applied the different libraries have the same name and the depth values in the graphic are the average depth values of these libraries This can typically be used when you want to merge replicates The table 1 and graphic 2 have been updated RNAbrowse user manual page 26 32 geno 00 y YNE WTI A toul 08c SIGENOL bioinfo Oe VA 7 WN Select Libraries You Want To Display In The Graphic Show 25 entries Search Dev stage Mean depth Nb of seq Dien diencephal unknown 196 24 4862 CEN DienN diencephal unknown 185 66 4601 Foie liver unknown 4 32 107 Gn FoieN liver unknown 4 92 122 Hypo Hypo hypophyse unknown 47 01 1165 E HypoN hypophyse unknown 37 41 927 W Apply label toselediedlibraries Copy SavetoCSV Showing 1 to 6 of 6 entrie First Previous 1 Next Last Depth Graph Based UP arie x Depth in bp Position on the contig Dien DienN SS Foie wr FoieN Hypo Variants page The environment has also been design to be able to store and present variation related data This is done in the Variants section presented in the global menu of the project see screen shot below Variants general information page The element
30. nown se 29371375 GAIX O O HypoN_GGCTAC_LOO6_R1 HypoN 1 hypophyse unknown se 28567049 GAIIx O O Perform a on the selected libraries Significant threshold 0 05 2 Run Copy Saveto csv Showing 1 to 6 of 6 entries First Previous a 1 Next e e Last Then select the libraries to be merged in the pools Select the significance threshold you want RNAbrowse user manual page 11 32 geno 00 y AE PAN 3 ke GG SIGENCE bioinfo to use five values are available 0 05 0 02 0 01 0 001 and 0 0001 Then click on the run button The following frame will appear This frame shows the selected library pools with the corresponding colours and invite you to enter your e mail address because of the time needed to process the data DDD analysis o Selected Libraries a ven malade saine Digital Differencial Display The DDD analysis has not been launched yet with the parameters you ve provided Processing may be long so please provide an email address to be warned as soon as the job is completed Run DDD close Once the processing is finished an e mail will be sent to your address This e mail contains a link to the DDD results Hello The ddd analysis you have launched is complete To see your results click on this link http Please do no respond to this mail Clicking on the link will redirect you to the corresponding web page example shown on the next page The result page contains four parts
31. pmbab glycoprotein M amp Ab Source 7FIN Acc 7 DB GENE 0307 10 8 184 B ENSDARP00000112234_6 70 Danio rerio gpm6 amp ab glycoprotein M6Ab Source 7FIN Acc DB GENE 0307 10 8 184 H ENSDARP00000109235_5 70 Danio rerio gpm6ab glycoprotein M6Ab Source ZFIN Acc DB GENE 030710 8 185 T ENSDARP00000058502_2 75 Danio rerio gpm aa glycoprotein M6 amp Aa Source 7 FIN Acc DB GENE 0307 10 7 184 B i gt d H Showing 1to5 of 5 entries First Previous 1 Next Last RNAbrowse user manual page 29 32 SS Ge gl bioinfo Download page The download page can be access from the main menu of the environment It is structured as presented 1n the next screen shot D Labrax RnasegDenovo SnpindelDenovo Download SnpindelDenovo Files In Your Project gt Variants Calling snp_context txt gz 8 42 Mb snp_count_allele 4 97 Mb des snpdetect vcf 20 08 Mb O Download all Get all URL RnasegDenovo Files In Your Project Assembly contigs Fasta gz 25 19 Mb deel contigs fasta gz 57 bytes deel contigs fasta gz 128 bytes des cont gs Fasta gz 1 45 Kb gt Mapping Statistics ES merged_count csv 1 90 Mb gt lllumina Reads Mapping Against Contigs contigs fasta 2 0 93 Mb per s 1 reference_l bam 1 58 Gb pen s_ _reference_1 2 47 Mb pen s_2 reference_2 bam 1 55 Gb ha s 2 reference 2 2 49 Mb ES s 3 reference 3 bam 1 54 Gb a s 3 reference 3 2 64 Mb 1m s 4 reference 4 bam 1 53 Gb Rar s 4 referente g a 2 65 M
32. s numbered in the hereunder presented screen shot correspond to 1 menu of the table and graphics of the general statistic section 2 general statistic graphical view 3 favourites SNP Indel table the variation favourites are managed as the contig favourites RNAbrowse user manual page 27 32 geno ez SI bioinfo Oe D L DLabraxBrainLiver Contigs Variants Download yi ots Statistics Available General Statistics General statistics There is 13127 contigs containing only SNPs and 23707 contigs with SNPs and Indels InDels size graph d Ae no annotation 93 24 SNPs List Of Your Favorites SNPs On the table bellow are listed all your Favorite SNPs This list has first been initialized with the bestones You can Q search for some others in order to add new ones Show 10 entries Search SNP name Contig name Alleles Position Bestannotspecies O MMP24_ORENI 1 1_194 SNP MMP24_ORENI 1 1 AJG 194 MMP24_ORENI 1 1_665 SNP MMP24_ORENI 1 1 C T 665 E _ MMP24_ORENI 1 1_848 SNP MMP24_ORENI 1 1 T C 846 With selected SNPs Jr Delete from favorites Copy Saveto CSV Showing 1 to3 of 3 entries First Previous 1 Next Last Variants general information view The general information about a variation contains elements about de location alleles and flanking regions of the variation as shown in the next screen shot D L D A Night General Info Alleles View Features View M
33. stem that provides unified access to disparate geographically distributed data sources It is designed to be data agnostic and platform independent such that existing databases can easily be incorporated into the BioMart framework RNAbrowse is organised to present the datasets first in a global graphical manner general statistics before exploring each individual contig or variation In the same way the contig or variation visualisation parts are entered through a summary linking to several more detailed views The system has been build to be easily extendible First new graphics can be added to the statistical views second new databases annotation results can be uploaded and queried last third new analysis pages can be developed and added to any section The first pages general and dataset can be customized to give informations about the corresponding project This document presents all the functions of the environment giving examples when needed of how to use it RNAbrowse is in its first version and many improvements can be made So please feel free to ask questions support genopole toulouse inra fr and modifications or new features using our forge tracker https mulcyber toulouse inra fr pm task php roup_project_id 527 amp group_1d 149 amp func browse RNAbrowse user manual page 5 32 eno OD i a Cie GG SIGENOE bioinfo General layout The general layout section give an overview of the two first pages encountered when
Download Pdf Manuals
Related Search