Cloning of shRNA Templates into shRNA Expression
Contents
1. 5774 PciI Agel 2322 BstBI 2331 AfeI 2391 5352 SfiI Xbal 2735 BsrGI 2797 x Bsu36I 3013 ey A j u 4732 KpnI vA ent ee Een ati d gt PfIFI Tth111I 3567 Ni SMIN BsiWI 3581 Ut BspEI 3638 4133 HincII Rs 3641 BstEII 3659 4131 SalI 4092 SexAI EagI 3973 1 MluI SphI 96 7438 SspI ANKE 612 7114 Scal EcoNI 945 2 MfeI 964 BbvCI 1199 6634 AhdI e PpuMI SanDI 1709 E BspDI ClaI 1798 2 o i BsaAI 1928 Cellecta pRSI16 U6 sh HTS6 UbiC TagRFP 2A Puro T 8025 bp pa o a E PaeR7I PspXI TliI XhoI 2113 f o amp EcoRI 2280 5741 PciI Agel 2289 BStBI 2298 AfeI 2358 5319 Sfi XbaI 2702 BsrGI 2764 7 Bsu36I 2980 PshAI 3354 BamHI 3426 4699 KpnI PfIFI Tthi11I 3534 4695 AccGSI S EY set 4618 NaeI zt 4616 NgoMIV PP RsrII 3608 E BstEII 3626 4100 HincII EagI 3940 4098 SalI SexAI 4059 Cellecta Inc 7 of 10 v 3a 8 29 13 Cloning of shRNA Templates into shRNA Expression Vectors www cellecta com User Manual www decipherproject net RSV S LTR Cellecta pRSI shRNA Expression Bay Lentiviral Vector AmpR Y RRE Fully Customizable Default features shown pRSI U6 sh UbiC RFP 2A Puro as lt shRNA promoter _ BbsI U6 U6 Tet pUC ORI 7 7 5 8 52. health and safety guidelines at your institution regarding the use of lentiviruses and follow standard microbiological practices which include Wear gloves and lab coat at all times when conducting the procedure Always work with pseudoviral particles in a Class II laminar flow hood All procedures are performed carefully to minimize the creation of splashes or aerosols e Work surfaces are decontaminated at least once a day and after any spill of viable material e All cultures stocks and other regulated wastes are decontaminated before disposal by an approved decontamination method such as autoclaving Materials to be decontaminated outside of the immediate laboratory area are to be placed in a durable leakproof properly marked biohazard infectious waste container and sealed for transportation from the laboratory Cellecta Inc 6 of 10 v 3a 8 29 13 Cloning of shRNA Templates into shRNA Expression Vectors www cellecta com User Manual www decipherproject net H Appendix 1 Lentiviral shRNA Expression Vector Maps Standard pRSI12 pRSI16 and Customized 1 MluI SphI 96 7471 SspI NruI 612 7147 Scal EcoNI 945 p MfeI 964 BbvCI 1199 6667 AhdI PpuMI SanDI 1709 BspDI ClaI 1798 BSaAI 1928 DECIPHER pRSI12 UG sh HTS4 UbiC TagRFP 2A Puro 8058 bp J493ouJ0J8 on E EcoRI 2117 PaeR7I PspXI TIiI XhoI 2126 CPPT
3. A Construct a Take 15 ul of each positive bacteria culture from Step B 1 c inoculate each clone in 10 ml of LB broth media with 100 ug ml ampicillin or carbenicillin and grow overnight at 37 C with shaking b Purify shRNA lentivector construct plasmid DNA in Midi or Maxi scale using an Endotoxin free plasmid purification kit Cellecta Inc 4 of 10 v 3a 8 29 13 Cloning of shRNA Templates into shRNA Expression Vectors www cellecta com User Manual www decipherproject net F Technical Support For additional information or technical assistance please contact us Phone 1 650 938 3910 Toll Free 1 877 938 3910 Fax 1 650 938 3911 E mail Technical Support tech cellecta com General Information info cellecta com Sales sales cellecta com Orders orders cellecta com Blog http www cellecta com blog Postal Mail Cellecta Inc 320 Logue Ave Mountain View CA 94043 For more information about Cellecta s products and services please visit our web site at http www cellecta com Cellecta Inc 5 of 10 v 3a 8 29 13 Cloning of shRNA Templates into shRNA Expression Vectors www cellecta com User Manual www decipherproject net G Safety Guidelines The HIV based lentivector system is designed to maximize its biosafety features which include Adeletion in the enhancer of the U3 region of 3 ALTR ensures self inactivation of the lentiviral construct after transduction and integ
4. IV 1 truncated transcription termination and polyadenylation of mRNA in HIV 1 3 LTR transduced cells Required for viral reverse transcription self inactivating 3 LTR with deletion in U3 region prevents formation of replication competent viral particles after integration into genomic DNA SVAN ae Allows transcription termination and polyadenylation of mRNA SV40 SV40 Ori Allows for episomal replication of plasmid in eukaryotic cells SV40 AmpR Ampicillin resistance gene B lactamase for selection of plasmid in paces bacterial cells paratyphi pUC ori pUC bacterial origin of replication pUC Cellecta Inc c element on complementary strand 9 of 10 v 3a 8 29 13 Cloning of shRNA Templates into shRNA Expression Vectors www cellecta com User Manual www decipherproject net I Terms and Conditions Cellecta Inc Limited License Cellecta grants the end user the Recipient of the Product a non transferable non exclusive license to use the reagents for internal research use only as described in the enclosed protocols in particular research use only excludes and without limitation resale repackaging or use for the making or selling of any commercial product or service without the written approval of Cellecta Inc separate licenses are available for non research use or applications The Product is not to be used for human diagnostics or included used in any drug intended for human use Care and attention shoul
5. LIS et Seg x 2 fs 4 A oh mW ww T T 4 1 RS Va f Discovery is yours CELLECTA Cloning of shRNA Templates into shRNA Expression Vectors User Manual v3a 8 29 2013 ATA Ae Let Proce 11 Cloning of shRNA Templates into shRNA Expression Vectors User Manual Table of Contents A ERG m mon gt Background Required Materials Cloning of shRNA Template Oligonucleotides into shRNA Expression Vector Identify clones with the target shRNA template Purify Plasmid shRNA Construct Technical Support Safety Guidelines Appendix 1 Lentiviral shRNA Expression Vector Maps 2 Common Lentiviral Vector Features Terms and Conditions Background www cellecta com www decipherproject net U 8 oO ONN DU HP AUNAN The protocols below provide the instructions on how to phosphorylate shRNA template oligos ligate them to shRNA cloning vectors transform competent cells and grow plasmid DNA to generate plasmid shRNA expression constructs Manual for Packaging and Transduction of Lentiviral Constructs before proceeding with your experiment For packaging of constructs into pseudovirus please refer to the User Please read the entire user manual B Required Materials For Phosphorylation and Annealing of shRNA Template Oligonucleotides e T4 Polynucleotide Kinase and 10X reaction buffer Recommended New England BioLabs T4 Polynucleotide Kinase 10 U ul Cat MO201S rATP Recommended GE Amers
6. d be exercised in handling the Product by following appropriate research laboratory practices Cellecta s liability is expressly limited to replacement of Product or a refund limited to the actual purchase price Cellecta s liability does not extend to any damages arising from use or improper use of the Product or losses associated with the use of additional materials or reagents This limited warranty is the sole and exclusive warranty Cellecta does not provide any other warranties of any kind expressed or implied including the merchantability or fitness of the Product for a particular purpose Use of the Product for any use other than described expressly herein may be covered by patents or subject to rights other than those mentioned Cellecta disclaims any and all responsibility for injury or damage that may be caused by the failure of the Recipient or any other person to use the Product in accordance with the terms and conditions outlined herein The Recipient may refuse these licenses by returning the enclosed Product unused By keeping or using the enclosed Product you agree to be bound by the terms of these licenses The laws of the State of California shall govern the interpretation and enforcement of the terms of these Licenses Limited Use Label Licenses The Recipient acknowledges that the Product has been developed by Cellecta based on licenses from Third Parties and agrees with the Terms of Limited Use for the Recipient provided b
7. filter Plasmid Midi Kit Cat 12243 and EndoFree Plasmid Buffer Set Cat 19048 Please visit the QIAGEN website to download the specialized protocol that is not contained in the user manual gt http wwwi giagen com literature protocols pdf QP15 pdf C Cloning of shRNA Template Oligonucleotides into shRNA Expression Vector 1 Phosphorylate and Anneal the shRNA Template Oligonucleotides gt oan g Note This protocol was developed for regular non phosphorylated oligos If your oligonucleotides are already phosphorylated dilute them to 10 uM in 1X T4 polynucleotide kinase buffer heat at 95 C for 2 min and anneal as in steps 1 d 1 e below Dissolve the shRNA template oligonucleotides in an appropriate amount of deionized water to a final concentration of 20 uM Set up 20 ul phosphorylation annealing reactions for each shRNA template 1 ul Top Strand shRNA template oligo 20 uM 1 ul Bottom Strand shRNA template oligo 20 uM 2 ul 10X T4 Polynucleotide Kinase Buffer 2 ul 5 mM ATP 13 ul Deionized water 1 ul T4 Polynucleotide Kinase 10 U ul 20 ul Total volume For the insert minus control use 2 ul deionized water in place of the top and bottom strands Incubate the phosphorylation reaction at 37 C for 30 minutes in a thermocycler Heat the reaction mix to 95 C for 2 min in a thermocycler Turn off the thermocycler and let it cool to room temperature Take a 2 wl aliquot from the reaction 1 uM shRNA te
8. ham Cat 27 2056 01 For Ligating and Transforming shRNA Constructs e Linearized shRNA Expression Vector e T4 DNA Ligase and 10X ligation reaction buffer Recommended New England BioLabs T4 DNA Ligase 400 U ul Cat M0202S Before using dilute T4 DNA ligase 10 fold with 1X T4 DNA ligase buffer to 40 U ul e Competent E coli cells RecA Recommended Invitrogen OmniMAX 2 T1 cells Cat C8540 03 e Petri plates containing LB Agar media with 100 ug ml Ampicillin or Carbenicillin For Screening shRNA Inserts e Taq DNA polymerase and 10X reaction buffer Recommended BDB Clontech Titanium Taq DNA polymerase Cat 639208 dNTP mix Recommended GE Amersham dNTP set Cat 27 2035 01 e Thermal Cycler e 3 1X TAE Agarose gel e PCR Screening Primers IDT o Forward FwdU6 2 5 CCTAGTACAAAATACGTGACGTAGAA 3 o Reverse R3301 3LTR 5 TGGTCTAACCAGAGAGACCCAGTA 3 To verify the screening primers for non standard and custom vectors please email tech cellecta com Cellecta Inc 2 of 10 v 3a 8 29 13 Cloning of shRNA Templates into shRNA Expression Vectors www cellecta com User Manual www decipherproject net For Purifying shRNA Constructs after Cloning Plasmid purification kit Recommended QIAGEN Endotoxin free Plasmid Kit The following kit combinations can be used for Midi scale preparation of endotoxin free DNA gt QIAfilter Plasmid Midi Kit Cat 12243 and EndoFree Plasmid Maxi Kit Cat 12362 gt QIA
9. ify clones with the target shRNA template 1 Prepare colony cultures a Randomly pick up 10 well separated colonies from each plate and grow each clone in 100 ul of LB Broth with 100 ug ml ampicillin or carbenicillin at 379C for 2 hours with shaking b Take 1 ul of each bacteria culture for PCR screening see B 2 and continue to grow the culture for another 6 hours C Store the bacterial culture at 4 C 2 Screen for shRNA template inserts a Prepare a PCR master mix for each clone you would like to screen for the presence of an ShRNA template insert as follows i rxn 10 rxn Composition 0 5 ul 5 ul Forward PCR Primer 10 uM 0 5 ul 5 ul Reverse PCR Primer 10 uM 0 5 ul 5 ul 50X dNTP mix 10 mM of each 2 5 ul 25 ul 10X PCR Reaction Buffer 19 5 ul 195 ul Deionized water 0 5 ul 5 ul Taq DNA Polymerase 5 U ul 24 0 ul 240 ul Total volume See Appendix b Mix the master mix very well and aliquot 24 ul into each well of a 96 well PCR plate or individual tubes c Add 1 ul of each bacterial culture from B 1 into each well or tube from B 2 b Mix Proceed with PCR using the following program 94 C 4 min 1 cycle 94 C 0 5 min then 68 C 1 min 25 cycles 68 C 2 min 1 cycle e Take 5 ul of PCR product from step d and run it on a 3 agarose EtBr gel in 1X TAE buffer f Confirm identity of shRNA template inserts by sequence analysis of positive PCR products using the Forward PCR primer E Purify Plasmid shRN
10. ing Luciw 1996 HIV 1 HIV 1 Rev response Permits Rev dependent nuclear export of unspliced viral mRNA HIV 1 element RRE Kjems et al 1991 Malim et al 1989 U6 Human U6 promoter drives RNA Polymerase III transcription for Human generation of shRNA transcripts Central polypurine tract cPPT improves transduction efficiency by cPPT facilitating nuclear import of the vector s preintegration complex in HIV 1 the transduced cells UbiC promoter Ubiquitin C promoter drives expression of TagRFP and PuroR Human TagRFP fluorescent protein Evrogen serves as an indicator of slapd TagRFP Entacmaea successful transduction quadricolor Thosea asigna virus 2A translational cleavage site containing 18 amino acid residues Cleavage occurs via a co translational 2A T2A ribosome skipping mechanism between the C terminal glycine and Thosea asigna proline residues leaving 17 residues attached to the end of virus TagRFP and 1 residue to the start of the puromycin resistance marker in the DECIPHER vectors PuroR Puromycin resistant marker for selection of the transduced cells Streptomyces alboniger Woodchuck hepatitis virus posttranscriptional regulatory element Woodchuck WPRE s DE enhances the stability of viral transcripts hepatitis virus 3 Self inactivating long terminal repeat Allows viral packaging but self inactivates the 5 LTR for biosafety purposes Dull et al 1998 The element also contains a polyadenylation signal for AU3 H
11. kb eh Bbs 2i cPPT H1 H1 Tet SV40 ORI AE UbiC SV40 PolyA Re KI Marker promoter SALTR krp PuroR hUbiC CMV hEF1a CMV Ferritin hPGK DERG for tet regulated shRNA for constitutive shRNA expression any combination of expression any combination of Tet Repressor TetR and one or 2 markers GFP RFP PuroR two markers GFP RFP PuroR BleoR NeoR Hygro HK etc BleoR NeoR Hygro HK etc Standard library expression vector used for library construction Specific variations shown are available with custom libraries For sequences and cassette designs for Cellecta vectors please see the Cellecta website http www cellecta com resources vectors or contact Cellecta at tech cellecta com All Cellecta lentiviral vectors including the DECIPHER vectors are covered by a lentiviral expression system license owned by Life Technologies Corporation LTC See Terms and Conditions Cellecta Inc 8 of 10 v 3a 8 29 13 Cloning of shRNA Templates into shRNA Expression Vectors User Manual www cellecta com www decipherproject net 2 Common Lentiviral Vector Features Feature Function Source Rous d virus Allows Tat independent production of viral mRNA Dull et al Rous sarcoma 1998 virus enhancer promoter HIV 1 truncated 5 Permits viral packaging and reverse transcription of the viral mRNA HIV 1 LTR Luciw 1996 Bais tss Allows viral packag
12. mplate and make a 1 5 dilution by adding 8 ul of 1X T4 Kinase buffer Mix well Use 0 5 ul of the diluted shRNA template 0 2 uM for the following ligation reaction 2 Ligate the shRNA Template into Linearized shRNA Lentivector a b Set up 10 ul ligation reactions for each phosphorylated shRNA template as follows 1 0 ul Linearized ShRNA Expression Vector 10 ng ul see Required Materials 0 5 ul Phosphorylated ds shRNA template step 1 0 2 uM 1 0 ul 10X T4 DNA Ligase Buffer 6 5 ul Deionized water 1 0 ul T4 DNA ligase 40 U ul 10 0 ul Total volume For negative control use insert minus Dilute T4 DNA ligase 400 U ul 10 fold to 40 U ul with 1X T4 DNA ligase buffer if you are using New England Biolabs enzyme Incubate the ligation reaction at 16 C for 1 2 hrs Cellecta Inc 3 of 10 v 3a 8 29 13 Cloning of shRNA Templates into shRNA Expression Vectors www cellecta com User Manual www decipherproject net 3 Transform E coli with the ligation product a For each shRNA template use the whole volume of ligation product for transformation Follow the manufacturer s protocol for transforming the competent cells Plate an appropriate amount of cells on LB plates with 100 ug ml ampicillin or carbenicillin and grow overnight at 37 C d You should expect to get at least 10 fold more colonies in experimental samples in comparison with negative control vector only ligation reaction D Ident
13. ration into genomic DNA of the target cells e The RSV promoter upstream of 5 LTR in the lentivector allows efficient Tat independent production of viral RNA reducing the number of genes from HIV 1 that are used in this system e Number of lentiviral genes necessary for packaging replication and transduction is reduced to three gag pol rev The corresponding proteins are expressed from different plasmids lacking packaging signals and share no significant homology to any of the expression lentivectors pVSV G expression vector or any other vector to prevent generation of recombinant replication competent pseudovirus e None of the HIV i genes gag pol rev will be present in the packaged pseudoviral genome as they are expressed from packaging plasmids lacking packaging signal therefore the lentiviral particles generated are replication incompetent Pseudoviral particles will carry only a copy of your expression construct Despite the above safety features use of HIV based vectors falls within NIH Biosafety Level 2 criteria due to the potential biohazard risk of possible recombination with endogenous viral sequences to form self replicating pseudovirus or the possibility of insertional mutagenesis For a description of laboratory biosafety level criteria consult the Centers for Disease Control Office of Health and Safety Web site at http www cdc gov od ohs biosfty bmbl4 bmbl4s3 htm It is also important to check with the
14. s CELLECTA is a registered trademark of Cellecta Inc Cellecta Inc 10 of 10 v 3a 8 29 13
15. y the Third Parties Life Technologies Corporation End User Label License for the use of Lentiviral Expression System This product or service based upon the Lentiviral Expression System is sublicensed from Life Technologies Corporation under U S Patent Nos 5 686 279 5 834 256 5 858 740 5 994 136 6 013 516 6 051 427 6 165 782 6 218 187 6 428 953 6 924 144 7 083 981 and 7 250 299 and corresponding patents and applications in other countries for internal research purposes only Use of this technology for gene therapy applications or bioprocessing other than for nonhuman research use requires a license from GBP IP LLC Please contact GBP IP LLC 537 Steamboat Road Suite 200 Greenwich CT 06830 Use of this technology to make or sell products or offer services for consideration in the research market requires a license from Life Technologies Corporation 5791 Van Allen Way Carlsbad CA 92008 Evrogen IP JSC End User Label License for the use of lentiviral shRNA constructs comprising TagRFP encoded gene This product is for internal non commercial research use only No rights are conveyed to modify or clone the gene encoding fluorescent protein contained in this product The right to use this product specifically excludes the right to validate or screen compounds For information on commercial licensing contact Evrogen Licensing Department email license evrogen com 2013 Cellecta Inc All Rights Reserved Trademark
Download Pdf Manuals
Related Search