ORA SOFTWARE - USER MANUAL
Contents
1. into the same transcript and when they have similar coverage on the two protein coding regions less than 2 fold coverage difference ORA needs a sam file with the reads aligned on the reference genome and optional a eff file reporting the annotation and the position of genes on the genome a test file is available saccharomyces_cerfevisiae_annotation_test_file gff The main output files report the positions of the transcripts identified in the genome with their length and coverage the transcripts IDs based on the genes present in the annotation eff file final_prediction gff and the UTR size all_ UTR DOWNLOADING AND INSTALLATION The trefence based transcriptome reconstruction software ORA is composed by a bash script and four perl scripts launcher pl The launcher is a bash script that runs the single parts of the software it simplify the procedure The other four scripts overlapping_reads_assembler_v2 p1 seconda_parte pl terza_parte pl quarta_parte pl MUST BE in the same folder where the launcher pl was saved The script quarta_parte pl determines the slope of the 5 UTR terminal regions of the transcripts and it helps the identification of alternative transcription start and termination sites TSS TTS After the download of the various scripts IN THE SAME FOLDER make them executable using chmod command Assume the scripts wete downloaded in folder named folder uset machine2. chmod 755 path to foldet launcher pl uset machine chmod 755 path to folder overlapping_reads_assemblet_v2 pl uset machine chmod 755 path to folder seconda_patte pl uset machine chmod 755 path to foldet tetrza_parte pl uset machine chmod 755 path to foldet quarta_parte pl uset machine chmod 755 path to folder estrapola_chr pl MANDATORY AND OPTIONAL FILES In order to work properly ORA needs three files 1 a file with the reads mapped on the reference genome in sam format the file has to be ordered using the samtools Li et al 2009 http samtools soutceforge net an example file is provided sacchatomyces_cerevisiae_3Mreads_ordered sam gz A few lines of the SAM file are reported below cerevisiae tept 7447889 solid0034_20090925_FC1_JGYeast_507_2002_1682 length 35 0 chr01 215 35 35M 0 OACCGTTACCCTCCAATTACCCATATCCAACCCACT lt 9 9 lt lt lt lt lt 9 lt lt lt lt 9 86 76 lt MD Z 35 NMi i 0 X1 Z 1_35_S1E34A25L34_T3Q25_BS1 HI i 1IH i 1 cerevisiae_rep_1 5898722 0 chr01 1117 23 13M402N10M 0 0 AGACGATACTGTGATTTCCAATT 0 amp 190 440 490 amp amp 19 MD Z 23 NMii 0 X2 Z AT AC X3 f 2 X4 0 0004 TH i 1 cerevisiae_rep_1 33834674 16 chr01 1140 21 13M1623N8M 0 0 TATTTAATAGGATGGATGGTA 3 H 9 lt 7762 MD Z 21 NM i 0 X2 Z CT GC X3 5 X4 0 0247 THi i 1 cerevisiae_rep_1 14271585 0 chr01 1196 17 11M1262N6M i 0 0 AGCGGCGTATAAGAATG 6873
3. 200verlap ping 20ORFs 20 Y ALO68W A 20and 20Y ALN69W display Telomeric 20X 20element 20Core 20sequence 200n 20the 20left 20arm 200f 20Chromosome 201 dbxref SGD S000028865 chr01 SGD nucleotide_match 753 763 0 ID TELO1L XC_nucleotide_match Name TEL01L XC_nucleotide_match dice SGD 000028865 chr01 SGD binding site 532 544 i ID TELO1L XC_binding_site Name TELO1L XC_binding_site dbxref SGD 5000028865 chr01 SGD gene 538 792 ID YAL068W A Name Y AL068W A Ontology_term GO 0003674 GO0 0005575 GO 0008150 Note Dubious 20open 20reading 20frame o20unlikely 20to 20encode 20a 20 protein 3B 20identified 20by 20gene trapping 2C 20microarray based 20expression 20analysis 2C 20and o20genome wide 20homology 20searching display Dubious 20open 20reading o20frame o20unlikely 20to 20encode 20a 20functionalo20protein db xtef SGD S000028594 orf_classification Dubious chr01 SGD CDS 538 792 i i 0 Parent YAL068W A Name YAL068W A_CDS orf_classification Dubious chr01 SGD ARS 650 1791 s ID ARS102 Name ARS102 Alias ARSI 1 Note Autonomously 20Replicating 20Sequence display Autonomously 420Replicating 20Sequence dbxref SGD S000121252 chr01 landmark region 24000 27968 ID FLO9 chr01 SGD gene 24000 27968 ID YAL063C Name YAL063C gene FLO9 Alias FLO9 Ontology term GO 0000128 GO 0000501 GO 0005537 GO 0009277 Note Lectin like 20protein20with 20similarity 20to 20Flo1p 2Co20thought 20to 20be 20expressed 20and o20involved 20in 20flocculation d
4. 20X 20element 20combinatorial 20repeats 2C 20and 20a 20short o20ter minal 20stretch 200f 20telomeric 20repeats display Telomeric 20region200n 20theo20left 20arm 200f 20Chromosome o20L dbxtef SGD S000028862 chr01 SGD X_element_combinatorial_repeat 63 336 g ID TEL01L XR Name TEL01L XR Note Telomeric 20X 20element 20combinatorial 220Repeat 20region 2200n 20the 20left20arm 200f 220Chromosome 201 3B 20contains 20repeats 200f 220the 20D 2C 20C 2C 20B 20and 20A 20types 2C 20as 20well 220as 20Tbf1p 20binding 20sites 3B 20formerly 20called 20SubTelomeric 20Repeats display Telomeric20X 20element20Repeat 20region 2200n 20the 20left 20ar m 200f 220Chromosome 201 dbxref SGD S000028866 chr01 SGD gene 335 649 i ID YAL069W Name YAL069W Ontology_term G0O 0003674 GO 0005575 G0O 0008150 Note Dubious 200pen 20reading 20fra me 20unlikely 20to 20encode 20a 20protein 2C 20based 200no20available 20experimental 20and 20comparative 20sequence 20d ata display Dubious 20open 20readingo20frame o20unlikely 20to 20encode 20a 20functionalo20protein dbxref SGD S000002143 orf_cl assification Dubious chr01 SGD CDS 335 649 0 Parent Y AL069W Name Y AL069W_CDS orf_classification Dubious chr01 SGD X_element 337 801 3 ID TEL01L XC Name TELO1L XC Note Telomeric 20X 20element 20Core 20sequence 200n 20the 20le ft 20arm200f 20Chromosome 201 3B 20contains 20a n 20ARS 20consensus 20sequence 2C 20an 20Abfl p 20bindingo20site 20consensus 20sequenceo20and 20two 20small
5. Done Do you want to perform analysis of putative alternative UTRs and slope y n y 4 1 5 and 3 UTRs analysis Chrs checked SS 555555555 Done 8 The software performs the final calculations the user can chose between the generation of an output file for each chromosome or of a single global file the script estrapola_chr pl separate the results into eff files one for each chromosome that can be uploaded in Artemis software Rutherford et al 2000 for a manual check Do you want to produce gff output for each chromosome y n 9 Finally the software can perform a final analysis to check for the presence of putative alternative UTRs and to check the slope of the 5 UTR coverage this part was not validated in the present version of the software Do you want to perform analysis of putative alternative UTRs and slope y n OUTPUT FILES Output files ate saved in a folder having the name assigned to the assembly project by the user at the beginning of the process and they ate localized in the same folder of the software Into the folder named coverage are reported the coverage files separated for each chromosome these files can be visualized with Artemis Rutherford et al 2000 http www sangetr ac uk resources softwate artemis using the command Graph Add user plot unrefinedblocks off is an intermediate file in the transcriptome reconstruction process containing th
6. in the annotation file and can also identify the transcripts that cannot be assigned to any annotated gene 6 The software reports the total number of transcribed regions blocks located into the same transcript that were joined during assembly and also the mean and standard deviation of the size of all the blocks localized into the same gene Number of intergenic blocks joined together 1174 Mean size 170 237 SD size 199 017 The software reports the size distribution of the transcripts generated at this step this will be useful to select in the next step the minimum size of the transcripts that will be reported in the output An example is given below and shows that ORA identify 321 transcript blocks with size between 0 and lt 50 bases 969 with size between 50 and lt 150 bases etc Frequence distribution for block s size aa nama aa an a a a a aS 0 50 gt 739 features 50 100 gt 969 e 100 150 gt 698 features 150 200 gt 321 features Jeen 200 250 gt 164 features E 250 300 gt 125 features 300 350 gt 105 features 350 400 gt 98 features 400 450 gt 72 features 450 500 gt 41 features 500 550 gt 40 features 550 600 gt 41 features 600 650 gt 24 features 65
7. 0 700 gt 25 features 700 750 gt 15 features 750 800 gt 10 features 800 850 gt 17 features 850 900 gt 6 features 900 950 gt 8 features 950 1000 gt 7 features 1000 1050 gt 9 features 1050 1100 gt 8 features 1100 1150 gt 7 features 1150 1200 gt 4 features 1200 1250 gt 2 features 1250 1300 gt 3 features 1300 1350 gt 3 features 1350 1400 gt 1 features 1400 1450 gt 4 features 1450 1500 gt 0 features 1500 1550 gt 1 features 1550 1600 gt 1 features 1600 1650 gt 0 features 1650 1700 gt 1 features The software links all the blocks that are not separated by introns predicted from the spliced reads and that are localized into the same gene this reduces the fragmentation of the transcripts 7 The user can select the minimum size of the blocks that will be reported in the output file Insert minimum intergenic blocks size default 170 237 Genes without reference deleted 1245 on the base of the coverage 203 of 1507 Chrs checked Done Genes moved in array other 25 Chrs checked Done Final refinement of the terminal regions removes very low coverage regions 3 1 Refinement of predicted genes with mean coverage in their terminal parts higher than 20 Chrs checked Done Refined genes 481 3 2 Calculation of the new mean coverage for each gene Chrs checked
8. 62045645944 amp MD Z 17 NM i 0 X2 Z CT GC X3 f 5 X4 f 0 2671 IH i 3 cerevisiae_rep_1 5849818 solid0034_20090925_FC1_JGYeast_400_1721_1293 length 35 16 chr01 1807 34 35M 0 OCTAGTNTGCGATAGTGTAGATACCGTCCTTGGATA gt gt gt lt lt lt 8 lt 8 lt gt 55 lt 3 1685 MD Z 35 NMii 0 X1 Z 35_1_S1E34A24L34_T0Q30_BS1 HI i 5IH i 10 cerevisiae_rep_1 12676941 solid0034_20090925_FC1_JGYeast_858_1992_548 length 35 16 chr01 1807 35 35M 0 OCTAGTTTGCGATAGTGTAGATACCGTCCTTGGATA 9 lt 99 lt gt lt 9 gt gt 97 8 2 lt MD Z 35 NMii 0 X1 Z 35_1_S1E34A25L34_T0Q23_BS1 HI i 7IH i 10 cerevisiae_rep_1 18230516 solid0034_20090925_FC1_JGYeast_1232_1125_2015 length 35 16 chr01 1807 33 35M 00 CTAGTNTGCGNTAGTGTAGATACCGTCCTTGGATA 844 71144 1514562401 812 6 24 MD Z 35 NM i 0 X1 2 35_1_S1E34A19L34_T0Q21_BS1HLi 6 TH i 10 cerevisiae_rep_1 2328659 solid0034_20090925_FC1_JGYeast_165_258_875 length 35 16 chr01 1814 35 35M 0 OGCGATAGTGTAGATACCGTCCTTGGATAGAGCACT lt lt lt gt gt P gt gt lt gt gt 2 gt lt gt lt 3 gt 44 MD Z 35 NM i 0 X1 2 35_1_S1E34A27L34_T3Q25_BS1 HI i 5IH i 9 cerevisiae_rep_1 6586352 solid0034_20090925_FC1_JGYeast_450_536_92 length 35 16 chr01 1814 35 35M i 0 OGCGATAGTGTAGATACCGTCCTTGGATAGAGCACT 18 lt lt lt 33533 13 5523 703 3 00 lt MD Z 35 NMii 0 X1 Z 35_1_S1E34A24L34_T3Q27_BS1 HI i 5IH i 9 cerevisiae_rep_1 6851993 solid0034_20090925_FC1_JGYeast_467_1136_1246 length 35 16 chr01 1814 35 35M 0
9. OGCGATAGTGTAGATACCGTCCTTGGATAGAGCACT 9 97 lt A gt 9 lt 9 lt 9 lt gt 3 2 89 87 MD Z 35 NM i 0 X1 Z 35_1_S1E34A26L34_T3Q23_BS1 HI i 5IH 1 9 2 a file with chromosomes names and their lengths an example file is provided saccharomyces_cerevisiae_S288c_input txt An example of the file structure is reported below hr01 230208 hr02 813178 hr03 316617 hr04 1531918 hr05 576869 hr06 270148 hr07 1090947 hr08 562643 hr09 439885 hr10 745745 hr11 666454 hr12 1078175 hr13 924429 hr14 784333 hr15 1091289 hr16 948062 Mit 85779 2micron 6318 O T T O O D mi O O Tm OO ED ES a 3 a gff file with the genome annotation the structure of the gene features reported in this file is identical to that reported in the egff file present in the SGD database an example file is provided saccharomyces cerevisiae annotation test_file gfP a few lines of the file are reported below chr01 a chromosome 1 230218 chr01 dbxref NCBI NC_001133 Name chr01 chr01 seb telomeric_repeat 1 62 ID TELO1L TR Name TELO1L TR Note Terminal 420stretch 20of 420telomeric 20repeats 200n 20the420leFt 20arm 200f 20Chromosome201 display Terminal 20t elomeric 20repeats 200n 20the 20left 20arm 200f 20Chromosome 20L dbxtef SGD S000028864 chr01 SGD telomere 1 801 ID TEL01L Name TEL01L Note Telomeric20region 200n 20the 20left 20arm 200 20C hromosome 201 3B 20compo sed 200f 20an 20X 20element o20core 20sequence 2C
10. ORA SOFTWARE USER MANUAL Disclaimer This software is provided AS IS without warranty of any kind This is developmental code and we make no pretension as to it being bug free and totally reliable Use at your own risk We will accept no liability for any damages incurred through the use of this software Use of ORA is free and the program is open soutce How to cite If you publish results obtained in part by using ORA then we require that you acknowledge this by citing the program as follows Sardu A 1 Treu L 2 Campanato S 3 2014 Transcriptome structure variability in Saccharomyces cerevisiae strains determined with a newly developed assembly software BMC Genomics 15 1045 doi 10 1186 1471 2164 15 1045 1 Department of Biology University of Fribourg Chemin du Mus e 10 CH 1700 Fribourg FR Switzerland 2 Department of Environmental Engineering Technical University of Denmark Anker Engelunds Vej 1 Building 101A 2800 Kes Lyngby Denmark 3 Department of Biology University of Padua Via Ugo Bassi 58 b Padova 35131 Italy Contact for information please contact Alessandro Sardu Alessandro sardu unift ch Stefano Campanato stefano campanato gmail com FOR IMPATIENT PEOPLE Download the software from https sourceforge net projects transctiptomeassemblyora files saving all the files launcher pl overlapping_reads_assembler_v2 pl seconda_parte pl terza_parte pl quarta_parte pl e
11. e transcripts assembled without the support of the reference annotation file histogram blocks noref gff contains the size distribution of the transcript blocks assembled at the first step without the support of the reference file final_prediction gff is THE MAIN OUTPUT FILE with the transcripts in gff format assembled considering the information in the gff annotation file all UTR contains the size of the 5 and 3 UTR regions calculated considering the transcripts identified and the protein coding regions reported in the eff file unrefinedblocks stat reports the statistics of the shotgun reads used for assembly the number of unique reads aligned only in one genomic position the number of not unique reads etc The files slope 5UTR cluster 3UTR cluster 5UTR report some information on the 5 and 3 UTR coverage for the transcripts having a coverage higher than 20 and an UTR size equal or higher than 100 bp These files are a representation of the coverage distribution around the transcription start site TSS It is known that several genes have alternative UTRs Analysis of the coverage profile can help the identification of the genes having a sudden and stepwise increase of the coverage in the UTR region these can represent alternative UTRs During this task ORA splits the UTR regions in four equal parts it calculates the mean coverage for each one a
12. et al 2009 The SAM output obtained from this step has to be ordered using SAM tools we provide a small bash script to manage this procedure sam_sorter pl sam_sorter pl needs as input only a compressed sam file sam_file gz and prior to use the script it is necessary to set the correct path to the folder were sam tools were saved lines 21 23 25 27 uset machine perl sam_sorter pl path to the sam_file gz Alternatively the user can directly run the sam tools view and sort EXAMPLE HOW TO PERFORM THE TRANSCRIPTOME PREDICTION After the short reads alignment process and the order sam step you are ready for the last step We assume you have changed your working directory moving into the folder containing the software using the cd command To run the software use the following command line launcher pl followed by three arguments the sam file the file with chromosome names and size and the gff file with the annotation optional see below uset machine folder launcher pl file_sam_odeted sam chtoms_name_and_size txt annotation_file gff After launching the software user has to set some parameters if you do not have clear in mind how to set the parameters values please use the default In grey are highlighted the parameters required by the software 1 the user can select only unique reads of the sam file for transcriptome reconstruction those univocally aligned or both the unique and t
13. he multiple aligned reads Do you want to use unique teads only y n 2 The user can select the minimum number of reads assembled into a single block this is very important to reduce the background since a lot of reads are singletons aligned into the genome in random positions Insert minimum number of reads to define a block default 5 3 The user can select the maximum distance between transcripts to consider them as independent transcripts this is very important because some internal regions of the transcripts can have zero coverage and frequently this effect is due to biases on the RNA seq process transcripts closer than selected threshold will be joined in a single transcript Insert maximum distance between reads allowed to merge them in a single block default 20 4 The software calculates the number of reads in the input file the number of unique reads and the number of reads per chromosome The software assembles the transcript blocks for genes having low coverage and for genes having regions that are difficult to sequence these blocks do not cover the entire transcript and they can be joined in the subsequent step to obtain a better prediction of the transcript structure If the annotation file was not provided to the software it will complete the process at this step 5 If the annotation file was provided the software can assign the vast majority of the transcripts to the genes reported
14. isp lay Lectin like 20protein 20with o20similarity 20to 20Flo1p dbxref SGD S000000059 orf_classification Verified chr01 SGD tRNA 139152 139254 ID tP UGG A Name tP UGG A gene TRN1 Alias TRN1 Ontology term GO 0005829 GO 0006414 GO 0030533 Note tRNA Pro 3B 20target 200f 20K 20lactis 20zymocin display Rane Pro dbxref SGD S000006680 chr01 SGD intron 139188 139218 Parent tP UGG A Name tP UGG A_ intron ee ik 5000006680 chr01 SGD noncoding exon 139152 139187 3 Parent tP UGG A Name tP UGG A_noncoding_exon dbxref SGD S000006680 chr01 SGD noncoding_exon 139219 139254 3 Parent tP UGG A Name tP UGG A_noncoding_exon dbxref SGD 5000006680 chr12 SGD rRNA 451575 458432 ID RDN37 1 Name RDN37 1 gene RDN37 1 Alias RDN37 1 RDN37 Note 358 20ribosomal 20RNA 20transcript 2C 20encoded 20by 20the 20RDN1 20locus 2C 20that 20is 20processed 20into 20the 20258 2C 20188 20and 205 8S 20rRNAs 20 represented 20by 20the 20RDN25 2C 20RDN18 2C 20and 20R DN58 20loci display 35S 20ribosomal 20RNA o20transcript dbxref SGD S000006486 chr12 SGD external_transcribed_spacer_region 451575 451785 r f Parent RDN37 1 Name RDN37 1_external_transcribed_spacer_tegion dbxref SGD S000006486 The relevant fields separated by tab spacers are 1 the chromosome name it is mandatory that names of the chrs scaffolds are IDENTICAL than those reported in the a file with chromosomes names and their lengths see above 2 the method followed for gene ann
15. nd calculates the ratio between the coverage of each part and the average coverage of the ORF producing four ratio values As a positive control it calculates a fifth ratio from a window inside the ORF with a size equal to the other four This fifth ratio is a control that helps to determine if the coverage modification could be due to an uneven profile ot to a real alternative TSS or TTS For each gene and each step the output is reported into the files cluster 3UTR and cluster 5UTR where are reported the gene name mean coverage size of UTR and values of the five windows from the outermost to the innermost of the transcript Ratios close to 1 indicate similar mean coverage on adjacent windows Output can be analyzed using software like MeV Saeed et al 2003 http www tm4 org mev html to genetate clustets of transcripts having similar UTR coverage behaviors ORA also analyzes the coverage profile around the TSS to determine if the profile reaches a value similar to the mean coverage level of the gene within the first 30 bases ORA calculates for each base starting from position 1 to 30 the coverage increment normalized with respect to the mean coverage of the gene using the formula Slope X anabyzed X before ORF mean coverage value where x analyzed is the coverage at the current position and x mpr is the coverage one base upstream The output file named slope 5UTR shows
16. otation SGD manual 3 features VERY IMPORTANT only features named gene tRNA snoRNA and snRNA considered by the software those having different names are discarded 4 transcript start 5 transcript end 6 a character 7 the strand or itis VERY IMPORTANT 8 a character 9 some characteristics separated by 5 characters the ID name field is MANDATORY because it defines the name of the gene s that will be assigned to the transcripts in the output files In the gene names please do not use characters like or other characters tRNAs must follow the standard nomenclature ID tF GAA B the t at the beginning in lowercase letter If the gff file with the genome annotation is not available ORA stops after the first transcriptome reconstruction step and it provides as output only the positions of the transcripts blocks that it was able to reconstruct but usually the transcripts are highly fragmented and obviously they cannot be referred to the annotated genes PRELIMINARY STEPS HOW TO ALIGN SEQUENCES ON THE REFERENCE GENOME Before transcriptome reconstruction process reads have to be aligned on the reference genome using short treads alignment software and the output file in SAM format has to be ordered This procedure can be afforded using a fast splice junction mapper for RNA Seq reads like TopHat Trapnell et al 2009 or PASS Campagna
17. other software generating an output in sam format a test file is available saccharomyces_ cerevisiae _3Mreads_ordered sam gz If you are analyzing lower eukaryotes we suggest to use a software that can manage spliced reads this allows introns identification The SAM output obtained from reads alignment has to be ordered using for example the samtools Li et al 2009 http samtools soutceforge net 4 Introns identification requires that spliced reads were identified by the software used for short reads alignment if this software cannot find and align spliced reads introns cannot be identified and are not reported by ORA in the final output 5 ORA requires a file with the name and the size of the chromosomes of the reference genome a test file is available saccharomyces_ cerevisiae S288c_ input txt 6 It performs reconstruction starting from short reads obtained from RNA seq It is best suited to manage the transctiptomes of lower eukaryotes with a low number of introns per gene usually zero or one per gene and it can be used also for prokaryotes Policistronic transcripts are reported in the output file both for eukaryotes where they are very rare and for prokaryotes and can be easily found in the output file final _prediction gff because the transcript ID has two different protein coding genes IDs Policistronic transcripts were found only when two adjacent genes on the same strand are included
18. strapola_chr pl into the same folder ORA requires 1 an ORDERED sam file obtained aligning reads on the reference genome 2 a file with the name and the size of the chromosomes and optional but strongly recommended 3 a eff file with the annotation of the reference genome having a format compatible of that reported in the SGD Decompress the sam file using gunzip command uset machine folder gunzip name_of_the_sam_file gz Run the software using uset machine folder launcher pl file_sam_odeted sam chroms_name_and_size txt annotation_file gff and follow the instruction provided by the software step by step RELEVANT NOTES 1 ORA software function on any standard Linux based environment it requires perl and a relevant amount of physical memory it requires approximately 5 10 Gb of RAM memory for the assembly of a typical transcriptome like that of Saccharomyces cerevisiae sequenced with 20 30 million of reads aligned on the reference genome 2 ORA is a software for reference based transcriptome reconstruction and for this reason it requires a reference genome where the reads obtained from the RNA seq process were aligned before the transcriptome reconstruction process 3 To align the reads on the reference genome you can use a software like PASS Campagna et al 2009 http pass cribi unipd it cgi bin pass pl or Bowtie Langmead et al 2009 http bowtie bio sourceforge net index shtml or any
19. the gene name mean coverage the first and last base position analyzed and finally the thirty ratios calculated using the formula Output can be analyzed using MeV software Saeed et al 2003 REFERENCES Campagna D Albiero A Bilardi A Caniato E Forcato C Manavski S Vitulo N Valle G PASS a program to align short sequences Bioinformatics 2009 1 25 7 967 8 Langmead B Trapnell C Pop M Salzberg SL Ultrafast and memoty efficient alignment of short DNA sequences to the human genome Genome Biol 2009 10 3 R25 Li H Handsaker B Wysoker A Fennell T Ruan J Homer N Marth G Abecasis G Durbin R 1000 Genome Project Data Processing Subgroup The Sequence Alignment Map format and SAMtools Bioinformatics 2009 Aug 15 25 16 2078 9 Rutherford K Parkhill J Crook J Horsnell T Rice P Rajandream MA Barrell B Artemis sequence visualization and annotation Bioinformatics 2000 16 10 944 5 Trapnell C Pachter L Salzberg SL TopHat discovering splice junctions with RNA Seq Bioinformatics 2009 May 1 25 9 1105 11 Saeed AI Sharov V White J Li J Liang W Bhagabati N Braisted J Klapa M Currier T Thiagarajan M Sturn A Snuffin M Rezantsev A Popov D Ryltsov A Kostukovich E Borisovsky I Liu Z Vinsavich A Trush V Quackenbush J TM4 a free open source system for microarray data management and analysis Biotechniques 2003 Feb 34 2 374 8
Download Pdf Manuals
Related Search