Home

"user manual"

Contents

1. 1 Grow a single colony picked from a freshly streaked LB kanamycin 25 ug mL plate in a starter culture of 5 mL LB medium containing kanamycin 25 ug mL and incubate in a shaking incubator for approx 8 h at 37 C with vigorous shaking at 300 rpm Inoculate a 500 mL LB kanamycin 25 g mL culture with 1 mL of the starter culture and grow as in step 1 for 12 16 h Transfer the culture to clean centrifuge tubes and pellet the bacterial cells at 7500 rpm for 15 min Resuspend the bacterial pellet in 10 mL of P1 buffer containing RNase A 100 ug mL until there are no visible clumps Add 20 mL of P2 buffer and mix gently by inverting the tube 10 times and leave at room temperature for 5 min Add 20 mL of chilled P3 buffer mix immediately by inverting four to five times and incubate on ice for 20 min Fluorescent In Situ Hybridization 79 10 LI 12 13 14 Centrifuge at 9500 rpm for 30 min at 4 C In the meantime prepare the Qiagen tip by adding 10 mL of equilibration buffer QBT and allowing to drip through by gravity flow If the supernatant is clear pipet onto the Qiagen tip and allow to enter the resin by gravity flow If the supernatant is not clear centrifuge again before applying to the Qiagen tip Wash the Qiagen tip with 2 x 10 mL buffer QC To elute the DNA apply 5 mL buffer QF prewarmed to 50 C see Note 6 Precipitate the DNA with 0 7 vol isopropanol at room temperature
2. 5 Pour off solution 2 remembering to reuse for up to three gels Add 400 mL of freshly prepared silver staining solution 3 see Note 5 Place the tray in a fume cabinet and leave for 20 min shaking occasionally A small amount of powdery black precipitate should be observed when solution 3 is added and the bands slowly appear on the gel during this stage 6 Pour off solution 3 and rinse the gel twice with deionized water Add 400 mL of silver staining solution 4 and leave for 15 min see Notes 13 15 7 Take two sheets of precut cellophane and soak in a sink of tap water The sheets become pliable when wet ensure that the whole sheet is adequately soaked 8 Place a drying frame inner section over the platform ensuring that the inner sec tion is in the correct orientation Place a moistened sheet of cellophane over the inner section ensuring that the whole of the inner section is covered 9 Gently slide an old sheet of X ray film under the gel while still in solution 4 Carefully pour off solution 4 and rinse the gel briefly twice with tap water Lift the gel out of the staining tray using the X ray film as a support onto a clean area of benching or plastic sheet The gel can now be carefully unfolded and unwanted areas of the gel trimmed away by pressing with the edge of a ruler If the whole gel is to be dried down then the gel will have to be cut in half and dried down in two separate frames 10 Transfer the gel onto the cellophane
3. 10 mM MgCl Stop solution for nonfluorescent gel based detection 95 formamide 10 mM EDTA pH 8 0 0 05 xylene cylanol 0 05 bromophenol blue see Note 3 Stop solution for fluorescent gel based detection 95 formamide 10 mM EDTA pH 8 0 0 05 crystal violet see Note 3 Sterile double distilled H O Thin walled reaction tubes 200 or 500 uL 2 3 Gel solution 6 10 acrylamide bis 19 1 solution 7 M urea 0 5X Tris borate Gel Electrophoresis EDTA TBE buffer 0 5X TBE gel running buffer pH 8 3 44 5 mM Tris 44 5 mM borate 1 mM EDTA pH 8 0 Ammonium persulfate 10 w v TEMED Teflon flat bottomed combs and spacers 0 5 mM thick 2 Glass plates 20 x 20 cm nonfluorescing for use with fluorescence imager or standard for chemiluminescence detection Gel electrophoresis support Power supply capable of supplying up to 2000 V Visualization of CFLP Patterns 1 Fluorescence Detection Hitachi FMBIO 100 Fluorescent Method Bio Image Analyzer Hitachi Soft ware San Bruno CA or Molecular Dynamics 595 FluorImager Molecular Dynamics Sunnyvale CA Lint free laboratory wipes Lens paper Nonfluorescing detergent e g RBS 35 Detergent Concentrate Pierce Rock ford IL 2 4 2 Chemiluminescence Detection jk W LOX SAAP 1 M NaCl 0 5 M Tris base pH 10 0 1X SAAP 0 1 sodium dodecyl sulfate SDS 100 mM NaCl 50 mM Tris Base
4. 2 The wash was not stringent enough decrease the SSC concentration High background to probe signal Chromosomes have The slide may have been overdenatured remake the denatur poor morphology ation solution ensure that the temperature is 75 C and that slide is denatured for 2 min only If codenaturing ensure that the temperature of hybridization chamber is 75 C If the slides still have poor morphology decrease the denaturation time or denaturation solution temperature 0 1 x total volume 3 M sodium acetacte pH 5 2 2x total volume cold 100 ethanol Mix well and incubate at 20 C for 30 min and centrifuge for 30 min at 13 000 rpm Remove the supernatant and wash the pellet with 200 uL cold 70 ethanol recentrifuge for 10 min Remove the supernatant and air dry the pellet before resuspending in distilled sterile water 8 The enzyme mixture is heat sensitive keep at 20 C until just before use and replace immediately after use 9 Human COT 1 DNA blocks repetitive sequences within single copy probes or whole chromosome libraries 10 Herring sperm DNA acts as carrier DNA and aids the precipitation of probe DNA It also blocks the nonspecific attachment of probe to the slide surface 86 Dyer and Green 11 Take care to avoid trapping air bubbles as the probe will not hybridize to target DNA under the bubbles 12 This step allows COT 1 DNA included in the probe mixture to hybridize to repetitive sequences within
5. and high solutions are prepared by mixing appropriate volumes of 0 and 80 denaturant polyacryla mide solutions see Note 6 The volume of the low and high solutions is dependent up on the total volume held by the glass plates The INGENYphorU plates hold a total volume of 55 mL Therefore 27 5 mL volumes of low and high solutions are prepared separately for each denaturing gradient gel The low and high solutions should be placed at 4 C for 15 min before pouring Place the gradient maker on a magnetic stirrer positioned 25 30 cm above the top edge of the glass plate sandwich The connection between the two chambers should be closed and the exit tube should be clamped Insert the end of the exit tube into the top of the glass plate sandwich this may be facilitated by attaching a yellow tip onto the end of the tubing Place a magnetic bar into the high chamber see Fig 3 The apparatus is now ready for pouring a gradient gel Add appropriate volumes of 10 APS and TEMED to the low and high denaturing solutions and mix gently 140 uL of 10 APS and 14 uL TEMED are added to the 27 5 mL solutions required to make an INGENYphorU gel Pour the low denaturant solution into the low chamber Briefly open the con nection between the two chambers to release a small quantity of polyacrylamide into the high chamber This action prevents air bubbles blocking the connec t
6. one of the addresses we will used later For this reason navigation is accomplished by using hyperlinks displayed in the now ubiquitous Web browsers Hyperlinks can readily be identified on Web pages because they are usually represented as underlined text in color or as a button that is pressed by clicking on it with the computer mouse and cursor If the pointer is positioned over the hyperlink the address or URL it represents will appear in the status bar at the bottom of the browser window Single click on the hyperlink and the Web browser will load the page at the new address Hyperlinks can refer to different places in the same document or to totally new addresses Hyperlinks should be traversed with care as it is all to easy to fol low links without thinking and end up miles from home both figuratively and literally It is usually possible to retrace the original path by pressing the Back button but take care this does not always work All Web browsers record a history of traversed links which can be used to connect rapidly to recently visited sites 1 3 Databases and the Web Since the early days of DNA and protein sequencing such information has been deposited in computer databases so that many individuals could access this information When the World Wide Web greatly expanded the reach of net worked computers it was not long before the Web browser became the interface between a very widely scattered population of res
7. 4 10 Ammonium persulfate prepared by adding 1 g ammonium persulfate to 10 mL water This solution may be kept at 4 C for several weeks 5 TEMED W 6 6 T Guilliatt Power supply Siliconizing solution dimethyl dichlorosilane e g Sigmacote 3 Methods 3 1 Agarose Gel Electrophoresis 3 1 1 Assembly and Pouring of the Gel 1 2 Seal the edges of the UV transparent plastic casting tray with strong masking tape or use a commercial gel casting system see Note 8 Place the tray gel caster onto a horizontal section of bench using a glass leveling plate if necessary and place the comb s in the appropriate position s so that wells are formed at the cathode end of the gel Add the desired amount of powdered agarose to a measured quantity of 1X elec trophoresis buffer in an Erlenmeyer flask or beaker and cover with Saran Wrap Heat the mixture in a microwave oven swirling every 30 s until the agarose is visibly seen to have dissolved Alternatively the agarose can be heated using a hot plate Any undissolved agarose appears as small translucent particles see Note 9 Allow the solution to cool to 50 C unless a high concentration of agarose or high gelling temperature agarose is used where gelation will occur more rapidly A low level 0 5 ug mL of ethidium bromide can be added at this stage allowing the progression of the electrophoresis to be analyzed during electrophoresis by illuminating the
8. 50 mL PNM buffer 125 uL fluoroscein avidin 2 mg mL Detection Reagent III 50 mL PNM buffer 100 uL mouse monoclonal anti digoxin 100 mg mL 50 mL PNM buffer 500 uL sheep anti mouse Ig digoxygenin 200 mg mL 500 uL sheep anti mouse Ig digoxygenin 200 mg mL 50 mL PNM buffer 500 uL sheep anti digoxygenin rhodamine 200 mg mL These chemicals are light sensitive handle in reduced light conditions at all times 50 mL PNM buffer 125 uL fluoroscein avidin 2 mg mL 100 uL mouse monoclonal anti digoxin 100 mg mL 50 mL PNM buffer 500 uL biotinylated anti avidin D 0 5 mg mL 50 mL PNM buffer 125 uL fluoroscein avidin 2 mg mL 500 uL sheep anti digoxygenin rhodamine 200 mg mL 84 Dyer and Green excess buffer by touching the end of each slide to a paper towel Do not allow the slide s to dry out completely 2 Apply 10 uL of the appropriate counterstain to the marked hybridization area of each target slide 3 Cover the hybridization area with a 22 x 32 mm coverslip avoiding air bubbles and store at 4 C in the dark until ready for microscopic evaluation 3 7 Microscope Evaluation A fluorescent microscope is required for analysis of FISH preparations and good signal intensities are achieved using a 100 W mercury bulb The micro scope needs to be fitted with excitation and barrier filters appropriate for the fluorescent labels used At this stage slides are prone to fa
9. 8 Dzik S 1998 The power of primers Transfusion 38 118 121 9 Hengen P N 1997 Optimizing multiplex and LA PCR with betaine Trends Biomed Sci 22 225 226 10 Henke W Herdel K Jung K Schnorr D and Loening S A 1997 Betaine improves the PCR amplification of GC rich DNA sequences Nucl Acids Res 25 19 3957 3958 Further Reading Bauer P Rolfs A Regitz Zagrosek V Hildebrandt A and Fleck E 1997 Use of manganese in RT PCR eliminates PCR artifacts resulting from Dnase I digestion 2 Biotechniques 2 1128 1132 Maudru T and Peden K 1997 Elimination of background signals in a modified polymerase chain reaction based reverse transcriptase assay J Virol Meth 66 247 261 Tang Y Procop G W and Persing D H 1997 Molecular diagnostics of infectious diseases Clin Chem 43 11 2021 2038 Vaneechoutte M and Van Eldere J 1997 The possibilities and limitations of nucleic acid amplification technology in diagnostic microbiology J Med Microbiol 46 188 194 7 Allele Specific Oligonucleotide PCR Elaine K Green 1 Introduction Many single base substitutions that lead to inherited diseases the predispo sition to genetic disorders and cancer are increasingly being discovered The ability to amplify specific DNA sequences by the polymerase chain reaction PCR 1 has made it possible to rapidly and accurately diagnose many inher itable diseases Prior to t
10. Exon 3 gives a typi cal SSCP pattern of two discrete bands corresponding to the forward and reverse strands Note how the patterns of shifts are different for each mutation i e the SSCP pattern of lanes 13 and 14 are quite similar but their heteroduplex mobility shifts are completely different Also note how both lanes 15 and 16 are not discernible by SSCP analysis alone but they give rise to clear and characteristic heteroduplex mobility shifts 14 Store the dried down gels flat and away from moisture Avoid bending and fold ing the gels because they are very brittle see Note 17 3 3 Interpretation 1 SSCP heteroduplex gels are straightforward to interpret Provided that a control normal sample is loaded onto each gel an SSCP shift or heteroduplex of differ ing mobility is indicative of the presence of a sequence difference Common poly morphisms may complicate interpretation but the use of controls of known polymorphism genotype and experience allows the most complex of combina tions to be successfully interpreted see Figs 2 4 for examples of typical data 2 ssDNA has a much lower mobility than dsDNA in the native acrylamide gels used for SSCP heteroduplex analysis Consequently the limiting factor for reso lution of SSCP shifts is the need to retain the dsDNA on the gel For maximum resolution the dsDNA should be run as close to the end of the gel as possible The ssDNA SSCPs tends to stain a reddish brown color whe
11. Med 329 1982 1987 Rowan A J and Bodmer W F 1997 Introduction of a myc reporter tag to improve the quality of mutation detection using the protein truncation test Hum Mutat 9 172 176 Becker K F Reich U Handschuh G Dalke C and H fler H 1996 Non radioactive protein truncation test nrPTT for rapid detection of gene mutations Trends Genet 12 250 Gardner R J Bobrow M and Roberts R G 1995 The identification of point mutations in Duchenne muscular dystrophy by using reverse transcription PCR and the protein truncation test Am J Hum Genet 57 311 320 Protein Truncation Test 107 6 10 11 12 13 14 15 16 17 18 19 Whittock N V Roberts R G Mathew C G and Abbs S J 1997 Dystrophin point mutation screening using a multiplexed protein truncation test Genet Test 1 115 123 van der Luijt R Khan P M Vasen H Van Leeuwen C Tops C Roest P et al 1994 Rapid detection of translation terminating mutations at the adenomatous polyposis coli APC gene by direct protein truncation test Genomics 20 1 4 Prosser J Condie A Wright M Horn J M Fantes J A Wyllie A H et al 1994 APC mutation analysis by chemical cleavage of mismatch and a protein truncation assay in familial adenomatous polyposis Br J Cancer 70 841 846 Hogervorst F B L Cornelis R S Bout M van Vlie
12. or indirectly labeled by the incorporation of a reporter molecule e g biotin d UTP or digoxygenin d UTP If probes are indirectly labeled they must be detected posthybridization using a reporter binding fluorescent molecule A schematic representation of the FISH principle is shown in Fig 1 Fluorescent in situ hybridization probes fall into three main categories depending on the region of the genome to which they hybridize repetitive sequence probes single copy probes and whole chromosome libraries Repeti tive sequence probes are specific for repetitive DNA regions found within the human genome Centromeric probes are a family of repetitive sequence probes hybridizing to mainly a satellite DNA found near the centromeres of all human chromosomes Subtelomeric probes are also repetitive sequence probes Single copy probes are specific for unique sequences within the genome Whole chromosome libraries are made up of a mixture of DNA sequences com prising the entire length of a specific chromosome these probes are also known as chromosome paints From Methods in Molecular Biology vol 187 PCR Mutation Detection Protocols Edited by B D M Theophilus and R Rapley Humana Press Inc Totowa NJ 73 74 Dyer and Green Target DNA fixed on microscope slide a i Label and Denature ae ar Indirect Direct Labeling labeling Hybridisation Probe binds to ae complementary target sequences binding fluorochrome
13. where 6 However after hybridization the filter is probed with a P labeled DNA fragment from the FVII gene This genomic probe called p114 12 is a 647 bp Stul Sacl restricted FVIII 7 The probed filter is exposed to an X ray film Hyperfilm MP Amersham for 4 7 d at 70 C in a cassette fitted with an intensifying screen In this polymorphism a restriction fragment of variable length of 879 bp and or 1165 bp can be detected in Southern blots of genomic DNA About 42 of females are heterozygous at this locus Figure 1 shows the Restriction Fragment Length Polymorphism 33 ee ieee iib e 2 0 86 bpp Fig 1 A family with history of hemophilia A was investigated for Bc I polymor phism and found to be fully informative Patient II 2 has inherited the hemophilic haplotype 0 8 bp from her mother who is the daughter of a hemophiliac and an obligate carrier The patient s sister II 1 is also a carrier and has the hemophilic haplotype whereas his other sister II 3 is unaffected She has inherited the unaffected 1 1 bp haplotype from her mother Southern blot using restricted DNA samples with Bci I and probed with the 32P labeled p114 12 probe 3 4 Use of PCR and Bcll RFLP Analysis in Hemophilia A The same RFLP identified by Bc I Southern blotting has now been demon strated by PCR followed by digestion with the restriction enzyme 6 The PCR product of this highly polymorphic allele gives a 142 bp allele and
14. 70 Ethanol store at 20 C 2 2 Probe Labeling 1 Nick translation kit e g Roche Diagnostics cat no 976776 containing dNTPs buffer DNA polymerase DNase I enzyme mix Labeled dUTP digoxygenin 11 dUTP biotin 11 dUTP fluoroscein 11 dUTP or Texas Red 11 dUTP at a concentration of 0 4 mM see Note 1 0 2 M EDTA pH 8 0 Herring sperm DNA Gibco BRL 5 ug mL Human COT 1 DNA Gibco BRL 1 mg mL 100 Ethanol 3 M Sodium acetate pH 5 2 Glycogen 20 mg mL Gibco BRL 20X SSC Dissolve 87 66 g NaCl and 44 11 g Na citrate in 500 mL distilled HO dH O Adjust pH to 7 0 Autoclave and store at room temperature 10 For use with repetitive sequence probes Hybridization buffer 1 HB1 contain ing 50 formamide Dissolve g dextran sulfate in 5 mL deionized formamide see Note 2 by heating to 70 C Add 1 mL 20X SSC and adjust pH to 7 0 Make up final volume to 10 mL with dH 0 Store at 20 C OS Sue N OEN DUP Y Fluorescent In Situ Hybridization 77 Table 2 Suggested Stringency Washing Conditions Repetitive sequence Single copy Chromosome library SSC concentration 0 5X SSC 2X SSC 1X SSC Temperature 75 C 75 C 75 C Time 5 min 5 min 2 x 5 min To prepare various SSC concentrations use 20X SSC see Subheading 2 2 and dilute as appropriate e g to make 2X SSC use 1 vol of 20X SSC to 9 vol H20 Tncubate wash chamber containing SSC in a 75 C water bath for at least 30 m
15. Depending on the sequence the record may contain infor mation on biologically important areas of the sequence e g promoters start AUG introns etc followed by the final and most important part of the record the sequence itself 2 2 Searching for Database Entries That Match a Sequence The first step of the human genome sequencing project has involved identi fying those DNA sequences most important for a cell These code for proteins synthesized by the cell which defines the cell s enzymatic complement and therefore its function For this reason people have been isolating the mRNAs expressed in cells converting them to DNA cDNA cloning and sequencing them in their thousands These expressed sequences are given the jargon name of Expressed Sequence Tag EST and will define the proteins made by a cell As the sequencing of the human genome progresses the function of more and more DNA protein sequences will be identified It is now routine to generate many ESTs and then to compare them with sequences in the databases to determine their function A number of such ESTs are given in Table 1 2 8 along with one bacterial gene 1 The next procedure illustrates how to com pare these sequences against the DNA databanks using Basic Local Alignment Search Tool BLAST to find out what they code for 1 Identify a sequence to use this can be an in house sequence or one of those provided in Table 1 Copy the sequence to your clipboa
16. Hybridization Protocol 3 For Use with Whole Chromosome Libraries Whole chromosome libraries are usually used for the characterization of metaphase chromosomes rather than interphases cells where the signals appear as indistinct often overlapping domains Dual color painting refers to the simultaneous application of two differentially labeled chromosome libraries to target chromosome spreads 1 At least 30 min prior to hybridization prewarm a lidded plastic Coplin jar con taining denaturation solution in a 75 C water bath The water bath should be sited in a Class 1 fume hood to contain formamide fumes Mark the hybridization area on the underside of each target slide using a diamond pen If using a single library dilute 3 uL of labeled library with 7 uL HB2 per slide mix well For dual color painting use 3 uL of each of two differentially labeled chromosome libraries and 4 uL HB2 per slide Denature the probe s at 75 C for exactly 5 min Snap chill on ice for 30 s and prehybridize at 37 C for at least 2 h see Note 12 Shortly before the end of prehybridization check that the temperature of the denaturation solution is 75 C Denature the target slide s in denaturation solu tion for exactly 2 min Dehydrate the target slide s by incubating through an ice cold alcohol series 2 min in each of 75 95 and 100 methanol and dry briefly on a 50 C hot plate Apply 10 uL denatured probe mix to the marked hybridization ar
17. L 1997 The use of a genetic map of biallelic markers in linkage stud ies Nat Genet 17 21 24 Nickerson D A Taylor S L Weiss K M Clark A G Hutchinson R G Stengard J Salomaa V Vartiainen E Boerwinkle E Sing C F 1998 DNA sequence diversity in a 9 7 kb region of the human lipoprotein lipase gene Nature Genet 19 233 240 Sun G L Diaz O Salomon B von Bothmer R 1999 Genetic diversity in Elymus caninus as revealed by isozyme RAPD and microsatellite markers Genome 42 420 431 Gusella J F Wexler N S Conneally P M Naylor S L Anderson M A Tanzi R E Watkins P C Ottina K Wallace M R and Sakaguchi A Y 1983 A polymorphic DNA marker genetically linked to Huntigton s disease Nature 306 234 238 Risch N and Merikangas K 1996 The future of genetic studies of complex human diseases Science 273 1516 1517 Risch N and Teng J 1998 The relative power of family based and case con trol designs for linkage disequilibrium studies of complex human diseases Genome Res 8 1273 1288 Larrey D Berson A Habersetzer F Tinel M Castot A Babany G Letteron P Freneaux E Loeper J and Dansette P 1989 Genetic predisposi tion to drug hepatotoxicity role in hepatitis caused by amineptine a tricyclic an tidepressant Hepatology 10 168 173 Collins F S Brooks L D and Chakravarti A 1998 A DNA po
18. Molecular Cytogenetics Protocols and Applications edited by Yao Shan Fan 2002 In Situ Detection of DNA Damage Methods and Protocols edited by Vladimir V Didenko 2002 Thyroid Hormone Receptors Methods and Protocols edited by Aria Baniahmad 2002 Combinatorial Library Methods and Protocols edited by Lisa B English 2002 DNA Methylation Protocols edited by Ken 1 Mills and Bernie H Ramsahoye 2002 Liposome Methods and Protocols edited by Subhash C Basu and Manju Basu 2002 Neural Stem Cells Methods and Protocols edited by Tanja Zigova Juan R Sanchez Ramos and Paul R Sanberg 2002 Mitochondrial DNA Methods and Protocols edited by William C Copeland 2002 Oxidants and Antioxidants Ultrastructural and Molecular Biology Protocols edited by Donald Armstrong 2002 Quantitative Trait Loci Methods and Protocols edited by Nicola J Camp and Angela Cox 2002 Posttranslational Modifications of Proteins Tools for Functional Proteomics edited by Christoph Kannicht 2002 RT PCR Protocols edited by Joseph O Connell 2002 PCR Cloning Protocols 2nd ed edited by Bing Yuan Chen and Harry W Janes 2002 Telomeres and Telomerase Methods and Protocols edited by John A Double and Michael J Thompson 2002 High Throughput Screening Methods and Protocols edited by William P Janzen 2002 GTPase Protocols The RAS Superfamily edited by Edward J Manser and Thomas Leung 2002 Epithelial Cell Culture Protoc
19. The kit contains 200 uL aliquots of the TnT T7 Quick master mix which should be thawed and refrozen no more than twice After thawing and using part of a 200 uL aliquot divide the remaining master mix into smaller aliquots For example aliquots of 50 uL of master mix is sufficient for five 12 5 uL reactions T7 luciferase control DNA 0 5 mg mL Supplied withTnT T7 Quick Coupled Transcription Translation system Promega Ltd Store at 20 C Nuclease free HO Supplied with TnT T7 Quick Coupled Transcription Trans lation system Promega Ltd Store at 20 C Redivue L S methionine see Notes 7 and 8 specific activity 37 TBq mmol 1000 Ci mmol product code AG1594 Amersham Life Science Store at 20 C Observe local regulations for handling and disposal of radioactive isotopes SDS PAGE and Autoradiography mask and gloves when weighing out the solid SDS if possible use a fume cup board SDS is extremely irritating to the respiratory system by inhalation and by direct contact with eyes and skin SDS PAGE sample loading buffer Mix 2 mL glycerol 2 mL 10 SDS w v 0 25 mg bromophenol blue and 2 5 mL of 0 5 M Tris buffer pH 6 8 add dH 0 to a final volume of 9 5 mL Just before use add 0 5 mL 6 Mercaptoethanol Stored at room temperature the loading buffer is stable for about 1 wk and then discard and prepare a fresh batch Mercaptoethanol is harmful by inhalation and contact with skin as well as
20. This can be removed by spraying the gel with a little household polish and then rubbing the gel firmly with a soft cloth References 1 Orita M Iwahana H Kanazawa H Hayashi K and Sekiya T 1989 Detec tion of polymorphisms of human DNA by gel electrophoresis as single strand conformation polymorphisms Proc Natl Acad Sci USA 86 2766 2770 Tassabehji M Newton V E Turnbull K Seemanova E Kunze J Sperling K et al 1994 PAX3 gene structure and mutations close analogies between Waardenburg syndrome and the Splotch mouse Hum Mol Genet 7 1069 1074 Makino R Yazyu H Kishimoto Y Sekiya T Hayashi K 1992 F SSCP fluorescence based polymerase chain reaction single strand conformation poly morphism PCR SSCP analysis PCR Meth Applic 2 10 13 Hongyo T Buzard G S Calvert R J and Weghorst C M 1993 Cold SSCP a simple rapid and non radioactive method for optimized single strand conformation polymorphism analyses Nucl Acids Res 21 3637 3642 Sheffield V C Beck J S Kwitek A E Sandstrom D W and Stone E M 1993 The sensitivity of single strand conformation polymorphism analysis for the detection of single base substitutions Genomics 16 325 332 White M B Carvalho M Derse D O Brien S J and Dean M 1992 Detecting single base substitutions as heteroduplex polymorphisms Genomics 12 301 306 Gan
21. and dTTP in distilled water Store at 20 C for up to 1 mo 6 15 pmol primers 1 forward and 2 reverse approx 0 1 ug uL for a 20 mer 5 U uL Taq polymerase 8 Mineral oil Store at room temperature 2 2 RT PCR Programmable thermal cycler 2 Sterile distilled water Use fresh and keep supply separate from that used for DNA PCR 3 15 pmol of primers 1 forward and 2 reverse approx 0 1 ug uL for a 20 mer Store at 20 C N ra PCR Principles Procedures and Parameters 41 4 10X Reaction buffer see Subheading 2 1 items 3 and 4 5 5 mM dNTPs see Subheading 2 1 items 5 6 5X Reverse transcriptase RT buffer containing 250 mM Tris HCl pH 8 3 375 mM KCl and 15 mM MgCl This is usually supplied with the reverse transcriptase Store at 20 C 7 Maloney Murine Leukaemia Virus MMLYV Reverse Transcriptase 200 U uL Store at 20 C 8 100 mM Dithiothreitol DTT Store at 20 C 9 Rnase inhibitor 50 U uwL Store at 20 C 10 5 U uL Taq polymerase Store at 20 C 11 Mineral oil Store at room temperature 3 Methods 3 1 DNA PCR Note Always wear and frequently change gloves to prevent contamination by DNA from human skin cells As likely sources of contamination include other samples and previous amplification products separate rooms away from sites of DNA RNA extraction manipulation and recovery of PCR products should ideally be allocated for the setup of PCR
22. e Search for like DNA sequences in online databanks e Locate DNA sequences in genomes e Compare modern human DNA sequences e Compare modern human DNA sequences to Neanderthal e Compare modern human DNA sequences to other organisms EMBnet DNA analysis tutorial http www ie embnet org other tut html This tutorial considers three popular sets of DNA and protein sequence analy sis programs The Staden Package from Rodger Staden et al MRC Laboratory of Molecu lar Biology Cambridge UK e The Wisconsin Package GCG from the Genetics Computer Group Inc Madison WI e EGCG Extended GCG from a consortium of researchers mostly based in Europe at EMBnet Nodes University of Adelaide A tutorial on sequence analysis From sequence to struc ture http www microbiology adelaide edu au learn index html An unusual tutorial by Harry Mangalam subtitled one person s cautionary tale of model building Index A ABI PRISM 111 122 Agarose see Gel electrophoresis Amplification refractory mutation system ARMS see ASO PCR Alkaline phosphatase 18 Allele specific oligo PCR ASO PCR 44 47 cycling conditions 49 primer design 49 Autoradiography 20 32 69 B Basic Local Alignment Search Tool BLAST 196 201 Big Dye Terminators 66 71 119 Bioinformatics 193 BiomassPROBE 184 185 Biotin 57 Bovine serum albumin 13 Bromophenol blue 4 9 C CA repeat 30 CDP Star 171 Ca
23. open end of glass plate on a universal Conformation Sensitive Gel Electrophoresis 145 3 10 3 3 ja W Insert comb into the mouth of the glass plates at the required well depth To prevent the introduction of air bubbles the gel plates can be overfilled before comb insertion Clamp the gel plates together with bulldog clips starting from the bottom of the plates Allow the gel mix to run out of the mouth of the plates and past the comb Check that the comb has not been dislodged and clamp firmly into place Leave the gel to polymerize for at least 1 h in this position checking regularly for leaks If leaks do occur top up gently with the remaining gel mix Loading and Running the Gel Remove comb from precast CSGE gel see Note 10 Slit the tape at the bottom of the gel with a scalpel blade to allow buffer access and place gel in electrophoresis apparatus Add 0 5X TTE to fill reservoirs Gently clean wells with 0 5X TTE buffer from reservoir using 50 mL syringe and needle see Note 11 Prerun gel at 750 V for 1 h Turn off power and clean out all wells again with 0 5X TTE see Note 11 Pipet 2 uL aliquots of loading buffer onto parafilm parafilm can be temporarily attached to the workbench by wetting with a small amount of water Mix 2 8 uL of heteroduplexed sample with 2 uL loading buffer and load onto the CSGE gel see Notes 2 and 5 Depending on the speed of sample loading wells should be
24. pH 10 0 0 1 SDS w v 1X SAAP 1 mM MgCl 100 mM NaCl 50 mM Tris base pH 10 0 1 mM MgCl Sequenase Images 5X Blocking Buffer cat no US75354 Amersham Pharmacia Biotech Streptavidin Alkaline Phosphatase Conjugate cat no US11687 Amersham Pharmacia Biotech CDP Star substrate cat no MS250R Tropix Bedford MA 172 Heisler and Lee 7 Isopropanol 8 Latex gloves powder free 9 X ray film 0 Positively charged nylon membrane pore size 0 2 um e g Nytran Plus Mem brane Schleicher and Schuell Keene NH 11 Blotting paper 20 x 20 cm cat no 28303 100 VWR Scientific 12 Sealable plastic bags 13 Forceps 14 Small plastic containers for processing membranes 15 Darkroom film developing facilities 16 Permanent laboratory marker 3 Methods 3 1 Purification of PCR Generated Fragments see Note 1 PCR amplification should be performed according to established protocols for the particular locus in question When PCR products are visualized by gel electrophoresis followed by sensitive detection of the label to be used to visu alize CFLP products contamination by labeled primers and prematurely trun cated single stranded PCR products is evident These contaminating DNA species are effectively removed by the procedures noted In particular the HPPPPK procedure has been proven effective for eliminating lower molecular weight i e gt 100 bp DNA species whereas Exonucle
25. protective goggles or a face shield that efficiently blocks ultraviolet radiation should be worn 16 The bottom corners of the plates is where leaks are most likely to occur An alternative method is to seal the glass plate with a strip of filter paper impreg nated with catalyzed acrylamide or use a commercial gel casting apparatus 17 Examples of typical acrylamide gel formulations are shown in Table 4 18 The pore size of the matrix is affected by the temperature at which polymeriza tion occurs and the optimum polymerization temperature is approx 25 30 C The concentration of catalysts used to initiate the polymerization reaction and the time taken for gelation to occur also affects the pore size Agarose and Polyacrylamide Gel Electrophoresis 11 19 20 It is important to wash out the wells thoroughly as any unpolymerized acrylamide in the wells may subsequently polymerize giving rise to irregular surfaces which lead to distorted bands It is important that the gel is not loaded symmetrically as the orientation of the gel can become lost during subsequent steps as it is removed from the plates for visualization and staining When loading the samples do not attempt the expel of any remaining sample from the pipet as the resulting air bubbles may blow out the sample from the well It is important not to take too long to complete the gel loading process as the samples may diffuse from the wells References 1 Helling
26. see Note 1 Longer GC clamps may be required for the sensitive analysis of particularly GC rich sequences 8 The introduc tion of a GC clamp increases the percentage of mutations detectable by DGGE close to 100 in fragments up to 500 bp therefore making it more sensitive than other commonly used mutation detection systems Successful DGGE requires knowledge of the melting behavior of each DNA fragment to be analyzed Optimal DGGE results are obtained if the DNA frag ment under analysis contains only one or two melting domains excluding the GC clamp domain In fragments containing two melting domains the GC clamp should be positioned immediately adjacent to the domain with the higher melting temperature Computational analysis using software such as MELT95 Denaturing Gradient Gel Electrophoresis 127 Low Gradient Linearly increasing denaturing gradient High Gradient Fig 1 Schematic diagram showing the electrophoresis of normal lane A and mutant lane B PCR fragments The normal PCR product in lane A has two melting domains X and Y and the melting temperature of X T X is higher thatn that of Y i e T X gt TmY As the normal fragment migrates through the linearly increasing denaturing gradient gel domain Y melts before domain X and the branched seg ment of Y causes retardation of the whole PCR fragment A mutation in domain Y marked with an increases the T of domain Y Y therefore melts at a higher denat
27. touching the well base Salts collecting at the base of the well will be seen as a viscous liquid The CSGE gels can stretch when mishandled mainly at the edges where the gel has come away from the glass plate Care must be taken to avoid agitating the gel when staining and destaining A CSGE gel that has become unstuck from the plain glass plate will grow a few centimeters in all directions Therefore stretch ing the gel can affect the results and must be avoided Make a note of the orientation of the gel Cut a corner off each segment of the gel to indicate the location of the first sample loaded To help to locate the DNA bands when using the hand held UV light samples of similar size should be loaded in clusters The detection of minor changes is improved when samples are loaded adjacent to a wild type sample or negative control Samples will not be visualized with a hand held UV light before the gel is transferred from the glass plate to the blotting paper The procedure of transferring the CSGE gel with 3MM paper can be repeated if required to reposition the gel for accurate documentation It is important to document all CSGE results Banding patterns can vary from large band separations to slightly thicker bands when compared with the negative control All banding patterns that differ from the negative control must be treated as a positive result until proven otherwise References i Ganguly A Rock M J and Prockop D J
28. 1 Preparation of DGGE Gel System It is important to use thoroughly cleaned glass plates as grease and dust may disrupt the denaturing gradient gel during pouring Plates should there Denaturing Gradient Gel Electrophoresis 137 fore be washed in water immediately after use and cleaned with 100 ethanol before use 1 Assemble the glass plates and spacer s according to manufacturers instructions GRI or other company If using a homemade system use plates that are at least 20 cm by 20 cm and use spacers that are 0 75 1 mm thick Insert the glass plate sandwich in to the electrophoresis cassette so that the inner smaller plate faces inwards to create an upper buffer chamber Insert the plexi glass pressure unit so that it rests against the larger outer glass plate this prevents over tightening of the screws and therefore plate cracking during electrophore sis Lift the U shaped spacer until it locks into position and tighten all screws to secure the glass plate sandwich into the electrophoresis unit The design of the U shaped spacer prevents leakage of the gradient gel during pouring The comb may be inserted at this point in to the top of the glass plate sandwich 3 2 Preparation of Denaturing Gradient Gel For each denaturing gradient gel prepare appropriate low and high poly acrylamide solutions e g 30 and 60 denaturant solutions should be prepared to make a 30 60 denaturing gradient gel The low
29. 10 APS 47 uL TEMED 33 uL 4 Pour in between the plates and allow it to set for 1 h Save the rest of acrylamide solution to check for its polymerization see Note 11 Prerun the gel for 15 min at PR 12A 1200 6 Load 2 uL of the sample from Subheading 3 4 2 3 above Dilute Rox GS 2500 1 5 in formamide loading dye Heat it at 92 C for 2 min and use 2 uL of this as a marker see Note 12 7 Electrophorese the gel on GS12A 1200 for 5 h 8 Analyze the gel using Genescan software Fig 3 Nn 118 Waseem et al hydroxylamine oem bun eee ey Migdia45 6 785 Ii full length segment Z Fig 3 Gel image of mismatch products obtained by Genescan software on ABI PRISM 377 DNA Sequencer Lane M Genescan 2500 Rox marker lanes and 6 patient UKA162 with G to T mutation at nt 1798 leading to 50 nt deletion in mRNA lanes 2 and 7 patient UKA160 with A to G mutation at nt 1763 see Note 13 lanes 3 and 8 patient UKA144 with A to G mutation at nt 1801 Lanes 4 and 9 patient UKA133 with C to T mutation at nt 1636 lanes 5 and 10 are wild type controls Mutation Detection in Factor VIII 119 3 6 Analysis of the Promoter and Polyadenylation Signal Region Samples with mutations in the promoter or polyadenylation signal region of factor VIII may have reduced levels or no transcripts Therefore RNA samples that fail to amplify or do not give any mismatch bands see Note 13 should be screened for the mutations in these regions S
30. 13 67 71 Pieles U Zurcher W Schar M and Moser H E 1993 Matrix assisted laser desorption ionization time of flight mass spectrometry a powerful tool for the mass and sequence analysis of natural and modified oligonucleotides Nucl Acids Res 21 3191 3196 K ster H Tang K Fu D J Braun A van den Boom D Smith C L Cotter R J and Cantor C R 1996 A strategy for rapid and efficient DNA sequencing by mass spectrometry Nat Biotechnol 14 1123 1129 Fu D J Tang K Braun A Reuter D Darnhofer Demar B Little D P O Donnell M J Cantor C R and K ster H 1998 sequencing exons 5 to 8 of the p53 gene by MALDI TOF mass spectrometry Nature Biotechnol 16 381 384 Berkenkamp S Kirpekar F and Hillenkamp F 1998 Infrared MALDI mass spectrometry of large nucleic acids Science 281 260 262 Braun A Little D P and K ster H 1997 Detecting CFTR gene mutations by using primer oligo base extension and mass spectrometry Clin Chem 43 1151 1158 Braun A Little D P Reuter D Muller Mysock B and Koster H 1997 Improved analysis of microsatellites using mass spectrometry Genomics 46 18 23 19 An Introduction to Bioinformatics Henry Brzeski The purpose of this chapter is to illustrate how to obtain information on DNA and protein sequences from databases This is most conveniently achieved using a Web browser Netscape or Internet Explorer This c
31. 1993 Conformation sensitive gel electrophoresis for rapid detection of single base differences in double stranded PCR products and DNA fragments evidence for solvent induced bends in DNA heteroduplexes Proc Natl Acad Sci USA 90 10 325 10 329 Bhattacharyya A and Lilley D M J 1989 The contrasting structures of mis matched DNA sequences containing looped out bases bulges and multiple mis matches bubbles Nucl Acids Res 17 6821 6840 Ganguly A and Prockop D J 1995 Detection of mismatched bases in double stranded DNA by gel electrophoresis Electrophoresis 16 1830 1835 Williams I J Abuzenadah A Winship P R Preston F E Dolan G Wright J et al 1998 Precise carrier diagnosis in families with haemophilia A use of con formation sensitive gel electrophoresis for mutation screening and polymorphism analysis Thromb Haemost 79 723 726 Hinks J L Winship P R Makris M Preston F E Peake I R and Goodeve A C 1999 Conformation sensitive gel electrophoresis for precise haemophilia B carrier analysis Br J Haematol 104 915 918 150 Williams and Goodeve 6 10 Ge 12 13 14 K rkk J Annunen S Pihlajamaa T Prockop D J and Ala Kokko L 1998 Conformation sensitive gel electrophoresis for simple and accurate detection of mutations Comparison with denaturing gradient gel electrophoresis and nucle otide sequencing Proc Natl
32. 2 vol of ethanol see Note 6 and place on ice for 5 min Centrifuge at 12 000g for 15 min Carefully remove the supernatant remember that it is radioactive and wash the pellet in 70 ethanol Air dry the pellet for 10 min and resuspend in the required amount of TE 10 100 uL The labeled DNA can be either immediately separated by gel electrophoresis and detected by autoradiography see Note 7 or digested further with a second restriction enzyme In either case it is a good idea to count a 1 uL sample in a scintillation counter between 5000 and 10 000 counts are required to detect the fragment by autoradiography Possible causes of poor labeling and pos sible solutions are discussed in Notes 8 10 3 2 End Labeling with T4 Kinase 1 Dissolve 1 2 ug of restriction enzyme digested DNA in 44 uL of dH 0 Add 5 uL of 10X CIP buffer and 0 05 1 U of CIP see Note 11 Incubate for 30 min at 37 C see Notes 12 and 13 Heat inactivate at 60 C for 10 min Phenol extract and precipitate as in Sub heading 3 1 steps 3 5 see Notes 14 and 15 Resuspend the DNA in 17 5 uL of dH O0 Add 2 5 uL of 10X kinase buffer 5 uL of P y ATP and 1 uL of T4 kinase Incubate at 37 C for 30 min Add 1 uL of cold ATP and incubate for a further 30 min see Note 16 Phenol extract and precipitate as in Subheading 3 1 steps 3 6 see Note 17 4 Notes 1 Unlabeled dNTPs are required for two reasons First the labeled nucleotide ma
33. 3 Methods 3 1 Manual Cycle Sequencing 3 1 1 Purification of PCR Products Before Cycle Sequencing Purify the PCR products prior to sequencing using a Geneclean Kit II Anachem according to manufacturer s instructions see Note 1 3 1 2 Termination Cycle Sequencing The amount of genecleaned PCR products should be roughly estimated on an agarose gel before sequencing The approximate range of template required is about 2 50 ng uL A general outline of the protocol is as follows details are available in the manual provided by the kit Amersham Pharmacia Biotech 1 Prepare four termination mixes one each for ddA ddC ddG and ddT Termination mix dGTP or dITP see Note 2 xl 2 uL a33P ddNTP Oa We 2 5 uL This can be multiplied by the number of samples to make a master mix and 2 5 uL aliquoted into each tube 2 Dispense 2 5 uL each of ddA ddC ddG and ddT termination mix into respec tively labeled tubes for each template to be sequenced 3 Prepare a reaction mix Reaction buffer 2 uL DNA 2 50 ng uL uL Primer 0 1 ug uL see Note 3 luL The concentration of the PCR product should be as stated above Cycle Sequencing of PCR Products 69 Water uLt Thermo Sequenase 4 U uL 2uL 20 uL Add 4 5 uL of this reaction mix to each of the termination mixes Mix contents of the tube with a pipet and then add one drop of mineral oil 4 Incubate the reactions in a thermal cycler using the following conditions
34. 3 my 12kb fas i Fig 4 Schematic diagram depicting the PCR assay for intron 22 inversion in factor VIII gene A Diagrammatic representation of the position of the primers around int22h 1 and int22h 2 and 3 B PCR products PQ AB from a normal male 12 kb and 10 kb lane 1 PB AQ AB from intron 22 inversion male patients 11 kb and 10 kb lane 2 and a PQ PB AQ AB from female carrier 12 11 and 10 kb lane 3 4 Notes 1 Blood stored for 3 d at room temperature can be used for the isolation of RNA Although the yield of RNA is low it is usually good enough for the RT PCR 2 We normally analyze our RNA on 1 agarose gel before starting the RT PCR To 2 uL RNA solution add 2uL bromophenol glycerol dye 0 1 bromophenol blue in 30 glycerol Heat it at 65 C for 5 min and load on the gel Two some times three ribosomal RNA bands are visible under UV light 3 Some types of mutations e g nonsense or frameshift make the transcript unstable To compensate for this increase the number of cycles in primary PCR from 10 to 30 4 Fluorescent dUTP and dCTP lowers the efficiency of PCR Avoid using too much fluorescent dUTP in the PCR reaction 122 Waseem et al N 10 11 12 13 14 15 We use cloned factor VIII cDNA from Genentech as a probe to amplify segment 1 2 5 and 6 Segment 3 and 4 are amplified from normal DNA Hybrids of target and control DNA can be stored at 20 for up to 3
35. 4 Analyze 10 uL of the sample on a 1 2 agarose gel containing ethidium bromide Ethidium bromide is carcinogenic See Chapter 1 RT PCR Note Follow the same precautions outlined in the note at the beginning of Subheading 3 1 The sterile technique is even more critical with RT PCR than DNA PCR in order to prevent RNA degradation as well as protecting against contamination 1 2 pa 3 3 Pipet 5 uL 0 2 0 5 ug RNA into a sterile PCR reaction tube Always run a blank alongside the sample by replacing the RNA with distilled water Prepare a premix of 15 pmol primer 2 reverse primer and distilled water to a volume of 2 5 uL per sample Add 2 5 uL of premix to the RNA Overlay with mineral oil see Note 5 Incubate at 65 C for 10 min Prepare the following premix according to the number of samples to be analyzed 4 uL of 5X RT buffer 2 uL of 100 mM DTT 1 uL of MMLV Reverse Transcriptase 200 U 0 5 uL of RNase inhibitor 25 U 5 uL of 5 mM dNTPs Add 12 5 uL of this second premix to each sample Incubate at 42 C for 1 h Prepare a PCR mix 5 uL of 10X reaction buffer 15 pmol primer 1 forward primer 2 5 U Taq polymerase Distilled water to a volume of 30 uL per sample Add 30 uL of the PCR mix to each sample Perform 30 PCR cycles at the following settings a Denaturation 93 C for 1 min b Annealing 55 65 C for 1 min adjust according to the calculated T of the primers see Note 1 c Extension 72 C
36. 99 43 bp allele after restriction with the enzyme see Fig 2 4 Notes 1 Keep the restriction enzyme cold at all times if removed from the freezer it should be immediately kept on ice In the majority of cases it can be used straight from the freezer 2 Reaction volume here is fixed at 30 uL as it is manageable Generally the smaller the volume the better Note that if the reaction volume is changed a Change the volume 10X assay buffer b Ensure that the enzyme added is lt 10 of the reaction volume c LB mixture added is one fifth the reaction volume 34 Enayat Fig 2 Bcll restricted lanes 3 5 and 7 and unrestricted lanes 2 4 and 6 PCR products showing 142 bp and 99 bp fragments Lane 1 is the molecular weight marker 3 Less enzyme can be used if the incubation period is lengthened 4 To ensure adequate digestion before full size gel electrophoresis a minigel should be run During digestion remove 2 3 uL of reaction mix and add 6 uL LB mixture Load into 1 minigel and run at 50 60 mA for 1 h View under UV illumination to check digestion see Chapter 1 5 HCl acid denaturation allows large gt 13 kb fragments to be transferred more effi ciently by breaking the DNA into smaller fragments Do not leave in HCl for more than 30 min or smaller DNA fragments will also be broken up into lt 300 bp significantly reducing the ability to DNA to bind covalently to the membrane 6 Gels may b
37. Allele 2 m z Fig 4 Raw data of microsatellite analysis heterozygous sample using the BiomassPROBE reaction Signals marked with an asterisk are stutter fragments see Subheading 1 3 trometric approach enables direct analyte detection with 100 specificity and needs no redundancy This accuracy and efficacy is combined with sample miniaturization bioinformatics and chip based technologies for parallel pro cessing of numerous samples Now the use of an advanced nanoliquid handling system based on piezoelec tric pipets combined with surface modified silicon chips permits an automated scanning of 96 samples in about 10 min Currently up to 10 SpectroCHIPs 960 samples can be analyzed in one automated run using a Bruker Sequenom SpectroSCAN mass spectrometer see Fig 5 The SpectroSCAN mass spec trometer addresses each position of the chip sequentially collects the sum of 10 laser shots processes and stores the data and proceeds to the next spot of the chip In Fig 6 96 raw data spectra from a heterozygous sample are depicted resulting from a SpectroCHIP with one sample spotted 96 times Using a pro prietary algorithm masses as well as signal intensities are automatically ana lyzed and interpreted After completion of analysis the results are transferred to a database and stored as accessible genetic information see Fig 7 The data base also provides a tool for visual control and comparison of spectra with theo retica
38. CGG repeats 4 The presence of Pwo polymerase with its proofreading ability can reduce this error frequency whereas improved cycle and buffer conditions can overcome the length limitation for PCR Thiel et al 5 have reported a sys tem encompassing the effective amplification of up to 20 kb of viral genomic RNA The subject of long range PCR is reviewed in Chapter 8 Allele specific PCR PCR can be used to discriminate between alleles by using allele specific oligonucleotides as primers Successful PCR amplification requires that the 3 end of the primers are complementary to the target DNA sequence any mismatch results in the inability of Taq polymerase to extend the primer This phenomenon can be exploited by designing primers that contain a base at the 3 end that matches either that of a known mutation or its wild type counterpart These primers will only anneal to and amplify target DNA containing that par 40 Jones ticular sequence Allele identity may therefore by determined by the presence or absence of PCR products Diseases that encompass only one mutation are par ticularly well suited to this technique Examples include the Prothrombin 20210A mutation 6 sickle cell anemia Fc y receptor ILA polymorphism 7 and a lantitrypsin deficiency where the technique is termed the amplification refrac tory mutation system ARMS Allele specific PCR is reviewed in Chapter 7 Polymerase chain reaction plays two roles in molecular
39. CINEMA window and choosing File Clear all from the menu bar Move back to the CLUSTALW interface window and view your alignment by pressing the Load Alignment button Note that a The amino acids are color coded according to their properties e g Polar posi tive H K R Blue Polar negative D E Red Polar neutral S T N Q Green Non polar aliphatic A V L I M White Non polar aromatic F Y W Purple P G Brown and C Yellow Colors can be viewed and modi fied by pressing the COLORS button b Where gaps have been introduced this is indicated with a dash c You can move through the aligned sequences using the scroll bars on the CINEMA window 3 5 Comparing 2D Gels in Databases from Different Tissues Identifying differences between two 2D gels is not always easy Using the Flicker program it is possible to compare two 2D gels on the screen at the same time and this program will make differences between the two gels more obvi ous by making the unique spots flicker 1 2 Go to the Flicker Web site http www lmmb ncifcrf gov flicker Scroll down the page until you see C Lists of 2D PAGE gel images you pick two from each list to compare in Section 1 1 then locate 6 T lymphocyte phosphoproteins from IL 2 IL 4 dependent cell line 2D gel studies and click on this The reason for choosing these gels are that they contain only phosphop roteins this makes the patterns simpler and so differences are
40. Designate separate sets of pipets for DNA and RT PCR and use filter tips whenever possible Solutions and buffers must be stored in sterile containers and always prepared with fresh distilled water 1 Into a sterile tube prepare the following master mix according to the number of samples to be analyzed 10 uL of 10X reaction buffer 10 uL of 5 mM dNTPs 15 pmol primer 1 approx 0 1 ug for a 20 mer 15 pmol primer 2 approx 0 1 ug for a 20 mer 0 5 uL 2 5 U Taq polymerase Distilled water to a volume of 98 uL per sample Aliquot 98 uL of master mix into a PCR reaction tube Add 2 uL genomic DNA 50 ug mL to give a final volume of 100 uL PCR may be done in much smaller volumes down to 10 uL especially for analytical PCR by reducing the reaction components proportionately Always perform a blank control alongside the samples by replacing the genomic DNA with dH O This will check for contamination Overlay the reaction mixture with drop of mineral oil to prevent evaporation unless using an oil free thermal cycler that has a heated lid to prevent evaporation Denature the template for 5 min at 94 C PCR at the following settings for 30 cycles 42 7 3 2 Jones a Denaturation 94 C for 1 min b Annealing 55 65 C for min adjust temperature according to the calculated Tm of the primers see Note 1 c Extension 72 C for 3 min optimum temperature for Taq polymerase activity see Note
41. FAA Nature Genet 14 320 323 Claes K Machackova E Callens T Van der Cruyssen G and Messiaen L 1998 Improved conditions for PTT analysis of the BRCA BRCA2 NFI and APC genes Elsevier Trends Journals Technical Tips Online T01457 22 7 98 Available from URL http www elsevier com homepage sab tto menu htm Sambrook J Fritsch E F and Maniatis T 1989 Molecular Cloning A Labora tory Manual 2nd ed Cold Spring Harbor Laboratory Cold Spring Harbor NY 13 Mutation Detection in Factor VIII cDNA from Lymphocytes of Hemophilia A Patients by Solid Phase Fluorescent Chemical Cleavage of Mismatch Nau shin H Waseem Richard Bagnall Peter M Green and Francesco Giannelli 1 Introduction Defects of the factor VIII gene causes f8 hemophilia A an hemorrhagic X linked disorder The factor VIII gene is 186 kb long with 26 exons varying from 69 bp exon 5 to 3106 bp exon 14 1 The factor VII mRNA is 9028 bases in length with a coding region of 7053 nucleotides 2 Hemophilia A mutations in factor VIII genes are quite heterogeneous and various methods have been used for the detection of these mutations The most widely used are 1 Denaturing gradient gel electrophoresis DGGE This is based on the ability of mutations to reduce the melting temperature of DNA domains resulting in altered mobility on a formamide and urea gradient polyacrylamide gel This method can detect any sequence change but r
42. H Van Leeuwen Cornelisse I et al 1992 Eight novel inactivating germ line mutations of the APC gene identified by denaturing gradient gel electrophoresis Genomics 13 1162 1168 Myers R M Maniatis T and Lerman L S 1987 Detection and localisation of single base changes by denaturing gradient electrophoresis in Methods in Enzy mology Volume 155 Wu R ed Academic Press NY pp 501 527 15 Conformation Sensitive Gel Electrophoresis lan J Williams and Anne C Goodeve 1 Introduction Conformation sensitive gel electrophoresis CSGE was first described by Ganguly et al in 1993 1 This technique was developed as the result of a study into a rapid non radioactive heteroduplex based detection method for mutation screening The method relies on the differential migration of DNA heteroduplexes in comparison with homoduplexes during polyacrylamide gel electrophoresis under mildly denaturing conditions Ethidium bromide stain ing and visualization under ultraviolet UV light determines those samples with aberrant banding patterns resulting from heteroduplexes These samples are subsequently subjected to DNA sequencing to determine the nature of the nucleotide alteration This chapter aims to describe the theory behind CSGE and provide infor mation to establish this method both quickly and effectively in most labora tory situations 1 1 CSGE Theory The difference in electrophoretic mobility of DNA homoduplexes
43. Hereditary Disorders Frequently Caused by Translating Terminating Mutations that Can Be Identified by PTT Disorder Gene Forward primer 5 extension Ref Duchenne muscular dystrophy DMD ggatccCTAATACGACTCACTATAGGaacagaCCACCATG 1 Duchenne muscular dystrophy DMD ggatccCTAATACGACTCACTATAGGaacagaCCACCATG 5 FAP APC ggatccCTAATACGACTCACTATAGGaacagaCCACCATG 7 8 Breast ovarian cancer BRCAI gcTAATACGACTCACTATAGGaacagaCCACCATGG 9 Breast ovarian cancer BRCAI ggatccCTAATACGACTCACTATAGGGagaCCACCATGG 10 Breast ovarian cancer BRCAI BRCA2 TAATACGACTCACTATAGGGagaCCACCATG 11 Breast cancer BRCAI BRCA2 ggatccCTAATACGACTCACTATAGGacagaCCACCATG 13 HNPCC hMLH1 ggatccCTAATACGACTCACTATAGGGagaCCACCATGG 14 HNPCC hMSH2 ggatccCTAATACGACTCACTATAGGGagaCCACCATGG 15 Cystic fibrosis CFTR ggatccCTAATACGACTCACTATAGGaacagaCCACCATG 16 Neurofibromatosis 1 NFI ggatccCTAATACGACTCACTATAGGGagaCCACCATG 17 Tuberous sclerosis TSC2 ggatccCTAATACGACTCACTATAGGaacagaCCACCATG 18 Polycystic kidney disease PKD1 ggatccCTAATACGACTCACTATAGGaacacaCCACCATG 19 Gastric cancer E cadherin aagcttATTAACCCTCACTAAAGGGA gagaCCACCATGG 4 Note The forward primer 5 extensions used in each case are shown Restriction sites and spacer sequences are shown in lowercase letters the T7 promoter is the T3 promoter is shown in uppercase letters and underlined the eukaryotic translation initiation site is shown in uppercase letters Protein Truncation Test 91 sequence ca
44. Lane 2 shows a normal band pattern Two heteroduplex bands migrate above the normal mutant homoduplex bands in both cases appear as additional bands above the homoduplexes and therefore facilitate detection of heterozygous mutations Fig 2 Homozygous mutations may also be detected by DGGE if the mutant homoduplex products migrate to a differ ent position along the denaturing gradient than their normal counterparts If necessary heteroduplex molecules may be artificially created by mixing nor mal and patient PCR products prior to DGGE analysis see Note 2 A denaturing gradient linearly increasing from the top to the bottom of a vertical polyacrylamide gel is created using a gradient maker A high dena turant polyacrylamide solution is gradually diluted with a low denaturant polyacrylamide solution as it pours into a glass plate sandwich under gravity see Fig 3 The choice of denaturant range and hence the concentration of the low and high polyacrylamide solutions is made based on the T of the domain of interest obtained by computational analyses with a top to bottom difference of 30 Gels are usually run at 60 C and at this temperature the conversion factor between the T of a melting domain and the required percentage of denaturant is derived from the following formula denaturant 3 2 x Tm 182 4 Therefore the starting denaturant range for a particular DNA fragment is usually selected as th
45. Probes Adrian JS Harwood ecarri e a i 17 4 Southern Blotting of Agarose Gels by Capillary Transfer Ralph Rapley and lan J Williams ccccccccccce eect eteee ete etee teenies 23 5 Restriction Fragment Length Polymorphism Mohammad S Enayat sissisodan 29 6 PCR Principles Procedures and Parameters Nicola LOUISC JONES orseson EANNAN 37 7 Allele Specific Oligonucleotide PCR Elaine K Green ccccccccccccseccecececeeecccneceececcsneaeesecenneeeeesseseeeeeesseeeaeess 47 8 Long Range PCR Peter A Davies and George Gray cccccccccccceteeeeeeeeteeeetesneeensaees 51 9 Analysis of Nucleotide Sequence Variations by Solid Phase Minisequencing Anu Wartiovaara and Ann Christine Syv nen eeaeeeee 57 10 Cycle Sequencing of PCR Products G K SUrdhar oono niia NE ERE EE RSO 65 11 Fluorescent n Situ Hybridization Sara A Dyer and Elaine K Green 73 12 The Protein Truncation Test Carol A Hardly AE 87 13 Mutation Detection in Factor VIII cDNA from Lymphocytes of Hemophilia A Patients by Solid Phase Fluorescent Chemical Cleavage of Mismatch Naushin H Waseem Richard Bagnall Peter M Green and Francesco Giannelli a eee 109 viii 14 15 16 17 18 Contents Denaturing Gradient Gel Electrophoresis Yvonne Walliser E es ee 125 Conformation Sensitive Gel Electrophoresis lan J Williams and Anne C GoOdeve ccccccccceesceeeeestteeeeeeees 137 SSCP Heteroduplex Analysis Andr
46. Protocols Edited by B D M Theophilus and R Rapley Humana Press Inc Totowa NJ 47 48 Green Comat Cosson pnamer premer ars TE DHA templabe i j Wild trp E j Wild iypa Miganl hrpi ASC pim ATD pim z Ho annealing Primer enoeals of pomer y O o Mibenge ch 2 Aumplticstion Hou plificaon Fig 1 Principle of allele specific oligonucleotide PCR Allele specific oligonucle otides allow amplification of a sequence of DNA to which they are perfectly homolo gous 1 but not one containing a mismatch 2 mal wild type or mutant sequence and both are used in conjunction with a common primer Because DNA polymerase lacks a 3 exonuclease activity it is unable to repair a single base mismatch between the pimer and the template at the 3 end of the DNA primers Thus if oligonucleotide primers are designed to contain mismatches close to or at the 3 end the primer will or will not be extended depending on which alternative single base polymorphisms are present in the target sequence Hence under the appropriately stringent condi tions only target DNA exactly complementary to the primer will be amplified as shown in Fig 1 2 Materials All reagents should be of molecular biology grade and solutions made up with sterile distilled water 1 PCR reaction buffer 10X 100 mM Tris HCl pH 8 3 500 mM KCl 15 mM MgCl 0 01 gelatin Autoclave and store at 20 C see Note 1 Allele Specific Oligonucleotide
47. R B Goodman H M and Boyer H W 1974 Analysis of EcoRI fragments of DNA from lambdoid bacteriophages and other viruses by agarose gel electrophoresis J Virol 14 1235 1244 Sharp P A Sugden B and Saunders J 1973 Detection of two restriction endonuclease activities in Haemophilus parainfluenzae using analytical agarose ethidium bromide electrophoresis Biochemistry 12 3055 3063 Thomas M and Davis R W 1975 Studies on the cleavage of bacteriophage lambda DNA with EcoRI restriction endonuclease J Mol Biol 91 315 321 Hjert n S Jerstedt S and Tiselius A 1965 Some aspects of the use of con tinuous and discontinuous buffer systems in polyacrylamide gel electrophore sis Anal Biochem 11 219 223 Orita M Suzuki Y Sekilya T and Hayashi K 1989 Rapid and sensitive detection of point mutations and DNA polymorphisms using the polymerase chain reaction Genomics 5 874 879 Further Reading Rickwood D and Hanes B D eds 1988 Gel Electrophoresis of Nucleic Acids A Practical Approach IRL Oxford UK Sambrook J Fritsch E F and Maniatis T Molecular Cloning A Laboratory Manual 2nd ed Cold Spring Harbor Laboratory Cold Spring Harbour NY 2 Internal Labeling of DNA Probes Ralph Rapley and Bimal D M Theophilus 1 Introduction One of the most common precursors to undertaking a protocol for mutation detection is the production
48. T7 Luciferase control DNA that is supplied with the TnT T7 Quick kit The control DNA translation product is an intensely labeled 61 kDa protein This provides a useful way of monitoring the activity of the kit particularly after prolonged peri ods of storage and provides an additional size marker for SDS PAGE Include a control reaction without any PCR product to monitor the background incorpora tion of labeled amino acid If possible include a positive control i e a PCR product with a characterized translation terminating mutation Incubate at 30 C for 90 min see Note 15 Store at 20 C until required or pro ceed with the SDS PAGE immediately SDS PAGE and Autoradiography a fresh tube containing 45 uL SDS PAGE sample loading buffer Heat at 100 C for 2 min to denature the protein then centrifuge briefly Store the remainder of the reaction at 20 C Ensure that the gel electrophoresis apparatus is clean and dry Assemble the glass plates and spacers in between the side clamps Ensure that the spacers and the glass plates are flush at the bottom end Position the clamped plates into the gel pouring stand Prepare two 12 resolving gels see Note 16 mixing 3 3 mL H O 4 0 mL of 30 acrylamide solution 2 5 mL of 1 5 M Tris buffer pH 8 8 and 100 uL of 10 SDS ina 15 mL disposable plastic tube Add 4 uL TEMED and 100 uL of 10 ammonium persulfate Mix by inversion and pour approx 3 mL into each of the gel
49. a 37 solution remember to take this into account when calculating volumes for solution 3 SSCP Heteroduplex Analysis 161 6 10 11 12 13 There is some evidence that the addition of mild denaturants like 10 urea 6 or 10 ethanediol and 15 formamide 7 can enhance the efficiency of heterodu plex analysis We have found that these additives reduce the efficiency of SSCP analysis and are not recommended for combined SSCP heteroduplex analysis Replicate gels can vary markedly in appearance the major causes of variability are gel quality and environmental factors Take great care when measuring reagents and always use fresh 10 AMPS solution Try to get into a routine so that gels are always poured at a certain time of the day and left to polymerize and then equilibrate at 4 C for the same time Your results will become more reproduc ible although some variability should still be expected The formation of heteroduplex DNA is dependent on spontanous reannealing in the formamide loading buffer or during the earliest phase of electrophoresis Some fragments reanneal very poorly preventing efficient heteroduplex analysis and thus reducing the mutation detection rate This problem can be overcome simply by preloading the gel with a proportion of the sample in formamide load ing buffer usually 25 of the final volume to be loaded before heat denatur ation of the sample The remainder of the sample can then be loaded
50. a T7 modified forward primer that also contains the myc tag reporter sequence Nonradioactive in vitro transcription translation is performed using the TnT T7 coupled wheat germ extract system In vitro transcription translation systems that contain rabbit reticulocyte lysate cannot be used because the antibodies used for the detection of the myc tag crossreact with the proteins in the reticulocyte lysate The trans lated proteins are separated by SDS PAGE and elec troblotted onto a hybrid ization membrane Detection of the proteins is accomplished by hybridization with an anti myc monoclonal antibody followed by a rabbit anti mouse anti body and finally with a horseradish peroxidase conjugated swine anti rabbit antibody The translation products are visualized by enhanced chemilumines cence The main advantage of myc tag PTT is that only proteins that contain the myc epitope are detected This greatly reduces the number of protein bands that are seen and simplifies the identification of truncated proteins The advantages of these nonradioactive PTT methods are that there is no handling of radioac tive isotopes chemiluminescence detection methods are sensitive and often quicker than autoradiography and the translated proteins can be stored indefinitely 9 The Mini Protean II electrophoresis cell is a convenient format for the separation of translated proteins in PTT Two gels 7 cm in length and 8 cm in width each with 10 or 15 lanes ca
51. a gene specific primer complimentary to the 3 end of the sense strand can also be used to prime the first strand synthesis of cDNA 5 6 3 Taq Extender PCR additive improves the efficiency of standard Taq DNA poly merase by increasing the number of extension reactions that go to completion by improved proof reading activity It increases the yield of PCR product and can improve the amplification of long and difficult PCR templates Optimized 10X Taq Extender reaction buffer is used instead of 10X Taq DNA polymerase reaction buffer 4 Sequence specific primers should be chosen to amplify a segment of between 1 and 2 kb It is possible to amplify larger segments although this is technically more difficult The length of the gene specific primer sequences should be about 18 25 bases A number of computer programs e g PRIMER are available that can be a useful aid in designing gene specific primer pairs For large genes PTT is more sensitive when the coding sequence is amplified in a number of overlap ping segments In most published methods the overlap is 300 500 bp although overlaps of 750 bp have been reported to further improve the sensitivity of PTT 11 Overlapping the PCR segments will maximize the chances of detecting all truncating mutations A mutation occurring near the end of segment is likely to result in a truncated peptide that is only fractionally shorter than the full length product Hence the two proteins may not b
52. above address or at any of the following numbers Tel 973 256 1699 Fax 973 256 8341 E mail humana humanapr com or visit our Website www humanapress com Photocopy Authorization Policy Authorization to photocopy items for internal or personal use or the internal or personal use of specific clients is granted by Humana Press Inc provided that the base fee of US 10 00 per copy plus US 00 25 per page is paid directly to the Copyright Clearance Center at 222 Rosewood Drive Danvers MA 01923 For those organizations that have been granted a photocopy license from the CCC a separate system of payment has been arranged and is acceptable to Humana Press Inc The fee code for users of the Transactional Reporting Service is 0 89603 617 0 02 10 00 00 25 Printed in the United States of America 109 87654321 Library of Congress Cataloging in Publication Data PCR mutation detection protocols edited by Bimal d Theophilus and Ralph Rapley p cm Methods in molecular biology v 187 Includes bibliographical references and index ISBN 0 89603 617 0 alk paper 1 Mutation Biology Laboratory manuals 2 Polymerase chain reaction Laboratory manuals I Theophilus Bimal D II Rapley Ralph III Methods in molecular biology Totowa N J v 187 QH462 A1 P37 2002 576 5 49 de21 2002020563 Preface As we enter the new millennium it is tempting to speculate what may lie ahead in future years decades and even centur
53. acrylamide gel From the size of the cleavage fragments the position of the muta tion is estimated and the relevant exons sequenced 6 7 To aid the visualization of DNA on the acrylamide gel the DNA is either radioactively or fluorescently labelled This chapter describes the methods used in the detection of mutations by solid phase fluorescent chemical cleavage of mismatch SPFCCM The factor VIII message except the large exon 14 is reverse transcribed with AMV reverse transcriptase and amplified with Tfl DNA polymerase into four overlapping segments Fig 1 Exon 14 is amplified from genomic DNA as two additional segments so that the entire coding region is represented in six overlapping segments The promoter region segment P and the polyadeny l ation signal region segment T are also amplified from the genomic DNA The promoter region overlaps with segment Fig 1 The promoter region and polyadenylation signal regions are sequenced directly whereas the rest of the segments are processed through SPFCCM Three different fluorescent labeled dUTPs are used to label the segments segment 1 and 2 with green segment 3 and 4 with blue and segment 5 and 6 with yellow fluorescence Similar segments are amplified from either control RNA or cloned factor VIII Mutation Detection in Factor VIII 111 kb 1 2 3 4 5 6 7 8 9 FACTOR VIH mRNA PCR AMPLIFIED SEGMENTS 1 3 5 eee P 2 4 6 a emy E Game Fig 1 Schematic d
54. after denaturation in the same wells and electrophoresis commenced Larger fragments can be analyzed without loss of detection efficiency by cutting the sample with an appropriate restriction enzyme to yield fragments of optimum size 200 250 bp Fig 4 10 Running both restricted and unrestricted samples in the same lane can increase efficiency still further because some loss of heterodu plex detection efficiency has been noted within 50 bp of the end of fragments 7 If the gene under analysis is X linked or mitochondrial in origin or if the mutation could be homozygous or hemizygous the samples should be mixed with a known normal control DNA and then subjected to a single round of denaturation and rena turation in order to encourage the formation of heteroduplexes prior to loading Pouring solutions off can be difficult the gels are large and can easily tear The talc on some latex gloves can also mark the gels Placing a piece of old X ray film over the gel while pouring off the solutions helps to support the gel prevent ing it from tearing It also prevents gloves from marking the gels Contaminating salts or alkali can make silver salts precipitate out in solution 2 causing the gel to become milky white in appearance If you continue to stain in solution 3 once this has happened these areas will turn black and the gel will be unreadable The gel can often be saved by washing twice in dH O and then immersing in 2 5 ammonium hydroxide f
55. are in frame other wise an incorrect translation product will be obtained and the results of the PTT will be meaningless The forward primer sequence should be positioned in a region that contains at least one or preferably more codons for the labeled amino acid 22 see Note 8 The reverse primer may be modified at the 5 end so that a stop codon is incorporated at the 3 end of the PCR product This is said to improve the efficiency of the translation reaction by preventing the ribosomes from stalling at the end of the PCR segment TnT T7 Quick kit user manual although in practice this modification does not seem to be essential for the success of PTT 5 Taq DNA polymerase is available from a variety of suppliers of molecular biol ogy reagents Tag DNA polymerase supplied by Invitrogen Life Technologies Ltd gives consistently good results It is supplied with 10X Tag DNA polymerase buffer a separate vial of 50 mM MgCl and 1 W1 reagent Added to PCRs at a final concentration of 0 05 the W1 reagent acts to stabilize the Tag DNA poly merase and improve the yield of the PCR product 6 A number of methods have been described for the isolation of genomic DNA and a variety of commercially available kits can be obtained for this purpose Any method that gives good quality high molecular weight DNA should be adequate for PCR amplification for PTT The phenol chloroform method Nucleon II kit Scotlabs Ltd and the Puregene DNA isolati
56. azide is a known mutagen and should be handled with extreme caution Propidium iodide is a potential carcinogen and should be treated with care Yield for PAC DNA can be as little as 10 ug from a 500 mL culture After precipitation if no DNA appears to have been eluted apply a higher pH buffer pH 9 0 to the Qiagen tip and precipitate as before 7 Isopropanol pellets have a glassy appearance and tend to be easily dislodged If this occurs use a standard ethanol precipitation in an Eppendorf and add the following Fluorescent In Situ Hybridization 85 Table 4 Troubleshooting FISH Problem Possible causes and solutions No signal or dim 1 Probe concentration may have been too weak increase signal at micro the amount of probe in the probe mix scope evaluation 2 The target slide was not sufficiently denatured remake the denaturation solution using fresh reagents and ensure temperature is 75 C If using the codenaturation method ensure that the temperature is 75 C 3 The wash was too stringent increase the SSC concen tration 4 Incorrect filters were used for slide evaluation check that filters and fluorescences are compatible 5 Detection solutions were incorrectly prepared indirectly labeled probes only remake detection solutions I II and III 6 Probe labeling may have failed repeat using fresh nick translation reagents 1 Too much probe was used decrease the amount of probe in the probe mixture
57. bands 3 Immunopreciptitaion can be used to isolate radiolabeled proteins containing the myc reporter tag Hence only proteins initiated from the methionine start site are identified 3 Alternatively nonradioactive PTT can be performed see Note 8 with the myc reporter tag providing a means of identifying the translated pro teins using Western blot methodology 3 3 An additional RT PCR product observed by agarose gel electrophoresis sug gests the presence of a splice site mutation However the presence of smaller nonspecific PCR products in samples from both affected individuals and normal controls is frequently observed when performing nested RT PCR from low level mRNA transcripts and may lead to a false positive result by PTT 11 20 21 The presence of additional RT PCR products has been correlated with the quality of the RNA preparation and is often simply a nonreproducible PCR artifact that can sometimes be eliminated by adjustment of the conditions for cDNA preparation and optimization of the PCR conditions 11 20 The presence of alternative mRNA transcripts can also lead to a false positive result and has been described in PTT for the hMLH gene in hereditary nonpolyposis colorectal cancer HNPCC 14 Alternative transcripts resulted in the identification of truncated proteins in many samples from both affected individuals and normal controls The alternative transcripts were found to be more common in RNA samples Protein Tr
58. batch 11 4 Waseem et al Table 2 Sequence of Primers Used in the Detection of Intron 22 Inversion Primer Sequence P INV GCCCTGCCTGTCCATTACACTGATGACATTATGCTGAC Q INV GGCCCTACAACCATTCTGCCTTTCACTTTCAGTGCAATA A INV CACAAGGGGGAAGAGTGTGAGGGTGTGGGATAAGAA B INV CCCCAAACTATAACCAGCACCTTGAACTTCCCCTCTCATA and should be titrated for every batch Hydroxylamine is highly toxic and should be handled in fumehood and protective laboratory clothing should be worn Osmiun tetroxide A 4 solution can be obtained from Sigma cat no O 0631 A working solution of osmium tetroxide is 0 4 osmium tetroxide in 0 2 pyri dine Sigma cat no P 3776 A fresh solution of osmium tetroxide should be made each time it is required as it has a short half life Fresh stock solution should be purchased every 2 3 mo Osmium tetroxide is very toxic and should be handled in a fumehood Protective laboratory clothing should be worn at all times during handling Formamide loading dye Deionized formamide containing 10 mg mL dextran blue Formamide from Amresco and Sigma give no background fluorescence when used as loading dye on ABI PRISM 377 DNA Sequencer Piperidine A 1 M solution of piperidine Sigma cat no P 5881 is prepared in formamide loading dye 10X Hybridization buffer 3 M NaCl in 1 M Tris HCl pH 8 0 This is stored at room temperature 2X Binding buffer 2 M NaCl 0 4 Tween 20 0 1 mM EDTA 10 mM Tris HCl pH 8 0 stored at roo
59. binding buffer Resuspend in three times the original volume of the beads with 2X binding buffer 4 Add 30 uL of the washed streptavidin beads to each reaction Incubate 15 min at room temperature 5 Place the tube on a magnetic stand to pellet the beads and aspirate the supernatant 3 4 2 Hybrid Modification and Cleavage 3 4 2 1 HYDROXYLAMINE 1 Resuspend the beads in 20 uL of 4 M hydroxylamine pH 6 0 see Methods for preparation procedure 2 Incubate 2 h at 37 C 3 Pellet the streptavidin beads on a magnetic stand and wash the beads with TE 8 0 and proceed to Subheading 3 4 2 3 below 3 4 2 2 OSMIUM TETROXIDE 1 Resuspend the beads from step 5 above in 20 uL 0 4 osmium tetroxide 0 2 pyridine and incubate for 15 min at 37 C see Note 7 2 Pellet the streptavidin beads on a magnetic stand wash with TE 8 0 see Note 8 3 4 2 3 CLEAVAGE oF DNA Add 5 uL of piperidine formamide loading dye to the reaction and incubate at 90 C for 30 min see Note 9 3 5 Analysis of the Products from SPFCCM on ABI PRISM 377 DNA Sequencer 3 5 1 Preparation and Loading of Polyacrylamide Gel 1 Clean the glass plates with 3 Alconox After rinsing them with water wipe them with isopropanol soaked lint free tissue paper 2 Set up the glass plates on the cassette with notched plate at the bottom 3 Prepare the following mix for the acrylamide gel for 12 cm plates see Note 10 6 Acrylamide Bisacrylamide solution 20 mL
60. biology First it pro vides enough material to allow further technical manipulations such as for the detection of mutations conformation sensitive gel electrophoresis e g in muta tion screening methods such as chemical mismatch cleavage single strand con formational polymorphism denaturing gradient gel electrophoresis and DNA sequencing Second it can be used analytically as a direct tool in mutation detection as in allele specific PCR and multiplex for deletion analysis Follow ing are given two standard methods for PCR first for amplification of DNA and second for amplification of RNA by first converting it to cDNA The many variations on the standard method are covered in later chapters of this volume 2 Materials 2 1 DNA PCR 1 Programmable thermal cycler 2 Sterile distilled water use as fresh 3 Solution A containing MgCl and a source of buffer salt usually KCl and Tris HCl at a pH of 8 3 In our laboratory solution A comprises 670 mM Tris HCl 166 mM ammonium sulfate and 67 mM magnesium chloride Twenty milliliter batches are usually prepared and stored at room temperature for up to 1 mo see Note 2 4 10X Reaction buffer To 1 mL of solution A add 34 uL of 5 bovine serum albumin BSA and 7 uL of 14 4 M B mercaptoethanol Note B Mercaptoethanol is toxic use in a fume cupboard Store at 20 C for up to 1 mo see Note 3 5 5 mM dNTPs dilute 50 mM stock solution of dNTPs i e dATP dCTP dGTP
61. buffer Gently load 10 15 uL of each sample into the bottom of each well using a fine gel loading tip Load only 5 uL of the Luciferase control reaction Mix 3 5 uL of the Rainbow colored protein molecular weight marker with an equal volume of SDS PAGE sample loading buffer Load the marker directly into one of the lanes of the gel there is no need to heat denature the size marker Perform electrophoresis at a constant voltage of 200 V for a period of 45 60 min or until the bromophenol dye has reached the bottom of the gel When electrophoresis is complete dismantle the apparatus and carefully sepa rate the glass plates containing the gel Remove the stacking gel the gel will be radioactive and should be disposed of in the appropriate way and cut off a small piece of one corner for orientation purposes Place the gel in a plastic box containing approx 200 300 mL of fix solution Leave for 20 30 min with gentle shaking Pour off the fix solution the solution will be radioactive and should be disposed of appropriately Place the gel on a piece of 3MM paper that is just slightly larger than the gel Cover the gel and 3MM paper completely with Saran Wrap and dry on a vacuum gel drier at 60 C for approx 1 h Do not release the vacuum until the gel is completely dried premature release of the vacuum will cause the gel to crack The 1 mm thickness of the gel should be reduced to a negligible thickness when the gel is completely dry Re
62. components to make one DGGE gel two glass plates one with a large notch and one with a small notch U shaped spacer 1 mm thick 32 well comb plexi glass pres sure unit 2 Gradient maker GRI with at least a 30 mL capacity per chamber 3 Electrophoresis unit GRI designed to hold two gradient gels The gels face each other to create the upper buffer reservoir The unit also incorporates the 130 Wallis cathode and anode platinum electrodes There is an inlet at the top of the unit that connects to a buffer flow tube During electrophoresis buffer is continuously pumped into the upper buffer reservoir and overflows from the chamber via two holes present on each side of the unit positioned above the level of the wells Circulating buffer maintains a constant pH in the upper reservoir 4 Buffer tank GRI holds 17L TAE Tris acetate EDTA buffer and incorporates a thermostat to keep the buffer at the designated temperature as well as a pump to circulate buffer from the tank in to the upper buffer reservoir via a buffer flow tube A safety mechanism cuts the current off if the tank lid is opened during electrophoresis 2 2 Reagents and Solutions 1 20X TAE buffer pH 8 0 800 mM Tris base 20 mM EDTA and 400 mM sodium acetate For L dissolve the following in 950 mL distilled water 97 g Tris base 7 5 g Na EDTA and 54 5 g sodium acetate 3H O Adjust to pH 8 with acetic acid approx 30 mL Make up to 1 L with distilled water
63. composition and ionic strength of the electrophoresis buffer temperature and the use of intercalating dyes such as ethidium bromide The matrix used for electrophoresis should have adjustable but regular pore sizes and be chemically inert and the choice of which gel matrix to use depends primarily on the sizes of fragments being separated Agarose gels are the most popular medium for the separation of moderate and large sized nucleic acids and have a wide range of separation but a relatively low resolving power Polyacrylamide gels are most effective for separating smaller fragments and although the gels are generally more difficult to prepare and handle they have three major advantages over agarose gels They have a greater resolving power can accommodate larger quantities of DNA without significant loss in resolu tion and the DNA recovered from polyacrylamide gels is extremely pure From Methods in Molecular Biology vol 187 PCR Mutation Detection Protocols Edited by B D M Theophilus and R Rapley Humana Press Inc Totowa NJ 1 2 Guilliatt Two electrophoresis buffers are commonly used and contain EDTA and Tris acetate TAE or Tris borate TBE at a concentration of approx 50 mM For historical reasons TAE is the most commonly used buffer for agarose gel electrophoresis but its buffering capacity is low and may become exhausted during extended electrophoresis TBE is slightly more expensive but it offers significantly hig
64. construct a bridge for blotting Cut a piece of the 3MM paper to the same width as the base glass plate but long enough to form a wick into the buffer compartment over the edges of the bridge 6 After the final soak in the neutralization buffer pour off the excess fluid and take up the gel onto a spare piece of 3MM paper 7 Place the gel onto the bridge with the DNA side up 8 Smooth out the gel gently with a gloved finger to remove any air bubbles between the bridge and the gel 9 Cut piece of Hybond N membrane to the approximate size of the gel and place on the gel Trim to the exact size of the gel again ensuring that no air bubbles are trapped underneath the membrane 10 Cut two or three pieces of paper to the size of the gel and then presoak briefly in 2X SSC Layer on top of membrane 11 Surround the bridge gel with Saran Wrap to prevent buffer bypass and evaporation 12 Cut a stack of paper towels to size and place on top of the presoaked papers Finally compress with a glass plate and a 1 to 1 5 kg weight 13 Add transfer buffer approx 400 mL 0 4 M NaOH and allow the DNA to transfer overnight 14 After blotting carefully remove the membrane and soak in 2X SSC to remove any adherent agarose 15 Briefly blot dry the membrane which is now ready for either storage at 4 C or immediate hybridization W 3 3 Hybridization and Autoradiography There are many different methods of hybridization that are dealt with else
65. detection step primer that anneals immediately adjacent to the nucleotide to be analyzed is extended by a DNA polymerase with a single labeled nucleotide complementary to the nucleotide at the variable site Fig 1 From Methods in Molecular Biology vol 187 PCR Mutation Detection Protocols Edited by B D M Theophilus and R Rapley Humana Press Inc Totowa NJ 57 58 Wartiovaara and Syvanen The amount of the incorporated label is measured and it serves as a specific indicator of the nucleotide present at the variable site We have used the solid phase minisequencing method for detecting numer ous mutations causing human genetic disorders 2 for analyzing allelic varia tion in genetic linkage studies and for identification of individuals 3 The protocol presented here is generally applicable for detecting any variable nucle otide The method suits well for analyzing large numbers of samples because it comprises simple manipulations in a microtiter plate or test tube format and the result of the assay is obtained as an objective numeric value which is easy to interpret Furthermore the solid phase minisequencing method allows quan titative detection of a sequence variant present as a minority of less than 1 in a sample 4 We have utilized the possibility of the sensitive quantitative analy sis for detecting point mutations in malignant cells present as a minority in a cell population 4 and for analyzing heteroplasmic mut
66. different P carinii types Fig 3 An inspection of the fin gerprints generated from these samples reveals a high degree of similarity overall indicative of the fact that only a few bases are altered in the variants with some marked differences that reflect those base changes In Fig 3 there are several examples of bands that appear in some lanes but that are absent in 170 Heisler and Lee others as well as bands that appear shifted in some lanes relative to others Unique bands indicated by arrows are apparent e g in lanes Bm In other cases the most notable difference is a composite shifting downward of a sub stantial portion of the pattern indicative of a small deletion such that the frag ments are shortened relative to the labeled 5 ends e g lanes Ed and Di as indicated by brackets Note that the patterns generated by the ramping procedure appear to be enhanced relative to the single temperature procedure in several places In par ticular note the appearance of additional bands between 82 and 118 bp This improvement in the richness of the patterns is likely due to the fact that certain substrate structures may not be as favored at a single temperature as is used in the conventional approach but rather emerge as the temperature changes over the course of the ramping reaction In some cases the ramping approach not only eliminates the need for preliminary optimization steps but may also serve to improve the sensitivity
67. disposable sterile polypropylene tubes with screw tops to prevent leakage of radioactivity Local safety precau tions must be obeyed when using radioactivity End Labeling of DNA Probes 19 2 1 1 End Labeling with Klenow 10X Klenow buffer 200 mM Tris HCl pH 7 6 100 mM MgCl 15 mM 6 mercaptoethanol 25 mM dithiothreitol 2 Labeled nucleotide 7P dNTP most commonly supplied dATP or dCTP but dGTP and dTTP are available It is also possible to substitute nonisotopic label such as fluoroscein 11 dUTP and digoxygenin 11 dUTP 3 Unlabeled dNTPs a dNTP mix a mixture of 0 25 mM of each unlabeled dNTP excluding that which corresponds to the labeled nucleotide see Note 1 b dNTP chase 0 25 mM dNTP corresponding to the labeled nucleotide see Note 1 4 Klenow the Klenow large fragment of DNA polymerase I at 1 U uL Store at 20 C 5 TE 10 mM Tris HCl pH 7 5 1 mM EDTA Autoclave and store at room temperature 6 Phenol Tris HCl equilibrated phenol containing 0 1 hydroxyquinoline as an antioxidant Use ultrapure redistilled phenol Extract repeatedly with 0 5 M Tris HCl pH 8 0 until the aqueous phase is 8 0 and then extract once with 0 1 M Tris HCl pH 8 0 Can be stored at 4 C for at least 2 mo Phenol is both caustic and toxic and should be handled with care 7 Chloroform 8 Phenol chloroform mixture A 1 1 mixture was made by adding an equal volume of chloroform to 0 1 M Tris HCl pH 8 0 equili
68. for 10 s 50 C for 5 s 60 C for 4 min see Note 4 Make up to 20 uL with water following the reaction 3 2 3 Purifying Extension Products This method utilizes ethanol and sodium acetate to purify the extension prod ucts see Note 6 1 After completion of the sequencing reactions transfer the 20 uL extension prod ucts to 0 5 uL tubes 2 Add the following to the tubes 2 uL of 3 M NaOAc pH 5 2 50 uL of 95 EtOH at room temperature see Note 7 Cap the tubes and vortex briefly Incubate the tubes at room temperature for 15 min 5 Place the capped tubes in a microcentrifuge and spin the tubes for 20 min at maximum speed This should be at least 1400g but less than 3000g 6 Without disturbing the pellet carefully aspirate the supernatant with a pipettor and discard it 7 Rinse the pellet by adding 200 uL of 70 EtOH Cap the tubes and vortex briefly Centrifuge for 5 min at maximum speed 8 Without disturbing the pellet carefully aspirate the supernatant with a pipettor and discard 9 Dry the pellet in a vacuum centrifuge for 10 15 min or remove the caps and place the tubes in a heat block at 90 C for 1 min E 3 2 4 Preparing and Loading Samples Resuspend each pellet in 20 uL of Template Suppression Reagent ABI and heat denature at 95 C on a heating block for 2 min 30 s immediately place on Cycle Sequencing of PCR Products 71 ice Load sample on to automated analyzer according to manufacturer s instructio
69. for structural rear rangements of mitochondrial DNA mtDNA in patients with neuromuscular diseases 6 rapid alignment of clones in gene libraries amplification and mapping of chromosomal translocation break points and successful amplifi From Methods in Molecular Biology vol 187 PCR Mutation Detection Protocols Edited by B D M Theophilus and R Rapley Humana Press Inc Totowa NJ 51 52 Davies and Gray Table 1 Examples of Commercially Available L PCR Kits Product DNA Proofreading name Manufacturer polymerase enzyme Expand Long Template Boehringer Taq Pwo PCR System Mannheim Gene Ampl XL PCR Kit Perkin Elmer r Tth Vent Taq Plus Stratagene Taq Pfu Note L PCR reaction mixes are used with the Expand Long Templates Kit as used for mtDNA amplication in our department cation of long stretches of trinucleotide repeat expansions 7 L PCR has also been used to amplify RNA templates by first converting the RNA into a DNA intermediate by use of a reverse transcriptase RT enzyme long RT PCR The enzyme is a genetically engineered version of the Moloney Murine Leukaemia Virus reverse transcriptase Extension of the cDNA occurs in the 3 5 direction A point mutation within the RNase H sequence prevents 5 3 exonuclease digestion of the growing cDNA strand Long RT PCR applications include looking for deletions in exons and preliminary enrich ment of sequences prior to subsequent PCR and mutation det
70. from DNA heteroduplexes has been the focal point for the development of rapid screening techniques in the detection of DNA sequence alterations A DNA homoduplex differs from a DNA heteroduplex in its complete Watson Crick base pairing of adenine thymine and guanine cytosine pairs A DNA homoduplex consists of entirely complementary DNA and is completely Watson Crick base paired A DNA heteroduplex has incomplete Watson Crick base pairing in opposition Mismatched noncomplementary base pairing may involve a single mismatched nucleotide to produce a DNA heteroduplex detectable by CSGE From Methods in Molecular Biology vol 187 PCR Mutation Detection Protocols Edited by B D M Theophilus and R Rapley Humana Press Inc Totowa NJ 137 138 Williams and Goodeve The CSGE method relies upon mildly denaturing solvents to amplify the conformational changes caused by single base mismatches during polyacryla mide gel electrophoresis J Under nondenaturing conditions slight confor mational changes caused by single base mismatches in DNA fragments will have an almost identical electrophoretic mobility to wild type DNA fragments of identical sequence Under mildly denaturing conditions one mismatched base becomes rotated out of the double helix creating a bend or kink in the DNA fragment The conformational change causes aberrant migration of this fragment compared with wild type DNA during polyacrylamide gel electro phoresis under
71. g Na EDTA dissolved in a final volume of 1000 mL distilled HO without adjust ment of pH Store at room temperature Ethidium bromide solution 5 mg mL in dH 0O Store at 4 C in a dark glass bottle Great care should be taken when handling solutions and gels containing ethidium bromide as it is a powerful mutagen Gloves should be worn at all times and a mask should be worn when weighing out the solid Solutions of ethidium bro mide should be disposed of in compliance with the local safety regulations Agarose gel 1 w v agarose in 1X TBE buffer with 0 5 ug mL ethidium bromide 1 kb Ladder Invitrogen Life Technologies Ltd supplied at a concentration of 1 0 ug uL Store at 20 C Prepare a working solution of 100 ng uL in 1X gel loading buffer Store at 20 C Load approx 100 ng of ladder per millimeter lane width 94 5 2 3 2 4 0 5 M Tris HCl buffer pH 6 8 autoclave and store at room temperature 10 w v Sodium dodecyl sulfate SDS Store at room temperature Wear a jk Hardy 6X DNA loading buffer 0 25 bromophenol blue 0 25 xylene cyanol 30 glycerol in dH O Prepare 2X DNA loading buffer by dilution in dH O Store at 20 C In Vitro Transcription and Translation TnT T7 Quick Coupled Transcription Translation system Promega Ltd see Note 7 Stable for 1 yr when stored at 70 C Avoid unnecessary thawing and refreezing as this will severely reduce the activity of the kit
72. gel without disfiguring the wells The loaded sample will take up the shape of the well so avoid loading misshapen wells These can be marked on the glass plates with a marker pen prior to loading and then avoided during loading Vacuum pressure may also cause wells to collapse when the comb is removed Two methods are available to remove combs in both instances unpolymerized liquid acrylamide is first removed by blotting the area around the comb with blue roll or tissue enabling air to enter the well space more freely The first method involves carefully coaxing the comb out of the well space at the same time as allowing air to enter the well space The second method involves the separation of the lugged glass plate from the cast gel With the gel laid flat and open face up on the bench a sharp object such as the point of a pair of scissors can be inserted in the center of the gel plate between the comb and the Conformation Sensitive Gel Electrophoresis 149 11 12 13 14 15 16 plate in a gap between the teeth of the comb and rotated slightly The gel will be seen to come away from the glass plate and the comb can be removed with ease This will not affect the running of the gel The syringe can be filled from the top reservoir providing that there is buffer remaining to cover the wells Take care when placing the needle onto the syringe With constant pressure the needle tip can be inserted into each well but avoiding
73. give a clean starting window 5 Select Pluglets Load pluglets in the menu bar 6 This opens the Load Pluglet window and you should select Clustal and then press the Load Pluglets button AutoAlign will appear in the menu bar 204 7 8 10 11 12 Brzeski Press the Close button in the Load Pluglet window Use SRS at SWISS PROT to find human globin sequences All text globin Organism Homo sapiens and note the SWISS PROT file names e g HBA HUMAN Inthe CINEMA window EITHER a Press the DB seq button b In the Load database sequence window delete Enter ID code here and then EITHER Enter the OWL code use the protein ID code e g opsd_sheep not acces sion number _ OR pais Change the Database name to SWISSPROT or PIR in the drop down list box at the top of the window Enter the SWISS PROT PIR code e g hba_human this is not case sensitive c Press the Get sequence button d The requested sequence will be loaded into the CINEMA window e Repeat this procedure until you have accumulated all your sequences OR if the OWL server is down a Load a database file in the browser window e g from SWISS PROT by clicking on the relevant hyperlink b Find the protein sequence at the end of the file Drag the mouse across the sequence to select it you will know it is selected because the sequence is now seen as white text on a black background don t worry if you ha
74. heat the sample at 92 C for 2 min W 3 7 2 Preparation of Polyacrylamide Gel 1 Clean and set up the 36 cm glass plates as described in Subheading 3 5 2 Prepare acrylamide mix as follows AutoMatrix 4 5 45 mL 10X TBE 5 mL 10 APS 250 uL TEMED 35 uL Stir to mix 3 Immediately pour it between the plates from the top end pressing the plates to avoid bubbles 120 Waseem et al 4 Allow it to set for 1 h at room temperature 5 Prerun the gel for 15 min on Seq PR 36E 1200 6 Load the samples from step 11 above Subheading 3 7 1 and electrophorese for 7 h on Seq Run 36E 1200 3 7 3 Sequence Analysis 1 To start the sequence analysis program double click on the Gel file from the sequence run 2 Define the first and last track on the gel and the click Track and Extract lanes from the Gel menu 3 Quit sequence analysis program and open Sequence Navigator Program for the analysis of mutations 4 Import relevant sequences together with the published factor VIII sequence and compare them using Comparative or Clustal program from Align menu 3 8 Detection of Intron 22 Inversion by Long PCR Forty five percent of the severe hemophilia A patients have inversions in their factor VIII gene involving intron 22 resulting in the factor VIII coding sequence ending at exon 22 and leading to segment 6 amplification failure 8 The inversions are due to intra chromatid homologous recombination between a sequence in intron 22 c
75. matrix by hydrogen bonding when heated in a buffer and allowed to cool Many chemically modified forms of agarose are available commercially that gel or melt at different temperatures without any significant loss of mechanical strength Although these different forms of agarose can be useful in both the qualitative and preparative electrophoresis of DNA the resolving power is still not comparable to that of polyacrylamide gels The density and porosity of the gel matrix is determined by the concentration of agarose used referred to as the percentage of agarose w v in buffer see Note 3 Typical agarose gel concentrations fall within the range of 0 3 to 2 5 w v depending on the size of DNA fragments to be separated Table 1 For most applications only a single component agarose is needed and no polymer ization catalysts are required and they are therefore quick and easy to prepare This coupled with the lack of toxicity unless in the buffers is largely respon sible for the popularity of agarose gel electrophoresis Agarose and Polyacrylamide Gel Electrophoresis 3 Table 1 Range of Separation of Linear DNA Molecules in Different Agarose Gel Concentrations Concentration of agarose Efficient range of separation of w v linear DNA molecules kb 0 3 5 60 0 6 1 20 0 7 0 8 10 0 9 0 5 7 1 2 0 4 6 1 5 0 2 3 2 0 0 1 2 Many configurations and sizes of agarose gel electrophoresis tanks are avail able of which
76. molecule Detection with reporter KA Microscope evaluation f Reporter molecule biotin d UTP or digoxy genin dUTP Fluorochrome conjugated molecule A Reporter binding fluorochrome molecule Fig 1 Schematic representation of the FISH principle Many FISH probes are commercially available prelabeled with a choice of direct or indirect labels A list of suppliers used by the authors is given in Table 1 Alternatively probes may be grown in the laboratory from appropri ate DNA stocks and labeled with a desired fluorochrome or reporter molecule Target preparations for FISH may take one of many forms including cell suspensions touch preparations or paraffin sectioned material and the tech nique is applicable to both dividing and nondividing cells i e metaphases or interphases respectively Fluorescent In Situ Hybridization 75 Table 1 Suggested Probe Suppliers Supplier Address Appligene Oncor Qbiogene Salamander Quay West Park Lane Harefield Middlesex UB9 6NZ United Kingdom Vysis Ltd Vysis SA UK Customer Department 81470 Maurens Scopont France Over the last decade FISH has proved to be an invaluable technique in both diagnostic and research laboratories The appropriate choice of probe and target can lead to the characterization of chromosomal and gene rear rangements and the ascertainment of chromosome copy number Single copy unique sequence probes have proved useful in the detection of micr
77. more alcohol tolerant than the tra ditional Tris borate buffer A 500 mL stock solution of 20X TTE can be used for 142 Williams and Goodeve Wild type Mutant DNA DNA Denature at 98 C for 5 min Reanneail at 65 C for 30 min Heteroduplexed DNA Homoduplexed DNA Fig 1 Illustration of the heteroduplexing reaction between normal or wild type DNA and mutant DNA Top Prior to heteroduplexing both DNA strands exhibit Watson Crick base pairing At the mutation site wild type pairing is presented as G C and the mutated nucleotide as A T Following the heteroduplexing reaction both homoduplex and heteroduplex DNA are formed bottom In homoduplexed DNA original base pairings are reinstated of wild type G C and mutant A T Heteroduplex DNA is formed where wild type and mutant DNA strands are paired which differ by one or more nucleotides In this example the two heteroduplexed species formed have non Watson Crick base pairings of G T and A C DNA heteroduplexes such as these can be resolved from DNA homoduplexes because of their induced conformation under mildly denaturing conditions by CSGE five CSGE gel runs including subsequent staining procedures and can be kept at room temperature for approx 4 mo 2 99 1 Acrylamide BAP 40 The crosslinker bisacryloylpiperazine BAP has been reported to be a more efficient crosslinker than bis NV N methylene bisacrylamide in its ability to improve the CSGE gel resolving capacity and
78. more easily seen Click on the hyperlink Select two gels and Flicker Compare them and then accept the default choices i e lymphocyte T_mouse_32P_59g PPDB G1 phase in the upper window and lymphocyte T_mouse_32P_59h PPDB G2 M phase in the lower window Press the Go Flicker button This may take some time to display the gels but you will eventually see a new page with two 2D gels one from each stage of the cell cycle at the bottom of the window Each gel image will have a set of cross hairs in blue Look at the two gels and a Decide on a common spot 206 3 6 Brzeski b Press and hold down the Control key Ctl and c Click on the common spot with the mouse in each gel This will move the gel image and position the cross hairs onto the spot If you are not happy with the position then repeat this procedure Scroll back up the screen and click in the Flicker box to check it The two images will be viewed in quick succession so that small changes can be easily seen Comparing 2D Gels in House from Different Tissues Flicker This is relatively easy to accomplish as long as you can download your 2D gels onto a Web server that can be accessed using a normal Web addressing system 1 Log onto the Flicker home page http www Immb ncifcrf gov flicker 2 Once you have connected with the Flicker page you should scroll down the page until you see 4 Flicker compare images from any two URLs then scroll fur ther unti
79. of 72 C for 10 min 3 Check the specificity and yield of the amplification by agarose gel electrophoresis 3 2 Agarose Gel Electrophoresis of PCR Products 1 Mix 2 5 uL of each PCR sample with an equal volume of 2X DNA loading buffer Load the samples onto the 1 agarose gel and load the appropriate vol ume of the 1 kb ladder into one lane Separate by electrophoresis at 75 Volts for 1 2 h View the gel on an ultraviolet UV transilluminator A single product of the expected size should be seen Estimate the yield of the PCR product This can most easily done by comparison with a similar sized DNA band of known con centration For example the 1 6 kb fragment of the 1 kb ladder contains 10 of the mass loaded on the gel It is useful to take a Polaroid photograph of the agarose gel as a record of the PCR product concentration and the specificity of the amplification A single PCR product of high yield can be used directly without purification in the in vitro transcription translation reaction The mineral oil can be removed from the PCR sample if preferred although this is not essential when using the TnT T7Quick kit This can be easily done by addition of 1 or 2 drops of chloroform vortexing and spinning for 2 min in a microcentrifuge Retain the upper aqueous layer and transfer to a fresh tube Proceed directly with the in vitro transcription translation or store the PCR samples at 20 C until required 3 3 In Vit
80. of the CFLP method 2 Materials 2 1 Preparation of End Labeled PCR Amplified Fragments 2 1 1 PCR Reagents 1 Sterile double distilled H O 2 10X PCR buffer 500 mM KCI 100 mM Tris HCl pH 9 0 15 mM MgCl 3 dNTP deoxynucleotide mix 0 2 mM each dNTP in sterile double distilled H O 4 Mineral oil or wax overlay 5 Oligonucleotide primers at a concentration of 10 uM at least one of which is labeled with a fluorescent dye e g tetrachlorofluorescein fluorescein or a moi ety detectable by chemiluminescence e g biotin digoxyigenin 2 1 2 Post PCR Fragment Purification 1 Exonuclease I Available at 10 U uL from Amersham Pharmacia Biotech Arling ton Heights IL cat no E70073Z or at 20 U uL from Epicentre Technologies Madison WI cat no X40505K 2 High Pure PCR Product Purification Kit HPPPPK available from Roche Molecular Biochemicals Indianapolis IN cat no 1732668 3 Sterile double distilled H O or T E 10 mM Tris HCl pH 8 0 0 1 mM EDTA pH 8 0 2 2 CFLP Analysis 1 Cleavase I enzyme 25 U uL in Cleavase enzyme dilution buffer 20 mM Tris HCl pH 8 0 50 mM KCI 0 05 Tween 20 0 05 Nonidet P 40 100 ug mL bovine serum albumin and 50 v v glycerol 2 DNA dilution buffer 5 mM MOPS pH 7 5 CFLP Analysis for Genotyping and Mutation Detection 71 Nm WwW N 8 2 4 2 4 1 10X CFLP buffer 100 mM MOPS pH 7 5 0 5 Tween 20 0 5 Nonidet P 40 2 mM MnCl
81. prefer ably 3 4 h Centrifuge contents in bench top microcentrifuge at full speed to recover the full content of the tubes Add 6 uL of loading buffer mixture and mix thoroughly Load the samples into a suitable size submarine gel well without touching the sides see Note 4 Electrophorese the gel at 30 V for 8 h but usually overnight Observe the gels on an ultraviolet UV transilluminator and make a permanent record by taking a photograph of the gel If the DNA has been digested properly a smearing from the well to the bottom of the gel should be present 3 2 Southern Blotting This method is used for the determination of the molecular sizes of the DNA fragments after digestion with restricted enzymes and gel electrophoresis DNA 32 Enayat fragments are transferred to a nylon membrane for reaction with a labeled probe for band visualization and molecular weight sizing of each of the fragments All of the procedures are done at room temperature and the buffers used do not have to be sterile 1 After electrophoresis trim away unwanted areas in the gel Mark on the corner for gel orientation and identification 2 Soak the gel in 0 25 M HCI for 15 min with gentle agitation on an orbital shaker see Note 5 Wash the gel twice with denaturation buffer for 30 min 4 Neutralize the gel by replacing fluid with neutralization buffer and soak as in step 2 for 30 min and repeat see Note 6 5 While the gel is in final soak
82. seems to destroy this balance leading to the creation of a typical SSCP band 6 When a genuine SSCP shift is present the relative staining of the normal bands in the sample will be reduced relative to those of other normal samples on the SSCP Heteroduplex Analysis 159 1 8 SSCPs Tml e hea id tad ba HDs Fig 4 SSCP heteroduplex analysis of CFTR Exon 14a This fragment at 511 bp is too large to analyze effectively as one fragment and so has been digested with RsaI to give rise to a 277 bp and 234 bp fragment 10 There is a frequent polymorphism in exon 14a nt2694t g that is visible as both SSCP and heteroduplex shifts Lanes 2 and 6 are heterozygotes for this polymorphism Lanes 1 3 and 4 are homozygotes for the faster migrating allele whereas lane 5 is a homozygote for the slower migrating allele Lanes 7 and 8 are heterozygotes for the polymorphism but also are heterozy gotes for the mutations 2711AT and W846X1 nt2669g a respectively Note how the presence of these mutations within the same fragment as the polymorphism modi fies the appearance of the polymorphism allowing them to be clearly differentiated same gel that have amplified with the same efficiency This is the result of the ssDNA being spread over a larger gel volume This effect can be used to filter out false positives resulting from spurious amplification 7 Excess primers left over in unpurified PCR reactions reannealing to the ssDNA a
83. sheet placed over the drying frame and wet the gel surface with a few milliliters of deionized water from a wash bottle 11 Carefully lay the second sheet of moistened cellophane over the top of the gel and frame taking care not to trap air bubbles between the sheets Place the outer section of the drying frame firmly over the inner section s rubber gasket The cellophane should now be drawn taut and the frame can be carefully lifted off the platorm 12 Turn the retaining screws 90 to retain the inner frame in position and trim any surplus cellophane away with a pair of scissors Wipe away excess water with a disposable tissue and leave the frame to dry either on a warm shelf for 24 h or in a 37 C incubator for 6 h see Note 16 13 Once the gel is thoroughly dry dismantle the frame and cut excess cellophane away from the dried gel with scissors Seal the cellophane by folding strips of adhesive tape around all of the edges This prevents the cellophane from peel ing apart SSCP Heteroduplex Analysis 157 1 16 dekiecmMS SSCPs Windia Bulle HDs Fig 2 SSCP heteroduplex HD analysis of CFTR exon 3 309 bp Lanes 1 10 are test samples lanes 11 16 are heterozygote mutation controls The mutant controls are as follows lane 11 P67L nt332c t lane 12 R75X nt355c gt t lane 13 G85E nt386g a lane 14 L88S nt395t c lane 15 E60X nt310g t Lane 16 is from a heterozygote for the polymorphism R75Q nt356g a
84. so the score will be correspondingly low 3 4 Aligning Protein Sequences Using CINEMA There are two commonly used programs for sequence alignment CLUSTALW and pileup One of these programs CLUSTALW can be accessed using a Web browser and a Java Applet called CINEMA Colour Interactive Bioinformatics 203 Editor for Multiple Alignment This applet will access local or database sequences over the Internet and then once they have been retrieved align them The alignments are color coded If you wish to modify the alignment it is possible using the CINEMA interface The purpose of an alignment is to compare two sequences and align the related regions to identify conserved and non conserved regions This align ment is built on the underlying assumption that the two sequences being aligned have evolved from a common precursor If this evolutionary relation ship is in fact true then substitution addition or deletion of amino acids will be a rare occurrence because of the evolutionary constraints on biological function the relationship is scored by assigning positive and negative values to matches and mismatches However not all amino acid changes are neces sarily equally disadvantageous for instance the substitution of one hydro phobic amino acid with another is less likely to cause dramatic changes in protein structure than substituting a hydrophobic amino acid with a polar one Each substitution has a cost associated with
85. such as conformation sensitive gel electrophoresis CONTENTS Agarose and Polyacrylamide Gel Electrophoresis Internal Labeling of DNA Probes End Labeling of DNA Probes Southern Blotting of Agarose Gels by Capillary Transfer Restriction Fragment Length Polymorphism PCR Princi ples Procedures and Parameters Allele Specific Oligo nucleotide PCR Long Range PCR Analysis of Nucleotide Sequence Variations by Solid Phase Minisequencing Cycle Sequencing of PCR Products Fluorescent In Situ Hybridization The Protein Truncation Test Mutation Methods in Molecular Biology 187 PCR MUTATION DETECTION PROTOCOLS ISBN 0 89603 617 0 humanapress com Detection in Factor VIII CDNA from Lymphocytes of He mophilia A Patients by Solid Phase Fluorescent Chemical Cleavage of Mismatch Denaturing Gradient Gel Electro phoresis Conformation Sensitive Gel Electrophoresis SSCP Heteroduplex Analysis Cleavase Fragment Length Polymorphism Analysis for Genotyping and Muta tion Detection Automated Genotyping Using the DNA MassArray Technology An Introduction to Bioinformat ics Index ISBN 0 89603 617 0 90000 9780896036178
86. the remainder of the reverse transcribed RNA at 20 C 2 Add 2 5 uL of 10X Taq extender reaction buffer 2 5 uL of 2 mM dNTPs 20 pmol forward primer 20 pmol reverse primer and sterile HO to bring the total volume to 24 uL When setting up a number of reactions it is more convenient to prepare a master mix containing the appropriate volumes of the PCR compo nents The master mix is added to the tubes containing the reverse transcribed RNA thus reducing the number of pipetting steps Mix well and overlay the reaction with or 2 drops of mineral oil to prevent evaporation 3 Perform hot start PCR see Note 12 Place the tubes in the thermal cycler and heat to 94 C for 4 min Pause the thermal cycler at 94 C and add 1 U Taq DNA polymerase and 1 U Taq extender additive Add the two enzymes simultaneously as a mixture diluted to 1 U uL in 1X reaction buffer 4 Resume thermal cycling and perform 30 35 rounds of amplification consisting of denaturing at 94 C for 1 min annealing at 50 65 C for 1 min and extension at 72 C for 2 min see Note 13 End the program with a final extension step of 72 C for 10 min 5 When the thermal cycling program has ended check 2 5 uL from each sample by agarose gel electrophoresis see Subheading 3 2 It may be possible to see the first round amplification product If a PCR product is visible check if it is of the expected size by comparison with the DNA size ladder 6 Transfer 1 5 uL
87. the blotting paper ensuring that the CSGE gel is firmly attached 11 Place gel face up on the work surface 12 Locate bands by visualizing the gel with a hand held UV light 302 nm and excise relevant portions of DNA band containing gel using the scalpel blade see Notes 13 and 14 13 Wet the surface of the UV transilluminator with deionized water from the water bottle 14 Place the excised gel section face down on the wet transilluminator 15 Wet the 3MM paper with water from the water bottle and peel off the 3MM paper leaving the excised gel section on the UV transilluminator see Note 15 16 Visualize bands in the gel using the UV transilluminator and document results see Note 16 3 4 Gel Banding Patterns The CSGE results often reflect the nature of the nucleotide change The variation in enhancement or retardation of DNA migration of heteroduplexes from homoduplexes will mainly depend on the type or nature of the nucleotide change The overall fragment size sequence composition and flanking nucle otide sequence at the mutation site will also play a role in the degree of DNA band separation during polyacrylamide gel electrophoresis Small insertions or deletions of one or a few base pairs produce the largest band separations because of an increased conformational change from wild type DNA In these cases all four possible reannealled conformations can often be seen on CSGE gels Figs 2 and 3 Single nucleotide substi
88. the probe DNA thus blocking these region from hybridizing to target DNA This process is known as competitive in situ suppression CISS 3 13 A maximum of four slides should be processed at any one time to avoid a signifi cant decrease in temperature References 1 Speicher M R Ballard S G and Ward D C 1996 Karyotyping human chro mosomes by combinatorial multi fluor FISH Nature Genet 12 368 375 2 Kallioniemi A Kallioniemi O P Sudar D Rutovitz D Gray J W Waldman F et al 1992 Comparative genomic hybridization for molecular cytogenetic analysis of solid tumours Science 258 818 821 3 Lichter P Cremer T Borden J Manuelidis L and Ward D C 1988 Delin eation of individual human chromosomes in metaphase and interphase cells by in situ suppression hybridization using recombinant DNA libraries Hum Genet 80 224 234 Further Reading Barch M J Knutsen T and Spurbeck J eds 1997 The AGT Cytogenetics Laboratory Manual Lippincott Raven PA Rooney D E and Czepulkowski B H eds 1992 Human Cytogenetics Volume I IRL Oxford 12 The Protein Truncation Test Carol A Hardy 1 Introduction The protein truncation test PTT 1 occasionally referred to as the in vitro synthesized protein IVSP assay 2 is a method for screening the coding region of a gene for mutations that result in the premature termination of mRNA translation The techniques involved in
89. to Conformation Sensitive Gel Electrophoresis 143 enhance the physical strength of polyacrylamide gels A 500 mL gel mix con tains 198 g of solid acrylamide BDH see Note 6 and 2 g of BAP Fluka Once dissolved this stock is kept at 4 C and has a shelf life of 4 mo Gel loading buffer 50 glycerol 0 25 xylene cyanol 0 25 bromophenol blue The ingredients are mixed and dissolved in water 10 Ammonium persulfate APS Used in the polymerization of acrylamide gels A solution of 10 w v APS dissolved in water is made fresh every 2 wk Reduced APS activity prolongs the polymerization reaction Ethidium bromide EtBr 10 mg mL Used in powder form and dissolved in water to yield a concentration of 10 mg mL Care must be taken in the preparation handling and disposal of this solution see Note 7 Gel rigs Electrophoresis equipment required for running CSGE gels are of a standard design and have few special requirements Electrophoresis tanks used for manual sequencing can be used for CSGE and make a good starting point to test the procedure Preferably shorter rigs should be used to minimize wasted gel space For this reason we use gel tanks which are 410 mm x 330 mm Flowgen Gel plates The glass plates are a standard plain and lugged glass plate set dimensions 410 mm x 330 mm with a siliconized lugged plate One millimeter spacers and 1 mm castle combs are used in casting CSGE gels The thickness
90. to 18 uL double distilled water final volume Final concentrations refer to the concentrations in the reaction mix after adding Reaction Mix 2 6 Thermocycler A machine with an option of increasing the extension time with each successive cycle is recommended such as the Perkin Elmer 9600 Rapid ramping between temperatures is also desirable 7 PCR reaction tubes Thin walled tubes allow rapid heat transfer and so minimize the time reactions are held at the relatively high denaturing temperature prolong ing enzyme life 3 Methods 3 1 Template DNA Preparation Having selected an appropriate DNA extraction method the following points should be observed lg 2 3 3 2 To reduce shearing and maintain high molecular weight DNA tube transfers should be carried out using sterile plastic pastettes rather than pipet tips To prevent shearing any mixing should be performed by gentle repeated inver sion by hand rather than by a vortex mixer If phenol is used in the DNA extraction protocol it should be buffered at pH 8 0 as nicking of template DNA may occur at acid pH Auto oxidation of phenol can also lead to degradation of the DNA Long Range PCR Procedure Thaw all the reaction components at room temperature Leave the enzyme mix at 20 C until needed Pipet 4 uL of appropriately diluted template DNA into PCR tubes 100 ng per reaction Prepare a mix containing diluted primers in an appropriate 10X reaction buffe
91. washed out every four to five wells with the syringe containing 0 5X TTE buffer Care must be taken not to elute samples already loaded onto the gel Once all samples have been loaded electrophorese at 400 V 10 V cm for 16 17 h at room temperature the second dye front xylene cyanol will run at about 200 bp Staining and Viewing the Gel Make space on a workbench close to the gel documentation system e g darkroom Fill staining tray with 2 L of 0 5X TTE and add 200 uL of EtBr 10 mg mL and mix well Add 2 L of water to the destaining tray Turn off electrophoresis power supply from gel rig and take CSGE gel to the designated staining area Place gel face up on the work surface and remove sealing tape The CSGE gel can be exposed by removing the top siliconized lugged plate with a plate sepa rator The CSGE gel should stick to the plain glass plate see Notes 12 and 13 Carefully lower gel and plate into staining tray gel face up and leave for 10 min Drain off excess buffer and lower gel into destaining tray for 10 15 min gel face up After destaining carefully drain off excess water and place plate and gel on work surface gel face up The CSGE gel can be transferred from the glass plate to 3MM blotting paper by covering the gel with two sheets of 3MM paper Apply firm pressure to obtain good contact between the gel and blotting paper 146 Williams and Goodeve 10 Carefully peel back
92. 0 5 ug mL ethidium bromide The mobility of linear DNA is reduced by the presence of ethidium bromide by about 15 11 The electrical resistance of the gel is almost the same as that of the buffer and so a significant proportion of the current passes through the gel but the deeper the buffer layer the less efficient this becomes 12 The maximum volume of solution that can be loaded is determined by the dimen sions of the well To reduce the possibility of contaminating neighboring samples it is not advisable to fill the wells completely The minimum amount of DNA that can be detected by ethidium bromide stained gels is approx 2 ng in a 5 mm wide band but if there is more than 500 ng of DNA the well may become overloaded 13 The power requirements for electrophoresis depend on the thickness and length of the gel and the concentration of agarose and buffer used It is recommended that for maximal resolution voltages applied to the gels should not exceed 10 V cm as higher voltages may preferentially increase the migration rate of higher molecular weight DNA and reduce the range of separation Overnight separa tions using lower voltages are frequently used 14 Extended destaining can lead to the removal of the ethidium bromide and lower ing of the detection sensitivity Insufficient de staining will lead to a higher back ground of fluorescence 15 Ultraviolet radiation is particularly dangerous to the eyes therefore to minimize exposure
93. 00 bp in length It has been shown to be more sensitive than many other commonly used mutation detection methods including single strand conformation polymorphism SSCP and heteroduplex analysis 5 6 2 The availability of user friendly computer programs reduces the amount of preliminary work required prior to fragment analysis It uses a nonradioactive method of DNA band detection 4 The formation of heteroduplexes significantly improves the detection of heterozygotes 5 Variant DNA bands may be readily isolated from gels for subsequent sequencing analysis a From Methods in Molecular Biology vol 187 PCR Mutation Detection Protocols Edited by B D M Theophilus and R Rapley Humana Press Inc Totowa NJ 125 126 Wallis DGGE also has a number of limitations including Its sensitivity decreases for fragments larger than 500 bp It requires the use of specialist equipment The addition of GC clamps makes the purchase of PCR primers expensive Knowledge of melting behaviour is essential for efficient analysis and therefore preliminary work ups must be performed before fragment analysis can take place BwWN Re DGGE analysis involves the electrophoresis of double stranded DNA fragments through a polyacrylamide gel containing a linearly increasing concentration of denaturants usually urea and formamide 1 Temperature may also be employed as the denaturant using a similar technique known as tempera ture dena
94. 1 TTGCCATCCTATGGAACTGCCTCGGTGAGT TTTCTCCTTCATTACAGAAACGGCTTTTTCA AAAATATGGTATTGATAATCCTGATATGA ATAAATTGCAGTTTCATTTGATGCTCGATG AGTTTTTCTAATCAGAATTGGTTAATTGGT TGTAACACTGGCAGAGCATTACGCTGACT TGACGGGACGGCGGCTTTGTT TCCTGGNTCTGTTCTTCATCTTCACCTACTTCAAAGTTCCTGAGACTAAA GGCCAAATTTGAAGAGCTCAACATGGATCTGTTCCGGTCTACTATGAAGC GATGTCCAGAAGAATATTCAGGACTTAACGGCTNCAGGNTTTTAACAAAA ATTGGCAGCCACACGGTGCTGGAGCTGCTGGAGGCTGGCTACTTGCCTGT CATCGTGGAGAAGCCCTTCGGGAGGGACCTGCAGAGCTCTGACCGGCTGT GCCCTGTCGAGACACTTGCCTTCTTCACCCAGCTAATCTGTAGGGCTGGA TACATAATGTATTTATATATTTTTTGTATAATCACTATCTTTGTATTTAC o unu Dua FW PLP the query sequence which matches the hit sequence The color represents the quality of the match Below the picture is a list of files which correspond to these matches sorted in match quality order The first hyperlink is to the file containing the entire sequence This is followed by a very brief description of the file The next number is a numerical score which represents how good the match was This score is hyperlinked to the actual match found between your query sequence and the match itself Finally the last number gives the statistical significance of the match the E value and the chances of finding this match by chance 2 3 Designing PCR Primers 2 3 1 Designing Primers for PCR Using xprimer xprimer is a Web based primer design package Go to http alces med umn edu xprimerinfo html to see a detailed explanation of the various condi tions that the pri
95. 50 cycles at 95 C 30 s 50 cycles at 50 C 30 s and 50 cycles at 72 C 60 s see Note 4 3 1 3 Treatment of PCR Products After Cycle Sequencing Add 4 uL stop solution to each tube and store at 20 C until ready to run on a gel 3 1 4 6 Polyacrlyamide Sequencing Gels 1 To make 150 mL of acrylamide solution add 63 g urea 30 mL of 30 acryla mide stock solution and 12 mL of 20X glycerol tolerant buffer and make up to 150 mL with distilled water 2 Just before pouring the gel add 50 uL of 25 APS and 50 uL TEMED to 50 mL of the acrylamide solution to initiate polymerization Pour this into a sandwich of two 45 inches long gel plates that have been sealed at the bottom with 10 mL 6 acrylamide 50 uL 25 APS and 50 uL TEMED Leave gel to set for approx 1 h or overnight Set up the gel apparatus using 0 8X glycerol tolerant buffer see Note 5 Load 4 uL of each sample into each well Run the gel at 50 C approx 50 W until the sample dyes have migrated the required distance As a general guide bromophenol blue migrates with a DNA fragment of approx 26 bp and xylene cyanol with a fragment of approx 106 bp in a 6 gel NS 3 1 5 Autoradiography Following electrophesis allow the glass plates to cool to room temperature Care fully separate the glass plates leaving the gel adhered to one of the plates Transfer the gel to a piece of Whatmann 3MM paper cut out to the same size of the gel by slowly placing it over the
96. 7 uL of the enzyme buffer mixture Mix well by pipetting up and down several times Incubate the CFLP reactions for 15 s at 35 C Program the thermal cycler to increase in temperature at a rate of 0 1 C s to 85 C or set to ramp for an 8 min period from 35 to 85 C On reaching 85 C stop the reactions with 16 uL stop solution see Note 3 3 3 Separation of CFLP Fragments 1 Prepare a denaturing polyacrylamide gel choosing a percentage of acrylamide 19 1 appropriate for the size of the fragment being analyzed see Note 6 2 Prerun the gel for approx 30 min before loading the samples at sufficient wattage to warm the gel e g 18 20 W 3 Heat denature the CFLP reactions at 80 C for 2 min immediately prior to load ing onto the gel The best resolution is achieved when the samples are fully denatured 4 Load 5 10 uL of the appropriate CFLP reaction per well The remainder of the reactions can be stored at 4 C or 20 C for later analysis 5 Continue electrophoresis until sufficient separation of the CFLP fragments is achieved the time will depend on the fragment size and the percentage of acrylamide used 3 4 Visualization of CFLP Patterns 3 4 1 Fluorescence Imaging of CFLP Patterns 1 Following gel electrophoresis thoroughly wash the outside of the gel plates using nonfluorescent soap 2 Dry and wipe clear with lens paper to remove residual debris 3 Place the gel carefully in the fluorescence scanning unit H
97. A Gelfand D and Skinsky J J 1991 Recent advances in the polymerase chain reaction Science 252 1643 1651 Kainz P Schmiedtechner A and Strack H B 1992 In vitro amplification of DNA fragments greater than 10 kb Anal Biochem 202 46 49 Lundberg K S Shoemaker D D Adam M W W Short J M Sorge J A and Mathur E J 1991 High fidelity amplification using a thermostable DNA polymerase isolated from Pyrococcus furiosus Gene 108 1 6 Barnes W M 1994 PCR amplification of up to 35 kb DNA with high fidelity and high yield from lambda bacteriophage templates Proc Natl Acad Sci USA 91 2216 2220 Cheng S Fockler C Barnes W M and Higuchi R 1994 Effective amplifi cation of long targets from cloned inserts and human genome DNA Proc Natl Acad Sci USA 99 5695 5699 Li Y Y Hengstenberg C and Maisch B 1995 Whole mitochondrial genome amplification reveals basal level multiple deletions in mtDNA of patients with dilated cardiomyopathy Biochem Biophys Res Comm 210 211 218 Campuzano V Montermini L Molto M D Pianese L Cossee M Cavalcanti F et al 1996 Friedreichs ataxia an autosomal recessive disorder caused by an intronic GAA triplet repeat expansion Science 271 1423 1427 9 Analysis of Nucleotide Sequence Variations by Solid Phase Minisequencing Anu Wartiovaara and Ann Christine Syvanen 1 Introduction The Sange
98. Acad Sci USA 95 1681 1685 Ganguly G Dhulipala R Godmilow L and Ganguly A 1998 High through put fluorescence based conformation sensitive gel electrophoresis F CSGE identifies six unique BRCA2 mutations and an overall low incidence of BRCA2 mutations in high risk BRCA1 negative breast cancer families Hum Genet 102 549 556 Ganguly A and Williams C 1997 Detection of mutations in multi exon genes Comparison of conformation sensitive gel electrophoresis and sequencing strate gies with respect to cost and time for finding mutations Hum Mut 9 339 343 Williams C J Rock M Considine E McCarron S Gow P Ladda R et al 1995 Three new point mutations in type II procollagen COL2A1 and identifi cation of a fourth family with the COL2A1 Arg519 Cys base substitution using conformation sensitive gel electrophoresis Hum Mol Genet 4 309 312 Williams C J Ganguly A Considine E McCarron S Prockop D J Walsh Vockley C et al 1996 A 2 G Transition at the 3 acceptor splice site of IVS17 characterises the COL2A1 gene mutation in the original stickler syndrome kin dred Am J Med Genet 63 461 467 Beauchamp N J Daly M E Makris M Preston F E and Peake I R 1998 A novel mutation in intron K of the PROS1 gene causes aberrant RNA splicing and is a common cause of protein S deficiency in a UK thrombophilia cohort Thromb Haemost 79 1086 1091 Abuzen
99. CR Remedial suggestions include the addition of 0 1 of the antioxidant 8 hydroxyquinoline to the mineral oil prior to UV treatment 8 False negatives may also result from stalling of the Tag DNA polymerase during primer extension This occurs when regions of target DNA form second ary structures 9 Suggestions for overcoming this problem include adding glycerol or tetramethylammonium chloride TMAC to the PCR mix Elimina tion of buffer components stabilizing these secondary structures e g KCl may also help If the annealing temperature is too high the primers will not bind to the target DNA and PCR failure may ensue Conversely if the temperature is too low nonspecific binding will occur It has been suggested that an increase in amplification products from GC rich sequences may be obtained following the addition of either betaine or trim ethylamine N oxide to the PCR reaction Betaine is thought to reduce the for mation of secondary structures caused by GC rich regions however the effect of betaine on the fidelity of Tag polymerase is unknown 10 Reagents and plasticware may be treated with UV irradiation to convert contami nating DNA into a nonamplifiable form Times and conditions for irradiation are dependant upon the energy of irradiation length of contaminating DNA and its thymidine content To control contamination PCR may be performed routinely with dUTP substi tuted for dTTP Treatment of PCR rea
100. DNA Laboratory Department of Medical Genetics St Mary s Hospital Manchester UK YVONNE WALLIS Regional Genetics Laboratory Birmingham Women s Hospital Birmingham UK ANU WARTIOVAARA Department of Neurology University of Helsinki Helsinki Finland NaAusHIn H WASEEM e Division of Medical and Molecular Genetics GKT School of Medicine Guy s Hospital London IAN J WiLiAMs Department of Haematology Birmingham Children s Hospital NHS Trust Birmingham UK 1 Agarose and Polyacrylamide Gel Electrophoresis Andrea M Guilliatt 1 Introduction Electrophoresis through agarose or polyacrylamide gels is a standard method used to separate identify and purify nucleic acids The technique is simple rapid to perform and capable of resolving fragments that differ by as little as 0 2 in size Electrophoresis occurs under the influence of an electric field Charged molecules such as nucleic acids migrate in the direction of the elec trode having the opposite charge anode The electrophoretic mobility of nucleic acids is determined by a number of parameters but molecules of linear double stranded DNA migrate through gel matrices at rates that are inversely proportional to the log of the number of base pairs J and therefore larger molecules migrate more slowly because of the greater frictional drag see Note 1 Other factors affecting electrophoretic mobility include the pK value base composition concentration of gel matrix
101. GCCAGCTTTGGGGCCCAC 5C TATGATGATACCATATCAGTTGAAATG 5D CTCTAATGTGTCCAGAAGCCATTCCC 6A TTCATTTCAGTGGACATGTG 6B CAGGAGGCTTCAAGGCAGTGTCTG 6C CAGTGGACATGTGTTCACTGTACGAA 6D TAGCACAAAGGTAGAAGGCAAGC PA GGATGCTCTAGGACCTAGGC PB AAGAAGCAGGTGGAGAGCTC TA CAAATGTTCATGGAACTAGC TB CTGTTCTCCTGGATTGAGGC The outer primers for seg 1 2 5 and 6 are given A and B as suffix whereas the nested ones are called C and D The primers also synthe sized with biotin at their 5 end are marked with an asterisk 3 Fluorescent deoxynucleotides Fluorescent deoxynucleotides for labeling the PCR products can be obtained from Perkin Elmer Applied Biosystems F dUTP set cat no P N 401894 contains 12 nmol of TAMRA dUTP 3 nmol of R110 dUTP and 3 nmol of R6G dUTP These are stored as 2 uL aliquots at 20 C in the dark to avoid repeated freezing and thawing 2 5 Solid Phase Fluorescent Chemical Cleavage of Mismatch 1 Hydroxylamine hydrochloride Sigma cat no H 2391 A 4 M solution is pre pared and titrated to pH 6 0 with diethylamine Sigma cat no D 3131 Since very little hydroxylamine 20 uL reaction is required for the reaction a rough guide to prepare a 4 M solution pH 6 0 is weight in mg of hydroxylamine divided by 0 28 gives the volume in uL of water to be added This value times 0 2 to 0 3 gives the volume of diethylamine in uL to be added to the solution to reach pH 6 0 The volume of diethylamine to be added varies from batch to
102. Genet 1 88 95 Suomalainen A Majander A Pihko H Peltonen L and Syv nen A C 1993 Quantification of tRNA343 point mutation of mitochondrial DNA in MELAS patients and its effects on mitochondrial transcription Hum Mol Genet 2 525 534 Bengtstrom M Jungell Nortamo A and Syv nen A C 1990 Biotinylation of oligonucleotides using a water soluble biotin ester Nucleosides Nucleotides 9 123 127 Wu R Wu N H Hanna Z Georges F and Narang S 1984 Oligonucle otide Synthesis A Practical Approach Gait M J ed IRL Oxford p 135 Syv nen A C and S derlund H 1993 Quantification of polymerase chain reaction products by affinity based collection Meth Enzymol 218 474 490 Harju L Weber T Alexandrova L Lukin M Ranki M and Jalanko A 1993 Colorimetric solid phase minisequencing assay illustrated by detection of alpha 1 antitrypsin Z mutation Clin Chem 39 2282 2287 Ihalainen J Siitari H Laine S Syv nen A C and Palotie A 1994 Towards automatic detection of point mutations use of scintillating microplates in solid phase minisequencing BioTechniques 16 938 943 Syv nen A C 2001 Accessing genetic variation genotyping single nucleotide polymorphisms Nat Rev Genet 2 930 942 10 Cycle Sequencing of PCR Products G K Surdhar 1 Introduction The development of the polymerase chain reaction PCR has allowed t
103. INE K GREEN Department of Psychiatry Queen Elizabeth Psychiatric Hospital University of Birmingham Birmingham UK Peter M GREEN Division of Medical and Molecular Genetics GKT School of Medicine Guy s Hospital London UK ANDREA M GuILLiATT Department of Haematology Birmingham Children s Hospital NHS Trust Birmingham UK Caro A Harpy Molecular Genetics Laboratory Regional Genetics Service Birmingham Women s Hospital Birmingham UK ADRIAN J HARwoop MRC Laboratory for Molecular Cell Biology and Department of Biology University College London London UK Laura HEISLER Third Wave Technologies Inc Madison WI Nicota Louise Jones Department of Haematology Birmingham Children s Hospital NHS Trust Birmingham UK CHRISTIAN JURINKE Sequenom Inc San Diego CA HUBERT K STER Sequenom Inc San Diego CA ix x Contributors Cuao Hunc Lee Department of Pathology and Laboratory Medicine Indiana University School of Medicine Indianapolis IN RALPH RapLey e Department of Biosciences University of Hertfordshire Hatfield UK G K SuRDHAR Department of Haematology Birmingham Children s Hospital NHS Trust Birmingham UK ANN CHRISTINE SYV NEN Department of Medical Sciences Uppsala University Sweden BmaL D M TuHeEopuiLus Department of Haematology Birmingham Children s Hospital NHS Trust Birmingham UK Dirk VAN DEN Boom Sequenom Inc San Diego CA ANDREW J WALLACE
104. L of PROBE nucleotide mix ddA ddC ddG or ddT with the respective dNTPs 2 uL of PROBE primer 20 pmol 7 6 uL of H O 0 4 uL of enzyme 2 5 U 2 The PROBE temperature profile comprises 1 min at 80 C 3 min at 55 C fol lowed by 4 min at 72 C Cool slowly to room temperature Keep the beads resus pended by gentle rotation see Notes 3 and 4 oie a n 190 Jurinke et al 3 1 5 Recovery of PROBE Products 1 2 3 4 5 After the reaction is completed remove the supernatant by magnetic separation Wash the beads twice with 50 uL of 10 mM Tris HCl pH 8 0 Resuspend the beads in 5 uL of 50 mM NH OH freshly aliquoted from 25 stock solution Incubate for 4 min at 60 C Transfer the supernatant to a microtiter plate and discard or store the beads 3 2 SpectroCHIP Loading see Note 5 1 2 3 4 Fill containers with ultrapure water Initialize the nanoplotter Place the SpectroCHIP and microtiter plate on the nanoplotter see Note 6 Start the sample spotting program 3 3 SpectroCHIP Scanning 1 Place the loaded SpectroCHIP on the sample holder 2 Insert the sample holder into the SpectroSCAN 3 Define which spots or chips have to be analyzed 4 Choose analysis method and start the automated run 5 Transfer the data to the processing server 4 Notes 1 For PCR as well as PROBE primers it is useful to verify the masses before use Primers that are not completely deprotected mass shift
105. Length Polymorphism 31 2 3 4 tech Amersham Pharmacia Biotech Buckinghamshire UK reaction buffer called One Phor All buffer PLUS OPA is 10 mM Tris HCl pH 8 0 100 mM KCl 10 mM MgCl2 10 mM B Mercaptoethanol B ME 100 ug bovine serum albumin BSA mL 200 ug mL BSA Loading buffer LB 30 xylene in 30 glycerol See Notes 1 4 for the restriction enzyme 2 2 Southern Blotting 1 2 0 25 M HCl Standard saline citrate SSC 20X 175 3 g L NaCl and 88 2 g L trisodium cit rate Adjust to pH 7 0 with concentrated HCl 3 Denaturation buffer 87 66 g L NaCl and 20 g L NaOH 4 Neutralization buffer 60 55 g L Tris and 87 66 g L NaCl Adjust to pH 7 4 with concentrated HCl 5 0 4 M NaOH 6 Amersham Hybond N nylon Amersham Pharmacia Biotech Buckingham shire UK as transfer membrane 7 Whatman 3MM chromatography paper Whatman International Ltd Maid stone Kent UK 3 Methods 3 1 Restriction of DNA 1 2 Isolate and purify DNA using standard methods Pipet a desired amount about 25 ug of DNA into a small Eppendorf tube and dilute to 20 uL with distilled water Add 3 uL of the appropriate 10X assay buffer 5 uL of 200 ug mL BSA and an appropriate number of units usually 10 U of the restriction enzyme diluted in dilution buffer usually supplied with the enzymes as desired in a 2 uL volume see Notes 2 and 3 Mix by pipetting and incubate at desired temperature for at least 60 min
106. MM paper Compress completed setup with a 1 kg weight to allow the transfer to proceed and leave for at least 12 h see Notes 11 and 12 After blotting carefully disassemble the gel and membrane from the transfer sys tem Before separating the gel and the membrane mark the position of the gel slots with a pencil as this will allow orientation following autoradiography see Note 13 Carefully remove the membrane see Note 8 and rinse the filter in 2X SSC Covalently crosslink the DNA fragments to the matrix by exposure to a 302 nm UV light transilluminator Place the filter DNA side down on a piece of cling film and expose for 2 3 min see Notes 14 and 15 The filter can be used imme diately or stored at 4 C in cling film until required 4 Notes 1 2 DNA fragment separation may be improved by varying electrophoresis condi tions Overnight runs at low voltages will provide good resolution It is possible to determine the size of the hybridizing band following autoradiog raphy by comparison with standard or marker DNA e g ADNA HindIll 1 kb marker 123 bp marker This needs to be end labeled with a radioactive or non radioactive marker see Chapter 3 26 11 12 13 14 15 Rapley and Williams Ethidium bromide stain can be incorporated into the gel or the buffer tank during electrophoresis Similarly the gel can be stained after the run is complete Trimming away unwanted areas of the gel
107. Methods in Molecular Biology VOLUME 187 PCR Mutation DAUNA Protocols Edited by Bimal D M Theophilus Ralph Rapley SIKHUMANA PRESS PCR Mutation Detection Protocols 2003 4 23 huangzhiman For www dnathink org METHODS IN MOLECULAR BIOLOGY 215 214 213 212 21 210 209 20 oo 207 206 205 204 20 o 202 20 200 199 198 197 196 195 194 193 192 19 190 189 188 187 John M Walker Series Epiror Cytokines and Colony Stimulating Factors Methods and Protocols edited by Dieter K rholz and Wieland Kiess 2003 Superantigen Protocols edited by Teresa Krakauer 2003 Capillary Electrophoresis of Carbohydrates edited by Pierre Thibault and Susumu Honda 2003 Single Nucleotide Polymorphisms Methods and Protocols edited by Piu Yan Kwok 2003 Protein Sequencing Protocols 2nd ed edited by Bryan John Smith 2003 MHC Protocols edited by Stephen H Powis and Robert W Vaughan 2003 Transgenic Mouse Methods and Protocols edited by Marten Hofker and Jan van Deursen 2002 Peptide Nucleic Acids Methods and Protocols edited by Peter E Nielsen 2002 Human Antibodies for Cancer Therapy Reviews and Protocols edited by Martin Welschof and Jiirgen Krauss 2002 Endothelin Protocols edited by Janet J Maguire and Anthony P Davenport 2002 E coli Gene Expression Protocols edited by Peter E Vaillancourt 2002
108. NA samples see Subheading 1 7 7 Positive and negative control samples see Note 8 8 50 mL syringe with a 21 gauge needle 2 4 Staining and Viewing the Gel 1 One CSGE gel loaded and electrophoresed for 16 17 h 2 Two large staining trays large enough to accommodate the plain glass plate e g photographic developer tray one for staining and one for destaining 3 Plate separator e g plastic wedge tool from Hoeffer 4 2Lof0 5X TTE 5 2 L of deionized water 6 Ethidium bromide 10 mg mL 7 Sharp scalpel 8 Two sheets of 3MM blotting paper Whatman area should be larger than that of the gel 9 Water bottle containing deionized water 10 Hand held UV light 302 nm 11 UV transilluminator 302 nm 12 Gel documentation system 3 Methods 3 1 Gel Preparation 1 For 175 mL of CSGE gel mix 10 99 1 acrylamide BAP 0 5X TTE 15 formamide 10 ethylene glycol mix Sterile water 81 38 mL 99 1 acrylamide BAP 43 75 mL 20X TTE 4 38 mL Formamide 26 25 mL Ethylene glycol 17 50 mL 2 To polymerize the gel add 1 75 mL of 10 APS and 100 uL TEMED see Note 9 3 Mix well and pour into prepared sealed glass plates The gel mix can be injected into the space between the plates using the 50 mL syringe To minimize the occurrence of air bubbles the gel mix should be introduced down the inside edge of the plate 4 Once full the plate should be laid horizontally with the open end elevated slightly place top
109. PCR 49 2 AYA WN Nucleotide mix 200 mM each of dATP dCTP dGTP and dTTP in sterile dis tilled water and store at 20 C Allele specific oligonucleotide primers and common primer 10 uM Store at 20 C see Note 2 DNA Taq polymerase Sterile distilled water Sample DNA see Note 3 Mineral oil 3 Methods 1 To 0 5 mL Eppendorf tube add 5 uL 10X reaction buffer 5 uL nucleotide mix 5 uL ASO primer either wild or mutant type primer see Note 4 and 5 uL common primer 100 ng template DNA and 2 U Taq polymerase see Note 5 make up to a final volume of 50 uL with sterile distilled water see Note 6 and overlay with mineral oil to prevent evaporation Place Eppendorf tubes on the thermal cycler to amplify the DNA by repeated cycles of denaturation annealing and extension initial denaturation of 94 C for 5 min followed by 30 cycles of 94 C for 30 s 55 C for 30 s and 72 C for 1 min see Note 7 Following thermal cycling electrophoresis 10 uL of the reaction sample through an agarose gel with a DNA size marker and stain with ethidium bromide A typical result is shown in Fig 1 see Note 8 4 Notes 1 2 Ww The concentration of MgCl may be altered 0 5 5 mM to optimize the specificity and yield of the reaction The design of the ASO PCR primer is essential for specific amplification of the template Primers are synthesized in two forms the wild or normal type and the mutant
110. References 1 Orita M Suzuki Y Sekeiya T and Hayashi K 1989 Rapid and sensitive detection of point mutations and DNA polymorphisms using the polymerase chain reaction Genomics 5 874 879 2 Kwok P Y Carlson C Yager T D Ankener W and Nickerson D A 1994 Comparative analysis of human DNA variations by fluorescence based sequenc ing of PCR products Genomics 23 138 144 3 Martin Gallardo A McCombie W R Gocayne J D Fitzgerald M G Wallace S Lee B M B et al 1992 Automated DNA sequencing and analysis of 106 kilobases from human chromosome 19q 13 3 Nature Genet 1 34 39 4 NIH CEPH Collaborative Mapping Group 1992 A comprehensive genetic link age map of the human genome Science 258 67 86 5 Sanger F Nicklen S and Coulson A R 1977 DNA sequencing with chain terminating inhibitors Proc Natl Acad Sci USA 74 5463 5467 6 McMahon G Davis E and Wogan G N 1987 Characterization of c Ki ras oncogene alleles by direct sequencing of enzymatically amplified DNA from car cinogen induced tumours Proc Natl Acad Sci USA 84 14 4974 4978 7 Carothers A M Urlab G Mucha J Grunberger D and Chasin L A 1989 Point mutation analysis in a mammalian gene rapid preparation of total RNA PCR amplification of cDNA and Taq sequencing by a novel method BioTechniques 7 5 494 499 8 Murray V 1989 Improved double stranded DNA sequencing using the li
111. S solution adjust final volume to 1000 mL with dH O Store at room temperature 10 Rainbow colored protein molecular weight markers see Note 10 low molecu lar weight range 2 35 46 kDa or high molecular weight range 14 3 220 kDa Amersham Life Sciences Stable for at least 3 mo stored at 20 C 11 Fix solution 10 v v acetic acid and 20 v v methanol in dH 0 freshly prepared before use 12 3MM Chromatography paper Whatman 13 Vacuum gel drier 14 X ray film e g Hyperfilm MP Amersham Life Science Kodak T mat or Kodak X OMAT AR Kodak and cassettes 3 Methods 3 1 PCR Amplification of Template for In Vitro Transcription and Translation 3 1 1 Reverse Transcription of RNA 9 Particular care must be taken when preparing and working with RNA to prevent contamination with RNases The workbench should be clean Clean disposable latex gloves should be worn at all times New autoclaved dispos able plastic microtubes and pipet tips should be used Some laboratories prefer to have a set of automatic pipets kept exclusively for RNA work only in order to minimize contamination problems 1 Place approx 1 3 ug of total cellular RNA and 500 ng of oligo d N primer see Note 2 ina 0 5 mL microtube Make the final volume to 32 uL with DEPC treated H O Heat to 65 C for 10 min and then place on ice Add 12 uL of 5X reverse transcriptase buffer 6 uL of 0 1 M DTT 6 uL of 10 mM dNTP mix 1 uL RNasin 30 40
112. S2 gel 17 After 16 h the xylene cyanol should have run to the end of the aluminum cooling plate on an 8 gel Double stranded DNA heteroduplexes of about 180 bp comigrates with the xylene cyanol on an 8 gel although there can be consider able sequence dependent variability It is best to determine optimum electro phoresis times empirically 3 2 Silver Staining and Drying of SSCP Heteroduplex Gels 1 Slide one of the spacers out from between the glass plates and gently prise apart with a plastic spatula or other nonmetal instrument Ensure that the gel is attached to the lowermost plate before completely removing the upper plate Mark the gel orientation by removing a corner adjacent to lane 1 For S2 gels cut the gel ver tically in half for staining by applying pressure on the gel with the edge of a ruler 156 Wallace 2 Carefully lift the bottom edge of the gel and fold over a 10 cm length Repeat this action until the gel is completely rolled up then place the plate in a clean stain ing tray and dislodge or lift the gel into the tray For S2 gels place each half in a separate tray 3 Pour on 400 mL of silver staining solution 1 and leave on an orbital shaker for about 5 min In the specified trays the gel should unfurl to a degree but remain folded in half during the staining process 4 Pour off solution 1 see Note 11 and save for reuse Pour on 500 mL of silver staining solution 2 and shake gently for 15 min see Note 12
113. SNP scoring In agricultural approaches quantitative trait loci can be explored resulting in significant breeding advances Methods are required that provide high throughput parallel sample process ing flexibility accuracy and cost effectiveness to match the different needs and sample volumes of such efforts Large scale hybridization assays performed on microarrays have enabled relatively high throughput profiling of gene expression patterns 13 How ever several issues must be considered in attempting to adapt this approach for the large scale genotyping of populations of several hundred individuals Hybridization chips for SNP scoring can potentially analyze in parallel several hundred SNPs per chip with DNA from one individual Therefore several hundred hybridization chips would be needed for projects with larger popula tions If during the course of a study an assay needs to be modified or new assays have to be added all chips might have to be completely remanufactured Also note that DNA hybridization lacks 100 specificity Therefore highly redundant assays have to be performed providing a statistical result with a false negative error rate of up to 10 for heterozygotes 14 Finally because of the inherent properties of repeated sequences hybridization approaches are hardly applicable to STR analysis 1 3 DNA MassArray Technology Within the last decade mass spectrometry MS has been developed to a powerful tool no lon
114. Stop solution 95 formamide 20 mM EDTA 0 05 bromophenol blue 0 05 xylene cyanol store at 4 C 2 1 4 6 Polyacrylamide Sequencing Gels 1 20X Glycerol tolerant gel buffer 1 L 216 g Tris base 72 g taurine 4 g Na EDTA 2H 0 stable at room temperature 30 mL 30 w v acrylamide stock solution 19 1 acrylamide bis acrylamide store at 4 C 63 g Urea TEMED N N N N tetramethylethylenediamine 25 Ammonium persulfate APS made fresh Loading buffer stop solution as in Subheading 2 1 3 N DAW 2 1 5 Autoradiography 1 X ray Hyperfilm 18 cm x 43 cm Sigma and cassettes 2 2 Automated Fluorescent Cycle Sequencing 2 2 1 Purification of PCR Products Before Cycle Sequencing 1 Microcon 100 Microconcentrators Amicon 2 2 2 Cycle Sequencing 1 Terminator Ready Reaction Mix Applied Biosystems ABI contains the following A Dye terminator labeled with dichloro R6G C Dye terminator labeled with dichloro ROX 68 Surdhar G Dye terminator labeled with dichloro R110 T Dye terminator labeled with dichloro TAMRA Deoxynucleoside triphosphates dATP dCTP dITP dUTP AmpliTaq DNA polymerase FS with thermally stable pyrophosphatase MgCl Tris HCl buffer pH 9 0 2 2 3 Purifying Extension Products 1 3 M Sodium acetate pH 5 2 2 Absolute ethanol 3 70 Ethanol 4 Distilled water 2 2 4 Preparing and Loading Samples 1 Template suppression reagent ABI store at 4 C
115. Store at room temperature 2 80 denaturant polyacrylamide stock 8 polyacrylamide see Note 4 5 6 M urea and 32 formamide For 500 mL add together the following 100 mL 40 polyacrylamide 19 1 acrylamide bis acylamide 170 g urea 160 mL deionized formamide see Note 5 25 mL 20X TAE buffer and distilled water up to 500 mL Stir until urea is completely dissolved Store at 4 C in a dark bottle stable at 4 C for 3 mo 3 0 Denaturant polyacrylamide 8 stock For 500 mL combine 100 mL 40 polyacrylamide 19 1 acrylamide bis acylamide and 400 mL distilled water Store at 4 C stable at 4 C for 3 mo 4 10 Ammonium sulphate APS Dissolve 1 g in 10 mL distilled water Divide into 500 uL aliquots and store at 20 C until required 5 N N N N Tetramethylethylenediamine TEMED Store in the dark at room temperature 6 6X Gel loading buffer 0 025 bromophenol blue 0 025 xylene cyanol and 20 Ficoll Dissolve 250 mg bromophenol blue 250 mg xylene cyanol and 20 g Ficoll in 100 mL distilled water can be stored at room temperature 7 10 mg mL Ethidium bromide solution Dissolve 1 g ethidium bromide in 100 mL distilled water Store at room temperature in a dark bottle Note Ethidium bro mide is a highly hazardous substance In addition to standard laboratory safety procedures always wear appropriate protective equipment when handling ethidium bromide powder i e face mask and solution i e gloves 3 Methods 3
116. T bases 4x Number of G C bases The starting point for determining the optimal annealing temperature is approx 5 10 C below that of the primer with the lowest Tm Ideally the two primers should have similar T s The primers usually completely complement the sequence of interest although for specific purposes such as allele specific PCR primers with mismatches to the target sequence may be used See Chapter 7 The pH of the reaction buffer is important as enzymes are sensitive to pH changes The optimal pH for Taq polymerase activity is 8 3 The magnesium concentration of the buffer is also critical Insufficient Mg leads to low product yields whereas excessive Mg gives nonspecific products Free magnesium in addition to that complexed to dNTPs is required for the polymerase to work efficiently Therefore because the concentration of dNTPs affects the amount of free Mg optimum concentrations of MgCl should be determined for each PCR protocol The addition of denaturants and other reagents such as dimethyl sulfoxide DMSO formamide glycerol polyethylene glycol PEG Triton X 100 bo vine serum albumin and spermadine appear to enhance the PCR reaction Such compounds may stabilize the polymerase prevent loop back sequences and increase the specificity of primer binding Owing to the superior quality of modern Taq polymerases and the technological advances in thermal cyclers it is often possible to reduce the exte
117. U uL and 3 uL M MLV reverse transcriptase 200 U uL Incubate at 42 C for 1 h Inactivate the reverse transcriptase by heat ing to 95 C for 5 min Perform RT PCR immediately or store at 20 C until required Reverse tran scribed RNA should be stable for several months when stored at 20 C 3 1 2 Nested RT PCR The gene under investigation may not be highly expressed in tissues that are easily sampled such as blood lymphocytes cultured skin fibroblasts or 96 Hardy lymphoblastoid cell lines In some cases the mRNA may be present only as illegitimate transcripts This problem can usually be overcome by performing nested RT PCR In the first round of PCR gene specific primers are used to amplify a segment of the gene using the reverse transcribed RNA as the template A second round of PCR is then performed using an aliquot of the first PCR as template The primers for the second round of PCR are nested within the first primer pair the forward primer has the 5 modification required for PTT If low level transcription of the gene is not a problem then one round of PCR should be adequate using the 5 modified T7 primer and a suitable reverse primer Obtaining good reproducible results for PTT depends to a large extent on obtaining a single PCR product of high yield Therefore it is important to ensure that the PCR conditions are optimized see Note 11 1 Place 1 5 uL of the reverse transcribed RNA in a 0 5 mL microtube Store
118. When the gel has polymerized assemble the gel tank apparatus as recommended by the manufacturers Fill the tank with 1X buffer remove the comb and wash out the wells with buffer Remove the tape from the bottom of the plates or cut with a sharp blade see Note 19 Mix the DNA samples with appropriate gel loading buffer and apply to the wells see Note 20 Run the gel at a voltage between 1 and 8 V cm If electrophoresis is carried out at a higher voltage differential heating in the center of the gel may cause bowing of the DNA bands or even melting of small strands of DNA When the marker dyes have migrated the desired distance turn off the power supply and disconnect the leads Remove and detach the glass plates and pry apart using a spatula 3 2 3 Staining and Visualization of Nucleic Acids 1 Because polyacrylamide quenches the fluorescence of ethidium bromide it is not possible to detect bands that contain less than 10 ng of DNA using this method To stain the gel gently submerge the gel and its attached glass plate in 0 5 ug mL ethidium bromide in 1X TBE buffer for 10 30 min at room temperature Destain for 10 min in water and following removal from the glass plate view the gel as described in Subheading 3 1 3 4 Notes 1 At low voltages the rate of migration of linear DNA fragments is proportional to the voltage applied but as the electric field strength is increased the mobility of high molec
119. acity of the ther mal cycler Bring the DNA to a final volume of 13 uL with DNA dilution buffer if necessary 2 Ina separate tube prepare an enzyme master mix that contains the following for each reaction 2 uL of 10X CFLP buffer 2 uL 2 mM MnCl uL of Cleavase I enzyme 2 uL of 10 mM MgCl optional see Note 4 and DNA dilution buffer to a final volume of 7 uL if needed 3 To denature samples place tubes containing DNA in a programmable thermal cycler or heat block and incubate at 95 C for 15 s If the single temperature method is used proceed to step 4 If the ramping method is to be used proceed to step 5 4 Temperature time optimization After the 15 s denaturation step set the thermal cycler to the desired reaction temperature or place the tubes in a heat block held at reaction temperature if no thermal cycler is available Optimal times and tem peratures can be determined by examining matrices of different reaction times e g 1 3 and 5 min and temperatures 40 50 and 55 C Choose the con ditions that yield the richest and most even pattern see Note 5 Incubate the CFLP reactions for the amount of time determined to be optimal holding the 174 Heisler and Lee temperature constant After the incubation period stop the reactions with 16 uL of stop solution Proceed to Subheading 3 3 5 Ramping After the 15 s denaturation step set the thermal cycler to 35 C As soon as the thermal cycler reaches 35 C add
120. adah A M Gursel T Ingerslev J Nesbitt I M Peake I R and Goodeve A C 1999 Mutational analysis of the von Willebrand disease Thromb Haemost Suppl A Abstract 887 Gari M Goodeve A C Wilson G Winship P R Langabeer S Linch D et al 1999 c kit proto oncogene exon 8 in frame deletion plus insertion muta tions in acute myeloid leukaemia Br J Haematol 10 894 900 Markoff A Sormbroen H Bogdanova N Priesler Adams S Ganev V Dworniczak B et al 1998 Comparison of conformation sensitive gel electro phoresis and single strand conformation polymorphism analysis for detection of mutations in the BRCA1 gene using optimised conformation analysis protocols Eur J Hum Genet 6 145 150 16 SSCP Heteroduplex Analysis Andrew J Wallace 1 Introduction Single strand conformation SSCP and heteroduplex analysis are separate mutation scanning methods in their own right They are however unusual in that they can be carried out simultaneously on a single gel The technique of SSCP analysis was originally described in 1989 1 It involves the heat denaturation of polymerase chain reaction PCR amplified DNA followed by electrophoresis under nondenaturing conditions The frag ments in the original protocol were visualized by radiolabeling and autorad iography although a variety of nonisotopic methods are now available including silver staining 2 fluorescent labels 3 and et
121. aining bromophenol blue and xylene cyanol in a lane that does not contain CFLP reactions in order to monitor the progress of gel electrophoresis 4 MgCl dramatically reduces the rate of cleavage in the CFLP reaction When MgCl is added to a final concentration of 1 mM in the presence of standard MnCl con centrations of 0 2 mM the rate of cleavage is slowed by as much as 10 fold This reduced reaction rate can be useful for analysis of DNA fragments that assume highly favored secondary structures that are rapidly cleaved in the CFLP reac tion The presence of such structures is readily identified by the appearance of a structural fingerprint comprising one or two prominent bands When mM MgCl is added the optimal time and temperature of digestion should be reevaluated to reflect the reduced rate of cleavage see Note 5 5 The structural fingerprint produced by CFLP digestion is a collection of fragments resulting from partial digestion usually of 5 end labeled fragments Because the CFLP reaction is a partial digestion and because the formation of the sub strate secondary structures depends on reaction temperature it is possible to modulate the extent of digestion through variations in the duration and tempera ture of the reaction Specifically lower temperatures stabilize secondary struc ture formation whereas higher temperatures reduce the number of structures formed by a given molecule Similarly longer reaction times lead to increas
122. al acetic acid 20 mM Acetate 100 mL of 0 5 M EDTA pH 8 0 1 mM EDTA Tris borate 10X Stock 108 g Tris base 89 mM Tris pH 7 6 TBE 55 g Boric acid 89 mM Boric acid 10 40 mL of 0 5 M EDTA pH 8 0 2 mM EDTA Loading buffers are usually made as 5X to 10X concentrates and consist of three main constituents The first is a high density solution such as glycerol Ficoll or sucrose and the second is tracking dyes such as bromophenol blue BPB or xylene cyanol When choosing the loading buffer it must be noted that it may quench the fluorescence of ethidium bromide and can obscure the presence of DNA Chelating agents such as EDTA are also included which complex divalent cations and stop any enzymatic reactions During storage acrylamide and bis acrylamide are slowly deaminated to acrylic and bisacrylic acid catalyzed by light and alkali The solution should be pH 7 0 or less and stored protected from light at room temperature Fresh solutions should be prepared every few months TEMED and persulfate are added immedi ately before use to initiate the polymerization process Acrylamide is a potent neurotoxin and is readily absorbed through the skin The effects of acrylamide are cumulative therefore gloves and a mask should be worn when working with powdered acrylamide and methylbisacrylamide Although polyacrylamide is considered to be non toxic it should be handled with care as it may contain small quantities of unpolymerized acrylamid
123. alled int22h 1 and either of the two repeats of these sequence int22h 2 and int22h 3 located 500 and 600 kb more telomerically and in inverted orientation relative to int22h 1 9 In 1998 Lui et al 10 developed a rapid PCR method for the detection of these inversions The reac tion is performed in a single tube containing four primers Primers P and Q amplify a 12 kb int22h 1 specific sequence and primers A and B amplify 10 kb of int22h 2 and int22h 3 When an inversion occurs two new recombined PCR products PB 11 kb and AQ 11 kb are amplified together with the AB 10 kb from unrecombined int22h 2 or int22h 3 and can be readily distinguished as two bands on a 0 5 agarose gel Fig 4 1 Ina0 2 mL microfuge tube add 1 uL of 10X Expand buffer 2 supplied with the enzyme 1 uL 5 mM dNTP made with 2 5 mM deaza dGTP 2 5 mM dGTP and 5 mM each of dCTP dTTP and dATP 7 5 DMSO 120 ng of primer P and Q 50 ng of primer A and B 0 3 uL of Expand Boehringer Mannheim Germany and 250 ng of DNA make up the volume to 10 uL with TE 8 0 2 Place the tube in a controlled temperature block and cycle under following condi tions after 2 min denaturation at 94 10 cycles of 94 for 15 s 68 for 12 min followed by 20 cycles of 94 for 15 s 68 for 12 min with 20 s increment per cycle 3 Load the products on 0 5 agarose gel and visualize the band after staining with ethidium bromide Mutation Detection in Factor VIII 121 A 2
124. apidly and specifically cleaves these structures many of which are formed on a given DNA fragment albeit transiently in equilibrium with alternative mutually exclusive structures The CFLP method is thus able to elucidate a considerable amount of information about the sequence content of a DNA fragment without relying on cumbersome high resolution analysis of each base Each unique DNA sequence produces a distinctive col lection of structures that in turn results in the generation of a singular finger print for that sequence This capability makes the CFLP technology suitable for diverse mutation scanning applications including genotyping J 3 7 14 Furthermore the CFLP reaction is unaffected by the length of the DNA frag ment and can be used to analyze far longer stretches of DNA than is currently possible with other methods up to at least 2 7 kb unpublished data 1 2 Visualizing Sequence Differences in CFLP Fingerprints The CFLP method comprises the steps of separation of DNA strands by heating formation of intrastrand structures on cooling with rapid enzymatic cleavage of these structures before they are disrupted by reannealing of the complementary strands and separation and visualization of the resulting struc tural fingerprint Fig 2 When closely related DNA fragments such as a wild type and a mutant version of a gene are compared the CFLP fingerprints CFLP Analysis for Genotyping and Mutation Detection Wild Typ
125. arison of spectra with the theoretical results Genotyping Using DNA MassArray Technology 189 2 2 Nanoliquid Handling and SpectroCHIPs 1 SpectroCHIP Sequenom 2 SpectroJET Sequenom 2 3 SpectroCHIP Analysis 1 SpectroSCAN Sequenom 2 SpectroTYPER Sequenom 3 Methods 3 1 PCR and PROBE Reaction The following steps can be performed either in microtiter plates using mul tichannel manual pipettors or automated pipetting systems or on the single tube scale 3 1 1 Preparation of PCR Perform one 50 uL PCR per PROBE reaction with 10 pmol of biotinylated primer and 25 pmol of nonbiotinylated primer see Note 2 3 1 2 Immobilization of Amplified Product 1 For each PCR use 15 uL of streptavidin Dynabeads 10 mg mL 2 Prewash the beads twice with 50 uL of 1X B W buffer using the magnetic rack 3 Resuspend the washed beads in 50 uL of 2X B W buffer and add to 50 uL of PCR mix 4 Incubate for 15 min at room temperature Keep the beads resuspended by gentle rotation 3 1 3 Denaturation of DNA Duplex Remove the supernatant by magnetic separation Resuspend the beads in 50 uL of 100 mM NaOH freshly prepared Incubate for 5 min at room temperature Remove and discard the NaOH supernatant by magnetic separation Wash three times with 50 uL of 10 mM Tris HCl pH 8 0 3 1 4 PROBE Reaction 1 Remove the supernatant by magnetic separation and add the following PROBE mix 3 uL of 5X reaction buffer 2 u
126. ase I digestion is effec tive for removing larger DNA species An alternative to the HPPPPK columns in conjunction with Exonuclease I digestion is to precipitate with 1 vol of iso propanol following Exonuclease I digestion If a single labeled product is detected following PCR and HPPPPK and Exonuclease I digestion then proceed with CFLP analysis If more than one product is detected then optimization of the PCR reaction or gel isolation of the desired product is necessary The following protocol describes the method for Exonuclease I digestion 1 Following PCR amplification incubate the reaction mixture at 70 C for 10 min 2 Bring the reaction mixture to 37 C 3 Add 1 U of Exonuclease I uL of original PCR reaction mixture e g 100 U toa 100 uL reaction mixture 4 Incubate for 30 min at 37 C 5 Inactivate the reaction by heating at 70 C for 30 min 6 Following Exonuclease I digestion apply the reaction mixtures to the HPPPPK spin columns according to the manufacturer s suggested procedures The sup plied elution buffer should be replaced with either sterile double distilled H O or T oEo1 pH 8 0 CFLP Analysis for Genotyping and Mutation Detection 173 3 2 Preparation and Performance of CFLP Reactions Prior to performing CFLP analysis it is strongly recommended that the qual ity and quantity of the PCR generated fragments following purification be checked This can be done by visualizing the label used i e by fl
127. at room temperature for 20 min 3 Transfer the opaque layer of lymphocytes at the interface with a disposable plas tic Pasteur pipet into a fresh 50 mL centrifuge tube and add 35 mL of phosphate buffered saline At this stage divide the suspension equally between two tubes 4 Centrifuge at 400g for 10 min at room temperature 5 In one tube resuspend the pellet in 500 uL of RNA Isolator Genosys and store at 70 C until further use In the other tube add 600 uL of Cell Lysis Solution Gentra USA and store at 4 C for DNA isolation 3 2 Isolation of DNA and RNA There are a number of kits available for the isolation of RNA and DNA We use Puregene DNA isolation kit for DNA isolation and RNA Isolator Genosys for RNA isolation 3 2 1 Isolation of DNA 1 To the 600 uL cell lysate add 300 uL of Protein Precipitation Solution supplied with the kit Mix 20 times and centrifuge at 16 000g for 10 min The precipitated protein forms a tight pellet at the bottom of the tube 2 Transfer the supernatant into a fresh 2 mL microfuge tube and add mL of 100 isopropanol to it and mix by inverting several times 3 Centrifuge at 16 000g for 10 min at room temperature 4 Decant the supernatant and add 70 ethanol and repeat the centrifugation 5 Air dry the pellet for 5 min and resuspend in 500 uL of TE pH 8 0 3 2 2 Isolation of RNA 1 Thaw the cell lysate in RNA Isolator Genosys Add 100 uL chloroform and mix gently 15 times and
128. ation of a CA repeat a ddG or ddT termination mix is used Even imperfect repeats harboring insertion or deletion mutations can be analyzed with this approach Figure 4 displays raw data from the analysis of a human STR marker in a heterozygous DNA sample Both alleles differ by four CA repeats The DNA polymerase slippage during amplification generates a pattern of stutter fragments marked with an asterisk in Fig 4 In the case of heterozygotes that differ in just one repeat the smaller allele has higher intensi ties than the larger allele because allelic and stutter signals are added together A DNA MassArray compatible STR portfolio with a 5 cM intermarker dis tance is currently under development at Sequenom When compared to the analysis of hybridization events by detecting labels even on arrays the DNA MassArray approach differs significantly The PROBE assay is designed to give only the relevant information The mass spec 184 Jurinke et al Immobilization of PER prodici Cenoturation of FSR product BlormassPROBE N GGECC Alae 1 MCOGOGCATAGGICASOCGCGAGCAT 1757 Da g GRACE Aleta 2 dC TOG GGCATAGSTCAGGCGIGASCAT Ang Da PROBE Ene AIP GAFET OGTR dP Fig 2 Reaction scheme for the BiomassPROBE reaction Allele 1 Allele 2 Y m z Fig 3 Raw data of SNP analysis heterozygous sample using the BiomassPROBE reaction Genotyping Using DNA MassArray Technology 185 Allele 1 k
129. ation system for prenatal diagnosis and carrier assessment in cystic fibrosis Lancet II 1481 1483 Green E K Bain S C Day P J R Barnett A H Charleson F Jones A F et al 1991 Detection of human apolipoprotein E3 E2 and E4 genotypes by an allele specific oligonucleotide primed polymerase chain reaction assay develop ment and validation Clin Chem 37 1263 1268 Main B J Jones P J MacGillivary R T A and Banfield D K 1991 Apoliprotein E genotyping using the polymerase chain reaction and allele specific oligonucleotide primers J Lipid Res 32 183 187 Ehlen T and Dubeau L 1989 Detection of Ras point mutations by polymerase chain reaction using mutation specific inosine containing oligonucleotide primers Biochem Biophys Res Commun 160 441 447 Kwok S Kellog DE McKinney N Spasic D Goda L Levenson C et al 1990 Effects of primer template mismatches on the polymerase chain reac tion human immunodeficiency virus type I model studies Nucl Acids Res 18 999 1005 Rychlik W Spencer W J and Rhoads R E 1990 Optimisation of the annealing temperature for DNA amplification in vitro Nucl Acids Res 18 6904 6912 Winship P R 1989 An improved method for directly sequencing PCR amplified material using dimethyl sulphoxide Nucl Acids Res 17 1266 8 Long Range PCR Peter A Davies and George Gray 1 Introductio
130. ation to the same probe will reveal the strongest signal that can be used to establish the optimal time for exposure With standard UV transillumi nator regular recalibration is required References 1 Southern E M 1975 Detection of specific sequences among DNA fragments separated by gel electrophoresis J Mol Biol 98 503 517 2 Evans M R Bertera A L and Harris D W 1994 The Southern blot an update Mol Biotechnol 1 1 12 5 Restriction Fragment Length Polymorphism Mohammad S Enayat 1 Introduction DNA sequence changes within a gene result either in polymorphism or muta tion causing different diseases Some of these polymorphisms that occur with a high frequency within the population can be a useful tool for gene tracking for a given disease Such investigations have initially been done by Southern blot techniques but where possible they have now been replaced by polymerase chain reaction PCR based methodology The nucleotide substitutions can be identified in two ways 1 By use of restriction enzyme analysis or restriction fragment length polymorphisms RFLPs 2 Allele specific oligonucleotide hybridization ASO H or similar techniques Another type of polymorphism a polymorphic tandem dinucleotide repeat sequence or variable number tandem repeat VNTR can also be used for gene tracing in a familial disease In these cases a segment containing the repeats is amplified and the fragment size d
131. ations is exceedingly time consuming and is usually less than 100 sensitive Moreover neutral polymorphisms and missense mutations of uncertain pathogenicity are identi fied by these techniques Direct sequencing of the gene is both time consuming and expensive PTT was developed to screen the dystrophin gene specifically for translation terminating mutations following amplification of large seg ments of the gene by nested RT PCR 1 The whole of the dystrophin coding Protein Truncation Test 89 Fig 1 PTT for exon 11 of the BRCA gene amplified from genomic DNA From left to right lane 1 a normal control with only the full length translated protein lane 2 a breast cancer patient with a 5 bp deletion of nucleotides 1623 1627 which results in a premature stop at codon 503 PTT performed by Ms Kim Hampson DNA Labo ratory Regional Genetics Service Birmingham Women s Hospital Birmingham 4 5 1 2 3 z Fig 2 PTT for the PTCH gene in patients affected with naevoid basal cell carci noma syndrome NBCCS or Gorlin syndrome RNA was isolated from lymphoblastoid cell lines and nested RT PCR was used to amplify a 1 6 kb fragment of the gene which includes exons 10 16 Truncated proteins were identified in NBCCS patients with the following mutations from left to right lane 1 2439insC lane 2 2101del19bp lanes 3 and 4 siblings with 2683insC mutation lane 5 normal control 06 Table 1 Some Examples of Human
132. ations of mitochon drial DNA 5 6 The high sensitivity is an advantage of the minisequencing method compared to dideoxy nucleotide sequencing in which a sequence vari ant must be present as 10 20 of a mixed sample to be detectable On the other hand a limitation of the solid phase minisequencing method is that it is restricted to analyzing variable nucleotides only at positions predefined by the detection step primers used The minisequencing reaction principle is utilized in a variety of other assay fomats than the one described here for reviews see refs 2 and 12 2 Materials 2 1 Equipment and Materials 1 One of the PCR primers should be biotinylated at its 5 end during the oligonucle otide synthesis and the other primer is not biotinylated resulting in a PCR prod uct with one biotinylated strand see Note 1 2 Detection step primer an oligonucleotide complementary to the biotinylated strand designed to hybridize with its 3 end with the nucleotide adjacent to the variant nucleotide to be analyzed see Fig 1 and Note 2 3 Facilities for PCR Microtiter plates with streptavidin coated wells e g Combiplate 8 Labsystems Finland see Note 3 Shaker at 37 C Water bath or incubator at 50 C Liquid scintillation counter Multichannel pipet and microtiter plate washer optional gt OO Sl ON 2 2 Reagents All of the reagents should be of standard molecular biology grade Use ster ile distilled or
133. ave been A G C I J etc This provided the resilience to possible attempts at dis From Methods in Molecular Biology vol 187 PCR Mutation Detection Protocols Edited by B D M Theophilus and R Rapley Humana Press Inc Totowa NJ 193 194 Brzeski ruption The original work was done by the Advanced Research Projects Agency and the network was known as ARPAnet Later on academic institu tions saw this as a wonderful way for researchers to communicate and so they started to connect their computers to this international network or Internet This gave rise to the ability to communicate via e mail and also allowed col laborators to share large amounts of data by transferring the files rapidly via the Internet rather than by mailing a pile of disks or tapes Now the Internet is being used for advertising and other commercial purposes 1 2 Navigating on the Web The files on computers scattered around the world must all have a unique name so that you can access each one specifically This means that their names sometimes can be rather complex Initially it is necessary to tell your Web browser where to go to pick up a specific page The address of this page is given a jargon name it is a URL which stands for Universal Resource Loca tor However navigating surfing on the Internet would be tedious if surfers had to type in these names continually They would soon get bored with typing http www expasy ch prosite
134. bes Dynal Specific PCR and PROBE primer see Note 1 ne shared a a du fu ju hi ab Lb i E F i 1 i er 188 Jurinke et al Reaction_Details Sample_Details Assay_Details PlateNo PlateID Well SampleNo SampleID PlateMo PlateID Well AssayNo Name Result Spectrum 1 11187872 Al 1 14688 1 23R902 Al 1 AMG Male 1187872 _Al sq 1 1157872 A2 2 14G89 1 23R902 A2 1 AMG Male 1187872 A2sq 1 1187872 A3 3 14G90 1 23R902 A3 1 AMG Female 11 7872_A3 sq 1 1187872 A4 4 14G91 1 23R902 A4 1 AMG Female 11 7872_A4 sq 1 1187872 A5 5 14G92 1 23R902 A5 1 AMG Male 1187872 _A5 sq 1 1187872 A6 6 14G93 1 23R902 A6 1 AMG Female 11S7872_A6 sq 1 1187872 A7 7 14G94 1 23R902 A7 1 AMG Male 11987872 A7 sq 1 1187872 A8 8 14G95 1 23R902 A8 1 AMG Female 1187872_A8 sq 1 fits7e72 a9 a 14G96 1 23R902 A9 1 AMG Male 1187872 A9sq 1 msan 10 14G97 1 23p90z aio 1 AMG Male 1157872 A10 s 1 fis7s72 ai 11 14G98 1 23R902 A1 1 AMG Female 1157872 _All sq 1 1187872 412 12 14G99 1 23R902 A12 1 AMG Female 11857872 A12 sq 1 1187872 B1 13 14G100 1 23R902 B1 1 AMG Male 1187872 B1 sq 1 1187872 B2 14 14G101 1 23R902 B2 1 AMG Female 11857872 B2 sq Fig 7 Sequenom data analysis software reports for automated sex typing using the DNA MassArray Fig 8 Tool for visual comp
135. box and stain in 1X TAE buffer or distilled water containing 0 5 ug uL ethidium bromide Shake gently for 15 30 min Decant ethidium bromide solution and rinse gel in distilled water and visualize the DNA bands under UV light 254 nm Denaturing Gradient Gel Electrophoresis 133 Heteroduplescs e a Hetorduplescs Karmal Hameduph e aa Horal Hoemoduples iuta Homoduphe p Ba ee ae Heteroduplexes Heterodu plewes D Pierce erature Homodeplexga armalh muani Homoduplexce 2 Fig 4 Photographs of DGGE gels showing examples of variant band patterns detected in exons 10 panel A 15D panel B and 5 panel C of the APC gene Panel A four bands in lane 1 represent a 5 bp deletion at codon 456 and 3 bands are seen in lane 4 caused by a 2 bp insertion at codon 452 Panel B a two band pattern in lane 1 is caused by a 1 bp deletion at codon 964 Panel C a G to T splice site mutation causes a three band pattern in lane 2 The presence of heteroduplex bands in lanes 4 of Panel A lane 1 of Panel B and lane 2 of Panel C facilitates the detection of these variants since the normal and mutant homoduplex bands comigrate 3 5 Gel Interpretation A normal PCR fragment containing no nucleotide alterations will resolve ona DGGE gel as a single band Amplification of a DNA fragment containing a heterozygous nucleotide change whether single base substitution or small insertion deletion wi
136. brated phenol Can be stored at 4 C for at least 2 mo 9 Ethanol and 70 ethanol v v in water 10 5M Ammonium acetate pH 7 5 Store at room temperature 2 2 End Labeling with T4 Kinase 11 10X CIP buffer 10 mM ZnCl 10 mM MgCl 100 mM Tris HCl pH 8 3 12 CIP calf intestinal alkaline phosphatase Boehringer Mannhiem Gmbh at 1 U uL Store at 4 C 13 10X Kinase buffer 700 mM Tris HCl pH 7 6 100 mM MgCl 50 mM dithiothreitol 14 P y ATP Specific activity gt 3000 Ci mmol 15 T4 kinase T4 polynucleotide kinase at 1 U uL Store at 20 C 16 Cold ATP 1 0 mM ATP freshly made from 20 mM stock 3 Methods 3 1 End Labeling with Klenow 1 Resuspend 1 1000 ng of DNA in 42 uL of dH O see Note 2 Add 5 uL of 10X Klenow buffer 1 uL of P a dNTP 1 uL of dNTP mix and 1 uL of Klenow Incubate at room temperature for 15 min see Note 3 20 Harwood Add 1 uL of dNTP chase Incubate at room temperature for a further 15 min see Notes 1 and 4 Add 50 uL of TE followed by 100 uL of phenol chloroform Vortex briefly and separate by centrifugation at 12 000g in a microfuge see Note 5 Remove the aqueous top phase to a fresh tube and add 100 uL of chloroform Separate the layers as in step 3 and remove the aqueous phase to a fresh tube Care must be taken as the discarded reagents are contaminated with unincorpo rated gt P c dNTP Add 60 uL 0 6 vol of 5 M ammonium acetate and 200 uL
137. c acid and choose blastp to carry out a blast search on the protein data bases Now press the Search button and wait while the chosen sequence is com pared to the databases and the matches displayed 3 3 1 Interpreting the Results The results from the NCBI BLAST server are presented both graphically and textually The graphical view shows the query sequence as a thick red line with base numbers attached to it Below this are a series of thin lines which represent matches to the query sequence The length of the line indicates which part of the query sequence matches the hit sequence The color represents the quality of the match Below the picture is a list of files corresponding to these matches and sorted in match quality order The first hyperlink blue and underlined is to the file containing the entire sequence This is followed by a very brief description of the file A numerical score represents how good the match was This score is hyperlinked to the actual match found between your query sequence and the match itself Finally the last number gives the statistical significance of the match the E value and the chances of finding this match by chance Note that the color of the line represents a hit of poor quality However clicking on the hyperlinked colored line will display the matching sequence which will be very similar The reason for the apparently poor match is that the chance of finding such a short sequence match is high and
138. cation test Hum Genet 98 328 332 Heim R A Kam Morgan L N W Binnie C G Corns D D Cayouette M C Farber R A et al 1995 Distribution of 13 truncating mutations in the neu rofibromatosis 1 gene Hum Mol Genet 4 975 981 van Bakel I Sepp T Ward S Yates J R W and Green A J 1997 Muta tions in the TSC2 gene analysis of the complete coding sequence using the pro tein truncation test PTT Hum Mol Genet 6 1409 1414 Peral B Gamble V Strong C Ong A C M Sloane Stanley J Zerres K et al 1997 Identification of mutations in the duplicated region of the polycystic kidney disease 1 gene PKD1 by a novel approach Am J Hum Genet 60 1399 1410 108 Hardy 20 21 22 23 24 233 Fitzgerald M G Bean J M Hegde S R Unsal H MacDonald D J Harkin D P et al 1997 Heterozygous ATM mutations do not contribute to early onset of breast cancer Nature Genet 15 307 310 Axton R Hanson I Danes S Sellar G van Heyningen V and Prosser J 1997 The incidence of PAX6 mutation in patients with simple aniridia an evalu ation of mutation detection in 12 cases J Med Genet 34 279 286 Hogervorst F B L 1998 Protein truncation test PTT Promega Notes 62 7 10 Lo Ten Foe J R Rooimans M A Bosnoyan Collins L Alon N Wijker M Parker L et al 1996 Expression cloning of a cDNA for the major fanconi anaemia gene
139. centrifuge immediately at 4 C for 30 min and carefully remove the supernatant see Note 7 Wash the pellet by adding 2 mL cold 70 ethanol and inverting Centrifuge at 11 000 rpm for 10 min Remove the supernatant air dry the pellet and redissolve in sterile water 3 2 Probe Labeling Nick translation is the method of choice for labeling FISH probes The tech nique involves the use of two enzymes a DNase that randomly nicks probe DNA and a DNA polymerase that repairs the nicked DNA and at the same time incorporates labeled dNTP molecules into the probe The following pro tocol uses a nick translation kit and describes a basic method suitable for indi rect or direct labeling of FISH probes 1 10 To label 1 ug of DNA add the following to a 0 5 mL Eppendorf tube on ice 1 ug DNA 10 uL dNTP mix 1 vol labeled dUTP 0 4 mmol L 2 vol dTTP 0 1 mM 3 vol each dATP dCTP dGTP 0 1 mM 2 uL 10X buffer 2 uL enzyme mix see Note 8 Sterile water to give final volume of 20 uL Mix well and incubate at 15 C for 90 min Add 2 uL EDTA 0 2 M to stop enzyme activity For nick translation of single copy probes or whole chromosome libraries add 25 uL Human COT 1 DNA 1 mg mL see Note 9 Add 10 uL Herring sperm DNA 5 ug mL see Note 10 To precipitate DNA add the following 0 1 x total volume sodium acetate 3 M pH 5 2 1 uL glycogen 20 mg mL 2 x total volume 100 ethanol Mix well and incubate at 20 C
140. cks hot ovens and water baths can all be used for heteroduplexing PCR product 5 This will give a total sample volume of 10 uL of which 2 8 uL can be loaded onto the CSGE gel Where PCR product volume is limited each PCR product can be reduced to for example 3 uL providing a total volume to load of 5 uL Where one PCR sample is at a lower concentration volumes mixed should be adjusted to produce equal DNA concentrations to be mixed together 6 Care must be taken when handling solid acrylamide Always read safety guide lines before attempting to make solutions 7 Ethidium bromide is mutagenic Care must be taken in its use and disposal 8 A heterozygous positive control sample should be loaded with each CSGE run to ensure that the gel has run properly and is capable of heteroduplex detection Samples with a known polymorphism or mutation genotype can be used A nega tive control must also be included where wild type DNA is heteroduplexed to self For samples that require mixing with wild type DNA the same wild type DNA should also be used in the negative control A negative control should be incorporated into the CSGE screening procedure for each DNA fragment stud ied for comparison with band characteristics of heteroduplexed samples 9 The CSGE gels should be prepared polymerized and electrophoresed on the same day Keeping the CSGE gel overnight even in a cold room may affect results 10 Combs must be removed from the
141. cols Volume 2 Methods and Techniques edited by Hans J Vogel 2001 Calcium Binding Protein Protocols Volume 1 Reviews and Case Histories edited by Hans J Vogel 2001 Proteoglycan Protocols edited by Renato V Iozzo 2001 DNA Arrays Methods and Protocols edited by Jang B Rampal 2001 Neurotrophin Protocols edited by Robert A Rush 2001 Protein Structure Stability and Folding edited by Kenneth P Murphy 2001 DNA Sequencing Protocols Second Edition edited by Colin A Graham and Alison J M Hill 2001 Immunotoxin Methods and Protocols edited by Walter A Hall 2001 SV40 Protocols edited by Leda Raptis 2001 Kinesin Protocols edited by Isabelle Vernos 2001 Capillary Electrophoresis of Nucleic Acids Volume 2 Practical Applications of Capillary Electrophoresis edited by Keith R Mitchelson and Jing Cheng 2001 Capillary Electrophoresis of Nucleic Acids Volume 1 Introduction to the Capillary Electrophoresis of Nucleic Acids edited by Keith R Mitchelson and Jing Cheng 2001 Cytoskeleton Methods and Protocols edited by Ray H Gavin 200 Nuclease Methods and Protocols edited by Catherine H Schein 2001 Amino Acid Analysis Protocols edited by Catherine Cooper Nicole Packer and Keith Williams 2001 Gene Knockoout Protocols edited by Martin J Tymms and Ismail Kola 2001 Mycotoxin Protocols edited by Mary W Trucksess and Albert E Pohland 2001 METHODS IN MOLECULAR BIOLOG Y PCR Mutation Detecti
142. cs 13 441 443 Sreevatsan S Bookout J B Ringpis F M Mogazeh S L Kreiswirth B N Pottathil R R and Barathur R R 1998 Comparative evaluation of cleavase fragment length polymorphism with PCR SSCP and PCR RFLP to detect antimi crobial agent resistance in Mycobacterium tuberculosis Mol Diagn 3 81 91 Tahar R and Basco L K 1997 Analysis of Plasmodium falciparum multidrug resistance pfmdr1 gene mutation by hairpin dependent cleavage fragment length polymorphism Mol Biochem Parasitol 88 243 247 Wartiovaara K Hytonen M Vuori M Paulin L Rinne J and Sariola H 1998 Mutation analysis of the glial cell line derived neurotrophic factor gene in Parkinson s disease Exp Neurol 152 307 309 Schlamp C Poulsen G L Nork M and Nickells R W 1997 Nuclear exclu sion of wild type p53 in immortalized human retinoblastoma cells J Natl Can cer Inst 89 1530 1536 Marshall D J Heisler L M Lyamichev V Murvine C Olive D M Ehrlich G D Neri B P and de Arruda M 1997 Determination of hepatitis C virus genotypes in the United States by Cleavase Fragment Length Polymorphism analysis J Clin Microbiol 35 3156 3162 178 Heisler and Lee 12 13 14 15 16 17 18 19 Rainaldi G Marchetti S Capecchi B Meneveri R Piras A and Leuzzi R 1998 Absence of mutations in the highest mutability region of th
143. ctions with uracil N glycosylase then pre vents contamination by carry over of PCR products from a previous reaction In order to eliminate false primer binding in the initial stages of DNA PCR which may produce nonspecific products a technique known as hot start PCR can be used Hot start PCR ensures the physical separation of one essential component of the PCR reaction e g primers or Taq polymerase prior to dena turation of the DNA template Using a solid wax bead keeps the reagents sepa rate Upon heating the wax bead melts and the components mix An alternative approach involves the use of a variant Tag polymerase that is inactive at room 44 Jones temperature but is activated at 94 C Conversely the missing component can be added manually immediately following the initial 5 min denaturation at 94 C 4 Notes 1 Primers are usually 20 bp in length but typically between 15 and 30 bp with approx 50 GC content It is desirable to have a G or C at the 3 end as this binds to the target DNA with a triple hydrogen bond thus anchoring the primer more effectively than A or T The primers should not contain self complementary sequences that might produce loop back or hairpin structures The annealing temperature of the primers varies according to their sequence but it is usually 50 65 C For primers up 20 bp in length the theoretical melting temperature Tm in C can be calculated approximately as 2x Number of A
144. d Osmium tetroxide is a strong oxidizing agent avoid undue exposure to the air Hydroxylamine and osmium tetroxide reaction can either be performed separately or can be combined To do that first do the reaction with hydroxylamine then osmium tetroxide followed by the piperidine cleavage step Follow the reaction until step 3 Subheading 3 4 2 1 then start step 1 of Subheading 3 4 2 2 the osmium tetroxide reaction as described in the protocol On a Genescan gel a couple of fluorescent bands appear around 150 200 bp These are the degraded fluorescent moieties from the fluorescence dUTPs They can be removed from the reaction mixture by ethanol precipitation Perform the cleavage step with aqueous 1 M piperidine at 90 C for 30 min To the supernant add 1 10 vol of 3 M sodium acetate pH 4 6 and 2 5 vol of ethanol Place the tube in dry ice for 5 min spin at maximum speed for 10 min in a microfuge Wash the pellet with 70 ethanol air dry and resuspend in 5 uL of formamide loading dye Twelve centimeter plates give good separation of most of the mismatch bands However samples that have large mismatch products are better separated on 36 cm plates The manufacturer of ABI PRISM 377 DNA sequencer recommend the gel to age for 2 h before loading the samples However we find that 15 min setting time is enough Gels left to set for more 2 h run slower More accurate sizing of the mismatched products on a Genescan gel will require interna
145. d If it is important to identify missense mutations another mutation detection method such as single strand conformation polymorphism SSCP see Chapter 16 would need to be used in conjunction with PTT The protein truncation test was first described in 1993 as a technique for identifying translation terminating mutations in the dystrophin gene 1 which cause the X linked disorder Duchenne muscular dystrophy DMD The technique was subsequently applied to identification of truncating mutations in the APC gene 2 that cause familial adenomatous polyposis Since then PTT has been used successfully in the identification of translation terminating mutations in many other genes that result in human hereditary disorders some examples are shown in Table 1 The dystrophin gene illustrates some of the problems encountered in screening large genes for mutations and shows how these problems are largely overcome by the use of PTT The dystrophin gene is exceptionally large with 79 small exons contained within a region of 2400 kb The majority of dystrophin mutations in DMD patients are easily identifiable deletions of one or more exons J However approximately one third of dystrophin mutations are nonsense mutations or small frameshift mutations that result in premature truncation of the dystrophin gene less than 2 of DMD cases are the result of a pathogenic missense mutation 1 5 Using conven tional methods such as SSCP to screen for these mut
146. deionized water Solid Phase Minisequencing 59 eke ee ei tee es ee i Sco ee ae cia 1 ga 3 ce 2 3 NN N s e oo gi eee T m 3 T aa z 7 g x DNA pol ae pol 4 3 Bera CaA so is 5 LOL 6 a a Fig 1 Steps of the solid phase minisequencing method 1 PCR with one biotinylated black ball and one unbiotinylated primer 2 affinity capture of the biotinylated PCR product in streptavidin coated microtiter wells 3 washing and denaturation 4 the minisequencing primer extension reaction 5 measurement of the incorporated label 6 calculation of the result 60 Wartiovaara and Syvanen 1 PBS Tween solution 20 mM sodium phosphate buffer pH 7 5 0 1 v v Tween 20 Store at 4 C 50 mL is enough for several full plate analyses 2 TENT solution 40 mM Tris HCl pH 8 8 1 mM EDTA 50 mM NaCl 0 1 v v Tween 20 Store at 4 C Prepare 1 2 L at a time which is enough for several full plate analyses 3 50 mM NaOH make fresh every 4 wk store at room temperature about 20 C Prepare 50 mL 4 Thermostable DNA polymerase Thermus aquaticus Taq DNA polymerase Promega 5 U uL see Note 4 5 10X concentrated Tag DNA polymerase buffer 500 mM Tris HCl pH 8 8 150 mM NH 4 SO 15 mM MgCh 0 1 v v Triton X 100 0 01 w v gelatin store at 20 C 6 PH labeled deoxynucleotides ANTPs dATP to detect a T at the variant site dCTP to detect a G and so fo
147. ding if exposed to light and should be kept in reduced light conditions During microscopic evaluation probe signals should appear as distinct sig nals with minimal background fluorescence Single copy probes should be seen as small bright signals and there should be virtually no background nonspecific hybridization Repetitive sequence probes tend to show some degree of cross hybridization across the genome but specific signals should still be bright and easily recognizable It should be noted that certain repetitive sequence centro meric probes hybridize to more than one centromeric pair because of extensive sequence homology e g the chromosome 1 centromeric probe hybridizes to the centromeric regions of chromosomes 1 5 and 19 whereas centromeric probes specific for chromosomes 13 and 14 also hybridize to the centromeres of chromosomes 21 and 22 respectively Whole chromosome libraries should hybridize specifically along the length of a chromosome pair although it is not uncommon to see low levels of cross hybridization across the rest of the genome Occasionally FISH preparations show no signal or excessive cross hybridization there is usually a simple reason for this and some troubleshoot ing tips are given in Table 4 4 Notes 1 If using direct labels i e fluoroscein 11 dUTP or Texas Red 11 dUTP handle in reduced light conditions at all times Formamide is a known teratogen and should be handled with extreme care Sodium
148. e Fluorescent In Situ Hybridization 81 1 At least 30 min prior to hybridization prewarm a lidded plastic Coplin jar containing denaturation solution in a 75 C water bath The water bath should be sited in a Class 1 fume hood to contain formamide fumes Mark the hybridization area on the underside of each target slide using a dia mond pen For each slide aliquot 1 uL of each labeled single copy probe into an Eppendorf tube and make up volume to 10 uL with HB2 e g if simultaneously applying two differentially labeled probes to two slides use 1 uL of each probe and 18 uL of HB2 mix well Denature by incubating the probe mix at 75 C for exactly 5 min snap chill on ice for 30 s and prehybridize by incubating at 37 C for 30 min see Note 12 Shortly before the end of prehybridization check that the temperature of the denaturation solution is 75 C Denature the target slide s by incubating in the denaturation solution for exactly 2 min see Note 13 Dehydrate the target slide s by incubating through an ice cold alcohol series 2 min in each of 75 95 and 100 methanol and dry briefly on a 50 C hot plate Apply 10 uL of the denatured prehybridized probe mix to the marked hybridization area of each denatured slide Cover the hybridization area with a 22 x 22 mm coverslip and seal the edges with rubber sealant see Note 11 Place slide s in a hybridization chamber and hybridize overnight at 37 C 3 3 3
149. e To avoid the hazards associated with acrylamide stock solutions are available commer cially that only require the TEMED and the persulfate to be added Acrylamides may contain contaminating metal ions although they can be easily removed by stirring overnight with approx 0 2 vol of monobed resin followed by filtration Some agarose gel systems enable the casting of the gel directly in the electro phoresis tank The buffer should not occupy more than 50 of the volume of the flask Always wear protective gloves when handling heated agarose as the solution may become superheated and boil violently when disturbed Some evaporation of the solution may occur and can be made up with water if desired During electrophoresis the ethidium bromide migrates toward the cathode in the opposite direction to the DNA Extended electrophoresis can lead to removal of the ethidium bromide from the gel making detection of smaller fragments diffi cult If this occurs the gel can be restained by soaking for 30 40 min in a solu 10 Guilliatt Table 4 Examples of Polyacrylamide Gel Formulations for 100 mL Gel Gel concentration T Constituents 3 5 5 0 7 5 10 0 15 0 20 0 Acrylamide g 3 24 4 7 7 13 9 6 14 55 19 5 Bis g 0 26 0 3 0 37 0 4 0 45 0 5 TEMED mL 0 1 0 1 0 1 0 1 0 1 0 1 10X Buffer stock mL 10 0 10 0 10 0 10 0 10 0 10 0 Water mL 86 4 84 9 82 4 79 9 74 9 69 9 10 Ammonium persulfate mL 1 0 1 0 1 0 1 0 1 0 1 0 tion containing
150. e for 1 h and proceed immediately to thermal cycling reactions 93 C for 30 s 65 C for 30 s 68 C for 5 min for 10 cycles 3 To set up secondary PCR add 2 5 uL of 10X Tfl buffer 0 5 uL of 10 mM dNTP 1 0 uL of 25 mM MgSO 2 5 uL of 100 ng uL primer XC amp XD x is the segment number 0 5 uL Tfl I 0 4 uL F GUTP 14 5 uL water 2 5 uL of primary PCR This reaction mix is also used for the amplification of segment 3 and 4 from DNA see Note 4 4 Set up the cycling conditions as follows 94 C for 5 min and 30 cycles of 93 C for 30 s 65 C for 30 s 72 C for 3 min 5 For amplification from control RNA or cloned factor VHI cDNA referred to as probe from now on use the same recipe except use biotinylated primers The products should be gel purified before using in the solid phase fluorescent chemi cal cleavage of mismatch see Note 5 3 4 Solid Phase Fluorescent Chemical Cleavage of Mismatch 3 4 1 Preparation of Hybrids 1 Set up the hybridization as follows 3 uL 10X hybridization buffer 30 ng each of the probe 1 3 and 6 the other multiplex will be 2 4 and 5 300 ng of target 1 3 and 6 Make up the volume to 30 uL with TE 8 0 2 Incubate at 95 C for 5 min and 65 C for 1 h see Note 6 Mutation Detection in Factor VIII 117 3 10 uL of Streptavidin coated magnetic beads a 50 suspension is supplied are required to bind the biotin tagged products per reaction Take out the required volume and wash twice with 2X
151. e DNA Se a Step by step description of the Mutant DNA a y NN N oa a S a S a e T aa iM y Wild Type DNA Mutant Wild Type 167 Time required for each step 15 seconds CFLP reaction In the first step the DNA sample is incubated at a high temperature i e 95 C both to melt apart the two DNA strands one or both of which is usually labeled and to denature any higher order structures In the second step the temperature is lowered and either held at a pre determined optimal reaction temp erature OR gradually increased i e ramped at 0 1 C sec from 35 C to 85 C allowing the individual strands to fold on themselves to create the intrastrand structures that are the substrates for the Cleavase enzyme The enzyme acts as molecular scissors to cleave the DNA strands at the positions indicated i e on the 5 side of the hairpin structures thus creating a collection of DNA fragments 2 10 minutes In the third step these fragments are 15 minutes to 3 hours resolved by gel electrophoresis on any of a number of platforms to yield band patterns that are distinct structural fingerprints of each sequence analyzed The time is dependent on the gel based instrument which varies from the traditional vertical apparatus to fluorescence sequencers with fragment analysis software Fig 2 CFLP reaction The CFLP reaction itself is a simple three step procedure that relies on the use of
152. e concentration of agarose used the voltage applied and the time of elec trophoresis will vary according to the size of the product to be resolved see Chapter 1 For mtDNA the following condition can be used Mix 5 uL of PCR products with 5 uL of loading dye 15 Ficoll w v in sterile double distilled water Load onto a 0 8 agarose gel in 1X TBE and electrophorese at 90 V for 2 h To maximize the yield of product produced in each successive cycle the combined annealing and extension time is increased by 30 s per cycle 4 Notes 1 Primer sequences should be chosen such that the melting temperature Tm of the primer is between 65 C and 70 C The length of L PCR primers is typically 38 bases The high Tm maximizes the specificity of primer and template binding and Long Range PCR 55 minimizes internal mispriming over long template reads The Tn values for each primer in the pair should not vary by more than 1 C or 2 C Nucleotides and magnesium ions form a complex that forms the substrate for the DNA polymerase A relatively high magnesium ion concentration 2 5 mM in the reaction buffer ensures that there is a sufficient supply of substrate for incorporation Use of a mineral oil overlay is recommended even with oil free PCR machines The combined annealing and extension time is increased by 30 s per cycle to maximize the yield of product produced in each successive cycle References 1 2 Ehrlich H
153. e custom made to order Acrylamide powder preweighed 49 1 acrylamide bis acrylamide e g Sigma cat no A0924 Dissolve according to the manufacturer s instructions with deionized water to make a 40 stock solution and store at 4 C Use within mo see Notes 2 and 3 TEMED N N N N tetramethylethylenediamine e g Sigma cat no T7024 10 Ammonium persulfate solution 10 AMPS e g Sigma cat no A9164 Make up fresh on the day of use 10X TBE electrophoresis buffer e g Gibco BRL cat no 15581 036 Use within 1 mo of opening Formamide loading buffer 10 mL deionized formamide 200 uL of 0 5 M EDTA pH 8 0 15 mg xylene cyanol 3 mg bromophenol blue Store at room temperature Electrophoresis power pack capable of maintaining 600 V and with a voltage preset Access to a 4 C cold room or cold cabinet with power supply see Note 4 Flat gel loading tips e g Life Sciences International cat no PPOOO OGEL FO01 2 2 Silver Staining and Drying of SSCP Heteroduplex Gels 1 8 Plastic photographic style staining trays e g Jencons Scientific part no 682 172 Orbital shaker Silver staining solution 1 10 industrial methylated spirit 0 5 glacial acetic acid Store at room temperature Solution 1 may be recycled up to 10 times Silver staining solution 2 0 1 AgNO3 Prepare as a 10X stock solution 1 AgNO3 Store at room temperature in a brown bottle Prepare and store t
154. e easily resolved by SDS PAGE However if segment 2 overlaps with segment 1 by 300 500 bp then a mutation near the end of segment will also occur near the start of segment 2 The smaller truncated protein should be easily identified by SDS PAGE The forward primer must have an extension at the 5 end containing the sequence motifs that are essential for in vitro transcription and translation Essentially most PTT primers are of a similar design with minor variations Some examples of the 5 modifica tions that are used in PTT are shown in Table 1 The extreme 5 end of the for ward primer may include a restriction enzyme recognition site often BamH1 which can be useful for cloning the PCR product into a plasmid vector 22 The addition of a restriction enzyme site is not essential for the success of the PTT and may be replaced by any 2 or 3 bases These are followed directly by the Protein Truncation Test 103 bacteriophage T7 promoter sequence required for RNA synthesis Alternatively the T3 or SP6 promoter may be used in which cases an in vitro transcription translation system designed for use with these promoters must be used see Note 7 The promoter sequence is followed by a small spacer sequence of 2 5 bp The spacer is followed by the eukaryotic translation initiation sequence the in frame ATG translation start site and the gene specific sequence It is most important to ensure that the ATG codon and the gene specific sequence
155. e inversion hotspot of mutation in hemophilia A Blood 92 1458 1459 Forrest S M Dahl H H Howells D N Dianzani I and Cotton R G H 1991 Mutation detection in phenylketonuria using the chemical cleavage of mis match method Importance of using probes from both normal and patient samples Am J Hum Genet 49 175 183 14 Denaturing Gradient Gel Electrophoresis Yvonne Wallis 1 Introduction Denaturing gradient gel electrophoresis DGGE is a powerful mutation detection technique described by Fisher et al in 1983 Z It allows the resolu tion of relatively large DNA fragments usually polymerase chain reaction PCR products differing by only a single nucleotide DGGE is most frequently employed for the detection of unknown mutations A related technique referred to as constant denaturing gradient gel electrophoresis CDGE is used for the sensitive detection of known mutations 2 3 More recently a modified version of DGGE known as 2 dimensional DGGE has been employed for the simultaneous analysis of several PCR fragments 4 PCR fragments are initially separated by size on a polyacrylamide gel prior to loading onto a con ventional denaturing gradient gel system as will be described in this chapter Denaturing gradient gel electrophoresis offers a number of advantages over other mutation detection techniques including 1 Itis capable of detecting up to 100 of all single base substitutions in fragments up to 5
156. e left in neutralization buffer for longer than 1 h with no adverse effects if kept at 4 C so as to limit diffusion Maximum time in neutralization buffer is 4 h References 1 White G C and Shoemaker C B 1989 Factor VIII and haemophilia A Blood 73 1 12 2 Peake I R Lillicrap D P Boulyjenkov V Briet E Chan V et al 1993 Report of a joint WHO WFH meeting on the control of haemophilia carrier detection and prenatal diagnosis Blood Coag Fibrinol 4 313 344 3 Peake I 1995 Molecular genetics and counselling in haemophilia Thromb Haemost 74 40 44 Restriction Fragment Length Polymorphism 35 4 Gitschier J Drayna D Tuddenham E G D White R L and Lawn R M 1985 Genetic mapping and diagnosis of haemophilia A achieved through a BclI polymorphism in the factor VIII gene Nature 314 738 740 5 Gitschier J Lawn R M Rotblat F and Goldman E 1985 Antenatal diagno sis and carrier detection of haemophilia A using factor VIII gene probe Lancet 1 1093 1094 6 Rapley R ed 2000 The Nucleic Acid Protocol Handbook Humana Press Totowa NJ 7 Kogan S C Doherty N and Gitschier J 1987 An improved method for prenatal diagnosis of genetic diseases by analysis of amplified DNA sequences application to haemophilia A New Engl J Med 317 980 990 6 PCR Principles Procedures and Parameters Nicola Louise Jones 1 Introduction In 1983 the Cetus sci
157. e may be used T4 DNA polymerase has a 200 fold higher 3 5 exonuclease activity than Klenow If the DNA fragments are incubation in the absence of dNTPs this enzyme will produce a region of single stranded DNA which can be subsequently labeled with a higher incorporation by the addition of 32P a dNTP and cold dNTPs to the mix 6 One unit of CIP dephosphorylates 50 pmol of ends in 1 h for a 5 kb fragment 1 pmol of ends is approx 2 ug The efficiency of dephosphorylation of blunt and 5 recessed ends is improved by incubating the reaction at 55 C The phosphatase reaction can be carried out in restriction enzyme buffer by the addition of 0 1 vol of 500 mM Tris HCl pH 8 9 1 mM EDTA and the required amount of enzyme 22 14 15 16 17 Harwood It is important to remove all phosphatase in order to prevent removal of the newly incorporated labeled phosphate The T4 kinase reaction is very sensitive to inhibitors such as those found in aga rose Care should be taken to ensure that the DNA is inhibitor free In addition T4 kinase will readily phosphorylate RNA molecules therefore the presence of RNA should be avoided as this will severely reduce the incorporation of labeled 32P into the DNA The labeling reaction is only approx 10 efficient To get all of the molecules phosphorylated it is necessary to chase the reaction with excess cold ATP This is a poor way to purify oligonulceotides instead I recommend a Sephade
158. e on Pneumocystis carinii f sp hominis typing based on nucleotide sequence variations in internal transcribed spacer regions of rRNA genes J Clin Microbiol 36 734 741 Sambrook J Fritsch E F and Maniatis T eds 1989 Molecular Cloning A Laboratory Manual Cold Spring Harbor Laboratory Press Cold Spring Har bor NY 18 Automated Genotyping Using the DNA MassArray Technology Christian Jurinke Dirk van den Boom Charles R Cantor and Hubert Koster 1 Introduction 1 1 Markers Used for Genetic Analysis The ongoing progress in establishing a reference sequence as part of the Human Genome Project 1 has revealed a new challenge the large scale iden tification and detection of intraspecies sequence variations either between individuals or populations The information drawn from those studies will lead to a detailed understanding of genetic and environmental contributions to the etiology of complex diseases The development of markers to detect intraspecies sequence variations has evolved from the use of restriction fragment length polymorphisms RFLPs to microsatellites short tandem repeats STRs and very recently to single nucle otide polymorphisms SNPs Although RFLP markers 2 are useful in many applications they are often of poor information content and their analysis is cumbersome to automate STR markers 3 by contrast are fairly highly informative through their highly polymorphic number of rep
159. e p53 gene in tumour derived CHEF18 Chinese hamster cells Mutagenesis 13 153 155 Rossetti S Englisch S Bresin E Pignatti P F and Turco A E 1997 Detection of mutations in human genes by a new rapid method cleavage frag ment length polymorphism analysis CFLPA Mol Cell Probes 11 155 160 Eisinger F Jacquemier J Charpin C Stoppa Lyonnet D Bressac de Paillerets B Peyrat J P Longy M Guinebretiere J M Sauvan R Noguichi T Birnbaum D and Sobol H 1998 Mutations at BRCA1 the med ullary breast carcinoma revisited Cancer Res 58 1588 1592 Centers for Disease Control and Prevention 1989 AIDS Weekly Surveillance Report Centers for Disease Control and Prevention Atlanta GA Latouche S Ortona E Masers E Margutti P Tamburrini E Siracusano A Guyot K Nigou M and Roux P 1997 Biodiversity of Pneumocystis carinii hominis typing with different DNA regions J Clin Microbiol 35 383 387 Lu J J Bartlett M S Shaw M M Queener S F Smith J W Ortiz Rivera M Leibowitz M J and Lee C H 1994 Typing of Pneumocystis carinii strains that infect humans based on nucleotide sequence variations of internal transcribed spacers of rRNA genes J Clin Microbiol 32 2904 2912 Lee C H Tang X Jin S Li B Bartlett M S Helweg Larsen J Olsson M Lucas S B Roux P Cargnel A Atzori C Matos O and Smith J W 1998 Updat
160. e percentage of denaturant 15 of the calculated denaturant as derived from the T value For example if a PCR fragment has a single melting domain with a T of 71 C the denaturant required for melting at 60 C is calculated to be 45 Denaturing Gradient Gel Electrophoresis 129 High Solution Clamp Magnetic Bead ae Magnetic Stirrer Fig 3 Schematic diagram of a gradient maker used to generate linearly increasing denaturant gradient gels for DGGE analysis ee Tube to Gel System and therefore a denaturing gradient of 30 60 should be employed to resolve this fragment Fragments containing two melting domains should be analyzed on two gradient gels with denaturant gradients specific for each of the two T values It may be necessary to optimize the denaturing gradient for some PCR prod ucts if they migrate either too far along the denaturing gradient or insufficiently so that they come to rest near the top of the polyacrylamide gel see Note 3 2 Materials The author uses the INGENYphorU DGGE system supplied by Genetic Research Instrumentation Ltd GRI and all materials and methods described below are for use with this system Commercial systems are not essential how ever and homemade equipment as originally described by Myers et al 13 may be used if a good electrical workshop is to hand 2 1 DGGE Equipment 1 DGGE gel system supplied by GRI comprising of the following
161. ea of each denatured slide Cover the hybridization area with a 22 x 22 mm coverslip see 82 Dyer and Green Note 11 and seal the edges with rubber sealant Place the slide s in a hybrid ization chamber and hybridize overnight at 42 C 3 4 Stringency Washing Stringency washing removes unbound probe from the target slide The amount of probe left on the slide depends on the stringency of the wash high stringency washes have a low salt concentration and or high temperature whereas low stringency washes have a high salt concentration and or low temperature 1 After hybridization gently remove coverslips and rubber sealant using fine for ceps and wash the slide s in the appropriate SSC concentration at 75 C see Note 13 for the required time see Table 2 2 Rinse briefly in PN buffer and then allow the slide to stand in PN buffer for at least 10 min If using indirectly labeled probes proceed to the detection stage see Subheading 3 5 If using directly labeled probes proceed to the counter staining stage see Subheading 3 6 3 5 Detection This stage is only necessary for slides hybridized with indirectly labeled probes if directly labeled probes have been used slides may be counterstained immediately see Subheading 3 6 Protocols are given for the detection of both biotin and digoxygenin labeled probes and involve amplifying detec tion reagents to give high intensity signals Biotin is detected with a gre
162. ead in recent years PCR Mutation Detection Protocols provides biological and clinical inves tigators with a comprehensive collection of new recent and updated PCR based screening methods suitable for detecting the presence of both known and novel mutations The methods cover point mutations e g ASO PCR SSCP DGGE chemical cleavage deletions multiplex PCR FISH blot ting non sense mutations PTT and more The new and exciting techniques of DNA array analysis along with such recently developed experimental methods as conformation sensitive gel electro phoresis are also included Additional coverage is given to the direct use of DNA sequencing as a detection method in its own right and to the characterization of mutations previously located by other screening techniques Each chapter explains the basic theory behind the technique and provides valuable notes essential for its successful execution Comprehensive and highly practical PCR Mutation Detection Protocols assures both seasoned and novice investigators access to the highly productive and readily reproducible PCR based mutation detection methods techniques that are laying the groundwork for many of today s major scientific and medical advances FEATURES All the key PCR based mutation detection methods in a readily reproducible format e Methods for detecting a known mutation or screening for new mutations e New techniques of DNA array analysis e Experimental methods
163. earchers and the programs that could sift through the large amounts of data that were being accumulated Bioinformatics 195 2 DNA Databases In the following sections I will introduce the reader to a few of the programs available via the Web for finding and analyzing biochemical information 2 1 Using Entrez to Search for Relevant Database Entries Sooner or later a project reaches the point when it is necessary to devise primers to amplify known sequences from cells This section describes how to obtain sequences for known genes mRNAs making it possible to devise prim ers to characterize genes mRNAs The National Center for Biotechnology Information NCBI has a very powerful computer with an easy to use Web based interface for accessing sequence information Follow these instructions to find sequences of particular genes mRNAs 1 Start a Web browser Netscape or Internet Explorer by clicking on its icon 2 Go to File Open in the menubar enter http www ncbi nlm nih gov Entrez in the dialog box and press the OK button This will not load the file into a new window 3 This will load the Entrez page which allows users to quiz the databases available at NCBI for textual information connected with any required topic 4 Click on the Nucleotide hyperlink 5 In the text box enter p53 and press the Search button 6 This very simple search will find many records note the button with Retrieve N records at the top right hand s
164. eats and easy to prepare using polymerase chain reaction PCR based assays with a considerable potential for automation However using conventional gel electrophoresis based analysis typing of large numbers of individuals for hundreds of markers still remains a challenging task Within the last few years much attention has been paid to discovery and typing scoring of SNPs and their use for gene tracking 4 5 SNPs are biallelic single base variations occurring with a frequency of at least 1 SNP 1000 bp within the 3 billion bp of the human genome Recently a study on the From Methods in Molecular Biology vol 187 PCR Mutation Detection Protocols Edited by B D M Theophilus and R Rapley Humana Press Inc Totowa NJ 179 180 Jurinke et al sequence diversity in the human lipoprotein lipase gene suggested that the fre quency of SNPs might be much higher 6 The diversity in plant DNA which would be relevant for agricultural applications is five to seven times larger than in human DNA 7 Even though the use of SNPs as genetic markers seems to share the same limitations as relatively uninformative RFLPs when used with modern scoring technologies SNPs exhibit several advantages Most interesting for gene track ing is that SNPs exist in the direct neighborhood of genes and also within genes Roughly 200 000 SNPs are expected 4 in protein coding regions so called cSNPs of the human genome Furthermore SNPs occur much mo
165. ecific nucleotide incorporation The minisequencing reaction mixture can be stored at room temperature for 1 2 h It is convenient to prepare it during the incubation of step 1 The conditions for hybridizing the detection step primer are not stringent and the temperature of 50 C can be applied to the analysis of most PCR products irre spective of the sequence of the detection step primer If the primer however is considerably shorter than a 20 mer or its GC content is low melting temperature close to 50 C lower temperatures for the primer annealing may be required Streptavidin coated microtiter plates made of scintillating polystyrene are avail able ScintiStrips Wallac Finland When these plates are used the final wash ing denaturation and transfer of the eluted detection primer can be omitted but a scintillation counter for microtiter plates is needed 11 The ratio between the cpm values for the two nucleotides reflects the ratio between the two sequences in the original sample Therefore the solid phase minisequencing method can be used for quantitative PCR analyses 4 6 The R value is affected by the specific activities of the H dNTPs used and if either the mutant or the normal sequence allows the detection step primer to be extended by more than one 7H dNTP this will obviously also affect the R value Both of these factors can easily be corrected for when calculating the ratio between the two sequences Another p
166. ection 2 Materials 1 Template DNA The quality of template DNA is of utmost importance Many methods are now available for DNA extraction Care should be taken to select a method that will provide the following a Template DNA of a sufficiently high molecular weight for the intended size of the L PCR product b Template of a sufficiently high purity 2 Optimal primer design This is essential to achieve successful amplification see Note 1 3 dNTP and magnesium concentrations To ensure efficient incorporation the concentration of dNTP s is usually higher in L PCR 300 500 umol L than in normal PCR 200 umol L as is the magnesium concentration see Note 2 4 Polymerase mix Since Barnes described the narrow window of success for achieving amplification of long templates 4 many commercial kits have been developed with optimal mixes of Taq DNA polymerase and proofreader enzyme see Table 1 The amount of enzyme mix used can affect specificity An excess of enzyme can promote extension of oligonucleotides bound to nontarget sequences 5 Reaction buffer Different buffers are supplied in kits each recommended for amplification of fragments within a specific size range Long Range PCR 53 Table 2 Reaction Mix 1 Reactant Volume uL Final concentration Primer 1 20 pmol uL 0 5 0 4 pmol uL Primer 2 20 pmol uL 0 5 0 4 pmol uL 10X L PCR reaction buffer 2 3 1X L PCR reaction buffer Sterile distilled As required
167. ed accumulation of smaller cleavage products The most informative fingerprints are those that contain a relatively even distribution of low and high molecular weight products including a fraction of full length uncut DNA Ensuring that the entire size distribution of cleavage products is visible increases the likelihood of detecting the products that reflect the presence of a polymorphism 6 The percentage of polyacrylamide to be used is dictated by the size of the PCR fragment being analyzed Appropriate percentages of polyacrylamide for various size ranges are well established 19 7 The objective of this step is to minimize carryover of alkaline phosphatase from previous reactions and from exogenous sources e g skin Throughout this pro cedure it is of paramount importance to minimize contamination by this ubiqui tous enzyme 8 An alkaline phosphatase reaction with the chemiluminescence substrate pro duces a long lived signal especially on membranes Light emission increases of gt 300 fold are seen in the first 2 h on application of the substrate onto nylon membranes with the chemiluminescence signal persisting up to several days Because film exposure times range from minutes to several hours multiple images may be acquired Varying film exposure times enables the user to optimize signal to noise CFLP Analysis for Genotyping and Mutation Detection 177 Acknowledgments We wish to acknowledge the efforts of Mary Oldenburg S
168. egment P promoter region and segment T polyadenylation signal region are amplified in the same way as above Subheading 3 3 step 4 except no FAUTP is added The primers used for amplification are shown in Table 1 The PCR products are gel purified and sequenced with one of the primers used for amplification 3 7 Sequence Analysis for Complete Mutation Characterization 3 7 1 Setting up the Sequencing Reaction 1 From the size of the mismatch fragment estimate the position of the mutation from either end of the segment 2 Amplify either the same segment from a new RT PCR or amplify the relevant exons see Note 14 Gel purify the products see Note 15 4 Set up the sequencing reaction as follows BigDye terminator mix 4 uL primer 0 8 pmol DNA 200 400 ng water to 10 uL 5 Start the following thermal cycling condition 96 C for 30 s 50 C for 15 s 60 C for 4 min 25 cycles and hold at 4 C 6 Transfer the content of the reaction tube to a fresh tube and add 1 uL 3 M sodium acetate pH 4 6 and 25 uL ethanol Mix and incubate on ice for 10 min 7 Centrifuge at the maximum speed for 15 min at room temperature 8 Wash pellet with 70 ethanol Vortex to resuspend for about 30 s This is very crucial in removing unincorporated nucleotides 9 Repeat the centrifugation step step 7 10 Discard the supernatant and air dry the pellet for 10 min at room temperature 11 Resuspend in 2 uL of formamide loading dye Just before loading
169. el electrophoresis at this point but it must be remembered that unincorporated P a dANTP will be present in the DNA solu tion This may increase the exposure of the operator and increase the risk of contamination when carrying out gel electrophoresis An alternative purification is to pass the DNA through a Sephadex G50 spin column If only very small amounts of DNA are present it may be necessary to add a carrier such as 10 ug of tRNA or glycogen The gel should be fixed in 10 acetic acid or trichloroacetic acid TCA before drying to prevent contamination of the gel dryer Klenow is rarely affected by inhibitors but it rapidly loses its activity if it is warmed in the absence of a substrate It can be one of the first enzymes to be lost from the general enzyme stock If the activity of the enzyme is in doubt carry out a test reaction by labeling control DNA Generally DNA markers are good for this but check the structure of the ends before proceeding The structure of the end is important as the enzyme can only fill in those bases present in the site Recheck the sequence of the single strand end produced by restriction enzyme digestion It may be possible to exchange the P a dNTP for another which has a higher specific activity The Klenow fill in reaction only incorporates a small number of P labeled nucleotides per DNA molecule If higher levels of incorporation are required T4 DNA polymeras
170. eling using a labeled S or 37P dATPs and mixtures of nucleotides similar to those used originally by Sanger 9 10 The latest manual method available is the termination cycle sequencing Amersham Pharmacia Biotech which incorpo rates the isotopic label into the sequencing reaction products by the use of four From Methods in Molecular Biology vol 187 PCR Mutation Detection Protocols Edited by B D M Theophilus and R Rapley Humana Press Inc Totowa NJ 65 66 Surdhar a 3P dideoxynucleotide ddNTP terminators G A T and C This method is the most efficient in terms of radioactivity usage as the labeled nucleotides label only the properly terminated DNA chains As a result prematurely termi nated chains are not labeled therefore stop artifacts that result in bands across all four lanes and most background bands are eliminated All results obtained from the above mentioned methods are visualized by running the samples on a polyacrylamide gel followed by exposure to X ray film for 24 h or more depending on the age of the radioactivity and amount of template used Fluorescent or automated sequencing methodology is commonly used now in order to avoid the use of radioactive materials The other advantage of this method is that approx 500 bp can be read per reaction on an automated DNA sequencer with 99 3 accuracy compared to 150 200 bp on an average manual sequencing gel 11 12 The automated sequencing market is di
171. en fluorescent label fluoroscein and digoxygenin with a red label rhodamine 1 Prepare detection reagents I II and III in light protected plastic Coplin jars as shown in Table 3 The detection reagents can be reused over a 6 wk period and should be stored at 4 C while not in use 2 After washing incubate the hybridized slide s in detection reagent I at room temperature for 20 min Rinse briefly in PN buffer and leave standing at room temperature in fresh PN buffer for 10 min Do not allow the slides to dry out at any stage 3 Repeat step 2 using detection reagents II and III consecutively Leave slide s standing in PN buffer prior to the counterstaining stage 3 6 Counterstaining For optimum contrast probes labeled or detected with a green label are best viewed on a red PI background whereas red probes are best viewed on a blue DAPI background If both red and green probes have been applied a DAPI counterstain should be used 1 Remove slide s from PN buffer i e the final stage of either stringency washing or detection for directly or indirectly labeled probes respectively and drain off 8 Table 3 Preparation of Detection Reagents Detection of biotin only Detection of digoxygenin only Simultaneous detection of biotin and digoxygenin Detection Reagent I 50 mL PNM buffer 125 uL fluoroscein avidin 2 mg mL Detection Reagent II 50 mL PNM buffer 500 uL biotinylated anti avidin D 0 5 mg mL
172. enaturing gel electro phoresis Proc Natl Acad Sci USA 88 8307 8311 Orita M Iwahana H Kanazawa H Hayashi K and Sekiya T 1989 Detec tion of polymorphisms of human DNA by gel electrophoresis as single strand conformation polymorphisms Proc Natl Acad Sci USA 86 2766 2770 Oldenburg J Ivaskevicius V Rost S Fregin A White K Holinski Feder E et al 2001 Evaluation of DHPLC in the analysis of hemophilia A J Biochem Biophys Meth 47 39 51 Waseem N H Bagnall R Green P M and Giannelli F 1999 Start of UK confidential haemophilia A database analysis of 142 patients by solid phase fluo rescent chemical cleavage of mismatch Throm Haemost 81 900 905 Naylor J A Green P M Montandon A J Rizza C R and Giannelli F 1991 Detection of three novel mutations in two haemophilia A patients by rapid screening of whole essential region of factor VIII gene Lancet 337 635 639 Naylor J A Green P M Rizza C R and Giannelli F 1992 Factor VIII gene explains all cases of haemophilia A Lancet 340 1066 1067 Naylor J A Buck D Green P Williamson H Bentley D and Giannelli F 1995 Investigation of the factor VIII intron 22 repeated region int22h and the associated inversion junctions Hum Mol Genet 4 1217 1224 Liu Q Nozari G and Sommer S S 1998 Single tube polymerase chain reac tion for rapid diagnosis of th
173. ences can be found at http www ncbi nlm nih gov genemap This Web address contains data on all chromosomes Selection of a chromosome number will display a figure which contains three parts First there are three different ways of dis playing the mapping data two RH radiation hybrid G3 and GB4 and one genetic map Second a drawing of the gene density on this particular chromo some is shown and third the chromosome is drawn as an ideogram Below this is a wealth of information on what has been sequenced and its relevance if known This site is continually updated Clicking on a region on the GB4 or G3 map will display the available sequencing information below the mapping data All this information contains hypertext links to the actual sequencing data itself 2 4 1 Genes Associated with Human Diseases The Online Mendelian Inheritance in Man OMIM Web site edited by Dr Victor A McKusick and his colleagues at Johns Hopkins University and elsewhere contains information on a large number 10 000 of diseases that have been identified as being linked with particular genes This site can be accessed at http www3 ncbi nlm nih gov omim and provides not only a description of the clinical symptoms of the disease but also the genetic lesion that gives rise to it It is possible to display the results from a search of this site in two differ ent ways 1 Searching the Gene map http www3 ncbi nlm nih gov Omim searchmap html acce
174. enior Technical Scientist Third Wave Technologies in performing much of the CFLP reaction optimization as well as in providing critical commentary on the manuscript References 1 10 11 Sreevatsan S Bookout J B Ringpis F M Pottathil M R Marshall D J de Arruda M Murvine C Fors L Pottathil R M and Barathur R R 1998 Algorithmic approach to high throughput molecular screening for alpha interferon resistant genotypes in hepatitis C patients J Clin Microbiol 36 1895 1901 Cotton R G H 1997 Slowly but surely towards better scanning for mutations Trends Genet 13 43 46 Brow M A Oldenberg M Lyamichev V Heisler L Lyamicheva N Hall J Eagan N Olive D M Smith L Fors L and Dahlberg J 1996 Differen tiation of bacterial 16S rRNA genes and intergenic regions and Mycobacterium tuberculosis katG genes by structure specific endonuclease cleavage J Clin Microbiol 34 3129 3137 Orita M Suzuki Y Sekiya T and Hayashi K 1989 Rapid and sensitive detection of point mutations and DNA polymorphisms using the polymerase chain reaction Genomics 5 874 879 Hayashi K 1991 PCR SSCP a simple and sensitive method for detection of mutations in the genomic DNA PCR Meth Applica 1 34 38 Sarkar G Yoon H and Sommer S S 1992 Dideoxy fingerprinting ddE a rapid and efficient screen for the presence of mutations Genomi
175. entist Kary Mullis developed an ingenious in vitro nucleic acid amplification technique termed the polymerase chain reaction PCR This technique involves the use of a pair of short usually 20 bp long pieces of synthesized DNA called primers and a thermostable DNA polymerase to achieve near exponential enzymatic amplification of target DNA Because of the sensitivity of this technique DNA of relatively poor condition may be amplified as only short intact sequences are required Therefore it is not always necessary to carry out lengthy template sample preparation For example a simple boiling step is often enough to release DNA from blood samples 1 The starting material for PCR may be DNA from a variety of sources such as blood tissues paraffin embedded material ancient archaeological samples or forensic material The PCR may also be used to amplify RNA which must first be converted into cDNA by the enzyme reverse transcriptase RT PCR In contrast to DNA great care must be taken in the preparation and handling of RNA because of its instability and susceptibility to degradation Polymerase chain reaction proceeds in three stages 1 Denaturation of double stranded DNA This initial denaturation step is not necessary when amplifying RNA because it is a smaller target molecule 2 Primer annealing 3 Extension of the annealed primers The target DNA is suspended in a reaction mixture consisting of distilled water buffer c
176. equence variability among isolates 16 Sequence variation in the internal transcribed spacer ITS regions of the rRNA genes of P carinii can be used for such genotypic identification 17 The region located between the 18S and 5 8S rRNA genes is called ITS1 and that between the 5 8S and 26S rRNA genes is ITS2 Among the two regions approx 60 different ITS sequences have been characterized by direct DNA sequencing 18 Sequence variation occurs throughout these 161 and 192 bp regions respectively and the majority of sequence changes within each ITS have been determined to be significant in establishing type 18 The suitability of the CFLP scanning method for differentiating sequences in the ITS region of five cloned P carinii sequences belonging to different types was investigated The ITS region was amplified by polymerase chain reaction PCR and the 5 ends of both strands were labeled by using tetrachlorofluorescein TET sense strand labeled primers see Note 1 The amplified products were purified and then partially digested with the Cleavase I enzyme The samples were analyzed in duplicate sets one of which was sub jected to CFLP digestion at a predetermined optimized reaction temperature whereas the other was digested under conditions in which the temperature was continually increased or ramped see Subheading 3 2 and Note 2 The results indicate that the CFLP method is highly effective in reproduc ibly distinguishing
177. equencing 2iZ PCR cycle 65 Sanger 65 183 stutter fragments 183 Sex typing 188 Short tandem repeats STR 179 Sigmacote 6 Silver staining 153 Single nucleotide polymorphism SNP 179 Single strand conformation polymorphism SSCP 109 151 Solid phase mini sequencing 57 Southern blotting 23 30 31 SpectroCHIP 185 189 Streptavidin 57 Stringency 76 77 82 SWISS PROT 200 T Taq polymerase 38 49 60 93 Temperature denaturing gradient gel electrophoresis TGGE 126 T4 polynucleotide kinase 17 T7 RNA polymerase 87 Index TEMED N N N M tetramethyl ethylenediamine 4 7 98 Tetramethylammonium chloride TMAC 43 Thermal cycler 38 148 Transcend detection system 104 Transilluminator 7 24 Trichloroacetic acid TCA 21 Tris acetate TAE 2 formulation of 9 Tris borate TBE 2 formulation of 9 TRIzol 102 U Ultraviolet radiation 2 Uracil N glycosylase 43 Vv Variable number tandem repeats VNTR 29 Von Willebrand disease 141 X primer 197 Xylene cyanol 4 9 METHODS IN MOLECULAR BIOLOGY 187 Series Editor John M Walker PCR Mutation Detection Protocols Edited by Bimal D M Theophilus Department of Haematology Birmingham Children s Hospital NHS Trust Birmingham UK Ralph Rapley Department of Biosciences University of Hertfordshire Hatfield UK Application of DNA technology to the identification of disease causing mutations has become widespr
178. equires 41 PCR to amplify the 26 exons of factor VIII gene and the putative promoter region The maximum length of the suitable PCR product is 600 700 bp and the product must have appropriate melting domain structure Some splicing signal region were not screened by this procedure 3 Single strand conformation polymorphism SSCP This method is based on the fact that single stranded DNAs differing in a single nucleotide will acquire dif ferent conformations that have different mobilities on a polyacrylamide gel Vari ous exons of factor VIII are amplified using polymerase chain reaction PCR and subjected to electrophoresis The exon showing an altered electrophoretic mobility is then sequenced 4 The PCR products must be between 100 300 bp for efficient screening From Methods in Molecular Biology vol 187 PCR Mutation Detection Protocols Edited by B D M Theophilus and R Rapley Humana Press Inc Totowa NJ 109 110 Waseem et al 3 Denaturing high performance liquid chromatography DHPLC This new tech nique for mutation detection has recently been used to scan factor VIII mutations 5 The exons from a normal DNA is hybridized to the corresponding exon from a hemophilia A patient and the resulting heteroduplexes are analyzed on a par tially denaturing HPLC column This method requires 33 amplifications and the detection rate is 70 5 In the above procedures the PCR products containing the mutation is identi
179. er bath 75 C 78 2 5 1 Dyer and Green Detection PNM buffer To 250 mL PN buffer see Subheading 2 4 add 12 5 g nonfat dried milk or other blocking agent e g bovine serum albumin and 0 05 g sodium azide see Note 3 mix well and incubate at 37 C for 60 min Cool and store at 4 C for up to 2 mo 2 Fluoroscein avidin Vector Laboratories Inc 2 mg mL 3 Biotinylated anti avidin D affinity purified Roche Diagnostics 0 5 mg mL 4 Mouse monoclonal anti digoxin Sigma Biosciences 100 g mL 5 Sheep anti mouse Ig digoxygenin F ab 2 fragment Roche Diagnostics 200 ug mL 6 Sheep anti digoxygenin rhodamine FAB fragments Roche Diagnostics 200 wg mL 7 PN buffer see Subheading 2 4 2 6 Counterstaining 1 Propidium iodide PI Vector Laboratories Inc in an antifade solution e g Vectashield Vector Laboratories Inc to give a final concentration of 1 ug mL see Note 4 2 6 Diamidine 2 phenylindole DAPI Vector Laboratories Inc in an antifade solution e g Vectashield Vector Laboratories Inc to give a final concentra tion of 0 5 ug mL 3 Methods 3 1 Growing Probes in the Laboratory Plasmid cosmid and P1 clone PAC DNA suitable for labeling as FISH probes can be isolated using a Qiagen Plasmid kit In the following methodol ogy the isolation of PACs will be described see Note 5 for plasmid and cosmid preparations see the Qiagen Plasmid purification handbook
180. esis A tris taurine buffer system was employed replacing a tris borate buffer as the tris taurine buffer is glycerol tolerant J Finally a 10 polyacrylamide gel of 1 mm thickness was used with bisacryloylpiperazine BAP replacing bis NV N methylene bisacrylamide as a crosslinker These conditions provide strength to CSGE gels and enhance the sieving action of the gel during electrophoresis 3 1 3 Sensitivity of Technique Originally Ganguly et al tested CSGE on a range of polymerase chain reac tion PCR products possessing known single nucleotide changes in amplified Conformation Sensitive Gel Electrophoresis 139 DNA fragments varying in size from 200 to 800 base pairs bp 1 Eighteen of twenty two single base changes were detected in four different collagen genes Of the four not detected three mismatches were located in an isolated high melting temperature domain The remaining undetected mismatch was located 51 bp from one end of the PCR fragment Subsequently this mismatch was detected when present 81 bp from the end of a new PCR fragment A similar observation was made with samples from patients having known factor IX gene FIX mutations where 31 35 mismatches were detected 1 The four undetected mismatches were located within 50 bp of the end of the PCR frag ment This led to PCR primers being designed further away from the sequence of interest with 50 100 bp of redundant sequence being incorporated into each end o
181. ew J Wallace 00 0 cccccccccccccecccccccccececeeeeecececaaaeaeaeaeaeseessesseeeseeeeeees 151 Cleavase Fragment Length Polymorphism Analysis for Genotyping and Mutation Detection Laura Heisler and Chao Hung Lee 00 00aa 165 Automated Genotyping Using the DNA MassArray Technology Christian Jurinke Dirk van den Boom Charles R Cantor and Hubert KOst er 0 00 00000 ccccccc ccc cccc cee eececceee cee eceeseseaueeeeeeeeaeaeees 179 An Introduction to Bioinformatics Henry Brzeski o ccccccccccccccceeeecee cece eee eneee cece eeeeaaeseceeeeeeaaeeseneeeetiaaeeeenes 193 Contributors RICHARD BAGNALL e Division of Medical and Molecular Genetics GKT School of Medicine Guy s Hospital London UK Henry Brzeski Windber Research Institute Windber PA CHARLES R CANTOR Seguenom Inc San Diego CA Peter A Davies Institute of Medical Genetics University of Wales College of Medicine Cardiff UK SARA A Dyer Regional Genetics Laboratory Birmingham Women s Hospital Birmingham UK Monamman S EnayarT Department of Haematology Birmingham Children s Hospital NHS Trust Birmingham UK FRANCESCO GIANNELLI Division of Medical and Molecular Genetics GKT School of Medicine Guy s Hospital London UK ANNE C GoopeveE Division of Genomic Medicine Royal Hallamshire Hospital Sheffield UK GeEorGE GRAY Department of Clinical Chemistry Birmingham Children s Hospital NHS Trust Birmingham UK ELA
182. exon 8 547 bp Lane 1 negative control heteroduplexed against self lane 2 heteroduplexed sample with an A to G substitution lane 3 heteroduplexed sample with an A to G substitution and a C to T substitution hence the different band ing pattern lane 4 heteroduplexed sample with an A to G substitution Figs 2 and 3 CSGE gel stained with ethidium bromide and visualized under UV light All samples have been mixed with a negative control or wild type sample of equal concentration and subjected to the heteroduplexing reaction 98 C for 5 min 65 C for 30 min Each lane contains a total of 5 uL heteroduplexed PCR product mixed with 2 uL dye and electrophoresed at 400 V for 17 h on a 10 polyacrylamide get 99 1 acrylamide BAP 0 5X TTE 15 formamide 10 ethylene glycol 148 Williams and Goodeve 4 Notes 1 Stock of 40 w v acrylamide 2 105 w v N N methylene bisacrylamide ratio 19 1 2 Both well preparation and sample loading are an essential part in obtaining reproducible results When loading the gel keep the sample volume to a mini mum and allow it to cover the bottom few millimeters of the well 3 Homemade PCR buffer 10X is 166 mM NH4 SO 670 mM Tris HCl pH 8 8 67 mM MgCl 2 Mercaptoethanol and 1 mg mL bovine serum albumin BSA The latter two ingredients are added immediately prior to use Commer cial PCR buffer 1X is 16 mM NH SO 67 mM Tris HCl pH 8 8 0 1 Tween 20 4 DNA thermocyclers hot blo
183. f exon 15 of the APC gene from genomic DNA and a single PTT it is theoretically possible to identify 50 of germline mutations in FAP patients and 75 of somatic mutations in sporadic CRC 7 PTT analysis of the com plete coding region of the APC gene can be accomplished by amplification of the whole gene in five or six overlapping segments 2 8 Exon 15 is amplified directly from genomic DNA in four overlapping segments 2 8 Exons 1 14 are amplified in one 2 or two overlapping segments by RT PCR amplifica tion of RNA 8 Using this approach translation terminating mutation were identified in 82 of FAP patients tested 2 A similar approach has been described for the identification of translation terminating mutations that occur in the BRCA and BRCA2 genes which cause the majority of cases of hereditary breast and ovarian cancer where a single gene is involved 9 11 BRCAI and BRCA2 are similar in structure both are large genes with many exons and in each case the majority of mutations result in the premature termination of translation The BRCA gene encodes a 7 5 kb transcript spread over 100 kb of DNA It has 22 coding exons and exon 11 alone contains 60 of the coding sequence 10 12 Approximately 86 of the mutations identified in BRCA are truncating mutations and approx 50 of these are located within exon 11 10 Similarly BRCA2 has 26 coding exons and encodes a 10 5 kb transcript exon 11 is exceptionally large and co
184. f the primers defines the length of the PCR product These three steps constitute a PCR cycle see Fig 1 Usually 30 cycles are performed in a programmable thermal cycler with each cycle theo retically doubling the quantity of target sequence This exponential increase is not achieved practically however because of the exhaustion of the PCR com ponents and the accumulation and reannealing of product strands Polymerase chain reaction is a very sensitive and specific molecular biology technique Its versatility is demonstrated by the growing array of technical PCR Principles Procedures and Parameters 39 modifications that lend PCR to multiple applications Such variations include RT PCR nested multiplex long range and allele specific PCR 1 RT PCR RNA may be amplified following its conversion to cDNA by the enzyme reverse transcriptase The use of RNA as a starting material ensures that only the coding regions or exons are amplified during the PCR reaction RT PCR not only provides a useful tool for analyzing the transcriptional activity of genes but also enables the investigation of many contiguous exons in a single analysis Nested PCR This involves the use of two sets of primers The first set external primers which flanks the region of interest allows for a first round of amplifi cation A small aliquot from the first round of PCR is then used as the target for a second round of amplification primed by a second pai
185. f the region amplified In the same study 100 detection of mutations was achieved in a further 11 samples having sequence alterations in the M13 phage and in the elastin gene giving a total of 60 68 mismatches detected The mutations not detected were either located in the terminal sequence of the PCR product or located in a high melting temperature domain In our laboratory CSGE was applied to screening the factor VIII FVIII gene of hemophilia A patients with similar success 4 Analysis of the FVIII gene of seven patients with hemophilia A revealed seven nucleotide alterations plus an intragenic deletion detected because of the failure of amplification of exons 23 25 The FIX gene has also been examined by CSGE in our laboratory CSGE detected nucleotide alterations in 21 of 21 individuals with hemophilia B 11 of which were previously unknown 5 Recent improvements by Korkko et al 6 yielded 100 detection of mutations by CSGE in 76 different PCR products ranging in size from 200 450 bp using altered electrophoresis conditions CSGE has also been adapted to use fluorescent dyes and automated detection on a DNA sequencer for an increased screening throughput 7 In summary CSGE will detect close to 100 of nucleotide sequence alterations 1 4 Applications of CSGE Conformation sensitive gel electrophoresis has been used for detection of sequence alterations in many different genes These include inherited defects in several collagen
186. ficiency 29 Fill in reaction 17 Flicker 205 Fluorescence 15 19 73 Fluorescent in situ hybridization FISH 73 multicolor 75 Fluoricon 61 Formaldehyde 153 160 Fragile X syndrome 39 G Gel electrophoresis agarose 1 97 low melting temperature 3 size separation 3 4 polyacrylamide 1 94 119 171 formulation of 10 119 denaturing 4 130 141 153 destaining of 10 Index N N methylene bis acrylamide 3 SDS PAGE 94 two dimensional 206 Gel drying 155 Geneclean 67 71 122 Genome sequencing 199 Giemsa banding 75 Glycogen 79 Gradient maker 129 H High performance liquid chromatography HPLC 61 Hemophilia A 29 109 110 Heteroduplex analysis 151 Heteroplasmic mutations 58 Heterozygosity 30 Hexanucleotides 14 Histopaque 111 Human genome project 179 199 Hybond 25 26 31 Hybridization 30 31 32 80 Hydrolink 160 Hyperfilm 32 I Ion exchange column 61 Immunoprecipitation 100 Industrial genomics 180 Internal transcribed spacer 169 K Kinase reaction 17 Klenow polymerase 14 19 L Labeling of DNA see DNA Linear amplification 65 Luciferase 99 Lymphocyte isolation of 111 M MALDI TOF 181 Index Mass array technology 179 Mass spectrometry 181 M13 139 Melting domains 126 Microcon 67 71 Maloney murine leukemia virus MMLYV 41 N Nanoliquid 189 National Center for Biotechnoloy Information NCBI 195 Nick translat
187. fied but the position of the mutation is not determined 4 Chemical cleavage of mismatch In order to develop a rapid and fully effective procedure for the detection of hemophilia A mutations the method of chemical cleavage of mismatch CCM is combined with analysis of the traces of factor VII mRNA present in peripheral blood lymphocytes The method of CCM has the advantage that it detects any sequence change even in long DNA segments 1 5 1 8 kb and indicates the position of mismatch within the segment Hence entire mRNA can be screened in few overlapping segments The mRNA analysis offers a chance of detecting mutations occurring in any region of the gene includ ing internal region of the long introns by virtue of their effect on the structure of the mRNA thus allowing a gain not only in the speed but also in the complete ness of mutation detection A further advantage of mRNA analysis is that it pro vides direct evidence of the effect gene mutation may have on the structure of the gene transcript In the basic procedure the factor VIII message and appropriate segments of a patient gene are specifically amplified and compared with similar products amplified from control RNA The patient and control PCR products are then hybridized to form a hetroduplex and treated with hydroxylamine and or osmium tetroxide which modify C or T residues respectively The DNA is then cleaved with piperidine at the modified base and analyzed on a denaturing poly
188. for 30 min to aid DNA precipitation Spin at 13 000 rpm for 30 min to pellet the DNA Discard aqueous phase and air dry DNA pellet at room temperature for 15 min or until supernatant is no longer visible Resuspend dried pellet in 20 uL HB1 for centromeric probes or HB2 for single copy probes and whole chromosome libraries to give a final concentra tion of 50 ng uL 80 Dyer and Green 11 Incubate at 37 C for 30 min to aid resuspension of DNA Store probe at 20 C while not in use 3 3 Hybridization The methodology for hybridization depends on the nature of the probe Three hybridization protocols are described for use with laboratory grown repetitive sequence single copy and whole chromosome library probes The protocols are designed for use on fixed cell preparations Target slides should be checked prior to hybridization under a phase con trast microscope The cells should not be overlapping and there should be mini mal visible cytoplasm Chromosomes if present should be of an appropriate length and adequately spread They should appear a dark gray color light gray chromosomes or those with a glassy appearance are likely to result in poor hybridization Optimum results are achieved on unbaked slides that are less than 1 mo old 3 3 1 Hybridization Protocol 1 For Use with Repetitive Sequence Probes Repetitive sequence probes can be applied with equal success to metaphase or interphase preparations By usi
189. for 5 min see Note 4 Remove 10 uL of sample for analysis on a 1 2 agarose gel containing ethidium bromide carcinogen See Chapter 1 Troubleshooting Inadequate design of the primers may result in the formation of a hairpin loop This is where internal complementarity of the primer sequence enables it to bind to itself rather than the DNA template so that the PCR cannot proceed PCR Principles Procedures and Parameters 43 2 10 11 12 Complementarity between a primer pair allows them to bind to each other thus forming primer dimers As with internal complementarity the primers are no longer free to bind to the DNA template resulting in failure of the PCR Primer dimers can also be produced as a byproduct of a successful PCR if the primers are present in excess 8 Heparin porphyrins and high concentrations of ionic detergent e g Proteinase K phenol and sodium dodecyl sulfate inhibit PCR As RNase enzymes can degrade target RNA RT PCR requires the use of Rnase free reagents and equipment to prevent false negative results Polymerase chain reaction failure or poor yield may result from a low target copy number e g where the RNA is from cell types expressing low levels of target material This may be remedied by using a second set of primers as in nested PCR see Note 6 It has been noted that mineral oil breaks down under 254 nm UV light with breakdown products inhibiting P
190. fter gel loading can lead to a third set of bands intermediate in mobility to the 160 Wallace ssDNA and dsDNA Although they usually show a similar pattern to the stan dard SSCPs they can occasionally highlight differences that are not detected elsewhere 8 Heteroduplexes usually show as bands of reduced mobility relative to the homoduplex dsDNA They are often more weakly staining than the homoduplex DNA see Note 8 9 Occasionally the homoduplex DNA itself displays mobility shifts This may be the result of the presence of an insertion deletion mutation leading to an alter ation in molecular weight Some single base substitutions can also give the same effect This is thought to be caused by the base substitution causing the DNA to bend to a greater or lesser degree thus affecting mobility 10 Frequently homozygous normal samples will give rise to two homoduplex bands the reason for this is not known 4 Notes 1 Fluorescent SSCP heteroduplex analysis is possible Both the Perkin Elmer 377 fluorescent analyzer and the 310 capillary electrophoresis instrument have tem perature control and are thus suitable for this technique There are several advan tages to this approach Fluorescent analysis permits multiplexing by dye color thus increasing productivity The gel images are also analyzed and stored electroni cally thus avoiding the need to dry down and store gels The internal size stan dards commonly used in fluorescent ana
191. ge products on Qo an ABI Genescan Gel 9 Key 9 Biotinylated primer Streptavidin beads Fluorescent labelled PCR product Fig 2 Diagrammatic representation of steps involved in the solid phase fluores cent chemical cleavage of mismatch method 2 4 RT PCR and PCR 1 Primers The primers used for amplification are listed in Table 1 The four RT PCR fragments are labeled 1 2 5 and 6 The outer primers are called A and B whereas the nested ones are given C and D as suffix Segment 3 4 P and T are amplified from DNA and therefore require only one pair of primers each The nested and the segment 3 and 4 primers are also synthesized with biotin at their 5 end and are marked with an asterisk in the table A working solution of primers at 100 ng uL is kept at 4 C and primer stocks are kept at 20 C 2 Access RT PCR System cat no A1250 is supplied by Promega USA The kit is stored at 20 C Mutation Detection in Factor VIII 113 Table 1 Primers Used for the Amplication of Factor VIII cDNA 1A GGGAGCTAAAGATATTTTAGAGAAG 1B CAACAGTGTGTCTCCAACTTCCCCAT ic GAGAAGATTAACCTTTTGCTTCTC 1D CCTACCAATCCGCTGAGGGCCATTG 2A GAAGAAGCGGAAGACTATGATGATG 2B GCCTAGTGCTACGGTGTCTTGAATTC 2C CTGATTCTGAAATGGATGTGGTCAGG 2D GGGAGAAGCTTCTTGGTTCAATGGC 3A AGAGTTCTGTGTCACTATTAAGACCC 3B TCTGAGGCAAAACTACATTCTCTTGG 4A CAAAGGACGTAGGACTCAAAGAGATGG 4B CACCAGAGTAAGAGTTTCAAGACAC SA CTTCAG TCAGATCAAGAGGAAATTGAC 5B GAAGTCTG
192. gel Slowly peel off the paper with the attached gel Cover the gel with cling film and dry in a slab gel dryer at 80 C for 30 120 min until the gel is dry Remove the cling film and autoradiograph the gel against a high speed X ray film in an appropriate cassette Exposure of the film at room temperature varies from about 1 d to 6 d depending on the amount of starting DNA template used and the age of the radioactivity 3 2 Automated Cycle Sequencing 3 2 1 Purification of PCR Products Before Cycle Sequencing There are various methods used for this procedure The Microcon 100 spin columns are recommended by ABI to give good sequencing results as they Adjust the amount of water to make up to a total volume of 20 uL 70 Surdhar remove salt which can interfere with the sequencing reaction There are alter native methods available see Note 1 3 2 2 Cycle Sequencing 1 For each reaction mix the following reagents in a labeled tube This is a half reaction one eighth and one quarter reactions can also be carried out but this requires a propietary buffer from ABI that maintains a reasonable reaction volume Terminator ready reaction mix 4uL PCR product 30 90 ng xuL Primer 0 02 ug uL see Note 3 l uL dH O yuL I0uL Set up and keep the reaction on ice until ready to transfer to the thermal cycler 2 Perform the sequencing reactions in a thermal cycler using the following con ditions 96 C for 10 s 25 cycles of 96 C
193. gel plates short plate uppermost on a box or upturned Eppendorf rack on a flat section of benching 5 For an 8 gel for the SA32 system place the following reagents in a clean dry beaker 15 mL 40 49 1 acrylamide solution 7 5 mL of 10X TBE solution 52 mL dH O 90 uL TEMED For the S2 system all these volumes should be doubled see Notes 2 4 and 6 6 Add 500 uL for SA32 gel or 1 mL for S2 gel of freshly prepared 10 AMPS solution to the acrylamide solution and mix thoroughly by gently swirling 7 Carefully draw the acrylamide solution into a 50 mL disposable syringe avoid ing introducing air bubbles 8 Rest the nozzle of the syringe on the protruding portion of the long glass plate about 2 mm from the edge of the short plate and slowly expel the contents of the syringe The acrylamide solution should run down between the plates quite evenly by capillary action Fig 1A The syringe will need to be refilled three to four times for the S2 system Gently tapping the glass plates just ahead of the acrylamide solution can help to prevent the formation of trapped air bubbles 9 Once the acrylamide has completely filled the space between the plates any air bubbles can be removed using a hook shaped bubble catcher The comb should then be carefully inserted while avoiding the introduction of further air bubbles The gel should be left to polymerize at room temperature for at least h prefer ably 2 h 10 Remove the c
194. gel with UV light see Note 10 Pour the agarose into the gel mold ensuring that no air bubbles form between the teeth of the comb and allow the gel to set at room temperature for 30 40 min 3 1 2 Running the Gel 1 Carefully remove the comb and place the gel and tray into the gel tank oriented with the wells at the cathode end and add sufficient 1X electrophoresis buffer to cover the gel to a depth of approx 1 mm see Note 11 Mix the DNA samples with gel loading buffer to produce a 1X concentration of buffer and load into the wells through the thin layer of running buffer Placing a black piece of paper behind the wells may facilitate in the loading process by making the wells more visible see Note 12 Load a DNA size standard to allow the determination of the sizes of the DNA fragments because although the tracking dyes in the loading buffer give a rough estimate of the migration of the DNA they do not give the exact size Size stan dards can be purchased commercially or prepared by restriction enzyme diges tion of plasmid DNA producing DNA fragments of known sizes Place the lid onto the gel tank being careful not to disturb the samples and begin electrophoresis see Note 13 When the dyes have migrated the appropriate distance on the gel as shown in Table 2 turn off the power supply and proceed with visualization of the DNA Agarose and Polyacrylamide Gel Electrophoresis 7 3 1 3 Staining and Visualization of t
195. genes 1 6 8 10 and genes involved in hae mostasis 4 5 11 12 plus acquired mutations in c kit 13 and BRCA and BRCA2 7 14 1 5 Variations on CSGE Many variations on CSGE conditions have been presented by different labo ratories As a standard we use the PCR sample alone in the heteroduplex reac tion covered by mineral oil to prevent evaporation of the sample and a 10 acrylamide 99 1 acrylamide BAP gel containing 10 ethylene glycol and 140 Williams and Goodeve 15 formamide This CSGE gel is prerun for 1 h at 750 V and then samples are electrophoresed at 400 V for 16 17 h Early work involved the addition of ethylene glycol formamide xylene cyanol and bromophenol blue to samples to be heteroduplexed J 3 9 10 Most laboratories heteroduplex samples with out additives Markoff et al 14 used urea as a denaturant in the gel at 15 in place of formamide 15 Electrophoresis conditions have ranged from 40 W for 6 h 6 to a 400 V overnight run 4 Gel documentation has been reported by both ethidium bromide staining and by silver staining 14 A more recent development has also adapted the CSGE mutation scanning assay for use with fluorescent detection F CSGE 7 1 6 PCR Amplification 1 6 1 Primer Design Primers for use in PCR amplification of a gene for mutation detection should encompass the entire coding region including intron exon boundaries the pro moter region and the polyadenylation signal Most p
196. ger restricted to the analysis of small compounds some hundred Daltons but also applicable to the analysis of large biomolecules some hundred thousand Daltons This improvement is mainly based on the invention of soft ionization techniques A prominent example is matrix assisted laser desorption ionization MALDI time of flight TOF MS developed in the late 1980s by Karas and Hillenkamp 15 182 Jurinke et al DNA Products are Separated by thelr Molecula Masses SpectrocHiP JERV 3 27 KV Ty til a Acceleration Region Drift Region Detector Fig 1 Schematic drawing of the MALDI TOF MS process as used in the DNA MassArray method The general principle of MS is to produce separate and detect gas phase ions Traditionally thermal vaporization methods are used to transfer mol ecules into the gas phase Most biomolecules however undergo decomposi tion under these conditions Briefly in MALDI MS the sample is embedded in the crystalline structures of small organic compounds called matrix and the cocrystals are irradiated with a nanosecond ultraviolet laser beam Laser energy causes structural decomposition of the irradiated crystal and generates a particle cloud from which ions are extracted by an electric field After accel eration the ions drift through a field free path usually 1 m long and finally reach the detector e g a secondary electron multiplier see Fig 1 lon masses mass to charge ratios m z are t
197. guly A Rock M J and Prockop D J 1993 Conformation sensitive gel electrophoresis for rapid detection of single base differences in double stranded PCR products and DNA fragments evidence for solvent induced bends in DNA heteroduplexes Proc Natl Acad Sci USA 90 10 325 10 329 Keen J Lester D Inglehearn C Curtis A and Bhattacharya S 1991 Rapid detection of single base mismatches as heteroduplexes on Hydrolink gels Trends Genet 7 5 Ravnik Glavac M Glavac D and Dean M 1994 Sensitivity of single strand conformation polymorphism and heteroduplex method for mutation detection in the cystic fibrosis gene Hum Mol Genet 3 801 807 SSCP Heteroduplex Analysis 163 10 Lee H H Lo W J and Choo K B 1992 Mutational analysis by a combined Pi application of the multiple restriction fragment single strand conformation poly morphism and the direct linear amplification sequencing protocols Anal Biochem 205 289 293 Inazuka M Wenz H M Sakabe M Tahira T and Hayashi K 1997 A streamlined mutation detection sysytem multicolor post PCR fluorescence label ing and single strand conformational polymorphism analysis by capillary electro phoresis Genome Res 7 1094 1103 17 Cleavase Fragment Length Polymorphism Analysis for Genotyping and Mutation Detection Laura Heisler and Chao Hung Lee 1 Introduction DNA sequencing is the gold standard in DNA diag
198. hapter is loosely based on a course given by the author at the University of Hertfordshire from a set of Web pages that facilitate Internet navigation by using hyperlinks and allow sequences to be copied from the Web page and pasted into the rel evant search engine The online version of this information can be found at http www herts ac uk natsci Bio informatics htm Many simple queries about protein and DNA sequences can now be answered using a Web browser The purpose of this chapter is to give you a flavor of the sorts of things which are now possible but first it is necessary to explain some of the jargon If you know all about the World Wide Web WWW or the Web URLs and hyperlinks then you can bypass the introductory information 1 Introduction 1 1 The World Wide Web The World Wide Web and the Internet were not invented by Bill Gates It was originally put together in the 1960s by primarily the US Department of Defense DOD to ensure continuity of communication during a war The DOD relied on the fact that every computer connected to its lines could communicate with any other computer However to make the system impregnable to attack there was not a straightforward connection between each computer Instead multiple computers were connected to each other As a result of this form of connection there was always more than one way to connect between A and J It may have been A B C G J it may have been A C H I J or it may h
199. having a very unpleasant smell Therefore only open the stock of B Mercaptoethanol in a fume cupboard and always wear dis posable latex gloves If possible only handle the SDS PAGE sample loading buffer in a fume cupboard or use only in a well ventilated laboratory 1 5 M Tris buffer pH 8 8 autoclave and store at room temperature 30 Acrylamide solution 29 1 ratio of acrylamide to bis acrylamide store at 4 C Both acrylamide and bis acrylamide are neurotoxins that are readily absorbed through the skin and by inhalation of the dust A mask safety spectacles and gloves must be worn when weighing them Therefore it is more convenient to purchase preprepared 30 acrylamide solution which is available from a number of suppli ers of chemicals and molecular biology reagents The solution is still extremely harmful and great care should be taken when using it Always wear protective clothing disposable latex gloves and safety spectacles Protein Truncation Test 95 6 10 w v Ammonium persulfate solution in dH O Store at 4 C and discard after 1 wk 7 N N N N tetramethylethylenediamine TEMED Store at 4 C 8 Polyacrylamide gel apparatus e g the Mini Protean II electrophoresis cell see Note 9 Bio Rad Laboratories Ltd 9 1X Tris glycine gel running buffer 25 mM Tris 250 mM glycine 0 1 SDS Prepare a 5X stock solution by dissolving 15 1 g Tris base and 94 g glycine dis solved in 900 mL of dH O add 50 mL 10 SD
200. he rapid isolation of DNA sequences utilizing the hybridization of two oligonucle otide primers and subsequent amplification of the intervening sequences by Taq polymerase This technique has facilitated the identification and typing of single nucleotide substitutions in the analysis of DNA sequence polymor phisms and the screening of large numbers of samples to either detect known mutations or search for unknown mutations at a defined locus 1 4 Since the introduction of PCR a variety of methods for sequencing PCR generated fragments have been described based on the Sanger chain terminat ing dideoxynucleotide sequencing method 5 Cycle sequencing 6 10 is a kind of PCR sequencing approach Like standard PCR it utilizes a thermo stable DNA polymerase and a temperature cycling format of denaturation annealing and DNA synthesis Cycle sequencing also called the linear ampli fication process in contrast with a traditional PCR reaction where the increase is exponential employs a single primer so that the amount of product DNA increases linearly with the number of cycles in contrast with a traditional PCR reaction where the increase is exponential Initially cycle sequencing utilized 37P labeled primers and a nonthermo stable polymerase which needed to be added after every denaturation cycle 6 Further progress was made with the introduction of thermostable Taq poly merase 7 8 and the replacement of labeled primers with internal lab
201. he 1X working solution in a clear bottle so that any precipitate is clearly visible an indication that the solution should not be used Both the 10X stock and the 1X working solution should be stored out of direct sunlight The 1X working solution may be reused to stain up to three gels Silver staining solution 3 1 5 NaOH 0 15 formaldehyde see Note 5 This solution is labile and the formaldehyde should only be added immediately prior to use The 1 5 NaOH may be made up in bulk and stored at room temperature Silver staining solution 4 0 75 Na CO Make as a 10X stock and dilute down as necessary store the 10X stock at room temperature Gel drying frame and platform e g Pharmacia Biotech part no 80 6122 37 and 80 6122 94 Cellophane sheets e g Pharmacia Biotech part no 80 6121 99 3 Methods 3 1 Preparation and Electrophoresis of SSCP Heteroduplex Gels R Wash a suitable comb pair of glass plates and spacers thoroughly with warm water and a household detergent Rinse with deionized water and dry with dis posable tissues 154 Wallace 2 Lay the glass plates on a clean section of the bench and wipe with a disposable tissue soaked in 100 ethanol 3 Smear the spacers with Pritt or an equivalent paper adhesive to prevent them from slipping while assembling and pouring the gel Assemble the glass plates and spacers as shown in Fig 1A B using four strong binder clips to to hold the plates together 4 Lay the
202. he Nucleic Acids The gel can be stained during electrophoresis by the addition of ethidium bromide as described in Subheading 3 1 1 or following electrophoresis by immersion in a solution of 0 5 ug mL ethidium bromide 1 If ethidium bromide has been incorporated in the gel the DNA can be visualized progressively during the run If post electrophoretic staining is necessary place the gel in an appropriate volume of 0 5 ug mL ethidium bromide for 30 min and then destain in water for 10 min see Note 14 2 Following staining place the gel on a UV transilluminator and photograph the gel using standard cameras and film such as a Polaroid camera with a red filter and 667 black and white film or a charged coupled devise CCD based digital analysis system see Note 15 3 2 Polyacrylamide Gel Electrophoresis There are many types of commercially available electrophoresis equipment with differing arrangements of glass plates and spacers In all cases the aim is to form an airtight seal between the plates and the spacers so that any unpolymerized gel solution does not leak Most vertical electrophoresis tanks are constructed to hold glass plates Spacers vary in thickness from 0 5 to 2 mm but the thicker the gel the hotter it will become during electrophoresis and overheating may occur 3 2 1 Assembly and Pouring of the Gel 1 Prepare the glass plates and spacers by washing with warm detergent and rinsing with water The plates should on
203. he use of PCR point mutations were identified by using direct cloning and sequencing Southern blotting and hybridization with labeled oligonucleotide probes centered on the site of the mutation or digestion with restriction endonucleases These methods have been greatly enhanced by PCR which allows amplification of DNA fragments containing the polymorphic sites from minute quantities of DNA However these techniques tend to be time consuming complex require the use of radioactive label and in the case of the restriction endonuclease detection are only applicable when the mutation alters a known cleavage site Polymerase chain reaction using allele specific oligonucleotides ASOs is an alternative method for the detection of mutations in which only the per fectly matched oligonucleotide is able to act as a primer for amplification The advantage of ASO PCR is that it is a rapid simple and nonradioactive method ASO PCR otherwise known as the amplification refractory mutation system ARMS was first described for the detection of mutations in the o antitrypsin gene 2 It has since been adopted in the study of a number of genes including prenatal diagnosis of cystic fibrosis 3 polymorphisms of apolipoprotein E 4 5 and point mutations in the ras oncogene 6 In this technique oligonucle otide primers are designed such that they are complementary to either the nor From Methods in Molecular Biology vol 187 PCR Mutation Detection
204. her buffering capacity Although the resolving power of the buffers is almost identical double stranded linear DNA migrates approx 10 faster in TAE than in TBE Electrophoresis buffers are routinely prepared as concentrated solutions and stored at room temperature see Note 2 The most convenient method for visualizing DNA in agarose and polyacry lamide gels is by staining with the fluorescent dye ethidium bromide 3 8 diamino 6 ethyl 5 phenyl phenanthridium bromide which contains a fixed planar group that intercalates between the stacked bases of the DNA 2 The fixed position and the close proximity to the bases causes the bound dye to display an increased fluorescent yield compared to that of the free dye in solu tion Ultraviolet UV radiation at a range of 260 360 nm is absorbed by the DNA and transmitted to the dye and the energy is re emitted at 590 nm in the red orange region of the visible spectrum Because the fluorescent yield of ethidium bromide DNA complexes is greater than that of unbound dye small amounts of DNA can be detected in the presence of free ethidium bromide in the gel Ethidium bromide promotes damage of the nucleic acids when viewed under UV light photonicking therefore if the nucleic acid is to be used in reactions following visualization the gel should be viewed using long wave length UV light 300 nm 1 1 Agarose Gel Electrophoresis Agarose is a linear polymer extracted from seaweed that forms a gel
205. hidium bromide stain ing 4 The SSCP technique relies on the propensity for single stranded DNA ssDNA in nondenaturing conditions to take on a three dimensional or sec ondary structure that is highly sequence dependent Consequently sequence differences can cause alterations to the DNA s secondary structure Because the electrophoretic mobility of DNA under nondenaturing conditions is depen dent on its shape as well as other factors like charge point mutations can give rise to mobility shifts The gels used for SSCP are usually native acrylamide typically with a low level of crosslinking 49 1 although there is a great deal of variability between published protocols The low level of crosslinking gives a large pore size thus permitting efficient separation of the bulky structures that ssDNA forms under these conditions The detection efficiency of SSCP is highly variable the most important parameter to consider is fragment size The optimum sensitivity is with fragments as small as 150 bp where under a single condition 90 of mutations are detected 5 Heteroduplexes are hybrid DNA molecules that although largely matched have one or more mismatched base pairs Heteroduplexes have been used as a From Methods in Molecular Biology vol 187 PCR Mutation Detection Protocols Edited by B D M Theophilus and R Rapley Humana Press Inc Totowa NJ 151 152 Wallace tool to scan for point mutations since 1992 6 They typica
206. http www expasy ch prosite and OWL http www biochem ucl ac uk bsm dbbrowser OWL OWL html 3 2 The Sequence Retrieval System SRS SRSWWW is a World Wide Web interface to the Sequence Retrieval System SRS It can be accessed at a number of different Web sites SRSWWW is widely used because of the simplicity of Web browsers as an interface Detailed instructions on how to use SRS can be found in the SRS online manual http www expasy ch srs5 man srsman html Here I will introduce the basics of the program In essence SRS will allow the construction of a query that will look for the requested information in a number of databases This is not as straightforward as it may seem because different databases orga nize the data into different fields so it is necessary to construct the query with care SRS ensures that this query construction is as simple as possible There are a number of SRS Web sites at which users can search various data bases Compare the SRS page at Heidelberg http www embl heidelberg de srs5 set up to find nucleic acid and protein database entries with the version of SRS at SWISS PROT http www expasy ch srs5 Go to the SWISS PROT SRS page http www expasy ch srs5 Press the Start button to Start a new SRS session Click on the TREMBL check box to deselect it A detailed explanation of the databases are available by clicking on the hyperlinked database name Press the Continue button 6 Type ox
207. iagram of factor VIII cDNA showing the positions segment 1 8 Open bars represent primary PCR whereas filled bars are nested PCR Segment 3 4 promoter region P and polyadenylation signal region T are amplified from DNA cDNA using biotinylated primers and fluorescent dUTPs The patient and the control products are then hybridized to form heteroduplexes in two multiplex reactions The heteroduplexes are then captured on streptavidin coated mag netic beads and treated with hydroxylamine and osmium tetroxide followed by treatment with piperidine Fig 2 The products are analyzed on an ABI PRISM 377 DNA sequencer 2 Materials 2 1 Lymphocyte Isolation 1 Histopaque 1077 is supplied by Sigma cat no 1077 1 2 Phosphate Buffered Saline PBS 10 mM potassium phosphate buffer 138 mM NaCl 2 7 mM KCl pH 7 4 2 2 RNA Isolation 1 Various RNA isolation kits are available commercially We used RNA Isolator from Genosys cat no RNA ISO 050 2 Isopropanol 3 Chloroform 2 3 DNA Isolation 1 Puregene DNA isolation kit D 5500A is purchased from Gentra Systems USA 2 Isopropanol 112 Waseem et al TARGET PROBE PCR products A _ G _ cine cee c Probe target A os G heteroduplex c r Hydroxylamine Osmium modification v modification Hybrid capture oA G on streptavidin 7 A __ rT a S beads Piperidine cleavage Ss Analyse cleava
208. ide add 3 g of mixed bed resin to 100 mL formamide and mix for 30 min in a fume hood Filter through Whatman paper again in a fume hood and store in a dark bottle at 4 C Appropriate volumes of 0 and 80 denaturant polyacrylamide solutions are mixed to make low and high gradient solutions For example 30 low and 60 high solutions are made to pour a denaturing gradient gel with a range of 30 60 The following volumes of 0 and 80 denaturant polyacrylamide solutions are mixed to give 27 5 mL volumes of 30 and 60 solutions 30 Low solution 60 High solution volume 0 solution 17 2 mL 6 9 mL volume 80 solution 10 3 mL 20 6 mL The temperature of the running buffer is very important and it must not be allowed to deviate from 60 C as this is a factor in the derivation of the denatur ing gradient If the temperature is too high DNA fragments may not migrate far enough into the gel and if it is too low migration may be too far PCR conditions are specific to the fragment under analysis and therefore have not been discussed in this chapter other than the necessity to incorporate a GC clamp into the product Reactions however should be free from nonspecific amplification products to avoid confusion caused by extra bands It is important to avoid overloading the gel as this leads to fuzzy bands or smeared lanes making interpretation difficult Fuzzy bands and smeared lanes may als
209. ide of the page 7 These matches or hits will consist of database entries containing partial and com plete genomic or cDNA sequences from Homo sapiens and many other species 8 Press the Back button on the browser 9 Change the query to p53 amp human the amp tells the server to find all records which contain both the word p53 and the word human an example of Bool ean logic and press the Search button You can find out more about Boolean expressions by clicking on Detailed help on the Entrez page scroll to the top of the page find the section labeled For Experts Only and click on Entering Com plex Boolean Expressions 10 This query finds fewer records You can adjust your query using various required words and Boolean operators By adding extra keywords e g complete mRNA etc you can fine tune your search and hit fewer documents 11 Once the list is manageable press the Retrieve N records to receive the first summary page of hits 12 Each hit contains a checkbox an accession number the ID of the record a brief summary of the entry taken from the file and various related links 13 Check the boxes of the relevant hits and then press the Display button to retrieve the actual record s 14 Each record contains a number of fields that describe the sequence e g the organism whether the sequence is genomic or derived from mRNA or relevant 196 Brzeski published information
210. ies In the area of the medical and life sciences at least we can speculate with perhaps more certainty than may be possible in other areas The exciting stage at which we find ourselves in the field of molecular genetics means that we can be in no doubt that the application of DNA technology will underlie many major advances in medicine in the coming decades While international research efforts seek to demonstrate the viability of gene therapy a major present application of human molecular genetics is the identification of disease causing mutations This information may be used for prenatal and carrier diagnoses or to aid early detection and determine appropri ate treatment of various disease states While traditionally progress has been in diseases caused by mutations in single genes present research is unraveling the underlying molecular basis of multigene disorders such as cancers as well as identifying increasing numbers of disease associated single nucleotide poly morphisms SNPs In addition the completion of the human genome project will no doubt advance the pace of discovery even further and also provide new possibilities for diagnosis and treatment The rapidly increasing applications of DNA technology to disease diagnosis has spawned numerous molecular diagnostic laboratories with an interest in mutation detection methodology Such laboratories would like the availability of a single mutation method that is cheap fast with 100 de
211. ifferences are detected by gel electrophoresis Hemophilia A or Factor VIII deficiency is the most common inherited bleed ing disorder in humans This X chromosome linked disorder affects approx 1 in every 10 000 males and within the families of these patients the females are at risk of being carriers of this disorder Factor VIII is a component of the intrinsic coagulation pathway and the FVIII gene is a large gene encompasses 186 kb at Xq28 It has 26 exons encoding a mRNA of 9 kb 1 Both RFLP and VNTR analysis have been extensively used in carrier detection and antenatal diagnosis in families with classical or familial hemophilia A So far 10 useful polymorphisms have been identified within intragenic or flanking extragenic From Methods in Molecular Biology vol 187 PCR Mutation Detection Protocols Edited by B D M Theophilus and R Rapley Humana Press Inc Totowa NJ 29 30 Enayat Table 1 DNA Polymorphisms Within or Flanking the Factor VIII Gene 2 Restriction Derection Heterozygosity enzyme Site PCR Probe in Caucasian Bell Intron 18 0 43 Xbal Intron 22 0 49 Hindi Intron 19 0 38 Mspl Intron 22 0 01 Taq 5 0 40 Bell 3 0 25 MspI 3 0 43 CA repeat Intron 13 10 alleles approx 0 80 CA repeat Intron 22 6 alleles approx 0 55 G A Intron 7 0 33 the FVII gene Table 1 Seven of these polymorphisms are diallelic RFLP and one within the intron 7
212. igh throughput high accuracy genomic analysis methods Validated target genes can also be used for a more rational drug devel opment in combination with genetic profiling of study populations during clini cal trials 1 2 2 Pharmacogenetics Traits within populations such as the ABO blood groups are phenotypic expressions of genetic polymorphism This is also the case for variations in response to drug therapy When taken by poor metabolizers some drugs cause exaggerated pharmacological response and adverse drug reactions For example Genotyping Using DNA MassArray Technology 181 tricyclic antidepressants exhibit order of magnitude differences in blood con centrations depending on the enzyme status of patients 11 Pharmacogenetics is the study of genetic polymorphism in drug metabolism Today pharmaceu tical companies screen individuals for specific genetic polymorphisms before entry into clinical trials to ensure that the study population is both relevant and representative Targets for such screenings are cytochrome P450 enzymes or N acetyltransferase isoenzymes NAT1 and NAT2 Potential drug candidates affected by polymorphic metabolism include antidepressants antipsychotics and cardiovascular drugs 1 2 3 Current Technologies In addition to candidate gene validation and pharmacogenetics many other applications such as clinical diagnostics forensics as well as the human sequence diversity program 12 are dealing with
213. ight Inactivate the DEPC by autoclav ing for 30 min at 120 C Store at 4 C DEPC should be handled with care as it is a powerful acylating agent always handle in a fume hood and never add to Tris buffers or solutions containing ammonia 4 5X Reverse transcription buffer Invitrogen Life Technologies Ltd Store at 20 C 5 0 1 M Dithiothreitol DTT Invitrogen Life Technologies Ltd Store at 20 C 6 10 mM dNTP mix in sterile DEPC treated HO prepared from 100 mM stocks of dATP dCTP dGTP and dTTP Amersham Pharmacia Biotech Ltd Store at 20 C 7 RNasin ribonuclease inhibitor Promega Ltd Store at 20 C 8 M MLYV reverse transcriptase 200 U uL Invitrogen Life Technologies Ltd Store at 20 C 2 1 2 Nested RT PCR 1 10X Tag Extender reaction buffer see Note 3 200 mM Tris HCl pH 8 8 100 mM KCl 100 mM NH4 2SOq4 20 mM MgSOu 1 Triton X 100 1 mg mL nuclease free bovine serum albumin Stratagene Ltd Cambridge UK Store at 20 C 2 2 mM dNTP mix in sterile HO prepared from 100 mM stocks of dATP dCTP dGTP and dTTP Amersham Pharmacia Biotech Ltd Store at 20 C Protein Truncation Test 93 3 Nested PCR primers pairs The forward primer of the inner pair must have the 5 extension which includes the T7 promoter sequence the eukaryotic protein translation initiation sequence followed by the in frame ATG start codon and the gene specific primer sequence see Table 1 and N
214. illiams 1Kg Weight eS Paper Towels C 3MM Paper Rs Hybridisation Membrane Paper Wick Reservoir Plastic Stand Transfer Buffer Fig 1 A typical setup for capillary action Southern blot 2 Materials SOMNAKAWNE Suitable apparatus for blotting two buffer tanks paper Towels Whatmann paper see Fig 1 Nylon hybridization membrane e g Hybond N Depurination buffer 0 25 M HCI Denaturation buffer 1 5 M NaCl 0 5 M NaOH Transfer buffer 1 5 M NaCl 0 25 M NaOH 20X SSC 3 M NaCl 0 3 M trisodium citrate pH 7 0 Ultraviolet UV light transilluminator 302 nm output Fixing solution 0 4 M NaOH Rinsing solution 5X SSC 3 Methods 1 2 3 Isolate DNA with an appropriate extraction technique Digest total genomic DNA with desired restriction enzyme Separate the digested DNA fragments by agarose gel electrophoresis see Chapter 1 see Notes 1 and 2 Following electrophoresis visualize the gel on a UV transilluminator and photo graph see Note 3 Trim the gel with a clean scalpel blade to remove any unused areas e g gel wells and sides see Note 4 Southern Blotting by Capillary Transfer 25 6 10 11 12 13 14 15 16 17 18 19 Soak the gel in three gel volumes of depurination buffer for 30 min at room temperature with gentle agitation on an orbital shaker see Notes 5 and 6 Decant depurination buffer and rinse the gel in dis
215. in Molecular Biology vol 187 PCR Mutation Detection Protocols Edited by B D M Theophilus and R Rapley Humana Press Inc Totowa NJ 13 14 4 3 Rapley and Theophilus Unlabeled dNTP 2 mM each of dATP dGTP and dTTP Radiolabeled dCTP 10 mCi mL a P dCTP specific activity approx 3000 Ci mmol see Note 2 This is stored at 20 C and should be removed from the freezer approx 20 min before setting up the reaction Stop solution 0 5 M EDTA pH 8 0 Sephadex separation spin column see Note 3 Random Hexamer Labeling of DNA DNA probe to be labeled in TE buffer 10 mM Tris HCl 1 mM EDTA pH 8 0 Hexamer mix 0 043 M each of dCTP dTTP and dGTP 0 43 M HEPES pH 7 0 12 U mL random hexanucleotides Amersham Pharmacia Biotech UK a P dATP specific activity 6000 Ci mM Amersham Pharmacia Biotech This is stored at 20 C and should be removed from the freezer approx 20 min before setting up the reaction Stop solution 0 5 M EDTA pH 8 0 DNA polymerase e g Klenow fragment 6 U uL 3 Methods 3 1 1 2 NAM 3 2 Nick Translation of DNA Dilute DNA to be labeled to 20 200 ng mL with sterile distilled H O and add 1 mg to a sterile microcentrifuge tube Add the following to the tube a 10 uL 10X nick translation buffer b 10 uL 20 nM unlabeled dNTPs c 10 uL 30 pmol labeled a P dCTP Add 1 ng mL DNase 10 mL and 2 5 U DNA polymerase I 5 mL Gently mix b
216. in prior to washing Check temperature inside the chamber before commencing washing 11 For use with single copy probes or whole chromosome libraries Hybridization buffer 2 HB2 containing 71 formamide Dissolve 1 g dextran sulfate in 5 mL deionized formamide see Note 2 by heating to 70 C Add 1 mL of 20X SSC and adjust pH to 7 0 Make up final volume to 7 mL with H 0 Store at 20 C 12 Water bath 15 C 13 Microcentrifuge 2 3 Hybridization Labeled probe s Methanol 100 95 75 For use with repetitive sequence probes HB1 see Subheading 2 2 For use with single copy probes and whole chromosome libraries HB2 see Sub heading 2 2 5 Denaturation solution 70 deionized formamide 2X SSC To 35 mL deionized formamide see Note 2 add 5 mL of 20X SSC see Subheading 2 2 and 10 mL dH 0 adjust pH to 7 0 Note Denaturation solution is not required when using repetitive sequence probes Diamond pen to mark target slides Sealable plastic hybridization chamber lined with moist tissue Hot plate 50 C Water bath 75 C Incubator 37 C 42 C AUNE OSCO N a Stringency Washing p SSC see Table 2 for concentration 2 PN buffer Titrate 4 L of 0 1 M sodium phosphate dibasic Na HPO solution with 0 1 M sodium phosphate monobasic NaH PO solution to give a pH of 8 0 Add 4 5 mL nonidet P 40 detergent Mix well and store at room temperature for up to 2 wk 3 Wat
217. incubate for 15 min at room temperature 2 Centrifuge at 16 000g for 15 min at room temperature 116 Waseem et al 3 Transfer the upper aqueous phase to a fresh 1 5 mL microfuge tube and add 250 uL isopropanol Mix and incubate for 10 min at room temperature 4 Centrifuge at 16 000g for 10 min at room temperature At this stage RNA should be visible as translucent pellet 5 Wash pellet with 70 ethanol 6 Air dry the RNA pellet and dissolve it in RNA Hydration Solution see Note 2 3 3 RT PCR For reverse transcription and amplification of four out of the eight segment from factor VIII mRNA we use Access RT PCR System In this kit the reverse transcription by AMV reverse transcriptase and initial 10 cycles of amplification by Tfl DNA polymerase is performed in a single tube primary PCR see Note 3 An aliquot is then amplified for another 30 cycles with nested primers secondary PCR Two of the four segments segment 1 5 and 2 6 are multiplexed in the primary PCR so in total we have two primary and four secondary PCRs 1 Add 5 uL 5X reaction buffer 0 5uL 10 mM dNTP 3 0 uL 25 mM MgSOu 2 5 uL of 100 ng uL primer 1A 1B 5A 5B 0 5 uL AMV reverse transcriptase 0 5 uL Tfl DNA polymerase 100 200 ng RNA Make up the volume with RNAse free water to 25 uL Set up a second RT PCR substituting primer 1A 1B 5A and 5B for 2A 2B 6A and 6B 2 Place the tubes in controlled temperature block equilibrated at 48 C and incubat
218. into consideration when designing PCR primers Practically the choice of labeled amino acid is limited by the configuration of the in vitro transcription translation kits and the avail ability of labeled amino acids Most published PTT methods use S methionine S cysteine and H leucine are the two other alternatives Nonradioactive methods have been described that involve the incorporation of biotinylated lysine with the additional steps of electroblotting of the SDS PAGE gel and detection of the proteins by chemiluminescence 4 Commer cially available kits for nonradioactive PTT are the Transcend nonradioactive translation detection system Promega Ltd and the protein truncation test nonradioactive kit Boehringer Mannheim An alternative nonradioactive method for detecting the products of the in vitro transcription translation reac tion involves the incorporation of a myc reporter tag into the translated protein 3 This is accomplished by the inclusion of 36 basepairs of the human c myc sequence in the forward primer sequence The in frame c myc sequence is posi tioned directly between the ATG start site and the in frame gene specific primer sequence The presence of the myc epitope in the translated protein allows non radioactive detection of the translated proteins using an anti myc monoclonal antibody and enhanced chemiluminescence technology 3 PCR amplification of the template is performed in the usual way using
219. ion 13 76 Nylon 23 Nucleon I 103 O Oligo dT primer 44 102 Online Mendelian Inheritance in Man OMIM 199 Osmium tetroxide 114 117 P P1 artificial chromosomes PAC 78 Pharmacogenetics 180 Polyacrylamide see Gel electrophoresis Polyethylene glycol PEG 44 Polymerase chain reaction PCR 37 allele specific see ASO PCR betaine 43 expand system 52 GC clamp 126 Gene Ampl XL 52 hot start 43 53 96 105 nested 39 long range 39 51 120 magnesium 55 multiplex 39 primer dimers 43 primer design 140 purification 70 172 211 RT PCR 44 88 92 112 120 Reverse transcriptase see Reverse transcriptase secondary 116 Taq Plus 52 template DNA 53 Probes 13 17 centromeric 75 detection 82 83 multiprobe 75 plasmid 78 repetitive sequence 73 80 single copy 75 80 Protein Information Resource PIR 200 Protein truncation test PTT 87 Propidium iodide PI 78 PWO DNA polymerase 39 Push column 15 R Rainbow markers 95 105 Redivue 94 Restriction enzymes 17 30 Restriction length fragment polymorphism RFLP 29 Reverse transcriptase 39 52 92 112 116 Rhodamine DUTP 15 RNA 42 extraction 115 rRNA 169 RNeasy extraction 102 RNAse inhibitor 41 S Sephadex 14 15 21 Sequence navigator 114 Sequence Retrieval System SRS 200 Sequencing of DNA automated 66 Maxam Gilbert sequencing 17 mini sequencing see Solid phase mini s
220. ion tube Pour the high denaturant solution into the high chamber Activate the mag netic bar to create a vortex and open the clamped exit tube By gravity the high denaturant solution will then leave the high chamber and pass into the glass plate sandwich via the exit tube At this point open the connection between the two chambers The low solution will then flow into the high chamber and mix with the high solution 132 3 4 After the required electrophoresis time disconnect the power supply and switch Wallis The clamp should be used to adjust the rate of flow of polyacrylamide solution from the high chamber through the exit tubing so that a denaturing gradient gel is poured in 5 10 min Allow the gel to polymerize for between 1 2 h In the meantime heat the TAE buffer in the buffer tank to 60 C see Note 7 Please note that the TAE buffer may be used three times before replacing Gel Electrophoresis Following polymerization loosen all screws until they just touch the plexi glass pressure unit Place the electrophoresis cassette into the INGENYphorU buffer tank and con nect the buffer flow tube Buffer should overflow from the upper buffer chamber into the main tank through holes in the sides of the cassette A valve on the out side of the tank controls the rate of buffer flow into the upper buffer reservoir Carefully remove the comb and p
221. is a nucleotide substitution G A usually detected by ASO H 3 The most useful intragenic polymorphic sites with high heterozygosity in different ethnic populations are in intron 18 and intron 22 recognized with the Bcll and Xbal restriction enzymes respectively A closely linked polymor phism recognized by the BglII restriction is also highly informative but with a 5 theoretical chance of recombination All three of these RFLPs have origi nally been identified and analyzed by Southern blotting However this method is time consuming and may need the radioactive method for DNA band visual ization To this end the Bc I intragenic RFLP method has now been replaced by a fast and nonradioactive polymerase chain reaction PCR analysis 4 5 1 1 Use of Southern Blotting in Bcll RFLP Analysis of Hemophilia A This method involves a series of techniques some of which are dealt with in detail elsewhere 6 These techniques include extraction of DNA from blood samples digestion with appropriate restriction enzyme and electrophoresis prepa ration extraction isolation purification and radiolabeling of the DNA probe Southern blotting hybridization and finally autoradiography for DNA band visualization 2 Materials 2 1 Restriction of DNA with the Bcll Enzyme 1 Assay buffer 10X The composition of this buffer varies from one manufac turer to another For example the composition of Amersham Pharmacia Bio Restriction Fragment
222. is is a format for displaying images on a com puter and it is not possible to copy and paste primer sequences from here If you want to copy and paste sequences then use the Text version of xprimer available from the Primer selection image window Compare these sequences with those of the M13 forward GTTTTCCCAGT CACGAC and reverse GGAAACAGCTATGACCATG primers Note The terms forward and reverse used for M13 primers are not the same as the terms used for forward and reverse primers Do they match Can you find these sequences in insert seq Remember that these are PCR primer sequences and will be given in a 5 to 3 direction for each strand Remember insert seq is single stranded and does not include the complementary strand Do they match 2 3 2 Checking the Suitability of Your Primers The final part of primer design is to ensure that the chosen sequences will be specific for the required DNA target This is achieved by repeating the BLAST search performed earlier However in this instance the two PCR prim ers should be used as the queries to ensure that there are no other sequences in the database which might be amplified along with your own sequence Bioinformatics 199 This is obviously not a guarantee against mis primes but it will help avoid the more obvious problems such as unknowingly including regions contain ing repeated sequences 2 4 The Human Genome Project The chromosomal location of completed human DNA sequ
223. it and this cost is contained in tables which have such names as PAM 30 PAM 70 BLOSUM 80 and BLOSUM 62 This concept of cost is also true for the introduction of gaps into either sequence addition or deletion of amino acids The introduction of gaps is an undesirable event and so the introduction of gaps carries penalties in the summation of the final score There are penalties to pay for mismatches and introduction of gaps into an alignment Depending on the specific aims of your own particular alignment you might want to change these penalties press the Advanced button in the CLUSTALW interface window If you do so then the results you obtain will probably be different The default values suggested by the program are a good starting point Don t be afraid to experiment with these penalties to look for less obvious similarities The CINEMA home page can be found at http www biochem ucl ac uk bsm dbbrowser CINEMA2 1 Alternatively if this server is proving slow then try one of the mirror sites at Venus Internet http www venus co uk cinema or The Weizmann Institute http bioinformatics weizmann ac il CINEMA 1 Go to the CINEMA home page http www biochem ucl ac uk bsm dbbrowser CINEMA2 1 directly into a Web browser 2 In the top window click on Applet here under the CINEMA logo 3 This will load a separate window entitled CINEMA which contains multiple color sequences 4 Select File Clear all in the menu bar to
224. itachi FMBIO 100 or Molecular Dynamics 595 4 Scan using the correct wavelength or filter for the fluorescent group to be detected 3 4 2 Chemiluminescence Detection of CFLP Patterns 1 After electrophoresis wearing powder free latex gloves that have been washed with isopropanol see Note 7 carefully separate the glass plates to expose the acrylamide gel 2 Cut a piece of Nytran Plus membrane Schleicher and Schuell to fit the gel size and moisten by applying 5 10 mL of 0 5X TBE 3 Carefully place the moistened membrane onto the gel avoiding lifting and repo sitioning the membrane and smooth out air bubbles with a clean pipet Transfer starts immediately so the membrane should not be picked up and repositioned once it has come into contact with the gel 4 Cover the membrane with two pieces of precut blotting paper cover with a glass plate and place a binder clip on each side of the sandwiched gel Alternatively CFLP Analysis for Genotyping and Mutation Detection 175 for large gels i e 20 x 20 cm or larger place an approx 2 kg weight on top of the sandwich 5 Allow the DNA to transfer onto the membrane for 4 16 h e g overnight if convenient at room temperature 6 After the transfer disassemble the sandwiched gel and remove the membrane by carefully moistening it with distilled water Mark the DNA side i e the side touching the gel during transfer using a permanent laboratory marker 7 Rinse a dish thor
225. ith the manufacturers 10X NH4 2SO buffer with excellent results Bioline Taq also works reliably with a homemade ammo nium sulfate based buffer see Note 3 Use of commercially supplied buffer ensures standard amplification conditions and eliminates the batch to batch variation with homemade buffer Conformation Sensitive Gel Electrophoresis 141 An incompatibility between PCR amplification buffer and CSGE gel can be identified at an early stage in the procedure by the appearance of smeared bands on CSGE gels not present on polacrylamide bis mini gels even with a dilution of the CSGE sample Once PCR conditions have been identified that give sharp single bands on CSGE gels test samples can be amplified heteroduplexed and screened by CSGE 1 7 Heteroduplexing DNA Samples DNA heteroduplexes are formed between mismatched wild type and mutant DNA fragments The heteroduplexing method is a simple two step process involving an initial denaturing stage where hydrogen bonds between paired nucleotides are broken producing single stranded DNA fragments This dena turing step involves heating the sample to 98 C for 5 min The second step or annealing stage involves cooling the sample to 65 C for 30 min see Note 4 At this temperature the DNA can reform back into double stranded DNA with the possibility of each sense strand pairing with a different antisense strand Fig 1 Heteroduplexes are formed when the new paired strands differ in
226. l standards For this purpose GS 2500 Rox diluted 1 400 in formamide loading dye should be used in place of formamide loading dye at the cleavage step A T nucleotide mispaired with G is not modified by osmium tetroxide if preceded by G at the 5 end and will only show up in the hydroxylamine reaction 11 Fluorescent DNA sequencing requires more template than S dATP sequencing Don t even attempt to sequence from a poor PCR For gel purifying the PCR product remove the relevant band from the low melt ing agarose gel and add equal volume of water Heat at 70 C for 10 min this keeps it in solution Several matrices are available commercially e g Geneclean BIO101 PCR purification kit Promega centrisep column Amicon which can be used for the purification of DNA from this gel References 1 Gitschier J Wood W I Goralka T M Wion K L Chen E Y Eaton D H et al 1984 Characterization of the human factor VIII gene Nature 312 326 330 Toole J J Knopf J L Wozney J M Sultzman L A Buecker J L Pittman D D et al 1984 Molecular cloning of a cDNA encoding human antihemo philic factor Nature 312 342 347 Higuchi M Antonarakis S E Kasch L Oldenburg J Economou Petersen E Olek K et al 1991 Molecular characterisation of mild to moderate hemo Mutation Detection in Factor VIII 123 10 Iig philia A detection of the mutation in 25 of 29 patients by d
227. l you get to Enter two images URLs 3 Click in the Left image box and type http www herts ac uk natsci Bio 2Dimages Image10alt gif or select copy and paste EITHER a Click in the Right image box and type in the gel address 1 e http www herts ac uk natsci Bio 2Dimages Image 1 2alt gif or select copy and paste OR a Drag the mouse cursor across the whole of the address you have just typed in step 3 to highlight it b Hold down Ctrl c Press and release the C key to copy the address to the clipboard d Click in the Right image box e Hold down Ctrl f Press and release the V key to paste the address into the box g Edit the address to give http www herts ac uk natsci Bio 2Dimages Image 2alt gif or select copy and paste 4 Now press the Go Flicker button 5 The relevant gels and the program to view them will now be downloaded This may take some time but you will eventually see a new page with your two 2D gels These will be found at the bottom of the window and if you can t see them then scroll down the window 6 Each gel image will have a set of cross hairs in blue Look at the two gels and decide on a common spot press and hold down Ctl and click on the common spot with the mouse in each gel This will move the gel image and position the cross hairs on the spot If you are not happy with the position then repeat this procedure 7 Now scroll back up the screen and click in the Flicker box t
228. le strand conformation polymorphism in the detection of mutations in exon 5 to 8 of the p53 gene Oncogene 9 1739 1743 Sheffield V C Cox D R Lerman L S and Myers R M 1989 Attachment of a 40 base pair G C rich sequence GC clamp to genomic DNA fragments by the polymerase chain reaction results in improved detection of single base changes Proc Natl Acad Sci USA 86 232 236 Olschwang S Laurent Puig P Groden J White R and Thomas G 1993 Germ line mutations in the first 14 exons of the adenomatous polyposis coli APC gene Am J Hum Genet 52 273 279 Lerman L S and Silverstein K 1987 Computational simulation of DNA melt ing and its application to denaturing gradient gel electrophoresis in Methods in Enzymology Volume 155 Wu R ed Academic Press NY pp 482 501 Wallis Y L Morton D G McKeown C M and Macdonald F 1999 Molecular analysis of the APC gene in 205 families extended genotype pheno type correlations in FAP and evidence for the role of APC amino acid changes in colorectal cancer predisposition J Med Genet 36 14 20 Fidalgo P Almeida M R West S Gaspar C Maia L Wijnen J et al 2000 Detection of mutations in mismatch repair genes in Portuguese families with hereditary non polyposis colorectal cancer HNPCC by a multi method approach Eur J Hum Genet 8 49 53 Fodde R Vander Luijt R Wijnen J Tops C Van der Klift
229. levant because scientists at Sequenom San Diego CA developed the primer oligo base extension PROBE reaction especially for the purpose of assessing genetic polymorphism by MS 24 The PROBE assay format can be used for the analysis of deletion insertion or point mutations and STR and SNP analysis and it allows the detection of compound heterozygotes The PROBE process comprises a postPCR solid phase primer extension reaction carried out in the presence of one or more dideoxynucleotides ddNTPs and generates allele specific termi nated extension fragments see Fig 2 In the case of SNP analysis the PROBE primer binding site is placed adjacent to the polymorphic position Depending on the nucleotide status of the SNP a shorter or a longer extension product is generated In the case of heterozygosity both products are generated After completion of the reaction the products are denatured from the solid phase and analyzed by MALDI TOF MS In the example given in Fig 2 the elongation products are expected to differ in mass by one nucleotide Figure 3 presents raw data for a heterozygous DNA sample analyzed by this PROBE assay The two SNP alleles appear as two distinct mass signals Careful assay design makes a high level multiplexing of PROBE reactions possible In the case of STR analysis a ddNTP composition is chosen that terminates the polymerase extension at the first nucleotide not present within the repeat 25 For length determin
230. ll result in the formation of both normal and mutant homoduplex molecules as well as two different heteroduplex molecules Ide ally the mutant homoduplex will be displaced from its normal counterpart In addition the two heteroduplexes will migrate to different positions along the denaturing gradient Following ethidium staining therefore a variant band pattern will usually appear as four DNA bands In some cases however vari ants may manifest as two or even three DNA bands Fig 4 134 Wallis 4 Notes 1 The 40 bp GC clamp originally described by Sheffield et al 7 has the following sequence 5 CGCCCGCCGCGCCCCGCGCCCGTCCCGCCGCCCCCGCCCC 3 and should be attached to the 5 end of either the forward or reverse primer To make heteroduplex molecules when screening homozygous mutations mix equal quantities of normal and mutant PCR products and denature at 95 C for 10 min followed by 30 min at the product specific annealing temperature Cool to room temperature before loading Optimization of DNA band migration may be achieved by altering the denatur ant gradient range For example if fragments migrate too far into the gel before they resolve the denaturant concentration at the top should be increased How ever if fragments do not migrate sufficiently the concentration at the top should be lowered The concentration of polyacrylamide may be altered to suit the fragment size under analysis To deionize formam
231. lly labeling DNA fragments and is useful for visualizing small amounts of DNA End labeling can also be used to label fragments at one end All of the enzymes employed are specific to either the 3 or 5 termini of DNA and will consequently only incorporate label once per DNA strand If double stranded DNA is used both ends are labeled but single end labeled fragments can be produced by further restriction enzyme digestion This works well with DNA fragments cloned into polylinkers as one labeled end can be removed as a tiny DNA fragment making subsequent purification easier Such single end labeled molecules can be used to order restriction enzyme fragments and are a prereq uisite for Maxam Gilbert DNA sequencing J End labeled synthetic oligo nucleotides have numerous applications including sequence specific probes 2 gel retardation and Southwestern assays 3 and sequencing polymerase chain reaction PCR products 4 There are two common methods of end labeling the fill in reaction and the kinase reaction The fill in reaction uses the Klenow fragment of Escherichia coli DNA polymerase 5 and labels DNA fragements that have been digested with a restriction enzyme to create a 5 overhang Klenow extends the 3 recessed end of one DNA strand by using the 5 overhang of the other strand as a template Fig 1A This is the method of choice for double stranded DNA fragments because of its ease When suitable restriction en
232. lly appear on native polyacrylamide gels as one or two bands of reduced mobility relative to the homoduplex DNA The mismatched bases present in heteroduplexes are thought to affect electrophoretic mobility by inducing bends in the DNA 7 Because two different DNA sequence variants must be present to form heteroduplexes they may need to be created for some types of analysis For example in order to analyze male samples for loci on the X chromosome by heteroduplex analysis heteroduplexes can be created by mixing denaturing and annealing the test sample PCR amplification with a known normal control amplification In heterozygotes however heteroduplexes form as a natural by product of PCR reactions During the latter stages of PCR amplification when the polymerase activity is limiting some of the denatured ssDNA can spontaneously reanneal without primer extension with an opposite strand from the other allele thus creating heteroduplex DNA Heteroduplex analysis is carried out by electrophoresis of the fragment of interest on long usually polyacrylamide gels with low ratios of crosslinking Heteroduplexes have been visualized using radioisotopes 6 silver staining 2 and ethidium bromide staining 8 Fluorescent labeling should also be theoretically possible The detection efficiency of heteroduplex analysis has been reported to approach 90 under ideal conditions 7 and the optimum size 250 500 bp is not as tightly defined as SSCP Co
233. lly expected results see Fig 8 The DNA MassArray throughput in terms of genetic information output depends on the chosen scale Using microtiter plates and 8 channel pipets the analysis of 192 genotypes two 96 well microtiter plates a day is routine work With the use of automated liquid handling stations the throughput can be increased by a factor of about four An automated process line was been developed during the last year to increase the throughput to an industrial scale The automated process line integrates biochemical reactions including PCR setup immobilization PROBE reaction sample conditioning and recovery 186 Jurinke et al Fig 5 Sample holder for 10 SpectroCHIPs for use in the SpectroSCAN mass spectrometer from the solid phase into a fully automated process with a throughput of about 10 000 samples per day 2 Materials 2 1 PCR and PROBE Reaction 1 Dynabeads M 280 Streptavidin Dynal Oslo Norway 2 Separate PROBE stops mixes for ddA ddC ddG and ddT 500 uM of the respec tive ddNTP and 500 uM of all dNTPs not present as dideoxynucleotides MassArray Kit Sequenom 3 2X B W buffer 10 mM Tris HCl pH 7 5 1 mM EDTA 2 M NaCl all compo nents from Merck Darmstadt Germany 25 Aqueous NH OH Merck Darmstadt Germany 10 mM Tris HCl pH 8 0 Merck AmpliTaq Gold Perkin Elmer Foster City CA AmpliTaq FS Perkin Elmer Magnetic particle concentrator for microtiter plate or tu
234. lue of each reaction expresses the amount of the incorporated 7H dNTP Calculate the ratio R between the mutant and normal nucleotide cpms In a sample of a subject homozygous for the mutant nucleotide the R will be gt 10 in a homozygote for the normal nucleotide R lt 0 1 and in the case of a heterozygote R varies between 0 5 and 2 0 depending on the specific activities of the H dNTPs see Note 11 4 Notes 1 The efficiency of the 5 biotinylation of an oligonucleotide on a DNA synthesizer is most often 80 90 The biotin labeled oligonucleotides can be purified from the unbiotinylated ones either by high performance liquid chromatography 7 polyacrylamide gel electrophoresis 8 or ion exchange columns manufactured for this purpose Perkin Elmer ABJ If the biotin labeled primer is not purified the biotinylation should be confirmed after the PCR by affinity capture of the biotinylated PCR product followed by detection of possible unbound products by agarose gel electrophoresis see Chapter 1 2 The detection step primer for our standard protocol is a 20 mer It is advisable to use a nested primer as a detection step primer to ensure that possible unspecific PCR products remain undetected The primer should be at least five nucleotides nested in relation to the unbiotinylated PCR primer 3 The binding capacity of a streptavidin coated microtiter well is 2 5 pmol of biotinylated oligonucleotide If higher binding capacity i
235. ly be held by the edges so that oils from hands do not become deposited on the working surface of the plates and lead to the forma tion of bubbles in the gel Rinse the plates with ethanol and allow to dry One surface of the glass plate should be periodically treated with silicone solution to prevent the gel from sticking to both plates and therefore reduce the possibility that the gel will tear when it is removed from the plates following electrophoresis 2 Most modern commercial gel systems provide gel casting units for the prepara tion of polyacrylamide gels therefore the manufacturers guidelines should be followed Generally lay one plate on the bench siliconized side upward and position the spacers on the plate Place the inner glass plate onto the spacers and seal the edges of the gel with electrical tape or a clamping unit see Note 16 3 Calculate and prepare the desired quantities of reagents needed to make suffi cient solution to fill the gel mould For example to pour a 5 acrylamide gel in a total volume of 100 mL add 10 mL 10 X TBE and 16 67 mL 30 acrylamide to 72 23 mL water see Note 17 4 Immediately before pouring add the ammonium persulfate solution and TEMED and mix Quickly fill the mould with the solution trying not to trap any air bubbles in the mould Apply a comb to the top of the gel and then flush out the syringe and needle see Note 18 8 Guilliatt 3 2 2 Assembly and Running of the Gel 1 2
236. lymorphism dis covery resource for research on human genetic variation Genome Res 8 1229 1231 Christopoulos T K 1999 Nucleic acid analysis Anal Chem 71 425R 438R Hacia J G 1999 Resequencing and mutational analysis using oligonucleotide microarrays Nat Genetics Suppl 21 42 47 Karas M and Hillenkamp F 1988 Laser desorption ionization of proteins with molecular masses exceeding 10 000 daltons Anal Chem 60 2299 2301 Wu K J Steding A and Becker C H 1993 Matrix assisted laser desorption time of flight mass spectrometry of oligonucleotides using 3 Hydroxypicolinic acid as an ultraviolet sensitive matrix Rapid Commun Mass Spectrom 7 142 146 Tang K Fu D K tter S Cotter R J Cantor C R and K ster H 1995 Matrix assisted laser desorption ionization mass spectrometry of immobilized duplex DNA probes Nucleic Acids Res 23 3126 3131 Jurinke C van den Boom D Jacob A Tang K W rl R and K ster H 1996 Analysis of ligase chain reaction products via matrix assisted laser desorp tion ionization time of flight mass spectrometry Anal Biochem 237 174 181 192 Jurinke et al 19 20 21 22 23 24 25 Jurinke C Z llner B Feucht H H Jacob A Kirchhiibel J L chow A van den Boom D Laufs R and K ster H 1996 Detection of Hepatitis B virus DNA in serum samples via nested PCR and MALDI TOF mass spectrometry Genet Anal
237. lysis also makes comparisons between samples more objective 11 However the major drawback is one of cost not only in capital equipment and software but also the fluorescently labeled primers 2 There are commercial gel matrices specifically marketed for SSCP and heterodu plex analysis such as Hydrolink and MDE They do have different character istics from the 49 1 acrylamide recommended here They tend to work out to be quite expensive for routine use 3 Acrylamide is a cumulative neurotoxin Great care should be taken when han dling acrylamide powder solution and gels Gloves should be worn at all times when handling acrylamide A face mask and fume cabinet should also be used when adding water to preweighed bottles of acrylamide powder 4 Gel additives are recommended in many SSCP protocols to improve detection efficiency The addition of glycerol in particular is reported to enhance the sensi tivity of SSCP analysis 9 Gels containing glycerol should also be run at room temperature thus offering an alternative method to workers without access to a cold room or cabinet We have found that the detection rate of heteroduplex analy sis is compromised in the presence of glycerol so we can only recommend its use as an additional condition to enhance the detection rate when this needs to be maximized The addition of 10 sucrose to SSCP gels has also been used to enhance the sensitivity of SSCP 9 5 Formaldehyde is usually sold as
238. m temperature TE 8 0 10 mM Tris HCl pH 8 0 containing 0 1 mM EDTA autoclaved and stored at room temperature 6 Acrylamide Bisacrylamide solution from Severn Biotech Ltd UK cat no 20 2700 10 Streptavidin coated magnetic beads Strep Magneshere Paramagnetic Particles from Promega USA cat no Z5481 2 6 Fluorescent Dye Terminator DNA Sequencing A ABI PRISM DNA Sequencing kit Big Dye Terminator Cycle Sequencing Ready Reaction cat no 4303152 is supplied by Perkin Elmer Applied Biosystems and is stored as 4 uL aliquots at 20 Absolute and 70 ethanol 3 M Sodium acetate pH 4 6 AutoMatrix 4 5 cat no EC 854 from National Diagnostics UK Sequence Navigator software from ABI Mutation Detection in Factor VIII 115 2 7 Detection of Intron 22 Inversions 1 Primers used for the detection of intron 22 inversion are shown in Table 2 2 Expand Long Template PCR System cat no 1681842 from Boehringer Mannheim Germany 3 Deaza dGTP cat no 988537 from Boehringer Mannheim Germany 3 Methods 3 1 Isolation of Lymphocytes 1 Ina50 mL polypropylene conical tube add 10 mL of Histopaque 1077 Gradu ally overlay equal volume of EDTA anti coagulated blood This can be facili tated by tilting the centrifuge tube containing Histopaque so that the blood trickles down the side of the tube It is essential that Histopaque and the blood are at room temperature see Note 1 2 Centrifuge at 400g
239. mage analysis equipment which is becoming increasingly important in the growing field of molecular cytogenetics 76 Dyer and Green Practically FISH involves probe labeling denaturation of probe and target DNA hybridization of probe to target DNA stringency washing to remove excess probe detection of indirectly labeled probes and counterstaining Basic hybridization methods are given in the following sections together with proto cols for growing and labeling probes in the laboratory All methods are designed as general guidelines only and in the case of commercially purchased probes manufacturer s guidelines should always be followed Particularly hazardous reagents have been highlighted but appropriate safety precautions should be followed for all laboratory work 2 Materials 2 1 Growing Probes in the Laboratory 1 Plasmid Maxi kit Qiagen cat no 12162 containing Qiagen 100 tips and buffers P1 resuspension buffer P2 lysis buffer P3 neutralization buffer QBT equilibration buffer QC wash buffer and QF elution buffer 2 LB broth Luria Bertani medium Dissolve 10 g bacto tryptone 5 g bacto yeast extract and 10 g NaCl in 950 mL of distilled water adjust the pH to 7 0 with 5 N NaOH and make up to L with distilled water Sterilize by autoclaving Kanamycin 50 mg mL store at 20 C Shaking incubator Sorvall centrifuge GSA and SS 34 rotors 250 mL and 50 mL centrifuge tubes Isopropanol
240. mbined SSCP heteroduplex analysis exploits the tendency for a propor tion of the DNA denatured during sample preparation for SSCP to spontane ously reanneal to form dsDNA and hence heteroduplexes when there are sequence differences in the sample The gel conditions for both SSCP and het eroduplex analysis are compatible and so it is possible to get two techniques for the price of one There are however some limitations to the technique foremost among these is that the dsDNA with which the heteroduplexes are associated have a much higher mobility than the SSCPs formed by the ssDNA This limits the electrophoresis time in order to retain the dsDNA on the gel reducing the resolution of the SSCPs In practice the loss of sensitivity is more than made up for by the complementarity between the two techniques a point evinced by the observation that every one of 134 different cystic fibrosis trans membrane conductance regulator CFTR mutations are detectable by a com bined SSCP heteroduplex strategy 9 Consequently a combined SSCP heteroduplex approach is now used more frequently by laboratories than either technique alone 2 Materials 2 1 Preparation and Electrophoresis of SSCP Heteroduplex Gels 1 S2 or SA32 sequencing gel system Gibco BRL cat nos S2 21105 036 and SA32 31096 027 see Note 1 SSCP Heteroduplex Analysis 153 2 9 10 1 mm thick combs and spacers These are a nonstandard thickness and need to b
241. mers must fulfil The purpose of this exercise is to learn how to design primers using xprimer and the sequence in Table 2 insert seq as the template This sequence repre sents an insert in a plasmid plus 50 100 bp of vector sequence on either side 198 Brzeski Table 2 insert seq TGTGAGCGGATAACAATTTCACACAGGAAACAGCTATGACCATGAT 10 11 12 TACGAAAGGTGCTTTTGGGGGCCGTCAGGGTCGAGGGTTCCTATTT CCTGGTCTATGGGGTCCCCGGCTTCGGGAAAGATAATGAAAGCCT CATCAGCAGGGAGGAGTTTTTAGGGGGGGTCCGCATGGGGGTCCC CCAAGCGACCGAATTGGCGGCTGAGGCCGTGGTGCTTCATTACAC CGATTTTCGAGCTCGGTACCCGGGGATCCTCTAGAGTCGACCTGC AGGCATGCAAGCTTGGCACTGGCCGTCGTTTTACAACGTCGTGAC TGGGAAAACCCTGGCGTTACCCAACTTAATCGC Start a Web browser Netscape or Internet Explorer by clicking on the rel evant icon Go to File Open in the menubar enter http alces med umn edu webprimers html in the dialog box and press the OK button After connection the Web browser will open the Primer selection image window Click in the Query sequence text box towards the bottom of the page Paste or type the sequence into this text Don t worry about any spaces which might appear It is possible to fine tune the search parameters i e primer length or Tm differ ence by altering the values in the various list boxes but for the moment use the suggested defaults Press the Submit button After a few seconds minutes the results will be returned in the form of a GIF file it has a gif file extension Th
242. mildly denaturing conditions If the denaturants within the gel matrix are increased above optimal conditions for CSGE both mismatched bases are rotated out of the double helix and the bend or kink causing the conformational change is eliminated In this situation homoduplexed and heteroduplexed DNA will have similar electrophoretic mobilities Bhattacharrya and Lilley 2 proposed that under nondenaturing conditions DNA fragments with an additional base or bases on one side of the DNA helix such as a dele tion or insertion resulting in a frameshift mutation exhibit more marked gel retardation than DNA fragments possessing single mismatches where two non Watson Crick bases are in opposition They also reported an increased gel retardation with an increasing number of mismatched bases This increased gel retardation with insertion and deletion mutations is also observed under the mildly denaturing conditions of CSGE see Subheading 3 4 Therefore CSGE aims to optimize conditions for mismatched bases in heteroduplexed DNA to result in a shift in band migration during polyacrylamide gel electro phoresis 1 2 CSGE Conditions Optimized conditions for CSGE were described by Ganguly and Prockop 3 Denaturants ethylene glycol and formamide known to alter the conforma tion of DNA were chosen for inclusion into the CSGE gel mix at concentra tions of 10 and 15 respectively because of their compatibility with polyacrylamide gel electrophor
243. molds Tap the glass plate to dislodge any air bubbles as they form To ensure that the top of the gel sets with a straight edge overlay the gel with 0 1 SDS solution Leave the gel to polymerise for about 1 h When the gel is fully polymerized pour off the 0 1 SDS solution and rinse the top of the gel with distilled H O Drain away as much water as possible and soak up the remainder using a piece of Whatman 3MM paper Prepare two 5 stacking gels by mixing 2 77 mL H O 0 83 mL of 30 acryla mide solution 1 26 mL of 0 5 M Tris buffer pH 6 8 and 50 uL of 10 SDS in a 15 mL disposable plastic tube Add 5 uL TEMED and 50 uL of 10 ammonium persulfate Mix by inversion and pour on top of the resolving gel fill the gel mold Protein Truncation Test 99 10 Ti 12 3 5 The presence of a translation terminating mutation within the PCR amplified up to the level of the small glass plate Insert the comb so that there is a depth of 1 cm between the bottom of each well and the top of the resolving gel Leave the gel to polymerize for at least 30 min When the stacking gel is polymerized carefully remove the comb Remove the clamped glass plates from the pouring stand and clip in to the central cooling core Place the central core within the electrophoresis chamber Place approx 100 mL of 1X Tris glycine running buffer in the upper buffer chamber and approx 200 mL in the lower buffer chamber Flush out the wells with 1X running
244. move the gel from the drier and discard the Saran Wrap Tape the gel inside an X ray film cassette and perform autoradiog raphy overnight at room temperature see Note 17 Develop the X ray film and align the film over the gel Mark the position of the Rainbow colored protein molecular weight markers on to the film with a perma nent marker pen The size of any truncated proteins can be estimated from a graph of log10 of the mass of the size standards plotted against electrophoretic mobility A shorter or longer exposure time may be required depending on the level of S methionine incorporation Interpretation fragment is indicated by the presence of a protein of lower molecular weight than the full length protein see Figs 1 and 2 The size of the truncated protein esti mated by comparison with protein molecular weight markers or with the trun cated protein of a characterized mutation indicates the position of the premature 100 Hardy stop codon The position of a nonsense mutation can be determined quite accu rately whereas a frameshift mutation may be located some distance upstream from the site of the premature stop codon Another mutation detection method such as SSCP or heteroduplex analysis can be used to locate the mutation more precisely and confirm the presence of the mutation in genomic DNA Sequencing of genomic DNA should be used to definitively characterize the mutation 2 Other labeled polypeptides in addition t
245. n The heat stable DNA polymerase utilized in the polymerase chain reaction PCR has been widely used to amplify DNA fragments since its conception by Kerry Mullis in 1985 However it soon became apparent that there was a constraint on the maximum size of amplified fragments For genomic DNA this was 3 4 kb 1 whereas for phage lambda DNA amplifications of up to 15 kb have been possible 2 The basis for this constraint is the rate of errors of misincorporation of Taq DNA polymerase which have been shown to be 2 x 10 to 2 x 1075 3 muta tions per nucleotide per cycle Incorporation of a mismatched base causes strand extension to stall and the Tag DNA polymerase to dissociate from the template strand The longer the PCR product the more likely misincorporation is to occur Barnes 4 demonstrated that inclusion of a proofreading enzyme with the Taq polymerase could greatly increase the length of amplified DNA strands The proofreader removes misincorporated nucleotides and allows the Taq poly merase to continue Although capable of high fidelity DNA synthesis proof reading enzymes alone produce a low yield of amplified template Combining Taq polymerase with the proofreader produces an increased yield of a high fidelity long range PCR product Using this mixture of enzymes it is possible to obtain amplifications of 40 kb from phage DNA clones and up to 22 kb from genomic DNA 5 Applications of long range PCR L PCR include looking
246. n be run simultaneously in under h Any similar gel system can used e g the Hoefer Mighty Small electrophoresis cell SE245 is of a similar design to the Mini Protean II model Some laboratories prefer to use larger format gels for the separation of PTT translation products The Protean II electrophoresis cell Bio Rad Laboratories Ltd is an alternative for those who wish to run longer gels Up to four gels of 16 x 16 cm or 16 x 20 cm can be run Protein Truncation Test 105 10 Lg 12 13 14 15 simultaneously to separate between 60 and 100 samples Using the Protean II system electrophoresis is performed over a period of 16 h at 30 mA The Rainbow colored protein molecular weight markers provide a less expensive alternative to 4C radiolabeled protein molecular weight standards The Kaleidoscope prestained SDS PAGE standards are a similar product Bio Rad Laboratories Ltd The main disadvantage of using the nonradioactive mo lecular weight standards is that the position of the protein standards must be marked on to the X ray film after the film has been developed by aligning the film with the gel Hence the molecular weight of the truncated proteins calcu lated in this way may be slightly inaccurate The Rainbow colored protein molecular weight markers are also available labeled with a 4C label Amersham Life Sciences In optimizing the RT PCR it may be necessary to adjust the amounts of cDNA and p
247. n by amplified and screened by PTT in just 10 overlapping frag ments and has been successfully used to identify translation terminating muta tions in affected males and carrier females 5 More recently multiplex PTT for the dystrophin gene has been described 6 The complete coding sequence can be analyzed in just five overlapping RT PCR products which are simulta neously tested for truncating mutations in a single in vitro transcription trans lation reaction translated proteins from one reaction are separated in a single lane of an SDS PAGE gel 6 The advantages PTT has over conventional mutation screening methods make it an ideal choice for identifying translation terminating mutations that occur in several important tumor suppressor genes Familial adenomatous poly posis FAP is caused by germline mutations of the APC gene and somatic mutation of the APC gene occurs frequently in sporadic colorectal carcinomas CRC In both FAP and CRC approx 95 of the mutations identified in the APC gene result in premature termination of protein translation 7 The APC gene is large with 15 exons and a coding sequence of 8 5 kb Exon 15 of the APC gene is 6 5 kb in length and approx 70 of the mutations found in FAP patients occur in the 5 end of exon 15 Approximately 65 of the somatic mutations found in sporadic CRC are located within a small region of exon 15 known as the mutation cluster region By direct amplification of a 2 kb seg ment o
248. near polymerase chain reaction Nucl Acids Res 17 21 8889 9 Levedakou E N Landegren U and Hood L E 1989 A strategy to study gene polymorphism by direct sequence analysis of cosmid clones and amplified genomic DNA BioTechniques 7 5 438 442 10 Lee J S 1991 Alternative dideoxy sequencing of double stranded DNA by cyclic reactions using Taq polymerase DNA Cell Biol 10 1 67 73 11 McBride L J Koepf S M Gibbs R A Nyugen P Salser W Mayrand P E et al 1989 Automated DNA sequencing methods involving PCR Clin Chem 35 2196 2201 12 Tracy T E and Mulcahy L S 1991 A simple method for direct automated sequencing of PCR products BioTechniques 11 1 68 75 11 Fluorescent n Situ Hybridization Sara A Dyer and Elaine K Green 1 Introduction Single stranded DNA will recognize a complementary strand with high specificity under suitably controlled conditions n situ hybridization ISH exploits this phenomenon by hybridizing an appropriately labeled single stranded DNA probe to target sequences in situ in either dissociated cell preparations or tissue sections Early ISH protocols used radioactivity to label probes whereas current tech niques use fluorescent labels giving rise to the term fluorescent in situ hybrid ization FISH FISH probes may be directly labeled by the incorporation of a fluorochrome conjugated molecule e g fluoroscein d UTP or Texas red d UTP
249. nfo html and http alces med umn edu webprimers html Positioning ORFs on 2D gels http expasy hcuge ch ch2d ProDom protein domains http protein toulouse inra fr prodom html Protein Information Resource PIR http pir georgetown edu SWISS PROT http www expasy ch sprot sprot top html Sequence retrieval system SRS http www expasy ch srs5 man srsman html or http www embl heidelberg de srs5 c http www expasy ch srs5 Searching the OMIM Gene Map http www3 ncbi nlm nih gov Omim searchmap html Searching the OMIM Morbid Map http www3 ncbi nlm nih gov Omim searchmorbid html The address of the online version of this chapter http www herts ac uk natsci Bio informatics htm Washington University Merck collaboration for EST sequencing http genome wustl edu est esthmpg html Washington University Medical School Genome Sequencing Center http genome wustl edu gsc index shtml 208 Brzeski 4 1 Other URLs Concerned with Bioinformatics 1 University College London A Taste of Bioinformatics http www biochem ucl ac uk bsm dbbrowser jj The aim of this tutorial is to provide a gentle intro duction to sequence and structure function analysis DNA Learning Center Cold Spring Harbor Laboratory Online DNA Sequence Analysis and Comparison Tutorial http vector cshl org SequenceAnlaysis Exercise index 1 html This tutorial uses reference human mitochondrial DNA sequences and online resources to
250. ng ethidium bromide carcinogenic See Chapter 1 Acknowledgments The author wishes to express her gratitude to Mr Charles Williams Head MLSO Haematology Department Birmingham Children s Hospital for his help and support in the writing of this chapter References i Rapley R 1998 Polymerase chain reaction in Molecular Biomethods Hand book Rapley R and Walker J M ed Humana Totowa NJ pp 305 325 Cooper D N and Krawczak M ed 1993 Human Gene Mutation BIOS Scien tific Oxford Henegariu O Heerema N A Dlouhy S R Vance G H and Vogt P H 1997 Multiplex PCR critical parameters and step by step protocol Biotech niques 23 504 511 Hecimovic S Barisic I Muller A Petkovic I Baric I Ligutic I et al 1997 Expand Long PCR for Fragile X mutation detection Clin Genet 52 147 154 Thiel V Rashtchian A Herold J Schuster D M Guan N and Siddell S G 1997 Effective amplification of 20 kb DNA by reverse transcription PCR Anal Biochem 252 62 70 Poort S R Bertina R M and Vos H L 1997 Rapid detection of the pro thrombin 20210A variation by allele specific PCR Thromb and Haemost 78 1157 1163 46 Jones 7 Flesch B K Bauer F and Neppert J 1998 Rapid typing of the human Fey receptor IIA polymorphism by polymerase chain reaction amplification with allele specific primers Transfusion 38 174 176
251. ng differentially labeled probes it is possible to apply more than one probe to a single target slide The following protocol involves codenaturation of target and probe DNA 1 Prewarm the hybridization chamber in a 75 C water bath 2 Mark the hybridization area on the underside of each target slide using a diamond pen 3 Dehydrate the target slide s by incubating through an alcohol series 2 min in each of 75 95 and 100 methanol at room temperature dry briefly on a 50 C hot plate 4 For each slide aliquot 0 5 uL of each labeled probe into an Eppendorf tube and make volume up to 10 uL with HB1 e g if simultaneously applying two differ entially labeled probes to two slides use 1 uL of each probe and 18 uL of HB1 mix well 5 Apply 10 uL of probe mix to the marked hybridization area of each dehydrated slide cover the hybridization area with a 22 x 22 mm coverslip see Note 11 and seal the edges with rubber sealant 6 Place the slide s in the prewarmed hybridization chamber seal the lid and incu bate at 75 C for exactly 10 min in order to codenature the probe and target DNA 7 Incubate the hybridization chamber containing the slide s at 37 C overnight 3 3 2 Hybridization Protocol 2 For Use with Single Copy Probes Single copy probes can be applied to metaphase or interphase preparations The use of differentially labeled probes allows the simultaneous application of more than one probe to a single target slid
252. nostics and is the only absolute means of establishing the identity of a new mutation However the clinical cost of obtaining this information is often prohibitive particularly when large DNA fragments are interrogated for the presence of any of a number of either known or previously undescribed genetic alterations 1 Instead several mutation scanning methods have been developed to eliminate the need to sequence every nucleotide when it is only the precise identity of one or a few nucleotides that is clinically significant Until now such methods have pro vided only a yes or no answer in determining whether a test sample differs from a known reference Relatively few methods have been proven capable of unambiguously identifying unique nucleic acid variants particularly when multiple sequence changes occur 2 Consequently the majority of existing mutation scanning methods are unsuitable for PCR based genotyping applica tions in which regions of sequence variability are used to categorize isolates for their similarities to known variants Third Wave Technologies has pioneered a novel mutation and polymor phism screening method that accurately and precisely distinguishes nucleic acid variants 3 This approach relies on enzymatic cleavage of characteristic struc tures formed by single stranded nucleic acids On sequential denaturation and renaturation both single stranded DNA and RNA molecules assume three dimensional conformation
253. ns 4 Notes 1 Geneclean Kit II Anachem or any other silica based purification methods puri fication with Exonuclease and Shrimp Alkaline Phosphatase and spin columns that concentrate and desalt the PCR products such as the Microcon 100 spin col umns Millipore may be used For automated fluorescent sequencing the latter method of purification is more appropriate as silica from the Geneclean can inter fere with the sequencing reaction such that a shorter read is obtained When there are multiple bands present because of nonspecific amplification then Geneclean is used to purify the sample in which case it is very important to not get any silica carryover into the sequencing reaction The enzyme method of PCR purification gives good sequencing as it removes the excess dNTPs and primers 8 uL of a 50 uL PCR product is digested with 1 uL of Exonuclease I 10 U uL and 1 uL of shrimp alkaline phosphatase 2 U uL Amersham supplies both enzymes together as a presequencing kit incubated at 37 C for 15 min and then inactivated at 80 C for 15 min 5 uL is used for the sequencing reaction Compressions occur when the DNA usually G C rich synthesized by the DNA polymerase does not remain fully denatured during electrophoresis dITP can be used instead of dGTP to reduce compressions in the sequence Primers should be about 18 25 nucleotides long It is also important to check the sequence of the primer for possible self compleme
254. nsion time to approx min kb In the protocol described the primer that is used subsequently as the reverse primer in the PCR reaction is also used to prime the cDNA reaction As an alter native the cDNA may be primed by an oligo dT primer which binds to the poly A tail present at the 3 end of most mammalian mRNAs or by random hexamers In these cases the whole mRNA population is converted to cDNA and both forward and reverse PCR primers must be added subsequently to amplify the sequence of interest Nested RT PCR Follow steps 1 8 in Subheading 3 2 then make the following master mix PCR Principles Procedures and Parameters 45 10 uL of 10X reaction buffer 10 uL of 5 mM dNTP 15 pmol primer 3 internal forward primer 15 pmol primer 4 internal reverse primer 2 5 U Taq polymerase Distilled water to a volume of 98 uL per sample To 98 uL of master mix add 2 uL of the primary PCR product this may also be done in a 50 uL or smaller reaction Overlay with mineral oil except when using an oil free thermal cycler that has a heated lid to prevent evaporation Perform 30 cycles at the following settings a Denaturation 93 C for 1 min b Annealing 55 65 C for 1 min adjust according to the calculated Tm of the primers see Note 1 c Extension 72 C for 5 min see Note 4 Link to a program of a 72 C for 2 min b 4 C soak Remove 10 uL of sample for analysis on a 1 2 agarose gel containi
255. ntains 50 of the entire coding sequence 12 Virtually all of the mutations 92 Hardy so far identified in BRCA2 are protein truncating 11 Thus like the APC gene translation terminating mutations in BRCA and BRCA2 are most easily iden tified by PTT In both cases exon 11 is amplified directly from genomic DNA in one 11 or three 9 10 overlapping segments for BRCA and in two to five overlapping segments for BRCA2 11 13 Exon 10 of the BRCA2 gene can also be amplified directly from genomic DNA as a single 1 2 kb segment 13 PTT for the other smaller exons is performed following nested RT PCR 9 11 12 In summary PTT is a simple rapid and cost effective method of screening large genes with a high frequency of mutations that result in premature termi nation of protein translation The following sections describe how to perform mutation analysis by PTT and consideration is given to some of the problems most often encountered when using this technique 2 Materials 2 1 PCR Amplification of Template for In Vitro Transcription and Translation 2 1 1 Reverse Transcription of RNA 1 Total cellular RNA prepared from the appropriate tissue see Note 1 2 Oligo d N primer 0 5 ug uL Promega Ltd Store at 20 C see Note 2 3 Diethyl pyrocarbonate DEPC treated distilled H2O Add 100 uL of DEPC to 100 mL of distilled H2O contained in a glass bottle Mix vigorously for 10 min and then leave at room temperature overn
256. ntarity The number of cycles required depends on the amount of template used for sequencing as well as the purity and sensitivity of autoradiographic detection In general when the amount of template is low more cycles should be used Most reactions can be carried out at the 50 C default annealing temperature Polymerization is optimal at 70 75 C except when using dITP which requires a maximum temperature between 55 C and 60 C Big Dye Terminators utilize dITP therefore the polymerization is carried out at 60 C The 0 8X glycerol tolerant buffer is recommended as it results in faster gel migration When using Big Dye Terminators there are two other methods recommended for purifying extension products using either 60 5 isopropanol or 60 3 ethanol These methods are described further in the ABI manual All three methods have been tested simultaneously and the described ethanol sodium acetate method was found to be the most efficient for purifying the extension products When exposed to air absolute ethanol absorbs moisture and becomes more dilute Also slight variations in concentration occur when ethanol is diluted to 95 These variations can result in increased residual dyes Use of a commercially prepared molecular biology grade 95 ethanol is therefore recommended to eliminate varia tions Alternatively 100 molecular grade ethanol can be diluted to 95 with molecular grade isopropanol 72 Surdhar
257. o be caused if the samples have not properly focused a problem that may require either optimization of the denaturing gradient conditions or primer design References 1 Fischer S G and Lerman L S 1983 DNA fragments differing by a single base pair substitution are separated in denaturing gradient gels correspondence with melting theory Proc Natl Acad Sci USA 80 1579 1583 Denaturing Gradient Gel Electrophoresis 135 2 10 11 12 13 Hovig E Smith Sorenson B Brogger A and A L 1991 Constant denatur ant gel electrophoresis a modification of denaturing gradient gel electrophoresis in mutation detection Mut Res 262 63 71 Borresen A L Hovig E Smith Sorenson B Malkin D Lystad S Andersen T I Nesland J M Isselbacher K J and Friend S H 1991 Constant denatur ant gel electrophoresis as a rapid screening technique for p53 mutations Proc Natl Acad Sci USA 88 8405 8409 Van Orsouw N J Vijg J 1999 Design and application of 2 D DGGE based gene mutational scanning tests Genet Analyt 14 205 213 Takahashi N Hiyami K Kodaira M and Satoh C 1990 An improved method for the detection of genetic variations in DNA with denaturing gradient electrophoresis Mut Res 234 61 70 Moyret C Theillet C Puig P L Moles J P Thomas G and Hamelin R 1994 Relative efficiency of denaturing gradient gel electrophoresis and sing
258. o check it The two images will be viewed in quick succession so that small changes can be easily seen Bioinformatics 207 4 URLs Cited Chromosomal location of genes http www ncbi nlm nih gov genemap Chromosomal location of completed human DNA sequences http www ncbi nlm nih gov genemap CINEMA http www biochem ucl ac uk bsm dbbrowser CINEMA2 1 Entrez NCBI http www ncbi nlm nih gov Entrez Flicker comparing two images http www Immb ncifcrf gov flicker Genes associated with human diseases http www3 ncbi nlm nih gov omim Genomes which have been or are being sequenced Human http www ornl gov TechResources Human Genome home html Mouse http www informatics jax org E coli http www genetics wisc edu Haemophilus influenzae http www tigr org tdb mdb hidb hidb htm1 Caenorhabditis elegans http www sanger ac uk Projects C elegans Arabidopsis thaliana http genome www stanford edu Arabidopsis Rice http www dna affre go jp 82 Yeast http genome www stanford edu Saccharomyces A list can be found at http www ncbi nlm nih gov Entrez Genome org html Human genome http www ornl gov TechResources Human Genome research html Human diseases which have been identified as being linked with particular genes This site can be accessed at the NCBI home page http www3 nebi nlm nih gov omim OWL http www biochem ucl ac uk bsm dbbrowser OWL OWL html PCR primers xprimer http alces med umn edu xprimeri
259. o the full length protein and any trun cated protein are often observed on the autoradiograph see Figs 1 and 2 These nonspecific proteins are usually weakly labeled and easily distinguishable from true truncated proteins These extra bands often arise from protein translation initiated from internal methionine codons and do not usually affect the overall result Occasionally these internally initiated proteins may be quite intensely labeled and may be wrongly identified as truncated proteins The addition of magnesium chloride to a final concentration of 1 5 mM in the in vitro transcrip tion translation reaction is reported to reduce nonspecific bands that result from initiation at internal methionine codons 6 Translation of mRNA transcripts from the reticulocyte lysate is another cause of nonspecific protein bands appear ing in all of the lanes of the gel including the no DNA control In the case of the PTT for the BRCAI gene the presence of nonspecific translated proteins has been shown to be both sequence dependent and to vary with the type of in vitro translation system being used 10 One of the PCR fragments tested was found to be more efficiently translated with fewer nonspecific protein bands when wheat germ extract was used compared with a rabbit reticulocyte based transla tion system 10 The inclusion of a myc reporter tag see Note 8 in the trans lated protein provides a means of eliminating these nonspecific protein
260. odeletions such as those found on chromosomes 7 15 and 22 in Williams Prader Willi and Di George syndromes respectively Single copy probes have also been widely used in recent years in the identification of gene rearrangements such as BCR ABL and PML RARA fusion in blood and bone marrow samples from patients with leukemia Chromosome libraries and subtelomeric probes have proved to be valuable in the characterization of complex and sometimes subtle chromosomal rearrangements in both constitutional and acquired genetic abnormalities Centromeric probes have been widely used to determine the chromosomal origin of small marker chromosomes that are unidentifiable by conventional Giemsa banding analysis These repetitive sequence probes are also of great value in determining the chromosome copy number in nondivid ing cells In recent years multi probe devices have been developed that allow simultaneous detection of all human telomeres or centromeres on a single microscope slide Over the past 10 years the basic FISH principle has been used to develop new molecular cytogenetic techniques including multicolor FISH M FISH 1 and comparative genomic hybridization CGH 2 M FISH allows each chromosome to be visualized in a different color enabling the rapid identifica tion of chromosome rearrangements whereas CGH allows a whole genome to be scanned for genetic imbalances in a single hybridization Both M FISH and CGH rely on sophisticated i
261. of the gel will affect its run time heat dissipation and the strength of the gel during the later handling stages Once the lugged glass plate has been siliconized and both plates cleaned with 70 ethanol the plates can be sealed using electrical tape Genetic Research Instrumentation Ltd code AFT UT to prevent leaking of the gel during casting Combs One millimeter castle combs Web Scientific special request are used to cast a CSGE gel with overall comb dimension width 280 mm depth 35 mm and thickness 10 mm Each comb has 40 teeth but it can be cut in half to give two equal sized combs of 20 teeth to use with standard sequencing sized plates The well dimensions are important to prevent overloading of the well Well dimen sions are 5 mm width 10 mm depth and 2 mm well separation 2 2 Casting the Gel SomnannFwWwndr 40 99 1 acrylamide BAP 20X TTE buffer Formamide Ethylene glycol Deionized water 10 Ammonium persulfate APS TEMED N N N N tetramethylethylenediamine Sealed glass plates 1 mm thick spacers and comb Bulldog clips 50 mL syringe with a 21 gauge needle 144 Williams and Goodeve 2 3 Loading and Running the Gel 1 One precast CSGE gel prepared as in Subheading 3 1 2 One gel running rig 3 One power pack range 100 1000 V 4 2L of 0 5X TTE buffer dependent on capacity of gel running rig reservoir 5 Glycerol loading buffer 6 Heteroduplexed D
262. of a suitably labeled DNA probe 1 Labeled nucle otides radioactive or fluorescent can be incorporated efficiently into double stranded DNA by a number of methods One of the most common is by a process termed nick translation Nick translation works by using DNase and DNA polymerase I enzymes DNase cuts one strand of the DNA exposing 5 phosphoryl and 3 hydroxyl OH termini Polymerase I adds dNTPs includ ing labeled dNTPs to the exposed 3 OH strand and at the same time the polymerase exonuclease activity digests from the exposed 5 end In this way a new complementary strand including labeled dNTPs is produced 2 It is also possible to incorporate radioactive nucleotides into a DNA using a enzy matic primer extension technique usually termed random primer labeling 3 In this method random hexanucleotides are annealed to denatured DNA to be used as the probe These are used as a primer for enzymatic extension in the presence of the four deoxyribonucleotides one of which is radiolabeled Alter native probes may be prepared where the label occurs on one of the termini of the DNA either the 3 or the 5 end The protocol for this type of labeling is found in Chapter 3 2 Materials see Note 1 2 1 Nick Translation of DNA 1 10X Nick translation buffer 0 5 M Tris HCl pH 7 5 0 1 M MgSO 1 mM dithiothreitol 500 mg mL bovine serum albumin optional 2 DNase I 10 ng mL 3 DNA polymerase I 0 5 U uL From Methods
263. of the Taq DNA polymerase and reducing the time in which misannealing of primers can occur The volumes given here for performing the in vitro transcription translation are actually one quarter of those recommended in the TnT Quick kit protocol Between 0 25 and 1 uL S methionine can be added to the reaction For tem plates that translate well the minimum volume of S methionine can be used For templates that contain few methionine residues or translate less efficiently the volume may be increased If it is necessary to use more than 2 uL of PCR product the volumes of reaction components can be scaled up Incubation at 22 C for 90 min has been reported to improve the efficiency of transcription and translation in PTT analysis of the BRCA BRCA2 NF 1 and APC genes using the Promega TnT T7 coupled reticulocyte lysate system 24 106 Hardy 16 17 A 12 SDS PAGE gel is suitable for separating proteins in the range of approx 14 100 kDa The volumes of reagents given in this method to prepare a 12 SDS PAGE gel are adapted from Sambrook et al 25 which also gives the vol umes of reagents required to prepare gels of 6 8 10 and 15 concentra tion Separating the translation products on several gels of different percentages e g 8 10 and 14 gels 21 can increase the likelihood of detecting the larger and smaller truncated proteins The use of 5 18 gradient SDS PAGE has been reported to give better resolution fo
264. of the first round PCR into a fresh 0 5 mL microtube Store the remainder of the first round PCR product at 20 C Add 2 5 uL 10X Taq extender reaction buffer 2 5 uL of 2mM dNTPs 20 pmol of 5 modified forward primer 20 pmol reverse primer and sterile H O to bring the total volume to 24 uL Mix well and overlay the reaction with or 2 drops of mineral oil 7 Perform hot start PCR Add 1 U Taq DNA polymerase and 1 U Taq extender additive Perform 30 35 rounds of amplification consisting of dena turing at 94 C for 1 min annealing at 50O 65 C for 1 min extension at 72 C for 2 min see Note 13 End the program with a final extension step of 72 C for 10 min Protein Truncation Test 97 8 Check the specificity and yield of the amplification by agarose gel electrophore sis see Subheading 3 2 3 1 3 PCR Amplification of Genomic DNA 1 Place 100 500 ng of genomic DNA in a 0 5 mL microtube Add 2 5 uL of 10X PCR buffer 2 5 uL of 2 mM dNTPs 0 75 uL of 50 mM MgCl see Note 11 20 pmol 5 modified forward primer 20 pmol reverse primer and sterile HO to bring the total volume to 24 uL Mix well and overlay the reaction with 1 or 2 drops of mineral oil 2 Perform hot start PCR Add 1 U Taq DNA polymerase Perform 30 35 rounds of amplification consisting of denaturing at 94 C for 1 min annealing at 50 65 C for 1 min extension at 72 C for 2 min see Note 13 End the program with a final extension step
265. ols edited by Clare Wise 2002 PCR Mutation Detection Protocols edited by Bimal D M Theophilus and Ralph Rapley 2002 186 185 184 183 180 179 17 oo 177 176 TIS 17 A 173 171 170 169 168 167 166 165 164 163 162 161 160 159 15 oo 157 Oxidative Stress Biomarkers and Antioxidant Protocols ed ited by Donald Armstrong 2002 Embryonic Stem Cells Methods and Protocols edited by Kursad Turksen 2002 Biostatistical Methods edited by Stephen W Looney 2002 Green Fluorescent Protein Applications and Protocols edited by Barry W Hicks 2002 In Vitro Mutagenesis Protocols 2nd ed edited by Jeff Braman 2002 Genomic Imprinting Methods and Protocols edited by Andrew Ward 2002 Transgenesis Techniques 2nd ed Principles and Protocols edited by Alan R Clarke 2002 Gene Probes Principles and Protocols edited by Marilena Aquino de Muro and Ralph Rapley 2002 Antibody Phage Display Methods and Protocols edited by Philippa M O Brien and Robert Aitken 2001 Two Hybrid Systems Methods and Protocols edited by Paul N MacDonald 2001 Steroid Receptor Methods Protocols and Assays edited by Benjamin A Lieberman 2001 Genomics Protocols edited by Michael P Starkey and Ramnath Elaswarapu 2001 Epstein Barr Virus Protocols edited by Joanna B Wilson and Gerhard H W May 2001 Calcium Binding Protein Proto
266. omb and straighten any uneven wells using an old gel loading tip 11 Place the gel in the electrophoresis apparatus and firmly tighten the four locking nuts Close the drain tap for the upper buffer chamber and fill the upper buffer chamber with 1X TBE Check for leaks by leaving the gel for 10 min and inspect ing the lower buffer chamber 12 Fill the lower buffer chamber with 1X TBE and leave the whole apparatus to equilibrate for at least 4 h at 4 C see Notes 4 and 7 13 Combine the PCR amplification with an equal volume of formamide loading buffer typically 10 uL and mix well see Notes 8 10 14 Place the samples on a heated block or thermal cycler set at 94 C for 3 min then snap chill in a bath of crushed ice 15 Load between 6 and 12 uL of each sample the optimum volumes depend on the size of well and amplification efficiency in each well using flat gel loading tips SSCP Heteroduplex Analysis 155 A acrylamide binder clips foam block syringe B glass plates foam block imm spacer Fig 1 Assembly of glass plates for S2 SA32 sequencing system and pouring with out tape A view from above to illustrate the pouring of the gel on a horizontal bench using a syringe B profile view to illustrate the position of the foam block against the short upper plate which forms a watertight seal against the gel tank gasket 16 Electrophorese for typically 16 h at a constant voltage of 370 V for SA32 gel or 450 V for
267. on Protocols Edited by Bimal D M Theophilus Department of Haematology Birmingham Children s Hospital NHS Trust Birmingham UK and Ralph Rapley Department of Biosciences University of Hertfordshire Hatfield UK A m Humana Press A Totowa New Jersey 2002 Humana Press Inc 999 Riverview Drive Suite 208 Totowa New Jersey 07512 www humanapress com All rights reserved No part of this book may be reproduced stored in a retrieval system or transmitted in any form or by any means electronic mechanical photocopying microfilming recording or otherwise without written permission from the Publisher Methods in Molecular Biology is a trademark of The Humana Press Inc The content and opinions expressed in this book are the sole work of the authors and editors who have warranted due diligence in the creation and issuance of their work The publisher editors and authors are not responsible for errors or omissions or for any consequences arising from the information or opinions presented in this book and make no warranty express or implied with respect to its contents This publication is printed on acid free paper ANSI Z39 48 1984 American Standards Institute Permanence of Paper for Printed Library Materials Production Editor Jessica Jannicelli Cover design by Patricia F Cleary For additional copies pricing for bulk purchases and or information about other Humana titles contact Humana at the
268. on kit Gentra Systems are all reliable methods of extracting DNA suitable for PCR amplification prior to PTT 7 The TnT T7 Quick coupled transcription translation system is recommended because it is very straightforward to use The TnT T7 Quick master mix contains all the components required for in vitro transcription translation hence few pipetting steps are involved One limitation of the TnT T7 Quick kit is that it can only be used in conjunction with T7 promoters and S methionine is the only labeled amino acid that can be used If it is necessary to use a different radiolabeled amino acid the TnT T7 coupled reticulocyte lysate or wheat germ extract tran scription translation systems may be used Promega Ltd These are supplied with three separate amino acid mixtures one for use with S methionine one for gt S cysteine and one for H leucine These systems are also available with dif ferent RNA polymerases to allow the use of T7 T3 or SP6 promoters 8 The choice of radiolabeled amino acid for detection of the translation products should be determined from the amino acid composition of the gene product under investigation Ideally the labeled amino acid should occur frequently within the protein particularly near the start of each translated segment Truncating muta tions near the start of each segment will not be identified if they do not contain 104 Hardy any labeled amino acid and this should be taken
269. on with suitable restriction enzymes see Chapter 5 To facilitate the transfer of larger DNA fragments the immobilized DNA contained within the gel matrix is partially cleaved by depurination with HCl Subsequent soaking of the gel in NaOH denatures the double stranded DNA to produce single strands which may be probed with an appropriately labeled single stranded DNA fragment 2 Traditionally the DNA is transferred to a nitrocellulose filter although now the membrane is usually constructed of nylon Nylon has an improved capacity for DNA binding and is more robust allowing reprobing to be undertaken The simplest and least expensive method of transfer utilizes capillary action to draw liquid through the gel matrix transferring the nucleic acid fragments onto the nylon membrane The nylon bound immobilized DNA fragments provide an exact representation of their original location following agarose gel electro phoresis Alternative methods of transfer such as vacuum blotting or electroblotting may provide a more efficient method of transfer and reduce blotting time but they are generally more expensive Following transfer the DNA is covalently crosslinked to the nylon membrane by exposure to ultravio let irradiation after which the blot may be stored or probed From Methods in Molecular Biology vol 187 PCR Mutation Detection Protocols Edited by B D M Theophilus and R Rapley Humana Press Inc Totowa NJ 23 24 Rapley and W
270. onomer concentration acrylamide and Bis in grams 100 mL and C being the percentage by weight of total monomer T that is contributed by the crosslinker Bis The pore size of the gel can be altered in an easy and controllable fashion by changing the con centrations of the two monomers The polymerization proceeds by a free radi 4 Guilliatt Table 2 Range of Separation of Linear DNA Molecules in Agarose and Polyacrylamide Gels and the Position of Migration of Bromophenol Blue and Xylene Cyanol Agarose gel concentration Effective range Xylene cyanol Bromophenol blue w v of resolution bp migration bp migration bp 0 5 1 5 1000 3000 4000 5000 400 500 Acrylamide gel concentration w v 3 5 1000 2000 460 100 5 0 80 500 260 65 8 0 60 400 160 45 12 0 40 200 70 20 15 0 25 150 60 15 20 0 6 100 45 12 cal mechanism and the most common method of initiation is with ammonium persulfate which produces oxygen free radicals by a base catalyzed mechanism typically tertiary aliphatic amines such as N N N N tetramethylethylene diamine TEMED see Note 5 The length of the chains is determined by the concentration of the acrylamide in the polymerization reaction between 3 5 and 20 One molecule of crosslinker is included for every 29 monomers of acrylamide The effective range of separation in nondenaturing gels containing different concentrations of acrylamide is shown in Table 2 Polyacrylamide gels are u
271. onstituents of the reaction altering the magnesium 0 5 5 mM deoxynucleotide triphospates dNTPs 50 200 uM ASO primer concentration DNA template and Taq polymerase concentration 1 8 and increasing the annealing temperature this may be overcome A good indication of the correct annealing temperature is the melting template of the oligonucleotide primers This can calculated using the formula 64 9 0 41 C G 600 n The addition of specificity enhancers such as DMSO 10 9 may also increase the specificity However it may be necessary to redesign the primers altering the 3 mismatches Amplification of a control DNA template with known point mutations will aid the establishment of the ASO PCR By including an internal control reaction such as B globin amplification the risk of false negatives will be reduced References 1 Saiki R K Scharf S Faloona F Mullis K B Horn G T Erlich H A et al 1985 Enzymatic amplification of B globin genomic sequences and restriction site analysis for diagnosis of sickle cell anaemia Science 230 1350 1354 Newton C R Graham A Heptinsall L E Powell S J Kalsheker K Smith J C et al 1989 Analysis of point mutation in DNA The amplification refrac tory mutation system ARMS Nucl Acids Res 17 2503 2516 Newton C R Summers C Schwarz M Graham A Heptinstall LE Super M et al 1989 Amplification refractory mut
272. ontaining MgCl which is necessary for the polymerase to work From Methods in Molecular Biology vol 187 PCR Mutation Detection Protocols Edited by B D M Theophilus and R Rapley Humana Press Inc Totowa NJ 37 38 Jones 94 C TiC 1 fi j F j Denuturation arma F s5 65C r Frimer Anmeling TETY oI me Tek a l j e TT oe tis men abt TFE Amplification of Nucleic Material Fig 1 Basic steps in the PCR cycle Hatched lines indicate target DNA Filled boxes represent annealed primers See text for further details efficiently the thermostable Tag polymerase and each of the four deoxynucle otide triphosphates dNTPs Also present are a pair of primers whose sequences are complementary to that of the DNA flanking the target region Numerous parameters must be taken into consideration when designing the primers see Note 1 The reaction mixture is first heated to denature the double stranded DNA into single strands then cooled to an optimum temperature to facilitate primer annealing The primer pair consists of a forward sense primer that binds to its complementary sequence upstream of the region to be amplified and a reverse antisense primer that binds downstream both with their 3 ends facing inward During primer extension the DNA polymerase progressively adds dNTP s complementary to the target to the 3 end of each primer so that the target sequence is copied The 5 ends o
273. or 15 min followed by two further washes in dH O Silver staining can then be recommenced with solution 1 How ever prevention is better than cure the most common causes of this are dirty staining trays and contact with gloves that have been used to prepare solution 3 Always wash trays thoroughly before use and change gloves after preparing solution 3 if you need to subsequently pour off solution 2 Sometimes we have observed gels with bands that fade and disappear while dry ing down this is due to solution 4 being made up incorrectly 162 Wallace 14 15 16 17 It is not possible to isolate and reamplify from silver stained bands with the given protocol because of the inhibitory effect of residual silver ions on PCR How ever if solution 4 is substituted for a 50 mM solution of EDTA pH 8 0 then this chelates the remaining silver ions and permits reamplification from the band of interest We have found this to be particularly useful for isolating minority alle les in mosaic samples Silver stained gels can be temporarily stored by heat sealing in plastic However the gels are delicate and easily crushed and tend to dry out after 2 3 yr High percentage acrylamide gels i e over 9 are prone to cracking while dry ing down Try to dry these slowly at room temperature rather than in an incuba tor as this minimizes cracking Sometimes a salty deposit builds up on the surface of old gels making them difficult to read
274. ossibility is to construct a standard curve by mixing the two sequences in known ratios and plotting the obtained cpm val ues as a function of the ratios to obtain a linear standard curve 5 6 The test results can then be interpreted from the standard curve without the need to take the specific activities of the number of PH dNTPs incorporated into account References 1 Syv nen A C Aalto Set l K Harju L Kontula K and S derlund H 1990 A primer guided nucleotide incorporation assay in the genotyping of apolipoprotein E Genomics 8 684 692 Syv nen A C 1999 From gels to chips minisequencing primer extension for analysis of point mutations and single nucleotide polymorphisms Hum Mutat 13 1 10 Solid Phase Minisequencing 63 3 10 Li 12 Syv nen A C Sajantila A and Lukka M 1993 Identification of individuals by analysis of biallelic DNA markers using PCR and solid phase minisequencing Am J Hum Genet 52 46 59 Syv nen A C S derlund H Laaksonen E Bengtstr m M Turunen M and Palotie A 1992 N ras gene mutations in acute myeloid leukemia accurate detection by solid phase minisequencing Int J Cancer 50 713 718 Suomalainen A Kollmann P Octave J N S derlund H and Syv nen A C 1993 Quantification of mitochondrial DNA carrying the tRNAg3445 point mutation in myoclonus epilepsy and ragged red fiber disease Eur J Hum
275. ote 4 Some examples of 5 extension sequences are shown in Table 1 Primers stock solutions are 200 pmol uL in TE buffer 10 mM Tris HCL 1 mM Na EDTA pH 8 0 store at 20 C Working solutions are 20 pmol L in sterile dH O Store at 20 C Sterile dH O Taq Extender PCR additive 5 U uL see Note 3 Stratagene Ltd Cambridge UK Store at 20 C Taq DNA polymerase see Note 5 5 U uL Invitrogen Life Technologies Ltd Store at 20 C 50 mM MgCl Invitrogen Life Technologies Ltd Store at 20 C Mineral oil Sigma Chemical Company Store at room temperature 2 1 3 PCR Amplification of Genomic DNA ra STO 2 2 1X TBE buffer 89 mM Tris borate 89 mM boric acid 2 mM EDTA Prepare a Genomic DNA see Note 6 10X PCR buffer minus magnesium see Note 5 200 mM Tris HCl pH 8 4 500 mM KCI Invitrogen Life Technologies Ltd Store at 20 C T7 modified forward primer and reverse primer pairs Stock solutions are 200 pmol uL in TE buffer store at 20 C Working solutions are 20 pmol L in sterile dH O Store at 20 C 2 mM dNTP mix see Subheading 2 1 2 50 mM MgCl Invitrogen Life Technologies Ltd Store at 20 C Taq DNA polymerase 5 U uL Invitrogen Life Technologies Ltd Store at 20 C Mineral oil Sigma Chemical Company Store at room temperature Agarose Gel Electrophoresis 10X stock solution by dissolving 108 g Trizma base 55 g boric acid and 9 3
276. oth strands using this approach Single end labeling i e of the sense or the antisense strand permits some degree of localization of the base change s corresponding to the observed pattern changes 3 The sensitiv ity of the CFLP method is approx 90 for single stranded analysis and gt 95 for two strand analysis While double end labeling precludes this localization it affords more sensitive mutational analysis 2 It has been determined empirically that samples analyzed according to the ramp ing procedure require approximately twofold more DNA than do those analyzed by the conventional method This is likely because in the ramping procedure digestion occurs throughout the course of the temperature increase and optimally cleaves different hairpins at different temperatures 3 The choice of dyes used in the stop solution depends on the system used to visu alize the CFLP patterns If chemiluminescence detection is used then the stop 176 Heisler and Lee solution should include 0 05 bromophenol blue and 0 05 xylene cyanol Sub heading 2 2 item 6 If fluorescent scanning is used then a dye that migrates with opposite polarity such as crystal violet 0 05 is preferable because dyes that migrate into the gel fluoresce at the wavelengths used to detect the fluores cent dyes thereby obscuring a portion of the CFLP pattern Note that when a dye with opposite polarity is used it is advisable to load 3 5 uL of stop solution cont
277. oughly with isopropanol see Note 7 and fill with 0 2 mL cm of 1X blocking buffer e g 100 mL for a 20 x 20 cm membrane 8 Transfer the membrane to the dish containing the blocking buffer and allow to rock gently for 15 min 9 Repeat the 15 min wash with fresh blocking buffer and discard the buffer 10 Add 2 uL of Streptavidin Alkaline Phosphatase Conjugate to 50 mL of fresh block ing buffer or add conjugate to the blocking buffer at a volume ratio of 1 4000 11 Pour the conjugate blocking buffer mixture onto the blocked membrane and rock gently for 15 min 12 Remove the conjugate and rinse for 5 min with 0 1 SDS 1X SAAP buffer 0 5 mL cm each 200 mL for a 20 x 20 cm membrane Repeat twice for a total of three washes 13 Remove the SDS and rinse 5 min with 0 5 mL cm 1 mM MgCl 1X SAAP buffer Repeat twice for a total of three washes 14 Place the membrane in a sealable bag and add 4 mL of CDP Star or 0 01 mL cm 15 Seal the bag and spread the CDP Star gently over the membrane for 3 5 min 16 Completely remove the CDP Star and any air bubbles Transfer the membrane while still in the bag to a film exposure cassette 17 Inthe darkroom expose the membrane to X ray film Initially expose for 30 min For subsequent exposures adjust the time for clarity and intensity see Note 8 18 Develop the film 4 Notes 1 Depending on the objective of the analysis in question the DNA can be labeled on either strand or on b
278. performing PTT are relatively straightforward and begin with the isolation of genomic DNA or RNA The polymerase chain reaction PCR is used to amplify a DNA template usually of 1 3 kb in size that is tested in an in vitro transcription and translation assay Truncated proteins are identified by sodium dodecyl sulfate polyacrylamide gel electrophoresis SDS PAGE and autoradiography or fluorography A single large exon of a gene can be amplified directly from genomic DNA in several overlapping fragments The complete coding sequence of a large gene with many small exons can be amplified in several overlapping fragments by reverse transcription PCR RT PCR starting from RNA Amplifying the gene in several segments that overlap each other by 300 500 bp increases the sensi tivity of PTT A truncating mutation located toward the 3 end of one segment will also occur near the 5 end of the next overlapping segment thus increasing the likelihood of identifying a truncated protein A specially modified forward PCR primer is required for PTT In addition to the in frame gene specific primer sequence an extension at the 5 end includes the T7 promoter sequence for RNA transcription by T7 RNA polymerase the eukaryotic consensus sequence for the initiation of protein translation and the ATG protein transla tion start site The yield and specificity of the PCR amplification is checked by agarose gel electrophoresis Then an aliquot of the PCR product i
279. pillary electrophoresis 160 Capillary transfer see Southern blotting Chemical cleavage of mismatch CCM 109 Chemiluminescence detection 174 Chromosome paint 73 CINEMA 203 Cleavase fragment length polymorphism CFLP 165 Clustal analysis 120 202 Competitive in situ suppression 86 Complementary DNA cDNA 40 Conformation sensitive gel electrophoresis CSGE 137 Counter staining 82 Cycle sequencing see Sequencing Cystic fibrosis 152 157 158 159 D DAPI 78 Databases genetic 194 Denaturing gradient gel electrophoresis DGGE 109 125 preparation of 130 gel staining of 132 Denaturing high performance liquid chromatography 110 Dideoxy fingerprinting 165 Digoxygenin 19 Dimethylsulfoxide 44 Dithiothreitol DTT 41 DNA affinity capture 60 end labeling 17 170 extragenic 29 GC content 44 49 62 hairpin structures 44 internal labeling 13 intragenic 29 interphase 73 isolation 115 melting temparature Tm 44 126 128 metaphase 73 209 210 mitochondrial 51 58 misincorporation 51 PCR of see Polymerase chain reaction paraffin embedded 37 probes see Probes random primer labeling 13 restriction of 31 size standards 6 staining 8 visualization 8 DNA polymerase I 13 Duchenne muscular dystrophy DMD 88 DYEnamic dyes 66 Dynabeads 61 E EMBnet 208 Ethidium bromide 1 42 147 Exonuclease I 71 170 Expressed sequence tag EST 196 F Factor VIII de
280. r in some cases the complete absence of the mutant mRNA 21 Similarly Whittock et al 6 postulated that the instability of mutant mRNA resulted in the failure to identify a characterized truncating mutation in an obligate female DMD carrier In contrast Lui et al identified truncating mutations in the hMSH2 gene by PTT even though the mutant mRNA transcripts were shown to be less abun dant than the normal transcript because of nonsense mediated mRNA instability 15 Samples that show no evidence of a translation terminating mutation by 102 Hardy PTT should be investigated by another mutation detection method such as SSCP or denaturing gradient gel electrophoresis DGGE to exclude the possibility of a false negative result and to investigate the pathogenic role of missense mutations 4 Notes 1 Total cellular RNA can be isolated using a variety of well established methods and a number of kits can be purchased for this purpose The RNeasy total RNA kit Qiagen Ltd is reliable and very easy to use Using the spin columns sup plied with the kit RNA can be rapidly isolated from a wide variety of tissues with minimum preparation and without the use of organic solvents The TRIzol reagent Invitrogen Life Technologies Ltd offers another reliable method for isolating RNA Whatever method is chosen to prepare RNA the integrity and yield should be assessed by agarose gel electrophoresis see Chapter 1 2 Oligo d T primer 23 or
281. r a broad size range of truncated proteins 11 The signal strength may be increased by treatment of the gel with Amplify fluorographic enhancement reagent Amersham Life Science for 20 30 min after the gel has been fixed The gel is then rinsed in distilled water and dried under vacuum Fluorography is performed with intensifying screens overnight at 70 C Some loss in resolution may be observed following fluorographic enhance ment Fluorographic enhancement is unnecessary if a strong signal can be obtained by autoradiography Acknowledgments I would like to thank all my colleagues for many helpful discussions on PTT in particular Dr David Bourn for his advice and comments during prepa ration of the manuscript and Kim Hampson for providing the BRCA autorad and information used in the preparation of Fig 1 I would also like to thank Professor Georgia Chenevix Trench and Dr Sue Shanley of the Queensland Institute of Medical Research Brisbane Australia for the primer sequences used for PTT of the PTCH gene illustrated in Fig 2 References 1 Roest P A M Roberts R G Sugino S van Ommen G J B and den Dunnen J T 1993 Protein truncation test PTT for rapid detection of translation termi nating mutations Hum Mol Genet 2 1719 1721 Powell S M Petersen G M Krush A J Booker S Jen J Giardiello F M et al 1993 Molecular diagnosis of familial adenomatous polyposis N Engl J
282. r and water see Table 2 Mix thoroughly by gentle inversion and pipet 18 uL into PCR tubes Overlay with 1 drop of mineral oil see Note 3 Prepare a separate mix of dNTPs and combined Taq and proofreader see Table 3 Pipet into the PCR tubes immediately following a hot start procedure After the initial long denaturing step of the cycle the temperature of the PCR heating block should be held at 80 C 54 Davies and Gray Table 3 Reaction Mix 2 Reaction reactant Volume uL Final concentration dNTPs Mix 5 mmol L of each nucleotide 25 500 umol L DNA polymerase plus proofreader 0 2 0 7 0 028 0 098 U uL Sterile pharmacy water As required to 3 uL final volume Final concentration refers to the concentration in the mix after adding Reaction Mix 2 while 3 uL of the DNA polymerase mix is added to each tube After addition of the enzyme the thermal cycler should proceed to the amplification part of the program 3 3 Thermocycling Conditions The optimal annealing temperature will vary with the primers used and is dependent on their Tm see Chapter 6 The following cycle conditions give an indication of the time intervals for which temperatures should be maintained Initial denaturation 92 C 2 min Hold hot start 80 C 10 min Cycle 1 Denature 92 C 50s Anneal and extend 68 C 10 min Cycles 2 30 Denature 92 C 10s Anneal and extend 68 C 10 min plus 30 s per cycle see Note 4 3 4 Analysis of PCR Products Th
283. r dideoxy nucleotide sequencing method has been simplified by a number of methodological improvements such as the use of the polymerase chain reaction PCR technique for generating DNA templates in sufficient quantities for sequencing the use of affinity capture techniques for convenient and efficient purification of the PCR fragments for sequencing the develop ment of laboratory robots for carrying out the sequencing reactions and the development of instruments for automatic on line analysis of fluorescent products of the sequencing reactions Despite these technical improvements the requirement for gel electrophoretic separation remains an obstacle when sequence analysis of large numbers of samples are needed as in DNA diagnosis or in the analysis of sequence variation for genetic evolutionary or epidemiological studies We have developed a method for analysis of DNA fragments differing from each other in one or a few nucleotide positions J denoted as solid phase minisequencing in which gel electrophoretic separation is avoided Analogous to the methods for solid phase sequencing of PCR products the solid phase minisequencing method is based on PCR amplification using one biotinylated and one unbiotinylated primer followed by affinity capture of the biotinylated PCR product on an avidin or streptavidin coated solid support The nucleotide at the variable site is detected in the immobilized DNA fragment by a primer extension reaction A
284. r of primers that lie inter nal to the first This technique is designed to increase the sensitivity of the PCR reaction and is particularly useful for the amplification of small quantities of target material from readily accessible cell types expressing very low levels of mRNA For example Factor VII mRNA present at a quantity of 1 molecule per 500 1000 cells can be amplified in this manner from the lymphocytes of hemo philia A patients 2 Multiplex PCR More than one target sequence can be amplified in a single PCR reaction by using multiple primer pairs Multiplex PCR has been utilized in the analysis of deletions mutations and polymorphisms as well as in RT PCR and quantitative assays 3 A specific application of multiplex PCR is in deletion screening of the dystrophin gene in patients with Duchenne muscular dystrophy Long range PCR It is possible to amplify long fragments of DNA gt 20 kb using an enzyme mixture of Tag and Pwo DNA polymerases High yields of PCR prod ucts from episomal and genomic DNA can be obtained from this powerful poly merase mixture An example of its application is in the routine diagnosis of Fragile X syndrome The mutation in Fragile X syndrome involves the expansion of CGG repeats in the FMR1 gene These repeats are resistant to amplification by ordinary PCR methods possibly because of the stopping or pausing of the Taq polymerase enzyme during the amplification of regions containing high levels of
285. r this reason people have been isolating the mRNAs expressed in cells converting them to DNA cDNA cloning and sequencing them in their thousands These expressed sequences cDNAs define those proteins made by a cell and are given the jargon name Expressed Sequence Tag EST As the sequencing of the human genome progresses the functions of more and more DNA protein sequences are identified It is now routine to generate many ESTs which are then sequenced and translated into proteins that can be compared with the protein databases to determine their function You will find a number of such protein sequences derived from ESTs in Table 3 Compare these against the protein databanks using Basic Local Alignment Search Tool BLAST to find out what they code for 1 Choose a sequence to use this can be an in house sequence or one of those pro vided in Table 3 2 Copy the sequence to your clipboard 3 Now click on Basic BLAST SEARCH at http www ncbi nlm nih gov BLAST to load a page containing the search form 4 Paste the copy on the clipboard into the search window 202 Brzeski Table 3 Number Sequence GDAAKNQLTSNPENTVFDAKRLI EKASGKKIPYKVVARREGDVAACY KLGKSFEMLILGRFIIGVYCGL KGRTFDEIASGFRQGGASQSDKTPEELFHP DDERNGWPVEQVWKEMHKLLPFSPDSVV WRIFTPLLHQIELEKPKPIPYIYGSRG PGAPGGGGGMYPPLIPTRVPTPSNGAPEIP AVFYYSTSIFEKAGVQQPVYATIG eAYADUNHPWNYN eK 5 Click in the Program drop down list box which at present says blastn blast nuclei
286. rd 2 Open your Web browser and go to http www ncbi nlm nih gov BLAST Click on Basic BLAST Search to load a page containing the search form Paste the copy on the clipboard into the search window Use the default conditions for the search i e blastn 5 Press the Search button and wait while the sequence is compared to the data bases and the matches displayed There is now a formal queuing system at NCBI and you will wait for your results as explained on the page aS The Washington University Merck collaboration for EST sequencing http genome wustl edu est esthmpg html generates a large amount of sequencing information and pictures of every sequencing gel are available at this site The Washington University Medical School Genome Sequencing Centre http genome wustl edu gsc index shtml is also involved in sequencing the human genome and information can be found here 2 2 1 Interpreting the Results The results from the NCBI BLAST server are presented both graphically and textually The graphical view shows the query sequence as a thick red line with base numbers attached to it Below this are a series of thin lines which repre sent matches to the query sequence The length of the line indicates that part of Bioinformatics 197 Table 1 Number Sequence GGAAAGAAATGCATAAGCTTTTGCCATTC TCACCGGATTCAGTCGTCACTCATGGTGATT TCTCACTTGATAACCTTATTTTTGACGAGG GGAAATTAATAGGTTGTATTGATGTTGGAC GAGTCGGAATCGCAGACCGATACCAGGATC
287. re frequently than STRs and offer superior potential for automated assays 1 2 Demand for Industrial Genomics 1 2 1 Genetics The efforts of many researchers are dedicated to the exploration of the genetic bases of complex inherited diseases or disease predispositions Studies are performed to identify candidate or target genes that may confer a predispo sition for a certain disease 8 Linkage analysis can be done as a genome wide screening of families association or linkage disequilibrium analysis can be done with populations Either approach can use STR or SNP markers Once a poten tial candidate gene is discovered a particular set of markers is compared between affected and unaffected individuals to try to identify functional allelic variations To understand the genotype to phenotype correlation of complex diseases several hundred markers need to be compared among several hundred individuals 9 10 To get an impression of the complexity of the data produced in such projects imagine a certain multifactorial disease in which predisposi tion is linked to e g 12 genes Consider that each of those 12 genes can be present in just two different alleles The resulting number of possible genotypes 2 homozygotes and 1 heterozygote 3 for each gene is 3 531 441 The whole process of drug development including hunting for new target genes and especially the subsequent validation significant link to a certain disease will benefit from h
288. reas the dsDNA heteroduplexes usually stain a dark gray or black color 3 Ahomozygote will typically give rise to two distinct SSCP bands corresponding to the two complementary strands of DNA Quite often more than two SSCP bands are present some of which stain more weakly than the others Assuming that the PCR is optimized and that no background amplification has taken place the subsidiary bands are the result of alternative stable conformations 158 Wallace Caw SSCPs t 9 daia a a ia 5 ihi HDs Mias baaa re Fig 3 SSCP heteroduplex analysis of CFTR exon 23 223 bp Lanes 1 7 are test samples lanes 8 and 9 are control heterozygotes for the mutations Q1412X nt4366c t and 4279insA respectively Note how lane 3 clearly has a mobility shift different from the two controls Direct sequencing revealed that this sample was heterozygous for the 4326ATC mutation Also note how Q1412X gives rise only to a SSCP shift 4 Occasionally a fragment only gives rise to a single SSCP band this is due to both complementary strands having identical mobilities and generally does not lead to loss of sensitivity 5 Rarely there is no distinct SSCP band present for a given fragment Closer inspec tion of the gel usually reveals the presence of a faint in track smear This appears to be caused by the fragment adopting a whole range of conformations each having only a slight mobility difference from the next The presence of a mutation
289. reduces the size of the nylon mem brane required to cover the gel The depurination step partially cleaves large DNA fragments within the gel matrix The smaller DNA fragments are transferred more efficiently during the blotting procedure When the xylene cyanol loading dye changes color to a greenish color or the bromophenol blue turns yellow the depurination buffer can be removed Alternatively this step can be achieved by exposing the gel to UV light 302 nm for 30 s to cleave high molecular weight DNA The blotting apparatus can be set up during the 30 min incubation periods in steps 6 9 The width of the 3MM paper wick is cut to accommodate the width or length of each agarose gel The gel platform can vary in size to accommodate different gel sizes Avoid touching the surface of the nylon membrane as any dirt or grease may affect the result Hold the membrane at the edges and wear gloves A small portion of the corner can be cut off for orientation Air bubbles trapped between the gel and nylon membrane sandwich will affect DNA transfer A glass plate can be placed on top of the stack in order to distribute the weight evenly allowing a more even transfer of DNA It is necessary to cover the blot ting apparatus with cling film to avoid evaporation of transfer buffer With the completed setup ensure that only the gel is in contact with the wick To ensure correct and only vertical transfer of DNA fragments f
290. rimer sets will thus be intronic and should include for the purpose of CSGE an additional 80 100 bp at either end of each exon Larger exons can be split into smaller PCR frag ments with an overlap of 80 100 bp for each fragment 1 6 2 PCR Conditions Polymerase chain reaction optimization for mutation screening enhances the quality of CSGE results and reduces PCR product purification steps for subse quent DNA sequencing Following PCR amplification samples are electro phoresed on 5 polyacrylamide bis see Note 1 minigels to assess DNA purity and concentration A single strong PCR product is ideal for CSGE and sequence analysis Polyacrylamide gel electrophoresis will also provide information relating to the volume of sample to be loaded onto the CSGE gel If the sample is too concentrated a smaller volume can be loaded or even diluted in water to maintain the loading volume An increased volume can also be loaded if the DNA concentration is too low see Note 2 In some situations we have found that the components of the PCR reactions can affect the DNA sample when loaded onto the CSGE gel In these cases smearing of the sample has occurred and instead of a single band the sample resembles a long streak blending into the DNA front masking any indication of heteroduplex band separation This smearing can be easily eliminated by changing PCR buffer components or buffer manufacturer In our laboratory Bioline Tag polymerase is used w
291. rimers added to the first round of amplification To establish the optimal MgCl concentration for specific amplification it is necessary to perform a MgCl titration The efficiency of amplification by Tag DNA polymerase and the com position of 10X reaction buffer from different suppliers may vary In establishing optimal amplification conditions it may be useful to try different types of Taq DNA polymerases and buffers to see which gives the best result Amplification of templates with a strong secondary structure can sometimes be improved by the addition of dimethyl sulfoxide to a final concentration of 5 10 Performing hot start PCR reduces mispriming and thus increases the specific ity of the amplification The melting temperature of the PCR primers can be calculated using a variety of formulas e g 4 G C 2 A T the PCR annealing temperature is usually taken as 5 C below the Tn In practice the optimal annealing temperature is best determined empirically The duration of the 72 C extension step is determined by the length of the fragment to be amplified Allowing 1 min for each kilobase to be amplified should be sufficient time for the extension reactions to be com pleted The number of cycles can be decreased if the amplification efficiency is good The use of thin walled PCR tubes allows the duration of the 94 C denatur ing step and the annealing step to be reduced considerably thus minimizing the loss of activity
292. ro Transcription and Translation When performing the in vitro transcription and translation reaction it is important to maintain an Rnase free environment Use new sterile plastic microtubes and pipet tips always wear clean disposable latex gloves 1 Remove a tube of TnT T7 Quick master mix from the 70 C freezer Thaw rapidly by hand warming then place on ice The TnT T7 Quick master mix should always be kept on ice while the reactions are being set up and should be returned to the 70 C freezer afterward to minimize the loss of activity 98 2 3 4 When the in vitro transcription translation reaction is complete transfer 5 uL to Hardy Place approx 250 500 ng of PCR product in a 0 5 mL microtube if necessary make the volume up to 2 uL with nuclease free H O Add 0 5 uL S methionine and 10 uL TnT T7 Quick master mix to give a final volume of 12 5 uL see Note 14 Mix well by gently pipetting avoid mixing too vigorously and causing the mixture to foam as this will reduce the activity of the lysate When testing a number of PCR templates it is more convenient to prepare a master mix contain ing the appropriate volumes of S methionine and TnT T7 Quick kit The num ber of pipetting steps is reduced by dispensing the master mix directly to tubes containing the PCR products To monitor the efficiency of the in vitro transcrip tion translation it is useful to include a reaction containing 250 ng of the
293. rom the gel to the nylon membrane contact of blotting items within the stack should only be with the layer above or below In some cases the wick can be covered or sec tioned off using cling film This will also prevent evaporation from the wick and the reservoirs Alternatives to the capillary system include vacuum blotting or electroblotting There are a number of manufacturers that produce equipment for this purpose and although they are more expensive they reduce the transfer process to as little as 1 h In some cases a more even transfer takes place For neutral nylon membranes e g Amersham Hybond N crosslinking is neces sary however for positively charged membranes e g Amersham Hybond N crosslinking may be undertaken by placing the membrane in 0 4 N NaOH for 30 min and rinsing in 5X SSC with gentle agitation for 1 min If using nitrocellu lose it is necessary to bake the filter at 80 C for 20 60 min Efficient crosslinking of DNA to nylon filters is achieved with an optimal amount of exposure to UV light Some manufacturers e g Stratagene pro duce UV crosslinkers Stratalinker that exposes the filter to the radiation for the optimal amount of time It is useful if no equipment such as this is available to calibrate a UV source before use This can be done by exposing filters with identical amounts of DNA on each filter to UV for different lengths of time Southern Blotting by Capillary Transfer 27 Hybridiz
294. rth Amersham 7H dATP TRK 625 dCTP TRK 576 dGTP TRK 627 dTTP TRK 633 store at 20 C see Note 5 7 Scintillation reagent e g Hi Safe II Wallac 3 Method 3 1 PCR for Solid Phase Minisequencing Analysis The PCR is done according to routine protocols except that the amount of the biotin labeled primer used should be reduced so as not to exceed the biotin binding capacity of the microtiter well see Note 3 For a 50 uL PCR reaction we use 10 pmol of biotin labeled primer and 50 pmol of the unbiotinylated primer The PCR should be optimized 1 e the annealing temperature and tem plate amount to be efficient and specific to be able to use PH dNTPs which are low energy emitters for the minisequencing analysis one tenth of the PCR product should produce a single visible band after agarose gel electrophoresis stained with ethidium bromide After optimization there is no need for purifi cation of the PCR product 3 2 Solid Phase Minisequencing Analysis 1 Affinity capture Transfer 10 uL aliquots of the PCR product and 40 uL of the PBS Tween solution to two streptavidin coated microtiter wells see Note 6 Include a control reaction i e a well with no PCR product Seal the wells with a sticker and incubate the plate at 37 C for 1 5 h with gentle shaking 2 Discard the liquid from the wells and tap the wells dry against a tissue paper 3 Wash the wells three times at room temperature as follows pipet 200
295. s comprising a Gel tank and safety lid b Gel tray c Comb d Gel caster optional Power supply capable of at least 100 V 100 mA Powdered agarose Electrophoresis buffer see Note 2 for formulations 10X Gel loading buffer The loading buffer for sample application should contain 0 25 bromophenol blue BPB and 0 25 xylene cyanol as tracking dyes and 30 sucrose glycerol or Ficoll to increase the sample solution density see Note 6 6 Ethidium bromide solution is generally prepared as a stock solution at a concen tration of 10 mg mL in water and stored at room temperature protected from light Ethidium bromide is toxic and a powerful mutagen therefore gloves should always be worn Solutions containing ethidium bromide should be disposed of appropriately as discussed in the Material Safety Data Sheets 7 Microwave oven or hot plate 8 UV transilluminator and gel documentation system we aS 2 2 Polyacrylamide Gel Electrophoresis All of the chemicals used are of molecular biology grade and solutions are prepared with double distilled water unless otherwise stated 1 Polyacrylamide gel apparatus comprising a Gel tank and safety lid b Glass plates c Spacers and combs of the same thickness d Clamps or gel caster assembly optional 2 30 Acrylamide stock prepared by the addition of 29 g of acrylamide and 1 g N N methylene bis acrylamide to 100 mL water see Note 7 10X TBE see Note 2 for formulation
296. s desired avidin coated polystyrene beads Fluoricon 0 99 um IDEXX Corp Portland ME biotin binding capacity over 2 nmol of oligonucleotide mg beads or streptavidin coated magnetic polystyrene beads Dynabeads M 280 streptavidin biotin binding capacity 300 pmol mg can be used 9 The biotin binding capacity of a microtiter well allows reliable detection of up to 2 of a sequence variant present in the sample 6 whereas a detection sensitivity of less than 0 1 is obtained with the bead based format 4 62 10 11 Wartiovaara and Syvanen It is advantageous to use a thermostable DNA polymerase for the single nucle otide primer extension reaction because a high temperature favorable for the simultaneous primer annealing reaction can be used Although the specific activities of the 7H dNTPs are low their half lives are long 13 yr and the necessary precautions for working with 7H should be taken Also dNTPs or dideoxy nucleotides labeled with other isotopes S or 37P or with haptens can be used 1 10 Each nucleotide to be detected at the variant site is analyzed in a separate well Thus at least two wells are needed per PCR product The washings can be performed utilizing an automated microtiter plate washer or by manually pipetting the washing solution to the wells discarding the liquid and tapping the plate against a tissue paper Thorough emptying of the wells is important to avoid unsp
297. s of DNA It is also possible to label more than one dNTP if higher specific activity is required for hybridizing low amounts of DNA However this increases nonspecific hybridization 3 To remove unincorporated labeled dNTPs the probe can be purified by passing the solution through a Sephadex spin column or push column Unincorporated dNTPs are trapped inside the Sephadex beads whereas DNA is too large to enter the beads and passes straight through the column 4 Percentage incorporation and the specific activity of the probe can be calculated by measuring the radioactivity in the mixture before and after separation Percentage incorporation cpm incorporated x 100 Total cpm Specific activity cpm mg DNA cpm incorporated x dilution x 100 mg input DNA References 1 Aquino de Muro M 1998 Gene Probes in The Molecular Biomethods Hand book Rapley R and Walker J M eds Humana Totowa NJ 2 Rigby P W J Dieckmann M Rhodes C and Berg P 1977 Labelling deox yribonucleic acid to a high specific activity in vitro by nick translation with DNA polymerase I J Mol Biol 113 237 251 3 Feinberg A P and Vogelstein B 1983 A technique for radiolabelling DNA restriction endonuclease fragments to a high specific activity Anal Biochem 132 6 13 3 End Labeling of DNA Probes Adrian J Harwood 1 Introduction End labeling is a rapid and sensitive method for radioactively or nonisoto pica
298. s that are a precise reflection of their nucleic acid sequences 4 This principle is the foundation of several mutation scanning techniques such as single strand conformation polymorphism SSCP and dideoxy fingerprinting 5 6 Instead of relying on direct observation of these From Methods in Molecular Biology vol 187 PCR Mutation Detection Protocols Edited by B D M Theophilus and R Rapley Humana Press Inc Totowa NJ 165 166 Heisler and Lee Loop Cleavage Site Stem a 5 3 Fig 1 Structures recognized by the Cleavase I enzyme The Cleavase I enzyme is a structure specific nuclease that recognizes the junctions between single and double stranded regions of nucleic acids i e so called hairpins or stem loops Cleavage occurs on the 5 side of such structures see arrow These intrastrand structures are formed when nucleic acid molecules are denatured and then allowed to cool structures e g by noting subtle differences in how different DNA strands migrate through nondenaturing gels the Third Wave Technologies enzyme based approach uses a structure specific endonuclease engineered from the nuclease domain of Taq DNA polymerase dubbed the Cleavase I enzyme to cut DNA strands wherever these structures occur 3 Fig 1 By analogy to restriction fragment length polymorphism analysis Third Wave has named their method Cleavase Fragment Length Polymorphism CFLP analysis The Cleavase I enzyme r
299. s used as the template for in vitro transcription and translation using RNA polymerase and rabbit reticulocyte lysate or wheat germ extract A radiolabeled amino acid is From Methods in Molecular Biology vol 187 PCR Mutation Detection Protocols Edited by B D M Theophilus and R Rapley Humana Press Inc Totowa NJ 87 88 Hardy usually incorporated into the translated protein to allow detection by autorad iography although nonradioactive PTT methods have also been described 3 4 The translated proteins are separated by SDS PAGE and autoradiogra phy is performed The presence of a protein that is smaller than the full length protein identifies a translation terminating mutation see Figs 1 and 2 The size of the truncated protein indicates the position of the premature stop codon and DNA sequencing of genomic DNA is performed to confirm the presence of a mutation The mutations identified are principally frameshift and nonsense mutations but may also include mutations that disrupt the normal splicing of exons There are two main advantages of PTT compared to most other mutation detection methods Several kilobase segments of a gene can be rapidly screened in a single reaction and PTT only identifies those mutations that have a clear pathological effect on protein function i e those that result in a truncated protein and are likely to result in loss of function Missense mutations and neutral polymorphisms are not identifie
300. sequence by one or more nucleotides For inherited disorders the inheritance pattern of the expected nucleotide change requires consideration Males posses only one copy of X linked genes such as FVIII For their analysis a PCR sample from a normal individual is mixed with the patient s sample enabling the two potentially different alleles to mix and form heteroduplexes Five microliters each of patient plus control PCR product are mixed and overlaid with mineral oil to avoid evaporation during heteroduplexing see Note 5 In the situation where the subject is expected to be heterozygous for a mutation such as female carriers of hemophilia PCR product is heteroduplexed with its own normal allele This also applies to autosomal dominant inherited disorders such as von Willebrand disease chromosome 12 Therefore if heterozygosity for a defect is expected heteroduplexing can be added at the end of the PCR thermocycling and an aliquot loaded directly onto the CSGE gel Where there is an uncertainty about the nature of a mutation samples should be analyzed by CSGE following both heteroduplexing against self and against a wild type sample The latter technique has been used determine allele frequency in poly morphism analysis 4 2 Materials 2 1 Gel Preparation All chemicals were obtained from Sigma unless specified 1 20X TTE 1 78 M Tris 570 mM taurine 4 mM EDTA A Tris taurine buffer system was developed for CSGE gels as it is
301. sses the database using the name of the disease of interest and will display the result in the order in which the genes are found on the chromosome 2 Searching the Morbid map http www3 ncbi nlm nih gov Omim searchmorbid html will allow a search of the database using the name of the disease of interest or a general descriptive term such as anemia and will display in alphabetical order a list of diseases found that contain the keyword s The list contains infor mation on the chromosome location and details of the genetics and clinical symp toms of the disease 2 5 Sequencing Genomes The genomes of the following species have been or are being sequenced and data can be found at the given Web site 200 Brzeski e Human http www ornl gov TechResources Human_Genome home html e Mouse http www informatics jax org e Escherrichia coli http www genetics wisc edu e Haemophilus influenzae http www tigr org tdb mdb hidb hidb html e Caenorhabditis elegans http www sanger ac uk Projects C_elegans e Arabidopsis thaliana http genome www stanford edu Arabidopsis e Rice http www dna affre go jp 82 e Yeast http genome www stanford edu Saccharomyces A more exhaustive list can be found at http www ncbi nlm nih gov Entrez Genome org html 3 Protein Databases 3 1 The Databases There are essentially three databases the Protein Information Resource PIR http pir georgetown edu SWISS PROT
302. sually run between two glass plates ensuring uni form electrical conditions across the slab so that comparison between different sample zones is far more accurate and a large number of samples may be run on the gel Polyacrylamide gels are poured and run in 1X TBE at low voltages to pre vent denaturation of small fragments of DNA by heat generated by passage of the electric current Most species of double stranded DNA migrate through the gel at arate approximately inversely proportion to the log of their size how ever their electrophoretic mobility is affected by their base composition and sequence so that two DNAs of exactly the same size can differ in mobility by up to 10 as a result of secondary structures that may form at specific sequences in the double stranded DNA 5 Denaturing polyacrylamide gels are used for the separation and purification of single stranded fragments of DNA and are polymerized in the presence of Agarose and Polyacrylamide Gel Electrophoresis 5 an agent that suppresses base pairing in nucleic acids usually urea Denatured DNA migrates though these gels at a rate that is almost completely dependent on its base composition and sequence and is discussed elsewhere in this vol ume see Chapters 14 16 2 Materials 2 1 Agarose Gel Electrophoresis All of the chemicals used are of molecular biology grade and solutions are prepared with double distilled water unless otherwise stated 1 Agarose gel apparatu
303. t M Oosterwijk J C Olmer R et al 1995 Rapid detection of BRCA1 mutations by the protein trun cation test Nature Genetics 10 208 212 Plummer S J Anton Culver H Webster L Noble B Liao S Kennedy A et al 1995 Detection of BRCA1 mutations by the protein truncation test Hum Mol Genet 4 1989 1991 Garvin A M 1998 A complete protein truncation test for BRCA1 and BRCA2 Eur J Hum Genet 6 226 234 Garvin A M Attenhofer Haner M and Scott R J 1997 BRCA1 and BRCA2 mutation analysis in 86 early onset breast ovarian cancer patients J Med Genet 34 990 995 Friedman L S Gayther S A Kurosaki T Gordon D Noble B Casey G et al 1997 Mutation analysis of BRCA1 and BRCA2 in a male breast cancer popula tion Am J Hum Genet 60 313 319 Kohonen Corish M Ross V L Doe W F Kool D A Edkins E Faragher I et al 1996 RNA based mutation screening in hereditary nonpolyposis colorectal cancer Am J Hum Genet 59 818 824 Lui B Parsons R E Hamilton S R Petersen G M Lynch H T Watson P et al 1994 hMSH2 mutations in hereditary nonpolyposis colorectal cancer kindreds Cancer Res 54 4590 4594 Romey M C Tuffery S Desgeorges M Bienvenu T Demaille J and Clautres M 1996 Transcript analysis of CFTR frameshift mutations in lympho cytes using the reverse transcription polymerase chain reaction and the protein trun
304. tection in kilobase lengths of DNA and does not require specialized equipment or harmful reagents However because no such universally applicable method exists the present state of play is a plethora of methodology from which the user makes a choice based on facilities expertise frequency of use detection rate demanded and whether the application purpose is diagnostic detection of the presence or absence of a known mutation or involves screening a candidate gene for a new unidentified mutation PCR Mutation Detection Protocols comprises a comprehensive step by step guide that brings together the large number of PCR based mutation detection methods described to date Many of the earlier chapters describe the basic tech nology and techniques e g the principles and methodology of PCR labeling DNA probes restriction fragment length polymorphism analysis and Southern blotting Further techniques are then presented covering both categories of V vi Preface mutation detection detection of the presence of a known mutation and screening fornew mutations The techniques presented in each involve different approaches appropriate to different mutation types point mutations e g ASO PCR SSCP DGGE chemical cleavage deletions multiplex PCR FISH blotting non sense mutations PTT etc The new and exciting techniques of DNA array analysis are also presented The final chapters deal with different approaches to DNA sequencing as a de
305. tection method in its own right or for characterizing mutations previously located by one of the other screening techniques Recently developed and experimental methods such as conformation sensitive gel elec trophoresis are presented in addition to the more established methods Each chapter includes the underlying basis of the techniques and enables the reader to select the optimum method to use in relation to the above criteria Particularly useful are the Notes sections containing the small details necessary for the successful execution of the technique PCR Mutation Detection Protocols is aimed at postgraduate scientists and researchers in diagnostic and research laboratories In addition the basic techniques covered in the introductory chap ters will ensure the book constitutes a fitting initiation to molecular techniques for individuals in related medical and scientific fields Bimal D M Theophilus Ralph Rapley Contents POT AC Se ss sessteenaettcecacd anti eE saudatuersancestaeds saved eesamectanedaaaaatesh es actetuaeaantenaeevapantaa shear v COMIMIDULOIS as ncesitvasceaacdcdutendevidsaneddacdeatdesaeecaiasncevodeaicedacecauadnedvaxeaseseeedeavaeeasveags ix 1 Agarose and Polyacrylamide Gel Electrophoresis Andrea M Guilliatt 0 000cccccccccccccce cc ceccceeceecccceeeeeseceaaeeeseseaaeeeeeseaaes 1 2 Internal Labeling of DNA Probes Ralph Rapley and Bimal D M Theophilus 0 c0 ccccceeeeeees 13 3 End Labeling of DNA
306. temperature to change some of the physical characteristics of DNA molecules exhibit strong familial resemblance to one another such that they share the majority of bands produced The sequence differences are revealed as changes in one or several bands These unique band changes are visualized as mobility shifts the appearance or disappearance of bands and or significant differences in band intensity Fig 3 168 Heisler and Lee Single Ramped Temperature A Bg med DI A Bg BmEG OI ane nv i ET a oe 40 S8 555 r D E PA ia Sil 200 ae 2 i m aa E rC m sa i Ce a ee pa m C i ss ot 5 m naana anna Ea Pe ea ee Ore Eo te J 4 5 ET 6 10 Ba Fig 3 CFLP analysis of the ITS regions of P carinii PCR products spanning the ITS1 and ITS2 regions of P carinii 534 bp long and labeled on the 5 ends of both strands with TET were subjected to CFLP analysis Approximately 250 fmol of labeled PCR product was analyzed in the ramped reactions and approx 150 fmol in the single temperature reactions The DNA aliquots were supplemented with DNA dilution buffer The ramping assay was performed as described in Subheading 3 2 The genotypes of the samples from which the DNA was amplified are indicated above the lanes Lanes marked mw contain molecular weight markets with fragment sizes as indicated The gel was electrophoresed at constant wa
307. the most common is the horizontal slab gel Because of their rela tively poor mechanical strength agarose gels are cast in clear plastic UV transparent trays allowing handling and transfer of the gel once set see Note 4 Electrophoresis is carried out with the gel submerged just beneath the surface of the buffer and as the resistance of the gel is similar to that of the buffer a current passes through the gel The principle advantage of submarine gel electrophoresis is that the thin layer of buffer prevents the gel from drying out and provides some degree of cooling The electrophoretic behavior of DNA in agarose gels is not significantly affected by temperature or the base composition of the DNA 3 therefore agarose gels are generally run at room temperature unless low melting tem perature agarose is used or the agarose concentration is less than 0 5 w v when the mechanical strength can be improved by running at 4 C 1 2 Polyacrylamide Gel Electrophoresis Polyacrylamide gels are formed by the vinyl polymerization of acrylamide monomers CH CH CO NH crosslinked by the bifunctional co monomer N N methylene bis acrylamide CH CH CO NH CH NH CO CH CH The resulting crosslinked chains form a gel structure whose pore size is deter mined by the initial concentrations of both acrylamide and the crosslinker The nomenclature introduced by Hjert n et al 4 is now widely used to describe gel composition the term T being the total m
308. tilled H O Discard H O and soak in three gel volumes of denaturation buffer Incubate with gentle agitation at room temperature for 30 min Decant denaturation buffer Replace with three gel volumes of transfer buffer Equilibrate the gel with gentle agitation at room temperature for 30 min Prepare Southern blotting system Fig 1 Cut a wick from 3MM paper suffi cient in width to cover the area of the gel platform and in length to reach both reservoirs see Note 7 Soak the 3MM paper wick in transfer buffer and place over the gel platform Ensure that both ends of the wick reach the reservoirs and that all air bubbles are removed from the wick by gently smoothing with a gloved finger Remove gel from transfer buffer and place face up on the gel platform of the capillary transfer system Fill both reservoirs with transfer buffer Cut a piece of Hybond N nylon membrane to the exact size as the gel see Note 8 and mark the side of the membrane that will be in contact with the gel see Note 9 Wet the membrane by floating it on distilled water Rinse in transfer buffer and place the membrane on the gel smoothing out any air bubbles between the gel and the membrane see Note 10 Cut three sheets of 3MM paper to the exact size of the gel membrane sandwich and wet with transfer buffer Place on top of the membrane and smooth out any air bubbles Cut a stack of absorbent paper towels to the size of the gel and place on top of the 3
309. tly labeled with a dye so four separate reactions have to be carried out It is possible to label each primer four times each time using a different dye and then pool the reactions together for sequencing but this turns out to be very expensive There have been vast improvements in sequencing technol ogy such that the 4 dye terminator kits available on the market now result in very even peak heights which allows for an easier detection of heterozygotes This chapter describes the two recent technologies for cycle sequencing manual radioactive termination cycle sequencing and automated sequencing using the Big Dye Terminators Perkin Elmer Applied Biosystems Both of these methods produce sequences of high quality Cycle Sequencing of PCR Products 67 2 Materials 2 1 Manual Cycle Sequencing 2 1 1 Purification of PCR Products 1 Geneclean Kit II Anachem 2 1 2 Termination Cycle Sequencing 1 Termination cylce sequencing kit Amersham The following components are provided in the kit a 10X Reaction buffer concentrate 260 mM Tris HCl pH 9 5 65 mM MgCl b dGTP termination master mix 7 5 uM dATP dCTP dGTP dTTP c dITP termination master mix 7 5 uM dATP dCTP dTTP 37 5 uM dITP d Four Redivue 3P labeled terminators which consist of the following which are all 0 3 uM a 2P ddNTP 1500 Ci mmol 450 wCi mL 11 25 wCi ddGTP ddATP ddTTP ddCTP 2 1 3 Treatment of PCR Products After Cycle Sequencing 1
310. to higher masses or mixed with n 1 synthesis products should not be used 2 Use asymmetric primer concentrations in PCR with the nonbiotinylated primer in excess 3 The length of the PROBE primer should not exceed 20 25 bases try to have C or G at the 3 end and avoid mismatches especially at the 3 end 4 The second temperature step in the PROBE program 55 C depends on the primer length 5 After the reaction the beads can be stored for further reactions in Tris HCI buffer at 4 C 6 Be sure to handle SpectroCHIPs with gloves and avoid any contact with moisture References 1 Collins F S Patrinos A Jordan E Chakravarti A Gesteland R Walters L and the members of DOE and NIH planning groups 1998 New goals for the U S human genome project 1998 2003 Science 282 682 689 2 Botstein D White D L Skolnick M and Davis R W 1980 Construction of a genetic linkage map in man using restriction fragment length polymorphisms Am J Hum Genet 32 314 331 Genotyping Using DNA MassArray Technology 191 3 10 11 12 13 14 15 16 17 18 Weber J L and May P E 1989 Abundant class of human DNA polymor phisms which can be typed using the polymerase chain reaction Am J Hum Genet 44 388 396 Collins F S Guyer M S and Chakravarti A 1997 Variations on a theme Cataloging human DNA sequence variation Science 278 1580 1581 Kruglyak
311. ttage 20 W until a bro mophenol blue market dye loaded in a far lane not shown reached the bottom of the gel The gel cassette was scanned on a Hitachi FMBIO 100 fluorescence imager with a 585 nm emission filter CFLP Analysis for Genotyping and Mutation Detection 169 CFLP analysis is exquisitely sensitive to the presence of minor sequence variations and can detect changes involving one or more bases including mis sense mutations with gt 95 sensitivity and 100 specificity Because the CFLP method results in an easily examined pattern rather than base by base analysis of each sequence the value of this approach may be even more pro nounced in genotyping applications In these cases what is sought is the rapid identification of compound sequence variations occurring throughout an ampli fied fragment Rapid inspection of the patterns generated by CFLP analysis of fragments containing multiple dispersed base changes has proven to be an effective approach to classifying bacterial and viral sequences according to genotype 1 3 11 Pneumocystis carinii f sp hominis is the leading cause of pneumonia and the most commonly transmitted life threatening opportunistic infection among AIDS patients 15 To establish the origin of particular infections verify localized outbreaks and determine whether an individual has sustained mul tiple coincident infections researchers have attempted to classify individual P carinii strains based on s
312. turing gradient gel electrophoresis TGGE During migration dis crete regions within the DNA fragments referred to as melting domains denature melt at specific positions along the denaturing gradient The con centration of denaturant at which denaturation of a melting domain occurs is referred to as the melting temperature or T Branched denatured portions of DNA fragments entangle more readily in the polyacrylamide matrix and as a con sequence cause an abrupt decrease in the mobility of the whole DNA fragment A DNA fragment may contain more than one melting domain with the T of each one being strictly dependent upon its nucleotide sequence Alterations in the nucleotide sequence e g disease causing mutations in all but the highest melting temperature domain will alter the melting properties of the whole DNA molecule thereby altering its electrophorectic mobility Fig 1 Base changes in the domain with the highest melting temperature will not be detected due to the loss of sequence dependent migration upon complete strand dissociation This limitation is easily overcome by the attachment of a highly thermostable segment referred to as a GC clamp to one end of the DNA frag ment The GC clamp is efficiently introduced during the PCR amplification step prior to DGGE analysis by the use of a modified primer containing a GC tail at its 5 end In general a GC clamp of 40 bp as originally described by Sheffield et al 7 is sufficient
313. tutions produce less marked band separations because of the small conformational change induced Results obtained from CSGE gels detecting different nucle otide substitutions insertions or deletions will vary dramatically Most banding patterns produced by single nucleotide substitutions can be easily identified when compared to wild type homoduplex DNA Some het eroduplexes only induce a slight retardation or enhancement of migration dur ing polyacrylamide gel electrophoresis These CSGE patterns consist of a single band which is slightly thicker in width than wild type DNA These fat ter bands can mimic an overloaded well and the nucleotide substitution can be overlooked An extensive visual examination of the CSGE gel is essential for comparing all samples with normal or wild type DNA After gel documenta tion all altered banding patterns must be investigated either by a repeat CSGE possibly with loading less DNA or direct sequencing of the sample All samples displaying altered CSGE migration should then be sequenced to deter mine the nature of the nucleotide change see Chapter 10 Conformation Sensitive Gel Electrophoresis 147 Fig 2 FVIII gene exon 6 423 bp Lane 1 negative control heteroduplexed against self lane 2 heteroduplexed sample with an A to G substitution lane 3 heteroduplexed sample with a 2 bp insertion of CC lane 4 heteroduplexed sample with a single base deletion of a T Fig 3 FVIII gene
314. uL of TENT solution to each well discard the washing solution and empty the wells thor oughly between the washings see Note 7 4 Denature the captured PCR product by adding 100 uL of 50 mM NaOH to each well incubate at room temperature for 3 min Discard the NaOH and wash the wells as in step 3 Solid Phase Minisequencing 61 5 For each DNA fragment to be analysed prepare two 50 uL mixtures of nucle otide specific minisequencing solution one for detection of the normal and one for the mutant nucleotide see Note 8 Mix 5 uL of 10X Tag DNA poly merase buffer 10 pmol of detection step primer 0 2 wCi usually equal to 0 2 uL of one 3H dNTP 0 1 U of Taq DNA polymerase and dH O to a total volume of 50 uL It is obviously convenient to prepare master mixes for the desired number of analyses with a certain nucleotide 6 Pipet 50 uL of one nucleotide specific mixture per well incubate the plate at 50 C for 10 min in a water bath or 20 min in an oven see Note 9 7 Discard the contents of the wells and wash them as in step 3 8 Release the detection step primer from the template by adding 60 uL of 50 mM NaOH and incubating for 3 min at room temperature 9 Transfer the eluted primer to the scintillation vials add scintillation reagent and measure the radioactivity i e the amount of incorporated label in a liquid scin tillation counter see Note 10 10 The result is obtained as counts per minute cpm values The cpm va
315. ular weight DNA fragments increases preferentially Therefore the effective range of separation decreases as the voltage is increased Electrophoresis buffers are generally prepared as concentrated stock solutions as shown in Table 3 A precipitate may form when 10X TBE is stored for extended periods of time therefore it should be stored in brown glass bottles at room temperature and discarded if a precipitate develops The unavoidable loss of water that occurs during the heating of the gel means that in practice the percentage value is not precise If the gel is to be handled extensively it may be convenient to place a sheet of hydrophilic plastic support at the bottom of the gel mould aiding in the handling of the gel once set Oxygen at above trace levels acts as an inhibitor therefore many people advo cate the deaeration of stock acrylamide solutions Gelation should ideally occur within 10 30 min of the addition of the catalysts because outside of these times uneven polymerization may result leading to non homogenous gels and poor separations Because of the nature of the gel casting inhibition of the polymer ization by oxygen is confined to a narrow layer at the top of the gel Agarose and Polyacrylamide Gel Electrophoresis 9 Table 3 Formulations of Stock Electrophoresis Buffers Electrophoresis buffer Concentrated stock 1X Working solution Tris acetate 50X Stock 242 g Tris base 40 mM Tris pH 7 6 TAE 57 1 mL Glaci
316. uncation Test 101 obtained from lymphocyte blood samples compared with RNA samples from lymphoblastoid cell lines These alternative transcripts were often found to have a deletion of one or more exons However sequencing of genomic DNA failed to identify any splice site defects involving these exons indicating that the unusual transcripts were unrelated to the HNPCC 14 Thus PCR artifacts and alterna tive transcripts can make the identification of translation terminating mutations and splice site mutations complicated However translation terminating muta tions and splice site mutations should give a consistently reproducible result and can be confirmed by sequencing of genomic DNA 4 For samples that show only the full length translation product and no truncated protein a number of possibilities must be considered The most obvious explana tion is that no translation terminating mutation is present However a number of other explanations must be considered as there are certain situations when PTT will fail to identify a truncating mutation Truncating mutations that occur at the extreme 5 and 3 ends of the gene are not easily identified by PTT 22 A trun cating mutation close to the 5 end may result in a truncated protein that is too small to be seen by SDS PAGE A mutation close to the 3 end of the gene may result in a truncated protein that is not significantly different in size from the full length protein which cannot be resol
317. uorescence analysis or chemiluminescence detection on an aliquot of the DNA in a small denaturing polyacrylamide gel As seen in Fig 3 there are two alternative approaches to be taken in config uring the CFLP reaction The initial configuration of the assay involves per forming the reaction under an abbreviated matrix of reaction times and temperatures in order to identify the optimal conditions for generation of a pattern with a broad spectrum of evenly distributed bands temperature time optimization Alternatively recent studies have demonstrated that the use of a programmable thermal cycler enables informative patterns to be generated by increasing the reaction temperature throughout the course of the reaction spe cifically from 25 to 85 C at a rate of 0 1 C s for a total ramping time of 10 min In some genetic systems such as P carinii the ramping approach appears to generate somewhat more even distributions of fragments and has improved mutation detection sensitivity Furthermore provided suitable thermal cyclers are available the ramping approach is simpler and requires less DNA since optimization reactions need not be run prior to analysis of test samples The following protocol describes the method of performing CFLP analysis utiliz ing either the single temperature or ramping procedure 1 Aliquot the desired amount of end labeled DNA approx 100 200 fmol into a thin walled reaction tube 200 or 500 uL depending on the cap
318. uring concentration and therefore migrates to a position further along the dena turing gradient than its normal counterpart Y The mutant PCR fragment therefore migrates further along the denaturing gradient 9 or MACMELT commercially available from Bio Rad Laboratories UK allows the melting behavior of each target DNA sequence to be visualized as a meltmap Using these programs PCR primers can be specifically designed to create fragments containing only one or two melting domains and GC clamps can be placed to produce products with the most favorable melting behavior DGGE is particularly sensitive when screening for heterozygous nucleotide alterations and is used to analyze a number of genes causing dominantly inher ited genetic disorders Examples include the APC and the hMLH1 and hMSH2 mismatch repair genes 10 12 Mismatches present in heteroduplex molecules produced during the PCR stage significantly reduce the thermal stability of the whole DNA fragment causing them to denature at a lower denaturant concen tration than their homoduplex counterparts Heteroduplex molecules usually 128 Wallis Heteroduplencs Heteriduplexes Mutant Homaduples Narmal Homoduphes jpe lt Normal Homodiples Mutunt Hianodupdies oe l 2 3 Fig 2 Photograph of a DGGE gel for the analysis of exon 6 of the APC gene Lane 1 shows an A to G transition at codon 235 and lane 3 shows a C to T transition at codon 232
319. ush the U shaped spacer downwards so that the bottom of the polyacrylamide gel makes contact with the buffer Dislodge any little air bubbles lying below the gel by briefly holding the cassette at a 45 angle Retighten the upper two screws on each side of the cassette Connect the elec trodes and prerun the gel at 100 V for 10 15 min before loading During this time add 6X gel loading buffer to the PCR samples to be analyzed see Note 8 Depending on the yield of the PCR product load 5 10 uL of sample from a 25 uL PCR reaction see Note 9 Before loading disconnect the power supply and flush out the wells thoroughly with TAE buffer using a needle and syringe After sample loading reconnect the power supply and electrophorese for the required running time The optimum running time may be calculated using software mentioned in the introduction As a guide the author runs all gels for the analysis of exons 3 14 of the Adenomatous polyposis coli gene at 100 V for a gel 30 cm in length for 16 h Products may be electrophoresed at a higher voltage for a shorter time if required Gel Staining off the buffer tank Carefully remove the hot gel electrophoresis unit from the buffer tank Remove the gel s from the unit and separate the glass plates gently to leave the gel on the noneared plate Remove as appropriate a top gel corner to assign the gel loading end Place the gel still on a noneared plate into a staining
320. ve selected numbers Choose Edit Copy from the menu bar Click on the button labeled CINEMA in the task bar at the foot of the screen Click on the Seq Editor button Give your sequence a title in the Accession name window Click in the large text window at the bottom and EITHER i Press Ctrl V to paste your sequence from the clipboard jis fis wo oO O ja OR jais Right click in the window then select Paste from the Shortcut menu ii Press the Add sequence button ili Press the Clear All button then repeat this procedure until you have included all the required sequences Select AutoAlign Clustal interface in the menu bar In the CLUSTALW interface window note that you have a series of dark gray but tons with white text on them which will indicate the progress of the alignment In the CLUSTALW interface window enter a name for your job and then press the Submit job button fas Bioinformatics 205 13 14 15 16 a You can fine tune your search by pressing the Advanced button This will give you the opportunity of using a different scoring matrix default is PAM 250 or by altering the criteria used for the alignment e g by changing the penalties for opening or extending a gap When the alignment has been performed the dark gray buttons will change to light gray and the text will become blue The alignment will be loaded into the CINEMA window so you should clear this first by switching to the
321. ved by SDS PAGE 22 As it is not pos sible to design overlapping PCR segments for these regions another mutation detection method such as SSCP or direct sequencing should be used to screen the extreme 5 and 3 ends of the segment in question 22 Mutations that alter primer binding sites may not be detected because of failure to amplify the mutated allele although this should not present a problem when the gene is amplified in several overlapping fragments Deletion insertion or duplication of several kilobases or a translocation with a break point within the gene will result in failure to amplify the mutant allele 22 Consequently these abnormalities cannot be detected by PTT A mutation in the promotor or 3 untranslated region that reduces the level of mRNA will not be detected by PTT Small in frame deletions or insertions which cause only a small change to the size of the mutant protein may not be resolved by SDS PAGE 22 A mutation that causes instability of the mRNA may result in failure to identify a mutation by PTT when RT PCR is used The instability of mutant mRNA transcripts with in frame stop codon mutations is a recognized phenomenon that is often cited as a cause of false negative results for PTT For example PTT analysis of the PAX6 gene following RT PCR was found to be less sensitive than expected 21 PTT failed to identify truncated proteins in a number of samples with characterized mutations because of low levels o
322. vided between 4 dye and 1 dye technology With the 4 dye technology there is one tube per reaction with the four dyes corresponding to the four bases therefore each sample can be run on a gel in one lane This is in contrast to the 1 dye four lane approach where there are four tubes per reaction each tube corresponding to one of the four bases and is therefore run on a gel in four lanes The former single lane approach has been the option for both large scale and large sample number application groups The 4 dye single lane instrumentation allows for higher sample throughput and consistent results among the large numbers of samples that are processed on a single run The other advantage of the 4 dye single lane approach compared to the 1 dye four lane approach is that varia tions in electrophoretic mobility across the four lanes with the single dye tech nology may result in artifacts of sequence miscalling between adjacent lanes The Big Dye Terminators from Perkin Elmer and the DYEnamic dyes from Amersham Pharmacia Biotech are examples of the 4 dye and single lane approach respectively The Big Dyes have been an improvement on previ ous systems as they produce more even peak heights which facilitates the identification of heterozygosity Prior to this system the recommended method for recognizing heterozygotes was to use the dye primer technology which gave even peak heights This method of sequencing requires the primer to be fluorescen
323. with the correspondingly different bases at the 3 end However a single mismatch is often not enough to prevent nonspecific amplification and the introduction of additional deliberate mismatches near the 3 terminal end e g four bases from the 3 end of the primers may overcome this problem Several inves tigations have examined the effect of the type of the 3 terminal primer template mismatches on the PCR amplification 2 7 however it appears to differ depending on the gene being studied Where possible select primers of random base distri bution and approx 50 GC content The primers should not be complementary to each other or contain a sequence with significant secondary structure The com mon primer should be designed to give a product of suitable size e g 200 bp Aconcentration 100 ng of template DNA is usually sufficient to amplify Two reactions are required for the detection of a point mutation one including the wild type and common primers and the other with the mutant type and com mon primers Addition of the Tag polymerase following the initial denaturation step while the PCR reaction is held at 80 C prior to the cycling reactions may increase the speci ficity of the PCR products 50 6 T Green The volume of PCR reaction can be altered according to requirements 10 100 uL These are standard PCR reaction conditions which may not amplify the template specifically By varying the conditions and c
324. x G25 spin column References 1 Pickersky E 1996 Terminal labelling for Maxam Gilbert sequencing in Basic DNA and RNA Protocols Harwood A J ed Methods in Molecular Biology vol 58 Humana Totowa NJ Wallace R B Shaffer J Murphy R F Bonner J Hirose T and Itakura K 1979 Hybridisation of synthetic oligodeoxyribonucleotides to phi chi 174 DNA the effect of single base pair mismatch Nucl Acid Res 6 3543 Harwood A J ed 1994 Protocols for Gene Analysis in Methods in Molecular Biology vol 31 Humana Totowa NJ Harwood J C and Phear G A 1996 Direct sequencing of PCR products in Basic DNA and RNA Protocols Harwood A J ed Methods in Molecular Biology vol 58 Humana Totowa NJ Klenow H Overgaard Hansen K and Patkar S A 1971 Proteolytic cleavage of native DNA polymerase into two different catalytic fragments Eur J Biochem 22 371 381 Challberg M D and Englund P T 1980 Specific labelling of 3 termini with T4 DNA polymerase Meth Enzymol 65 39 43 4 Southern Blotting of Agarose Gels by Capillary Transfer Ralph Rapley and lan J Williams 1 Introduction The detection of specific nucleic acid species following electrophoretic sepa ration of a complex sample may be undertaken by the use of Southern blotting 1 Genomic DNA fragments are separated according to size by agarose gel electrophoresis following digesti
325. y not correspond to the first nucleotide to be filled within the restriction enzyme site In the example shown in Fig 1A which is a BamHI site the labeled nucle otide dCTP corresponds to the fourth nucleotide therefore the other three nucleotides must be filled with cold dNTPs before the label is incorporated For convenience a general 7 5 mM mix of the unlabeled dNTPs can be used regard less of the actual composition of the restriction enzyme site Second a chase is required to generate molecules with flush ends as the polymerase stalls in the limited concentrations of the labeled nucleotide This step may be omitted in End Labeling of DNA Probes 21 10 11 12 13 cases where the heterogeneous sized termini are not a problem e g when label ing large DNA fragments for separation by agarose gel electrophoresis The fill in reaction is very robust and provided Mg is present it can be carried out in almost any buffer This means that it is possible to carry out the reaction by simply adding the labeled dNTP unlabeled dNTPs and Klenow directly to the restriction enzyme mix at the end of digestion As only a small region of DNA is labeled in this reaction it proceeds very quickly Incubation at room temperature is sufficient unless S labeled dNTP is used when labeling should be carried out at 37 C Prolonged incubation can result in degradation of the DNA ends The labeled DNA may be used for g
326. y pipetting solution up and down Add water to ensure a final volume of 100 uL Incubate for 2 h at 15 C Stop the reaction by adding 10 uL EDTA The probe is now ready for hybridization However it may be necessary to remove any unincorporated nucleotides using Sephadex spin columns see Notes 3 and 4 Random Hexamer Labeling of DNA Take 25 100 ng of DNA to be labeled and adjust the volume of TE to 11 uL Denature the DNA by boiling for 5 min and transfer immediately to an ice bucket Add 11 uL of the primer mix 2 uL of the a P dATP and 3 U of the Klenow polymerase 0 5 uL Incubate the mix at room temperature for approx 4 h Add 5 uL of stop mix to terminate the reaction At this point the probe may be purified from free nucleotides by use of Sephadex spin columns see Notes 3 and 4 Internal Labeling of DNA Probes 15 7 Following recovery of the labeled DNA it must be rendered single stranded by boiling before it may be used in hybridization experiments 4 Notes 1 Enzymes and buffers are now available in kit forms Amersham Amersham Pharmacia Biotech UK Promega Promega UK however slight variations exist in concentrations of enzymes and buffer ingredients 2 Nick translation can also be used to label DNA with nonradioactive markers including incorporation of Cy3 dCTP and fluorescein or rhodamine dUTP into DNA However radiolabeled probes are more sensitive markers for low quanti tie
327. ygen in the first field leave the default All text in the drop down list box in the SRS Query Form Page Bu a pi Bioinformatics 201 7 Press the Do query button 8 This search will find over 1000 entries 9 Press the Back button on your Web browser to return to the SRS Query Form Page 10 Click on the drop down list box to the left of the first text field and select Description 11 Press the Do query button 12 This search will find about 100 entries 13 Press the Back button to return to the SRS Query Form Page 14 On the next line change All text to Organism 15 Type Homo sapiens in the adjacent text box 16 Press the Do query button 17 This search will find just less than 10 entries 18 This query is looking for database entries in SWISS PROT that contain only the word oxygen in the Description field and Homo sapien in the Organism field It is possible to change this to an OR search in the drop down list box adjacent to the Do query button 19 Using this search technique it is possible to find entries from one or many data bases using only one set of search parameters 3 3 Searching for Database Entries That Match a Sequence The first step of the human genome sequencing project has involved identi fying those DNA sequences most important for a cell the ones coding for pro teins synthesized by the cell and hence which define the cell s enzymatic complement and thus its function Fo
328. ypically calculated by measuring their TOF which is longer for larger molecules than for smaller ones provided their ini tial energies are identical Because predominantly single charged nonfragmented ions are generated parent ion masses can easily be determined from the spectrum without the need for complex data processing and are acces sible as numerical data for direct processing The quality of the spectra which is reflected in terms of resolution mass accuracy and also sensitivity is highly dependent on sample preparation and the choice of matrix compound For this reason the early applications of MALDI TOF MS were mostly for analyzing peptides and proteins The discov ery of new matrix compounds for nucleic acid analysis 16 and the develop Genotyping Using DNA MassArray Technology 183 ment of solid phase sample conditioning formats 17 18 enabled the analysis of nucleic acid reaction products generated in ligase chain reaction or PCR 19 The more demanding DNA sequence determination with MALDI TOF MS can be addressed using exonucleolytic digestion 20 Sanger sequencing 21 or solid phase Sanger sequencing approaches 22 These approaches are cur rently restricted to comparative sequencing and the read length is limited to about 100 bases Further improvements in reaction design and instrumentation 23 will surely lead to enhanced efficacy and longer read length For genotyping applications this limitation is not re
329. zyme sites are unavailable or when the substrate is single stranded the kinase reaction is used The kinase reaction uses T4 polynucleotide kinase T4 kinase to transfer labeled phosphate to the 5 end of the DNA molecule 6 Fig 1B This method From Methods in Molecular Biology vol 187 PCR Mutation Detection Protocols Edited by B D M Theophilus and R Rapley Humana Press Inc Totowa NJ 17 18 Harwood A The Fill in reaction Klenow dGTP dATP dTTP dCTP ATATG 3 p ATATGGATC 3 TATACCTAG 5 TATACCTAG 5 Restriction enzyme Incubation with digested DNA labeled dCTP B The Kinase reaction i Removal of 5 terminal phosphate 5 pATATG pe p gt ATATG TAC TAC Incubation with CIAP ii Addition of labeled 3 P to 5 terminus 5 ATATG n f 4 OS APATATC cy TAC TAC Incubation with 32p y ATP and T4 kinase Fig 1 A The fill in reaction B the kinase reaction is ideal for labeling oligonucleotides which are normally synthesized without a 5 phosphate To label restriction enzyme digested DNA fragments the ter minal phosphate must first be removed by using a phosphatase such as calf intestinal alkaline phosphatase CIP All of these reactions can be used with out labeled nucleotides to modify the DNA fragments for further recombinant DNA manipulations 2 Materials Molecular biology grade reagents should be utilized whenever possible Manipulations are performed in 1 5 mL

Download Pdf Manuals

Related Search

Related Contents

User Guide - Med Handbook  Rollei RH-10  Ⅳ 平成 21 年度 長野県中学校技術・家庭科 実態調査のまとめ  `UNIÓ - ITCS  Manuel Util. DPA XL  COLETA DE DADOS  ALTERNATIVE MOTION CARTONER  LIT-127 SUNOPTICS SURGICAL TITAN 180 SERVICE MANUAL  basic in-ground fence™ - Drs. Foster and Smith  674KB  

Copyright © All rights reserved. Failed to retrieve file