Gegenees V 1.1.0
Contents
1. Select data for analysis Database Included genomes Filter Bacillus_anthracis_Ames_Ancestor_ Bacillus_anthracis_str __Vollum All genomes Complete genomes Draft genomes Bacillus_cereus_E33L Bacillus_cereus_G9241 Bacillus_cereus_NVH0597 99 Bacillus_cereus W Genome Abiotrophia_defectiva ATCC_49176 Acaryochloris_CCMEE_5410 Acaryochloris_marina_MBIC11017 Acetobacter_pasteurianus_IFO_3283_01 Acetobacter_pomorum_DM001 Acetobacterium_woodii_DSM_1030 Achromobacter_piechaudii_ATCC_43553 Achromobacter_xylosoxidans_AXX A Achromobacter_xylosoxidans_C54 Acidovorax_NO_1 Bacillus_anthracis_Ames_Ancestor_ Bacillus_anthracis_str _Vollum Bacillus_cereus_E33L Bacillus_cereus_G9241 Bacillus_cereus_NVH0597 99 Bacillus_cereus_W Bifidobacterium_longum_NCC2705 Bifidobacterium_longum_infantis_157F Bifidobacterium_longum_infantis_ATCC_15697 Streptococcus_agalactiae_2603V_R Streptococcus_infantarius_CJ18 Strentacacciuc mralic Had The alignment When you which to start the alignment process click the start button The calculation progress will be shown and the log window in the right part will show messages on what is happening Typically first a lot of conversion and preparation messages appears Then the a BLAST list is created and executed in parallel threads Typically each thread should not take more than at the most a few minutes to complete The number of simul2. 5 880 0 220 0 GBAA_pX01_0171 149 Bacillus_anthracis__Ames_Ancestor_ 1_300 149501 150000 924 0 924 0 924 0 824 0 206 0 GBAA_pX01_0172 149 Bacillus_anthracis__Ames_Ancestor_ 1_301 150001 150500 924 0 924 0 924 0 843 0 210 8 GBAA_pX01_0172 149 Bacillus_anthracis_Ames_Ancestor_ 1_302 150501 151000 924 0 924 0 924 0 896 0 224 0 GBAA_px01_0172 149 Bacillus_anthracis_Ames_Ancestor_ 1_303 151001 151500 924 0 924 0 924 0 924 0 231 0 GBAA_p 01_0172 149 Bacillus_anthracis__Ames_Ancestor_ 1_304 151501 152000 924 0 924 0 924 0 924 0 231 0 GBAA_pX01_0172 149 Bacillus_anthracis__Ames_Ancestor_ 1_305 152001 924 0 924 0 924 0 918 0 229 5 Intergenic between GB Fragment filtering Info All subsequences Annotation filter Biomarker range 0 8 l Biomarker score max min Fragment range 277 s Show sequence Workspace work space Analysis Demo Database Default Show sequence displays the actual sequences of the fragments and it is possible to fuse adjacent and overlapping fragments into continuous sequences The sequences can be exported to a Fasta file or sent to a web page ready for a blast comparison at NCBI bBacillus_anthracis__Ames_Ancestor_ 2_369 ctottgcqaaaatgcaagatatictctttcatagaaatctttcgatttctttttagctc tetgttaatcagtttcattttctaacacgtacattttcatqctacgttcctttagatc atcaacatcattttgtaattcagggtgaatatattcaggcttcacaactgaagatacaac accaaattcttcaggaacatttca
3. AM Number of letters in database 5 843 235 Number of sequences in database 6 Matrix blastn matrix 1 2 Gap Penalties Existence 0 Extension 2 5 Score Bits Sisia E Value 8e 005
4. Desktop Gegenees_v1 1_Release3 Gegenees_1 1 0 WIN64 bin blast ncbi blast 2 2 25 bin Browse V BLAST Restore Defaults l Apply A function for testing if Gegenees finds blast is under implementation and will come in the next version Perspectives Gegenees have two main perspectives The active perspective can be changed in the perspective bar just under the main menu The perspectives are Workbench overview An overview of all comparisons collected in this workspace Analysis a perspective where the comparative calculations are started and controlled but also for phylogenomic and signature analysis of a completed alignment The workspace The workspace is where all your genomes and your comparison projects will be stored A workspace must always be selected so when Gegenees starts for the first time a workspace location is asked for Typically a user always use the same workspace Different users on the same computer might want to collect their genomes and comparisons in their own separate workspace The workspace can be changed by clicking File and Switch workspace The name of the current workspace can always be seen at the bottom left side of the status line The comparisons that are present in the current workspace will be listed in the table in the Workbench overview perspective File Edit New Data Software Help Genomes Created Modified Workspace demospace Analysis Database D
5. genomic regions that are associated with a specific phenotypic trait that the target group share The target group should ideally contain genomes that represents the genomic variability in the group as well as possible e The background group represents other genomes The background should contain the genomes that are most likely to give a cross reaction false positive in an assay For best result close neighbor strains isolates that do not contain the phenotypic trait should be included e Excluded genomes You may also chose to exclude genomes from the analysis e The reference genome is the genome where the nucleotide coordinate system and the annotations are collected from For a high stringency biomarker analysis see below the best annotated genome in the target group should be used For lower stringency in the biomarker analysis the result may be slightly different depending on which target genome is selected as reference It is then good to look at the data with different reference genomes A reference genome must be chosen to be able to look at the score overview and score table tabs Several group settings can be created from the same dataset e g different subtypes with the New or Make a copy buttons File Edit New Data Software Help eQ E Run alignment RE Included genomes E Group settings i Heat plot ag Score overview HEH Score table Search Current group definition default KA New Makea c
6. to the analysis of the alignment A comparison is represented in the computer s file system as a folder with the prefix comparison_ and it contains copies of the genomes and a file comparison geg that contains the genome list Creating a fragmented all all comparison To create a fragmented all all comparison click on New and then Fragmented all all comparison in the main menu A wizard will help you set up the comparison by first letting you chose a name and some alignment settings The resolution of the alignment is controlled by two parameters the Fragment size and the Sliding step size The fragment size represents the scanning window size and it should be smaller than the genomic region you anticipate to find in the analysis For bacteria we recommend 200 100 frag size slide size which is more accurate and 500 500 much faster and usually sufficient settings Small fragment sizes and sliding step sizes gives more demanding calculations When working with viruses and small sequences shorter settings may be needed It is also possible to use tblastx compares sequences on translated level i e amino acids This is much more demanding and the datasets should be smaller If the sequences are pylogenetically far apart this may be a useful operating mode Then you have to select genomes from your database to include in the comparison and click Finish By clicking finish you will be taken to the analysis perspective
7. O GBAA 1706 TCT RAUL A UIUC CUM RMAC LU T A E E A E E A A A E A E A s Lil 4l Ji gt lt lt E tiin 1579866 1581218 flagellar capping protein misc_feature 1580401 1580700 E nisc_feature 1580601 1581100 W nisc feature 1581001 1581200 misc_feature 1581101 1581300 misc feature 1561201 1581400 GBAA 1672 1581241 1581609 misc_feature 1581301 1581600 W nisc_feature 1581501 1582100 E cpaa_1673 1581599 1581871 hypothetical protein misc_feature 1582001 1582600 E 108 1582241 1582648 flagellar basal body rod protein FlgB W nisc_feature 1582501 1583100 IM tige 1582669 1583082 flagellar basal body rod protein FlgC goon 1583001 1583500 fliE 1583099 1583398 flagellar hook basal body protein FliE 1622001 ireann m 4 Ih Score table tab In the score table tab details about the fragments representing either e a selection e g a range defined by the mouse in the graphical view e auser defined range expressed as fragment numbers e asub sequence e a subset of fragments with a specific biomarker score range e g 0 8 1 0 1 0 is the maximum biomarker score e f none of the range boxes are checked all fragments will be shown Fragments from a certain sub sequence can also be selected After setting the filtering range or a combination of them e g all fragments in the first 200 kb of sub sequence 2 with biomarker sore over 0 8 press t
8. User Manual Gegenees V 1 1 0 What ISIGE RCM CCS otin a E E eee EE a E A E EEES 1 VerSIOM SYSTEM assier a Eaa a E a a a a E EREA a EEE R a EA a E EARR 2 What s NEWasnid ier eE Ern ED E E R E 2 iStallatiO EE A N E E N A E N D S A O E T 2 Perspectives nossen nenea O a E ra ie a a a ae EE a E Ea e epia eaaa a IERT 4 TG WORKS PICE cerr ane pee ae e EE AE e E EEE a A E REE 4 The local Gata base ses veces sass cecsedaeeses coves e E REENE ET ET E 6 Populate the local database sia saisccssiscceicceesaggessedis asvosdedove ss eeess aE Ea a EE Sa N ee EEEa 7 GEgENeeS genome ForMalina nmorao iE 7 Gegene s COmMpPariSNS sssini anae e e aE cocuel E EERE ER aaka EOE ESKERRA 8 Creating a fragmented all all COMPATLISON cccccccccccceeceeseseseseseessnaaeaeeeceeseceeeeeeessessseseeesaaaaeeaeeeseeaagaes 9 Theale a SINE eases Se ssn eeesccat hs astaaicch cee teeeaben eae a a a s a ainese aa iaeei 10 TS analysis seriero an a ates Geewe decade cov deqautavlysdu sats rane a ii naadh 10 INGIUGEd GENOMES taB sinsero nerriet eeaeee R aaen S 11 Gro p settings tab 2625c50si5 selec p2b gdb yen aces cant sccdeaeonntin A E E a a p aaa 11 Heat plot tabirinin n o n E aA enin a a aaeei SEE 12 Score overview CAD siscccicssseadeasesiaenseccevsisSesndcecsaiaeauceeusadascetiansaidassineunaiabscaameba secede dari demseaneys 13 Viewing a Signature IN ALrteMis cccccccccccccccsssessssseeececccceccessaeauaussseeececeeeeeeesesssasaaeaessessesessaes 15 Score ta
9. ble tabanin iraran ENEA EEA AAEE EEA N EEEE A ROA i 16 Primer mapping Primer score table tab c cccccssccccsscccesssccessseecesseecessseecessseeceesseecesseeesessseeeeeeseceneeees 22 What is Gegenees Gegenees is a software that compares genome sequences Draft and Completed It was primarily developed for bacterial genomes but it is also possible to use on viruses and smaller eukaryotes Gegenees fragments the genomes and compares all pieces against all genomes Based on this all against all comparison a phylogenetic data can be extracted It is also possible to define a target group and search for genomic regions that have high specificity for the target group This is referred to as a genomic signature The genomic signature regions can be used to find candidate regions for the design of primers and probes for new highly specific diagnostic assays There is also a built in primer probe verification system that compares new candidate or existing primers and probes to the genomic database and to the defined target groups Future versions will include more aspects of comparing next generation sequencing NGS data Version system The first released version was 1 0 1 Based on user feedback new versions will be released that solves problems and makes the program easier to use These versions will be called 1 0 1 1 0 2 New functionality will lead to version 1 1 1 1 2 1 To see your version select About Gegenees in the He
10. ctaatcaccacaatgtagttatcacttgctcgata aactttcgttttacgttgttatcctttgttaatgtactattctctactttgtatt catgttacttagaatttycgagtcgttatctgcccttaactcataatcaattcgtaacgt ttgattgtcgggattgtattctttttcgcaactgcaatcttcaccgtggaggacaaact ttgatactcacctattttcatttcttcasatttgtatgtcgctccactassaacagggga aatacaaagtacasaaaaca Show as fragments Show as continuous sequences Sve tefl The detailed scores shows how each fragment scores against each genome in the target and background group This may help to identify which particular strain is causing a cross reaction Show fragment BLAST scores es W 5 a es Genome Bacillus_anthracis_Ames 1_3451 Bacilus_anthracis_Ames 1_3452 Bacillus_anthracis_Ames 1_3453 _Bacillus_anthracis_Ames 1_3454 Bacillus_anthracis_Ames 1_3455 Bacilu Bacillus_cereus_Q1 oo 0 0 0 0 0 0 0 0 oo Bacilus_cereus_E33L 00 o0 00 oo o0 oo Bacilus_cereus_AH820 0 0 0 0 0 0 00 0 0 oo Bacilus_anthracis_Steme 370 0 370 0 370 0 370 0 370 0 370 0 Bacillus_anthracis_Ames 370 0 370 0 370 0 370 0 370 0 370 0 Bacillus_anthracis_40193 370 0 370 0 370 0 370 0 370 0 370 0 Si p m J n It is also possible to export the table as its shown or the full data table without filtering as a tab delimited text file for further analysis in e g a spreadsheet program Primer mapping Primer score table tab To make a primer probe mapping click on New in the top menu and then Primer mapping Chose a name and enter y
11. d background group settings can also be modified from the right click context menu If Drag and drop single sorting is selected genomes can be dragged with the mouse one by one The sort is saved and if several sorts are wanted new ones can be created with the new button There is also an autosort function that tries to minimize the score distances between the rows There is also an export button that allows of the phylogenomic data e export of the table in tab format for work in spreadsheet programs e export as html Can be opened in a web browser or converted to publication grade figures This is sometimes a better overview if the table is very large e export nexus file Use this export to create dendrograms in e g SplitsTree File Edit New Data Software Help eQ Run alignment Included genomes Group settings _ cm Score overview Score table 1 Bacilus_anthracis_Ames_Ancestor_ HPE 2 Bacillus_anthracis_str_Vollum 3 Bacillus_cereus_E33L 4 Bacillus_cereus_G9241 5 Bacillus_cereus_NVH0597 99 6 Bacillus_cereus_W Current Heatplot Ee Default Heat settings Show score Show core E Use thresholds 0 Color profile1 4 0 decimals Tools Autosort Show Complete Export Sorting Move selection to row E Drag and drop single sorting Wate work space Analysis Demo Database Default Score overview tab The score overvie
12. efault The local database This is where you store your genomes A default database is always present but customized databases can also be made The default database represents a directory called database in the workspace Custom databases represent directories named database_NameOfCustomDatabase The local database content is shown by clicking Data and then Database manager If the database is large subsets can be shown by entering a case sensitive filter text e g Bacillus to show only the genus Bacillus There is also a filter for showing only genomes in draft or complete form Database Edit Data All genomes Complete genomes Draft genomes Name Type Abiotrophia_defectiva ATCC_49176 Draft Acaryochloris_CCMEE_5410 Draft Acaryochloris_marina_MBIC11017 Complete Acetobacter_pasteurianus IFO_3283 01 Complete Acetobacter_pomorum_DMO001 Draft Acetobacterium_woodii_DSM_1030 Complete Achromobacter_piechaudii_ATCC_43553 Draft Achromobacter_xylosoxidans_AXX A Draft Achromobacter_xylosoxidans_C54 Draft Acidovorax_NO_1 Draft Bacillus_anthracis_Ames_Ancestor_ Complete Bacillus_anthracis_str Vollum Draft Bacillus_cereus_E33L Complete Bacillus_cereus_G9241 Draft Bacillus_cereus_NVH0597 99 Draft Bacillus_cereus_W Draft Bifidobacterium _longum_NCC2705 Complete Bifidobacterium_longum_infantis_157F Complete Bifidobacterium_longum_infantis ATCC_15697 Complete Streptococcus _agalactiae_2603V_R Complete Streptococcus _infantar
13. elect Software and then click on Download BLAST BLAST is then downloaded and installed in your Gegenees installation folder under the new directory bin blast BLAST can also be downloaded from ftp ftp ncbi nlm nih gov blast executables blast In general the latest version of BLAST is recommended and can be downloaded from ftp ftp ncbi nlm nih gov blast executables blast LATEST There is one exception though and it is regarding Windows computers At the time of writing the latest version of BLAST is version 2 2 26 which for unknown reasons and seemingly at random gets stuck Version 2 2 25 works fine though and this is the version that Gegenees uses in its automatic download Chose a version that corresponds to your OS and architecture 32 bit 64 bit and extract or in windows run the installation program If you have downloaded BLAST manually Gegenees must be configured to find BLAST Click File and then Preferences in the Gegenees menu In the preference dialog click on Third party software components and specify the full path name to the directory containing the BLAST executables and then click OK E g Windows C blast bin or Linux usr local blast If BLAST is added to your system path you may not need to specify the path Third party software components Gegenees preferences Te Te Paths and settings for third party software components Path to NCBI BLAST executables C Users Anders
14. he show fragments button to load the fragments It is possible to sort the table based by clicking the header The type of biomarker score to be shown can be selected in the info region File Edit New Data Software Help eQ Run alignment Included genomes D Group settings La Heat plot bse Score overview Eg Fragment Coord from Coord to Biomarker max min Targetmax Targetmin Targetavg Backmax Back avg Annotations in fragment Bacillus_anthracis_Ames_Ancestor_ 1_277 138001 138500 0 14 924 0 924 0 924 0 791 0 197 8 GBAS_pX01_0156 137 Bacillus_anthracis_Ames_Ancestor_ 1_278 138501 139000 0 02 924 0 924 0 924 0 907 0 226 8 GBAA_pX01_0157 138 Bacillus_anthracis__Ames_Ancestor_ 1_279 139001 139500 0 11 924 0 924 0 924 0 819 0 204 8 GBAA_px01_0157 138 Bacillus_anthracis_Ames_Ancestor_ 1_280 139501 140000 0 2 924 0 924 0 924 0 743 0 185 8 GBAA_pX01_0157 138 Bacillus_anthracis__Ames_Ancestor_ 1_281 140001 140500 0 17 924 0 924 0 924 0 769 0 192 3 GBAA_pX01_0158 139 Bacillus_anthracis__Ames_Ancestor_ 1_282 140501 141000 0 19 924 0 924 0 924 0 749 0 187 3 GBAA_px01_0158 139 Bacillus_anthracis_Ames_Ancestor_ 1_283 141001 141500 0 08 924 0 924 0 924 0 852 0 213 0 GBAA_px01_0161 141 Bacillus_anthracis_Ames_Ancestor_ 1_284 141501 142000 0 01 924 0 902 0 913 0 896 0 246 5 GBAA_pX01_0162 141 Bacillus_anthracis_Ames_Ancestor_ 1_285 142001 142500 0 0 924 0 924 0 924 0 924 0 231 0 GBAA_px01_0163 142 Bacillus_anthracis_Ames_Ances
15. ible to zoom into the graph by selecting a region with the right mouse button down If the left mouse button is used the corresponding region is selected A selection can thereafter be loaded into the tabular view for further data mining by a right click There are possibilities to export the graph as seen on the screen as an image It is also possible to export the data to a file that can be explored in Artemis see section below File Edit New Data Software Help Reference organism Bacillus_anthracis__Ames_Ancestor_ Biomarker score max min Exclude drafts Max fragment Z Downwards Biomarker score max average Exclude drafts Max fragment X Subsequence coordinates cursor Ar aljagmens wih score aver threshold Score type Bm max min X Threshold Exports image _ Workspace work space Analysis Demo Database Default Viewing a signature in Artemis It is possible to export an interesting sub sequence from the genome or the whole genome if it is completed into a format that can be viewed in Artemis http www sanger ac uk resources software artemis The export will end up in a directory called export under the workspace directory It will be a gbk file that essentially is the same file as the original gbk file if there are problems or warnings when loading the original file in Artemis they will remain The gene a
16. ius_CJ18 Complete Streptococcus _oralis_Uo5 Complete Streptococcus_pneumoniae_Hungary19A 6 Complete Filter text Total 23 Visible 23 Selected 0 Populate the local database It is possible to download genomes from a remote FTP server by clicking in the database manager Data and then Import by FTP A few predefined FTP sites are distributed with the Gegenees software and can be found in the section called FTP client settings at the center of the window These predefined site are the NCBI complete genomes pointing at ftp ftp ncbi nih gov genomes Bacteria and NCBI genomes bacteria draft pointing at ftp ftp ncbi nih gov genomes Bacteria_DRAFT and NCBI Genbank bacteria draft pointing at ftp ftp ncbi nih gov genbank wegs NCBI Genbank bacteria draft contains more genomes than NCBI genomes bacteria draft Select one in the combo box and click on the button with two yellow arrows to connect When you are connected to the FTP server you get a list of available genomes where you can select the ones you want to download When you have selected the genomes you which to download click the green arrow to download them to your local database The FTP sites are defined by a file ending with site in the ftp directory in the workspace directory It is possible to make own site files Copy the content of the existing files and replace the HostName and the Directory fields with custom i
17. lp main menu Gegenees Version 1 1 0 For more info visit http www gegenees org Installation Details What s new Since version 1 0 4 our aim has been to make Gegenees more intuitive and user friendly The implementation of wizards for creating comparisons was one major step in this direction but also the new database manager and ftp client along with some under the hood structural rearrangements facilitates this aim Installation The software can be downloaded from http www gegenees org There are several variants uploaded depending on your operating system OS Windows Macintosh and Linux are supported You must also chose the correct processor architecture 32 bit or 64 bit To see the architecture In Windows 7 select properties when right clicking computer In Macintosh select About this Mac from the Apple menu Mac OS X 10 5 or greater is a 64 bit In Linux in a terminal type uname a If x86_64 or ia64 is shown the system is 64 bit Java needs to be installed You may check your Java version at this link http java com en download installed jsp Download and extract the compressed Gegenees program Run the Gegenees program from in the Gegenees folder You will then be asked to specify a Workspace This is the place where all your genomes and comparisons will be stored If Gegenees starts OK it is time to install BLAST Gegenees can download and install BLAST for you if you s
18. nd misc feature track is replaced by the biomarker scores Five files are exported 1 the original annotated file with also the gene and misc feature track intact 2 a file with Biomarker scores max min as a misc_feature track 3 a file with Biomarker scores max avr as a misc_feature track 4 a file with Bimarker scores avr avr as a misc_feature track 5 a file with Biomarker scores max min only complete genomes as a misc_feature track An example of how this kind of export will look like in Artemis is shown below ie R Artemis Entry Edit 3 anti Ames File Entries Select View Goto Edit Create Run Graph Display Entry Selected feature bases 369 amino acids 122 GBAA 1672 locus_tag GBAA_1672 codon_start 1 transl_table 1l product flagellar protein Flis p RTT em TT n TTT TT TTT TCT em TOT TTT TUT TTL S gK GBAA 1672 JC fliH GBA flgD yE GBAA 1698 GBAA 1701 TE n E E CTC a em ST E LE UN m a m GBAA GBAA 1673 iE GBAA 1683 GBAA 1667 GBAA 1692 GBAA 1695 j 1707 fli ULUL m m S a a TM a a a a fliD 1iG fliI GBAA GBAA 1697 1704 C GBAA 1 GBAA isc_feature mi misc feature feature e e misc_feature ture isc_feature ature ture e mi misc_feature mi misc_feature e misc_fec nisc_fea misc_feature 7400 15796500 iss1800 564000 15686200 15886400 issoe00 isszeoo usosooo 1s97200 s assa400 Lso1s00 1603600 1sosoo0 16o8z00 _ ae1040q IDE ANT WON OE TI TAA We OO O OOK M OY OO
19. nd highly conserved regions Target group average score Shows the average conservation within the target group Can be used to find highly conserved regions Background group maximum score Shows the best score in the background group This represent the worst cross reaction Background group minimum score Shows the minimum score in the background group Can be used to find regions that are not conserved in a group of very related genomes Background group average score Shows the average conservation within the background group The biomarker scores are drawn graphically There is possibilities to compare two types of scores by drawing one upwards from the coordinate axis and a second downwards The graphical view is spitted into two rows in order to use the computer screen optimal do not confuse the upper row with the upwards score there are upwards scores in both rows there is a possibility to exclude draft genomes in the calculations since they sometimes lack regions that in some cases may disturb the analysis When the mouse moves over the graph the sub sequence fragment number and coordinate at the cursor position is shown in the info part to the right The number of fragments that each pixel column on the screen represent is also indicated It is also possible to see how many percent of the genome has a biomarker score over a certain threshold This gives a good overview of the how much genomic regions one can expect It is poss
20. nformation The FTP site must be formatted as the NCBI site If you need to connect to other types of ftp sites contact the support at Gegenees Gegenees genome format Gegenees uses a folder for each genome The folder name corresponds to the Name of the genome as appearing in Gegenees and the type of the genome Draft Complete The last part of the folder name has the format Draft or Complete In future versions more types may be introduced The folder contains at least one Genbank formatted file with extension gbk or gbff If there are several subsequences contigs they may be in the same file or in separate files Genomes are stored in the database folder s but also in the comparison folders Thus the comparison keeps a copy of the part of the database it is using If the database is modified the genomes belonging to a comparison is still untouched in the comparison folder Gegenees comparisons At present Gegenees conducts two base types of analyses a fragmented all against all comparison and a primer mapping Structurally Gegenees treats all analyses as comparisons even if it is called primer mapping The Gegenees comparison is a package containing e alist of genomes that belongs to the comparison e acopy of all the genomes as they looked like when they were added to the comparison e one alignment which represents a comparative calculation at a certain resolution see below e Files coupled
21. opy Delete Bacillus_anthracis_str _Vollum Bacillus_cereus_E33L Grouping modification Bacillus_cereus_G9241 Bacillus_cereus_NVHO0597 99 Bacillus_cereus_W Organism Target Background Reference Exclude Select as target organism Select as background organism Select as reference organism Exclude organism Workspace work space Analysis Demo Database Default Heat plot tab The heat plot tab gives an phylogenomic overview of the data It is the average normalized BLAST score values of all fragments that are shown It is also possible to define threshold values meaning that that fragments falling under the threshold is not used to calculate the average similarity value This gives a better phylogenetic signal since the similarity value is only based on conserved genetic material the core genome It is also possible to see how large the core genome is at the specified threshold select show core instead of show score It is possible to change the color profile of the heat plot so that differences are highlighted as well as possible for the particular dataset The number of decimals shown can be changed The genomes are sorted alphabetically which often is sufficient There are sorting possibilities built in for the heat plots It is possible to move genomes or group of genomes with the Move selection to row field or by right clicking it and select move from the context menu The target an
22. our primers click next and select what genomes to run your primer mapping against and run the analysis New primer mapping Chose a name and define your primer sequences for the primer mapping Chose aname DemoPrim gt test primer1 a agcgctgca gt test primer 2 i ttgatctaagtgaaggat gt test primer 3 acgcgctaacga Import primer sequence from FASTA file The primer mapping can now be explored in the Primer score table tab The unalignment index represents mismatches in the alignment plus non aligned nucleotides It is marked green if it is a perfect match A target group background group setting can be loaded from a fragmented alignment and the genomes are color coded accordingly so that a the primer matching can easily be compared to the target group definition File Edit New Data Software Help itl E Primer mapping HEH Primer score Select primer A Fiter by Database Database Primer name Unalignment index Identity Query length Alignment length Mismatches Bacillus_cereus_W Background test_primer_1 3 100 0 15 12 Bacillus_cereus_W Background test_primer_2 2 90 0 20 20 Bacillus_cereus_NVH0597 99 Background test_primer_1 3 100 0 15 12 Bacillus_cereus_NVHO597 99 Background test_primer_2 ot 100 0 20 20 Bacillus_cereus_G9241 Background test_primer_1 3 100 0 15 12 Bacillus_cereus_G9241 Background test_prime_2 OD 000 20 20 Bacillus_cereus_E33L Background test_
23. primer_1 3 15 12 Bacillus_cereus_E33L Background t_prir 10 20 20 Bacillus_anthracis_str _Vollum T arget tpt 33 15 15 Bacillus_anthracis_str _Vollum Target t_pri 20 20 Bacillus_anthracis_Ames_Ancestor_ Reference t_prir 15 15 Bacillus_anthracis_Ames_Ancestor_ Reference tpi 20 20 Acidovorax_NO_1 Not in group t_pri 10 15 it Acidovorax_NO_1 Not in group test_primer_2 1 33 20 15 Workspace work space Analysis DemoPrimer Database Default If a primer row is double clicked with the mouse or the show alignment button is pressed the alignment of this primer against this genome is shown The table and the alignment views can also be exported as text files a BLAST result BLASTN 2 2 25 Reference Zheng Zhang Scott Schwartz Lukas Wagner and Webb Miller 2000 A greedy algorithm for aligning DNA sequences J Comput Biol 2000 7 1 2 203 14 G3 fna 6 sequences 5 843 235 total letters Database Query test_primer_2 Length 20 Sequences producing significant alignments Nc_007105 gt NC_007105 Length 53501 Score 38 1 bits 20 Expect Identities 20 20 100 Gaps Strand Plus Plus 8e 005 0720 0 Query 1 TATGTATCACCTGTATTAGA 20 TTT Sbjct 19861 TATGTATCACCTGTATTAGA 19880 Lambda K H 1 33 0 621 1 22 Gapped Lambda K H 1 28 0 460 0 850 Effective search space used 23372556 Database G3 fna Posted date May 24 2012 11 02
24. taneously calculating threads is indicated and also the thread number and the total number of threads that should be run It is possible to send a pause signal and then resume the calculation later After all the threads have been run some data analysis is made and then the alignment is completed Once an alignment is completed it is possible to analyze the data in the other tabs in the analysis perspective An alignment is represented on the hard drive by a folder with the prefix alignment_analysis Gegenee File Edit New Data Software Help Progress log Number of BLAST jobs 0 Succesfull BLAST jobs 0 Failed BLAST jobs 0 Nr Genomes Logfile Parameters Fragment size Sliding step size Versions Method Status Created Status Run time Estimated time left l Alignment control Cotas Sra paesi Workspace work space Analysis Demo Database Default The analysis The analysis perspective also contains different tools for analyzing the data from a completed alignment The tabs are Included genomes This tab is a list of all genomes included in the analysis There is also the place for add or remove genomes from the comparison Group settings A tabular view of the genomes that allows definition of the target and background groups for the analysis Heat plot This tab represents an phylogenomic overview of the data based on average similarities Score overview This tab represents a graphical overvie
25. tor_ 1_286 142501 143000 0 0 924 0 924 0 924 0 924 0 231 0 GBAA_pX01_0163 142 Bacillus_anthracis_Ames_Ancestor_ 1_287 143001 143500 0 03 924 0 885 0 904 5 313 0 228 3 GBAA_pX01_0163 142 Bacillus_anthracis__Ames_Ancestor_ 1_288 143501 144000 0 02 924 0 918 0 921 0 902 0 225 5 GBAA_pX01_0164 143 Bacillus_anthracis_Ames_Ancestor_ 1_289 144001 144500 0 0 924 0 924 0 924 0 924 0 231 0 GBAS_pX01_0164 143 Bacillus_anthracis_Ames_Ancestor_ 1_290 144501 145000 0 01 924 0 924 0 924 0 918 0 229 5 GBAA_pX01_0164 143 Bacillus_anthracis_Ames_Ancestor_ 1_291 145001 145500 0 01 924 0 918 0 921 0 924 0 231 0 GBAA_pX01_0164 143 Bacillus_anthracis_Ames_Ancestor_ 1_292 145501 146000 0 0 924 0 918 0 921 0 918 0 229 5 GBAA_pXO1_0164 143 Bacillus_anthracis__Ames_Ancestor_ 1_293 146001 146500 0 0 924 0 924 0 924 0 924 0 231 0 GBAA_px01_0164 143 Bacillus_anthracis_Ames_Ancestor_ 1_294 146501 147000 0 0 924 0 913 0 918 5 913 0 228 3 GBAA_pX01_0185 146 Bacillus_anthracis__Ames_Ancestor_ 1_295 147001 147500 924 0 924 0 924 0 918 0 229 5 GBAA_px01_0166 146 Bacillus_anthracis_Ames_Ancestor_ 1_296 147501 148000 924 0 924 0 924 0 900 0 225 0 GBAA_pXO1_0167 147 Bacillus_anthracis_Ames_Ancestor_ 1_297 148001 148500 924 0 924 0 924 0 924 0 231 0 GBAA_pX01_0168 148 Bacillus_anthracis__Ames_Ancestor_ 1_298 148501 149000 I 924 0 924 0 924 0 924 0 392 8 Intergenic between GB Bacillus_anthracis_Ames_Ancestor_ 1_299 149001 149500 924 0 881 0 302
26. w and exploration tool of the genomic regions that are unique or discriminatory for the target group Score table This tab represents a tabular exploration tool for the genomic regions that are unique or discriminatory for the target group Included genomes tab The included genomes tab shows all the genomes that are included in the comparison If you want to add or remove genomes from your comparison it is possible by clicking on the button Modify comparison It is also possible to export genome info for all genomes that are included in the comparison File Edit New Data Software Help eQ Run alignment fa Included genomes Group settings fj Heat plot Em Score overview Score table Filter All genomes Complete genomes Draft genomes Bacillus_anthracis_Ames_Ancestor_ Genome Bacillus_anthracis_str _Vollum Bacillus_cereus_E33L Bacillus_cereus_G9241 Hl Bacillus_cereus_NVH0597 99 Bacillus_cereus W Total 6 Visible 6 Selected 0 E j J i Modify comparison Workspace work space Analysis Demo Database Default Group settings tab The group settings tab allows the target group and the background group to be defined e The target group represents the genomes that you are interested in You might want to find discriminatory genomic regions that can be used to design specific molecular assays You might also be interested in finding and analyzing
27. w tab shows a graphic representation of the biomarker scores Biomarker scores are score values that rank all genomic regions fragments in how discriminating they are for the target group in terms of conservation no false negatives and uniqueness no false positives in the background There are three types of scores with different stringency Biomarker score max min Biomarker score max average Biomarker score average average Target group maximum score represents the highest stringency The high scoring fragments must be present and conserved in ALL target group genomes and must be absent or very diverged in ALL background genomes The score goes from 0 or negative values representing bad regions up to 1 which represents a perfect region The score is based on the worst background genome max score and on the worst target group genome min score Similar to Biomarker score max average but uses average values of the background group relaxes the uniqueness criterion Similar to Biomarker score max average but uses average values of the background group and the target group relaxes the uniqueness and the conservation criterion Shows the best score in the target group self score This is usually 100 everywhere but if bad regions are present in the sequence e g nnnnnnnnnnnnnn they can be identified here Target group minimum score Shows the worst conservation within the target group Can be used to fi
Download Pdf Manuals
Related Search