Home
English - Magtrol
Contents
1. MODEL 6200 22 CONTROLLER DISPLAY POWER AUK TORQUE SPEED MAGTROL POWER DECREASE INCREASE E POWER UNITS TORQUE UNITS AUX SETUP CLR MENU SETUP BRAKE ON OFF TORQUE SET DISPLAY STORE RECALL DOWN Figure 2 1 Front Panel FRONT PANEL CoNrROLS AND BuTTONS The front panel controls and buttons from left to right are e Power switch e Five double function control button Secondary Function BRAKE ON OFF POWER UNITS UNITS DISPLAY TORQUE UNITS DISPLAY AUX SETUP STORE CLR MEM RECALL SETUP e Three single function control buttons e SHIFT enables saving function and secondary functions printed in blue above control buttons UP Left arrow moves cursor to the left DOWN Right arrow moves cursor to the right e Decrease Increase Dial decreases or increases the selected parameter Enabling Secondary Functions To enable the secondary function of the double function control buttons 1 Press the blue SHIFT button and release it The word SHIFT appears in the dispay POWER AUK TORQUE Figure 2 2 Secondary Function Menu 2 Press any control button to enable the function shown in blue letters above the button 12 z T O Z 0 2 m 2 gt r Magtrol Model 6200 Open Loop Dynamormeter Controller Chapter 2 Controls 2 1 2 2 POWER UNITS TORQUE UNITS AUX SETUP CLR MEM OR SETUP 3 Press the SHI
2. ERE E qe Pep ERI p o n 23 7 TROUBLESHOOTING ini tette att aie 26 APPENDIX A LABVIEW PROGRAMMING EXAMPLES erret 27 AJ SIMPLE READ pete Rte be ne Mr e ue ee Re bores Lees aereo dea oe atu ER Pe ees dee ERES 27 A2 CURRENT STABIEIZED t pese red t rece n ice e e UE e ERR teer 28 APPENDIX B FRONT PANEL DISPLAY MENU FLOW CHARTS 29 B 1 SETUP MENU ten e ER E eee i HERES eM 29 B 2 POWER UNITS MENU het roit att d eo eves Pee e QE 30 B 3 AUX SETUP MBENU nn ehe e e EOD ED EE REO RERO Erg 30 B 4 TORQUE UNITS MENU eee eet re d e eae rh be arsi de ets tein 31 APPENDIX SCHEMAT O endet 32 CL ENCODER SWITCH BOARD tret tito Pe Pe 32 POWER SUPPLY inte tee eqeen igo e aei b e HE 32 3 DSP amp MEMORY d nde 33 C4 ANALOG t ee t e d D Ra eR teet b e pe dee aa e eee eie pee 34 SERVICE INFORMATION o resiste en RHET itte pai 35 RETURNING MAGTROL EQUIPMENT FOR REPAIR AND OR CALIBRATION eene 35 Returning Equipment to Magtrol Inc United 5 35 Returning Equipment to Magtrol SA Switzerland essere eene rennen et enne 35 vi Magtrol Model 6200 Open Loop Dynamormeter Controller Table
3. ROTARY ENCODER 2 POWER SUPPLY U1 5VD 5VA LM340T5 OUT 9 8 14A 30 515 05 m gt 0 0 2 m 14 56 28 32 ics Schemat Appendix C DSP amp MEMORY 3 Magtrol Model 6200 Open Loop Dynamormeter Controller C APPENDICES 0 919821V Z88v LNL zezSu PN a PA 91 PA vL 1nozxu 9 NILXY 1noixu bet E inoixi E E vaa pozn EC En orr 08d 22 5 002HYZ 6 559 6 5 B 002HvZ V eod axu ej 29 LOd QXL 9 9 699 Vdd 3 zodnios 594 095 24 126 91 154 24 295 A Ea 39s 90d MOS Ls aus 29 xen 4 5 prier ais 015 E 9T s 9 ead eT vad vr Sad 28 7 68d ead L vH zou In sna 50 28 8 18 lt Aqu odid e ee X Ol ge Lon au 1 sa Te S aava 8 454 sa he 98 zz EL YV i s 30 snav snag r9o0oronezog 5520660008 9ELOHPZ s svoa snaa snav a osa g S2av1 iz soav so INN O
4. Ue Auxiliary Input Offset and Gain Items needed for calibrating the 6200 e External voltage reference of 0 to 5 volts DC e Digital multimeter DMM e Function generator with square wave TTL output Z i z gt z O m Both instruments should have a VDC accuracy of 0 05 or better 6 3 1 INITIAL CALIBRATION PROCEDURE Note Record the actual correction factors displayed before proceeding with calibration 21 Chapter 6 Calibration Magftrol Model 6200 Open Loop Dynamormeter Controller 1 Allow the 6200 to stabilize in an environment with e An ambient temperature of 18 C to 25 e Relative humidity less than 80 Turn on the 6200 3 Allow the 6200 to warm up for at least 30 minutes 4 Enable the calibration mode as follows a Turn instrument power OFF b Press in and hold the UP lt and DOWN P buttons simultaneously c Turn instrument power ON d Continue pressing the UP and DOWN P buttons until the display shows the software revision date then release e Press the SHIFT button once Note To exit CALIBRATE mode without making any changes press the SHIFT button 6 times 6 3 2 TORQUE OFFSET AND GAIN 1 Connect the external voltage reference common to Pin 13 and Pin 4 of the dynamometer input connector 2 Connect the external voltage reference high to Pin 14 of the dynamometer input connector 3 Apply 42 000 VDC 4 Press the DISPLAY but
5. Pat 3 isnra 2492 3d 3ISSH taav 1 82 3 22 4210858 aI jt 95 96278 5 E 5 aaan wol 11 300308 er mA far 328 oil rol ve 8293 eI Se A yraz ONG 1 p NOV c H DITS VAS 6 2 01 4 10 21492 Lu pe Leds ee T 1143 075 9 INY 143A VIENI LE L9 MENT 2T occ 90 E gl t NIA Ly A 5 VAS m 128 L 811 VAS eey 2 Tal e 5 yee v A amp 2 Wa yee vd t 6 ova lt 81 1 z ance MT 6 5 VAS APPENDICES 34 Service Information RETURNING MAGTROL EQUIPMENT FOR REPAIR AND OR CALIBRATION Before returning equipment to Magtrol for repair and or calibration please visit Magtrol s Web site at http www magtrol com support rma htm to begin the Return Material Authorization RMA process Depending on where the equipment is located and which unit s will be returned you will be directed to either ship your equipment back to Magtrol Inc in the United States or Magtrol SA in Switzerland Returning Equipme
6. Controller 10 Press SHIFT 11 Press UP or DOWN P to turn ON or OFF Speed PASS FAIL testing 12 If ON press SHIFT 13 Use the UP lt or DOWN P buttons and the Decrease Increase Dial to adjust the high limit for Speed 14 Press SHIFT 15 Use the UP or DOWN P buttons and the Decrease Increase Dial to adjust the low limit for Speed 16 Press SHIFT 17 Press UP or DOWN P to turn ON or OFF Auxiliary Input PASS FAIL testing 18 If ON press SHIFT 19 Use the UP or DOWN P buttons and the Decrease Increase Dial to adjust the high limit for Auxiliary Input 20 Press SHIFT 21 Use the UP DOWN P buttons and the Decrease Increase Dial to adjust the low limit for Auxiliary Input 22 Press SHIFT to exit 4 1 5 Up I O PARAMETERS Press and release SHIFT Press SETUP Press the DOWN P button twice Press SHIFT Press UP lt or DOWN P until you see the desired contrast level Press SHIFT Press UP lt or DOWN P until you see the desired GPIB address Press SHIFT Press UP or DOWN P until you see the desired RS 232 baud rate 10 Press SHIFT to exit O v m gt O z 9 HO RO 4 2 SETTING DYNAMOMETER LOAD Press the UNITS DISPLAY button Use the Decrease Increase Dial to adjust the current output to 0 Use the BRAKE ON OFF button to turn the brake ON Start the motor under test Use the UP or DOWN P buttons and the Decrease Increase Dial to adjust th
7. RPM clockwise with the dynamometer loading the motor to 22 6 oz in the 6200 will return S 1725T22 60R By manipulating the string the speed torque and shaft direction if required can be extracted Then separate numerical variables can be assigned to them for data processing SELECTING THE BAUD RATE FOR THE RS 232 INTERFACE The 6200 communicates with the host computer through a DB 9 interface connector The connector pin out is 2 RX 3 TX 4 DTR 5 GND No other pins are connected v m gt O z RX DTR TX GND 10 20 30 40 50 OX 12 0 6 7 8 9 Figure 5 2 Connector Pin Out The 6200 is equipped with an RS 232 serial interface To select the baud rate 1 Press SHIFT and release 2 Press SETUP button 3 Press DOWN P twice 4 Press SHIFT three times 5 Press the UP or DOWN P buttons to cycle through the following available baud rates 300 2400 9600 600 4800 19200 1200 6 Press SHIFT to Exit Other important communication parameters are No Parity 8 Data Bits Stop Bit Chapter 5 Computer Controlled Operation Magftrol Model 6200 Open Loop Dynamormeter Controller To wire your own serial communications cable use the following wiring diagram 9 Pin 23 4 5 6200 9 Pin 3 2 6 5 Computer A cable may also be purchased from your local electronics store A Radio Shack 26 152 cable and 26 264 null modem adapter are known to work The null modem adapter must
8. Readout outputs data acquisitionrate 120 at 120 S s Using an RS 232 interface samples per second the rate is 60 S s Communications L Sets low data The Controller Readout outputs data acquisition rate 3 8 at 3 8 S s default rate samples per second Magtrol Model 6200 Open Loop Dynamormeter Controller Chapter 5 Computer Controlled Operation Command Command Explanation Category Code Communications OA Communications Setup M1 Enables front panel controls NE Prompts to return to auxiliary input data string Prompts to return speedtorque direction data string Locks out front panel controls Resets as follows Manual control ON Low data acquisition rate Brake OFF Sets auxiliary input scaling to Sets encoder pulse count to Output Auxiliary prompt to return the value at the AUX INPUT x AUX SCALING factor Output Data prompt to return data string with this format SxxxxxTxxxxxRcrlf or TxxxxxLoerlf RorL is the shaft direction indicator as viewed looking at the dynamometer shaft where R right clockwise CW left counterclockwise CCW The speed will equal the displayed value and the torque will be in the same units as displayed on the front panel Use this command to enable front panel control of most functions Use this command to lock out the front panel controls so that the Controller Readout settings can be changed on
9. be used on the computer end of the cable O v m gt O z 20 6 Calibration 6 1 CLOSED BOX CALIBRATION The 6200 features closed box calibration The advantage of closed box calibration is that the user does not have to disassemble the case or make mechanical adjustments However the calibration of the Accessory Torque Output must be done internally with Offset and Gain trim pots The Torque readout and Auxiliary Input can be calibrated using external reference sources Correction factors for Offset and Gain are stored in nonvolatile memory They remain in effect until the user or the calibration house updates them The front panel displays the actual values for the ZERO and GAIN correction factors Record these values before calibration In the unlikely event of a Controller Readout failure it can re initialized by pressing and holding the STORE and RECALL buttons while turning the power internal memory and setups will be lost After re initializing reprogram the GAIN and ZERO values into memory 6 2 CALIBRATION SCHEDULE Calibrate the 6200 e After any repairs are performed e Atleast once a year more frequently to ensure required accuracy 6 3 BASIC CALIBRATION PROCESS The basic calibration process consists of four procedures which must be performed in the following order 1 Initial Calibration Procedure Torque Offset and Gain Speed Verification Accessory Torque Output Offset and Gain
10. circuit board for 0 mVDC on the DMM 5 Apply 2 000 VDC 6 Adjust R25 GAIN on the circuit board for 2 000 VDC on the DMM 6 3 4 AUXILIARY INPUT OFFSET AND GAIN 1 Press SHIFT button once Display indicates AUX INPUT calibration as follows Connect the external voltage reference to the Auxiliary Input BNC connector Apply 45 000 VDC Press DISPLAY button Adjust the gain by turning the Decrease Increase Dial until the displayed voltage equals the reference voltage Uni Ge Note The magnitude of change per revolution can be increased by pressing the UP button or decreased by pressing the DOWN button 6 Apply 0 000 VDC 7 Press UNITS DISPLAY button 8 Adjust the Decrease Increase Dial until the display indicates 0 mVDC 9 Repeat steps 3 through 8 to complete this procedure 10 Press SHIFT 11 Record the A ZERO correction factor for future reference 12 Press SHIFT 13 Record the A GAIN correction factor for future reference 14 Press the SHIFT button once to return to default display 6 4 ALTERNATE CALIBRATION PROCEDURE The 6200 can also be calibrated by using a certified dynamometer calibration beam and weight instead of an external voltage reference Note Magtrol suggests you do NOT use this method By using the alternate calibration procedure you are calibrating the 6200 to a specific dynamometer not to a reference standard If you connect the 6200 to a different dynamometer
11. connected The displays from left to right are m e POWER expressed in horsepower or watts AUX INPUT gt TORQUE 2 e SPEED Memory Indicator 2 3 1 CONTRAST SETTINGS The 6200 is shipped with the Contrast Setting at zero lowest in order to prolong display life If it is necessary to increase the Contrast for improved readability execute the following steps 1 Press SHIFT 2 Press COM SETUP button 3 Select CONTRAST until desired brightness is reached 4 Press SHIFT to return to main menu Note Make sure the lowest possible setting is used to achieve desired result Using a setting higher than necessary may cause display segments to burn in over a period of time resulting in uneven illumination from segment to segment 2 3 2 DisPLAYING DESIRED INFORMATION 2 3 2 1 Local Control 1 Press SHIFT and release then press POWER UNITS to see UNITS displayed 2 Press UP DOWN P to scroll through available choices 3 Press SHIFT to exit 4 Press SHIFT and release then press TORQUE UNITS to see UNITS displayed 5 Press DOWN P to scroll through options for units 6 Press SHIFT to exit 7 Press RECALL to view memory contents last in first out 8 Press SHIFT to exit 2 3 2 2 Remote Control Refer to 6200 Command Set in Chapter 4 The 6200 with a PC for a list of commands recognized by the 6200 2 3 2 3 Auxiliary Input 1 Press SHIFT and release then press AUX SETUP 2 Rotate Decr
12. nnn 14 23 1 2 Changing the GPIB Primary Address t petet etre i 15 5 2 CHECKING THE 6200 TO PC CONNECTION 2 Ee ite ener ter tette ELE UR ed e tete 15 5 3 PROGRAMMING deam Rat ede 16 5 4 6200 COMM ANN D SET tt rette to Ree a ret He RES Pe 16 9 41 gt 6200 16 5 5 ACQUIRING SPEED TORQUE DATA eae een coe eh bd dee 18 5 6 SELECTING THE BAUD RATE FOR THE RS 232 INTERFACE 19 6 CALIBRATO N 21 6 1 CLOSED BOX CALIBRATION ether ret coe bak 21 6 2 CALIBRATION SCHEDULE aii hea ae eee eS 21 6 3 BASIC CALIBRATION PROCESS iti tere Meet e dude 21 6 3 1 Imtial Calibration Procedure teet RR HR E ERE EA F E vn Pee e 21 6 3 2 Torque Offset amd Gain scars iiu Rees eee e 22 6 33 Accessory Torque Offset and Gain tede sette tiit enter tp repeti e E RR ge e E ete Eie Rs 23 6 3 4 Auxiliary Input Offset and Gain en nee netten etes enne nnn 23 64 ALTERNATE CALIBRATION PROCEDURE
13. of Contents TABLE OF FIGURES 2 CONTROLS unes erii 12 Fig te 2 1 Front Patel nee cett e eee n baee YU Meere ERES HE dea een ARE ven EXE LY 12 Figure 2 2 Secondary Function pte rettet i ree rr EHE E a ee Ele EDO Rep ebd 12 Figure 2 3 Rear Panel Ue Re D RU e et i OTHER ert rond 14 Figure 2 4 Dynamometer Brake Outp t erede teet epe iie b ar 14 Figure 2 5 Accessory Torque Speed 2 024804224244 1 0 00 14 Figure 2 6 Dynamometer TSC1 Connector 15 Figure 2 7 RS 232C Interface in t e m I e 15 Figure 2 8 GPIB IEBE 488 Interface e hlc P p 15 3 INSTALLATION iiic toti iei bio E toon i 9 Figure 3 1 Cover for Voltage Selector Fuses isnin i ot i exte doves e epe ind 9 5 COMPUTER CONTROLLED 2 22 06 14 Figure 5 1 GPIB IBBE 485 ioeie ri nete rte eere e Ree eR eR eL eee ES T ER ERR RE ER Rege thy 15 Figure 5 2 Connector Pin Out dte rte eerte ten P Pe OR EH ES ETHER e Ee 19 gt 24 21 Figure 6 1 Alternative Calibration aeter et ee ad e e rete cus HEU RET 24 vii Preface PURPOSE OF THIS
14. quaerit 10 31 3 Test sse niae IC eoe e an E OH E E Ra 10 33 2 BASICSTEST SETUP pte a aet dee C TIR e er Rb edes 10 4 MANUALLY CONTROLLED OPERATION nnn nnne nn nnne nnn nan 11 4 1 SETTING DESIRED OPERATING 8 11 4 1 1 Set Power Display to Desired Units Watts Hp or AUX 2 11 4122 Set Display to Desited Torque tee e be 11 41 3 Setup System Parameters eee e b e ra e ea e roe REN E 11 4 14 Sec Up Pass Fail Parametri S 11 4 1 5 Up VO Parameters noce de eee eH p a eO e ec re 12 4 2 SETTING DYNAMOMETER LOAD rte ttt tete ert ERR 12 4 3 USING INTERNAL MEMORY 5 estes eto t ep ite cds Gn e e e tee 13 Stonng Data Ports Ree ete date elite e e 13 4 32 Recalling Data POIS iepr nenioo rrt Ee te eR PR ERE Een tars teret 13 43 3 the Memory Mode elu eee ates t e E Ce edet 13 434 Clearing the Memoty3 ence et e e E Een aes n er 13 5 COMPUTER CONTROLLED 2050 14 ABOUT THE GPIB INTEREAGE ere tee tne ee 14 Table of Contents Magftrol Model 6200 Open Loop Dynamormeter Controller 5 1 1 Installing the GPIB IEEE 488 Connector Cable essen nennen enne enne
15. 4 1 1 Power Desiren Units Watts Aux 1 Press and release SHIFT 2 Press POWER UNITS 3 Press UP or DOWN P to scroll through choices 4 Press SHIFT to exit 4 1 2 Set Desiren TonoUE Units 1 Press and release SHIFT 2 Press TORQUE UNITS 3 Press UP or DOWN until you see the desired unit of measure 4 Press SHIFT to exit v m gt O z 4 1 3 Set up System PARAMETERS 1 Press and release SHIFT 2 Press SETUP 3 Press SHIFT 4 Press UP lt or DOWN P until you see the desired unit of input torque 5 Press SHIFT 6 Press UP lt or DOWN until selection matches encoder installed on dynamometer 60 bit standard Press SHIFT Use the UP lt or DOWN P buttons and the Decrease Increase Dial to adjust the maximum power setpoint for the dynamometer in use 9 Press SHIFT to exit 9o vs 4 1 4 Set Up Pass FaiL PARAMETERS Press and release SHIFT Press SETUP Press the DOWN button once Press SHIFT Press UP lt or DOWN P to turn ON or OFF Torque PASS FAIL testing If ON press SHIFT Use the lt or DOWN P buttons and the Decrease Increase Dial to adjust the high limit for Torque Press SHIFT 9 Use the DOWN buttons and the Decrease Increase Dial to adjust the low limit for Torque am 9o Chapter 4 Manually Controlled Operation Magftrol Model 6200 Open Loop Dynamormeter
16. DIRECTIVES PROCEDURES ETC WHICH IF IGNORED MAY RESULT IN DAMAGE BEING CAUSED TO THE MATERIAL BEING USED THE ASSOCIATED TEXT DESCRIBES THE NECESSARY PRECAUTIONS TO AND THE CONSEQUENCES THAT MAY ARISE IF THE PRECAUTIONS ARE IGNORED WARNING THIS INTRODUCES DIRECTIVES PROCEDURES PRECAUTIONARY MEASURES ETC WHICH MUST BE EXECUTED OR FOLLOWED WITH THE UTMOST CARE AND ATTENTION OTHERWISE THE PERSONAL SAFETY OF THE OPERATOR OR THIRD PARTY MAY BE PUT AT RISK THE READER MUST ABSOLUTELY TAKE NOTE OF THE ACCOMPANYING TEXT AND ACT UPON IT BEFORE PROCEEDING FURTHER viii 1 Introduction 1 1 1 2 UNPACKING YOUR 6200 Your 6200 was packaged carefully for shipping Please notify your carrier and Magtrol Customer Service if you believe your unit was damaged in shipping 1 2 3 Save all shipping cartons and packaging material until you inspect the 6200 Inspect the 6200 for any evidence of damage in shipping Make sure the carton contains the following max ur 9 EN ot a il xi 6200 Dynamometer Controller Readout S p DF Certificate of Calibration Line cord Calibration Certificate Magtrol User Manual CD Rom FEATURES OF THE 6200 High quality easy to read display Vacuum fluorescent readout with 0 36 9 1 mm high dig
17. DRESS Each instrument serviced by the GPIB has its own Primary Address code which enables the IEEE 488 INTERFACE D1 130E D5 D2 14 D6 D3 15 D7 D4 16 D8 EO1 17 REN DAV 18 DAV COM NFRD 19 NFRD COM NDAC 20 NDAC COM IFC 21 IFC COM SRQ 910 22 SRQ COM M11 23888 ATN COM SHIELD 912 24888 SIGNAL GROUND Figure 5 1 GPIB 488 Interface v m gt O z computer to obtain readings from the instrument The factory default setting on the 6200 is 15 Some PC interfaces can access from one to fifteen 4 bit primary addresses Other interfaces can access as many as thirty one 5 bit primary addresses The 6200 uses the 4 bit format 1 Oy eG R9 Press the SHIFT button and release Press SETUP Press DOWN P twice Press SHIFT twice Press lt or DOWN until you see the desired GPIB address Press SHIFT twice to exit CHECKING THE 6200 TO PC CONNECTION Note Make sure that the 6200 and its host computer are communicating before acquiring data Make sure the primary address is set correctly for the 6200 Set the input variable to 15 characters 13 variable characters and the two required data termination characters CR and LF See Programming in this chapter Issue output data command OD and read 15 characters according to the instructions for your GPIB interface Chapter 5 Computer Controlled Operatio
18. ERATION How to run a test when the 6200 is used as a stand alone unit Includes information on setting power and torque units torque and speed control and open loop control COMPUTER CONTROLLED OPERATION How to run a test when the 6200 is used with a PC Includes information on GPIB Interface RS 232 Interface data format programming and command set CALIBRATION Provides recommended calibration schedules along with step by step instructions for the calibration procedure TROUBLESHOOTING Solutions to common problems encountered during setup and testing LABVIEW PROGRAMMING EXAMPLES Magtrol s comprehensive motor test software programs made specifically to compliment the 6200 Dynamometer Controller FRONT PANEL DISPLAY MENU FLOW CHARTS A visual display of various setup procedures vii Preface Magftrol Model 6200 Open Loop Dynamormeter Controller Appendix C SCHEMATICS For Encoder Switch Board Power Supply DSP amp Memory and Analog I O CONVENTIONS USED IN THIS MANUAL 857 The following symbols and type styles may be used in this manual to highlight certain parts of the text Note This is intended to draw the operator s attention to complementary information or advice relating to the subject being treated It introduces information enabling the correct and optimal functioning of the product to be obtained CAUTION THIS IS USED TO DRAW THE OPERATOR S ATTENTION TO INFORMATION
19. FT button again to exit the secondary function and return to main menu How ro Use Front PANEL AND BUTTONS z T O Z Controls Single Function Buttons _ Button Tous Function POWER Press to turn power ON Turns power ON or OFF Press O to turn power off SHIFT Press this button and release Enables the function written in blue then press desired control above control button button UP LEFT Press Increases magnitude of change when adjusting a numerical value speed torque or max speed DOWN RIGHT Press Decreases magnitude of change when adjusting a numerical value speed torque or max speed DECREASE Turn clockwise or Increases or decreases the parameter INCREASE DIAL counterclockwise selected Double Function Buttons ToUs Function POWER UNITS Press SHIFT and release then Sets power display to WATTS HP or press this button AUX input BRAKE ON OFF Toggles brake ON or OFF TORQUE UNITS Press SHIFT and release then Enables you to set desired unit of press this button measure Press UP or DOWN button to see options Press SHIFT to enable option UNITS DISPLAY Press Shows power units torque units and percent of full scale current output AUX SETUP Press SHIFT and release then Enables you to set the scaling of the press this button auxilary input DISPLAY Press When in the PASS FAIL mode shows actual value of parameter CLR MEM Press SHIFT and r
20. Fail feature This feature is ideal for quick pass fa go no go testing in production and incoming inspectio applications When the 6200 is operated in the Pass Fail mode one of thre readings is used as the tested parameter torque speed or th auxiliary transducer The two parameters not used are set wit user defined upper and lower acceptable limits As the is loaded to the tested parameter value for example speed the other two parameters in this case torque and transduce are measured Test results for the other 2 parameters a1 indicated with a PASS or FAIL or the display can t toggled to show the actual values MODEL 6200 CONTROLLER z T O Z DENER Magtrol Model 6200 Open Loop Dynamormeter Controller Chapter 1 Introduction z Snecifications 6200 Az m gt 2 MEASUREMENT CHARACTERISTICS O EG Maximum Torque 2000 units Width 19 0 in 483 mn z Maximum Speed 99 999 rpm Height 3 5in 89mn Speed 0 0196 of reading from 10 rpm to 100 000 rpm Depth 12 4 in 315 mn Accuracy Torque 0 2 of range x2 V with handles 13 8 351 mn Aux 0 1 of range 5 V Weight 16 37 Ib 7 42 ELECTRICAL CHARACTERISTICS Brake UL CSA 1 25 250 V Fuses 5 x 20 mm IEC 1 00 A 250 V Power 120 V UL CSA 800 mA 250V SB Power 240 V IEC 315 mA 250V T Power Requirements 75 VA Voltage Requiremen
21. GOW C S Fer eu 11 GAS 1SHA3M oVvivd OGA33 evivd vviva pue MI 01 1 sviva 19539 9viva ous NLY 8gviva 103 eviva LINId Ava orviva dl elviva viviva SLYLYA 90 41035 zoia 40 soa bua fer J 90 a soia 5 vo soia vuaav E 0 401a 20 19539 79 to 1 0 2 42009545 vn 33 Magftrol Model 6200 Open Loop Dynamormeter Controller ics Schemat Appendix C ANALOG I O C 4 YAS VAS ro ro TO TO P 62 5 T ad to I da g 92 4997 0997 9 QAS xe VAS S4 WHO 089 3LON WAS 07 a ANI og we 655 in ded 8 t 1000 SA T gr 19071 40 9m PSI WOO PINI NOWWOD Lg n rs pd vd viva Ino ved wrezontd 0 ve oy 28 ed Y 92977 n en ea eA X Jasa 9 9 SION 2 1 um 2 264 mE ne A 02 002 115 ND 01 T 161434 v us 82 871 087 10 001 1 OND 4 gt 689 9 698 153 13538 213538 898 IT 4c T wel 13 2 XS j 4 Lg 100 Tas gg 1005 Agr A 7 want 1072 een E
22. HOULD USE EHIS MANUALE e eerte te VII MANUAI ORGANIZATION titt er e HERR EPIO B VII CONVENTIONS USED IN THIS VIII sw npe pee EE 9 1 1 UNPACKING YOUR 6200 retirer e e p E ee te dps 9 12 FEATURES OF THE 6200 1 ete t ret A RC rede o dee ge e D eR eben 9 1 3 10 2 GONTROLS eodein ene auia ond earn 12 2 1 FRONT PANEL o RR E OO He re ette i qd 12 211 Front Panel Controls and nennen 12 2 1 2 How to Use Front Panel Controls and 13 2 2 REAR PANEL RO HO HE IU ea ee RD TAM RUE QUEE eee 14 22221 te CR eR USE ET NUES REL YN erae Pr 14 2 3 VACUUM FLUORESCENT DISPLAY 16 2 301 Contrast Set gs ERE 16 2 3 2 Displaying Desired Information pe dc D eg ibys rbi rie 16 3 INSTALLATION sss oes ss ct cats sce is cs et ats Ra cas tdi s dee Dd ete 9 31 POWERING UP THE 6200 e rhe it aedes tee Eee dp b EE qe send ETHER EL dened ERRAT 9 3 1 1 Setting Unit for Line Voltage serie p gie ite ER Rega 9 3 1 2 Hardware Connection EH re E Hp e EE ERE rede Ee a
23. KAACS TROL MODEL 6200 Open Loop Dynamomefter Controller User s Manual Purchase Record Please record all model numbers and serial numbers of your Magtrol equipment along with the general purchase information The model number and serial number can be found on either a silver identification plate or white label affixed to each unit Refer to these numbers whenever you communicate with a Magtrol representative about this equipment Model Number Serial Number Purchase Date Purchased From While every precaution has been exercised in the compilation of this document to ensure the accuracy of its contents Magtrol Inc assumes no responsibility for errors or omissions Additionally no liability is assumed for any damages that may result from the use of the information contained within this publication COPYRIGHT Copyright 2002 2014 Magtrol Inc All rights reserved Copying or reproduction of all or any part of the contents of this manual without the express permission of Magtrol is strictly prohibited TRADEMARKS LabVIEW is a trademark of National Instruments Corporation Microsoft is a registered trademark of Microsoft Corporation National Instruments is a trademark of National Instruments Corporation Windows is a registered trademark of Microsoft Corporation 15 Edition rev A March 2014 NA AACGSTROL Safety Precautions Make sure that all Magtrol dynam
24. MANUAL This manual contains all the information required for the installation and general use of the Model 6200 Open Loop Dynamometer Controller To ensure proper use of the instrument please read this manual thoroughly before operating it Keep the manual in a safe place for quick reference whenever a question arises WHO SHOULD USE THIS MANUAL This manual is intended for bench test operators who are going to use the Model 6200 Dynamometer Controller in conjunction with any Magtrol Hysteresis Dynamometer or auxiliary instrumentation MANUAL ORGANIZATION This section gives an overview of the structure of the manual and the information contained within it Some information has been deliberately repeated in different sections of the document to minimize cross referencing and to facilitate understanding through reiteration structure of the manual is as follows Chapter 1 Chapter 2 Chapter 3 Chapter 4 Chapter 5 Chapter 6 Chapter 7 Appendix A Appendix B INTRODUCTION Contains the technical data sheet for the 6200 Dynamometer Controller which describes the unit and provides its technical characteristics CONTROLS Description of the elements located on the front and rear panels of the unit INSTALLATION Provides setup options available with the 6200 Dynamometer Controller Illustrates and outlines the hardware connection setup and software configurations for each option MANUALLY CONTROLLED OP
25. S ONLY CONNECTING ANOTHER DEVICE TO THIS OUTPUT MAY CAUSE EQUIPMENT FAILURE z T O Z 0 2 m 2 gt r Magtrol Model 6200 Open Loop Dynamormeter Controller Chapter 2 Controls DYNAMOMETER Connect dynamometer signal cable here m Z m 2 gt 14 13 12 11 10 9 8 2 T O O Z 1 N C 8 COMMON 2 N C 9 D P 3 ISOLATED 22 VDC 10 TACH SIGNAL 4 ISOLATED 22 VDC 11 N C 5 6 7 ISOLATED 22 VDC 12 D P ISOLATED 22 VDC 13 TORQUE COMMON TACH 5 0 VDC 14 TORQUE SIGNAL Figure 2 6 Dynamometer TSC1 Connector Q AUX INPUT Connect auxiliary instrument signal cable here RS 232C Use this socket for RS 232 connector cable Figure 2 7 RS 232C Interface GPIB IEEE 488 Use this socket for GPIB cable meets IEEE 488 specifications 1 D1 13 D5 2 D2 14 D6 3 D3 15 D7 4 D4 16 D8 5 E01 17 REN 6 DAV 18 DAV COM 7 NRFD 19 NRFD COM 8 NDAC 20 NDAC COM 9 IFC 21 IFC COM 10 SRQ 22 SRQ COM 11 ATN 23 ATN COM 12 SHIELD 24 SIGNAL GROUND Figure 2 8 GPIB IEEE 488 Interface POWER Attach power cord here EARTH GROUND Attach earth ground here 15 Chapter 2 Controls Magftrol Model 6200 Open Loop Dynamormeter Controller 2 3 VACUUM FLUORESCENT DISPLAY VFD 2 T The VFD provides information about the control functions the motor under test and an auxiliary 2 m input device if
26. e loading on the motor gap CAUTION Do NOT EXCEED THE CAPABILITIES OF THE DYNAMOMETER OR THE POWER SOURCE IN USE MOTORS DRAW VERY LARGE CURRENTS WHEN HELD AT LOCKED ROTOR AND OVERHEATING MAY RESULT WHEN USING OPEN LOOP CURRENT CONTROL INDUCTION MOTORS CANNOT BE TESTED BEYOND BREAKDOWN EXCEPT AT LOCKED ROTOR Magtrol Model 6200 Open Loop Dynamormeter Controller Chapter 4 Manually Controlled Operation 4 3 4 3 1 4 3 2 4 3 3 4 3 4 USING INTERNAL MEMORY SToniNG Data Points 1 Press and release STORE The VFD will indicate STORE followed by a number This indicates the memory location that contains the data 2 Continue pressing STORE at each desired point RECALLING Data Points 1 Press and release RECALL The VFD will indicate RECALL followed by a number This number indicates the memory location that is being displayed The order of recalled data is LAST IN FIRST OUT LIFO A M also appears to the right of the SPEED display to let the user know that the displayed data is from memory and not real time data 2 Continue pressing RECALL until all the desired data is retrieved Once data has been recalled it is lost from internal memory ExiriNG THE Memory Mope 1 Press and release SHIFT CLEARING THE Memory 1 Press and release SHIFT 2 Then press CLR MEM v m gt O z 5 Computer Controlled Operation 5 1 The 6200 can be used with a personal computer to c
27. ease Increase Dial to select scale 3 Press SHIFT to exit 3 Installation Note Before installing the 6200 you should become familiar with the 887 front and rear panels as outlined in Chapter 2 Controls 3 1 POWERING UP THE 6200 SURE THE 6200 IS EARTH GROUNDED BEFORE STOP WARNING TO REDUCE THE RISK OF ELECTRIC SHOCK MAKE STARTING 3 1 1 SETTING UNIT Fon LINE VOLTAGE The 6200 will operate with either of the following power sources e 120 V 50 60 Hz e 240 V 50 60 Hz 1 Find the line cord receptacle on rear panel The line cord is a detachable NEMA Standard 3 wire 2 Make sure the selector matches the power source numbers should match the line voltage If not Locate the power entry module e Remove the line cord Insert a screwdriver into the slot and open the cover Slide the voltage selector so the desired line voltage appears in the window Install the appropriate fuses for that voltage Figure 3 Cover for Voltage Selector Fuses Chapter 3 Installation Magftrol Model 6200 Open Loop Dynamormeter Controller 3 1 2 3 2 CONNECTION Do not overload or stall the motor Prolonged overload can cause the motor to overheat Note To make sure that the 6200 is operational a Magtrol dynamometer with a test motor installed must be connected to the 6200 It is not required that the 6200 be connected to a computer 1 Connect the 6200 t
28. elease then Clears the data memory Resets next press this button memory location to O STORE Press Stores data into next available memory location SETUP Press SHIFT and release then Enables user to select SYSTEM press this button PASS FAIL and I O menus RECALL Press Displays memory contents beginning at last stored value 0 m 2 m 2 gt r Chapter 2 Controls Magftrol Model 6200 Open Loop Dynamormeter Controller 2 2 2 2 1 REAR PANEL The rear panel provides connectors and receptacles for connecting to appropriate equipment Refer to figures 3 4 and 5 in this chapter for detailed drawings of the brake ACCESSORY TORQUE SPEED OUTPUT DYNAMOMETER UL CSA 1 25 250V SB IEC 1A 250V T FUSE 5x20mm 240V IEC 315mA 250V T Figure 2 3 Rear Panel Rear PANEL FUNCTIONS The rear panel from left to right provides the following functions BRAKE Connect dynamometer brake cable here Current 35V Regulation Fused Figure 2 4 Dynamometer Brake Output BRAKE Contains brake fuse 5 x 20 mm FUSE UL CSA 1 25A 250V SB IEC 1 250V CTRL OUT Connect to Model 5241 Power Amplifier when using HD 825 Dynamometer Q 55 Connect accessory output cable here optional TORQUE SPEED OUTPUT 1 TACH SIGNAL 2 TORQUE OUTPUT 3 D P 4 TORQUE COMMON 5 N C 6 TACH COMMON 7 Figure 2 5 Accessory Torque Speed Output AUTION FOR USE WITH MAGTROL READOUT
29. its High speed data acquisition 120 torque and speed readings per second via IEEE GPIB bus Pass Fail testing Upper and lower limits are programmable for torque speed and auxiliary input Current regulated supply Provides up to 1 amp output Internal data storage Nonvolatile memory of up to 100 data points Dynamometer overload protection Maximum power limit can be programmed to shut down if exceeded Two standard computer interfaces RS 232 and IEEE 488 Additional analog input Accepts any 5 VDC transducer Many torque measurement options Includes English metric and SI torque readings as standard Closed box calibration of torque and auxiliary input Eliminates need to open box for adjustments The 6200 is designed to work with any personal computer using an IEEE 488 or an RS 232 interface or as a stand alone unit In a computer controlled environment the 6200 provides the following motor testing capabilities Current regulated control of dynamometer brake for open loop testing Torque Q and Speed N data acquisition at a rate of up to 120 readings per second Saving Allows user to save programmed values within their configurations z T je 2 2 Z m 2 gt r Chapter 1 Introduction Magftrol Model 6200 Open Loop Dynamormeter Controller 1 3 DATA SHEET Model 6200 Open Loop Dynamometer Controller FEATURES e Open Loop Dynamometer Control e Built in Pass Fail M
30. its default to 0 oz in if out of range Programmed value is not saved at power down This command sets the torque unit conversion for the torque readout Values for are 0 oz in 5 kg cm 1 oz ft 6 N mm 2 lb in 7 3 Ib ft 8 N m 4 g cm Torque unit conversion defaults to 0 oz in if out of range Programmed value is not saved at power down This command returns the 96 current value in the format l The value will be between 0 no loading and 99 99 full loading The power supply outputs a fixed value of current Use any value between 0 and 99 99 99 99 1 Amp e 13 4 ET Speed torque data is a fixed length string in ASCII format with a floating point decimal Use the following string format SdddddTdddd R cr If or SdddddTdddd L cr If where S speed in RPM No leading zeroes are used d decimal digit 0 through 9 T torque units selected during setup The torque value always contains a decimal point L counterclockwise dynamometer shaft rotation left R clockwise dynamometer shaft rotation right Magtrol Model 6200 Open Loop Dynamormeter Controller Chapter 5 Computer Controlled Operation 5 6 decimal point The decimal point location depends on the specific dynamometer and torque range in use Note The cr and If characters will not display Example If a motor is running at 1725
31. ly by using the computer with either the GPIB IEEE 488 or the RS 232 interface NOTE The brake ON OFF switch on the front panel still functions Use this command to cancel any previous commands NOTE These settings are the power on default settings This command sets the scaling factor for the auxiliary input to units volt The range is 0 0 to 10000 0 Programmed value is not saved at power down This command selects the pulse count option for speed transducing The pulse count defaults to 60 bit if out of range The standard encoder supplied with all Magtrol Load Cell Dynamometers is 60 pulses revolution Optional 600 and 6000 pulse encoders are available for low speed applications Codes for pulse count are 0 60 bit 1 600 bit 2 6000 bit Programmed value is not saved at power down Chapter 5 Computer Controlled Operation Magftrol Model 6200 Open Loop Dynamormeter Controller 5 5 Command Command Explanation Category Code Setup Ul Sets dynamometer torque units to Setup UR Sets readout torque units to Misc X Prompts to return 96 current output Misc Sets current output to ACQUIRING SPEED TORQUE DATA NOTE For Hp and watts calculations to be correct the correct dynamometer torque units must be specified Values for are O ozin 5 kg cm 1 oz ft 6 2 lb in 7 N cm lb ft 8 N m 4 g cm Torque un
32. n Magftrol Model 6200 Open Loop Dynamormeter Controller Desired results e Torque speed data will be returned Note If the desired results did not occur Please see Chapter 7 Troubleshooting 5 3 PROGRAMMING Check the manual provided with your software for full instructions 1 Use the following information to answer the formatting questions asked when installing your GPIB software e All GPIB data acquisition systems requires the use of data termination characters The 6200 uses the GPIB standard termination characters Carriage Return CR Line Feed LF Provide them in that order Codes for CR LF oec oo 15 2 Setthe timeout for at least one second if you are asked to set a communication fault delay timeout O v m gt O z e Ifthe communication fault delay timeout is too short or if the computer resets the interface too quickly the host instrument may stop responding 5 4 6200 COMMAND SET When entering a command code 1 Type all characters in uppercase ASCII format 2 Endall commands with a CR LF hex OD 0A 3 Do not string multiple commands together in one line The character represents a floating point numerical value following the command Leading Zeroes are not required 5 4 1 For 6200 Explanation Category Code Communications H Sets high data The Controller
33. nt to Magtrol Inc United States When returning equipment to Magtrol Inc s factory in the United States for repair and or calibration a completed Return Material Authorization RMA form is required 1 Visit Magtrol s Web site at http www magtrol com support rma htm to begin the RMA process 2 Complete the RMA form online and submit 3 An RMA number will be issued to you via e mail Include this number on all return documentation 4 Ship your equipment to MAGTROL INC 70 Gardenville Parkway Buffalo NY 14224 Attn Repair Department 5 After Magtrol s Repair Department receives and analyzes your equipment a quotation listing all the necessary parts and labor costs if any will be faxed or e mailed to you 6 After receiving your repair estimate provide Magtrol with a P O number as soon as possible A purchase order confirming the cost quoted is required before your equipment can be returned Returning Equipment to Magtrol SA Switzerland If you are directed to ship your equipment to Switzerland no RMA form number is required Just send your equipment directly to Magtrol SA in Switzerland and follow these shipment instructions 1 Ship your equipment to MAGTROL SA After Sales Service Route de Montena 77 1728 Rossens Fribourg Switzerland VAT No 485 572 2 Please use our forwarder TNT 1 800 558 5555 Account No 154033 Only ship ECONOMIC way 3 days max within Europe 3 Include the following documents wi
34. o the dynamometer using the following cables e 14 signal cable e 2 pin brake power cable 2 Turn on 6200 power SELF TEST After turning the power on to the 6200 the display panel will show all segments of the VFD series of rectangles indicating that the 6200 is downloading the program When the program download is complete the message MAGTROL 6200 appears BASIC TEST SETUP 1 After the Model Display wappears press the UNITS DISPLAY button and set current output to 0 with Decrease Increase Dial Start the test motor wre WN Desired results Allow the motor speed to stabilize at its no load speed for a few seconds Press the BRAKE ON OFF button to ON Turn the Decrease Increase Dial clockwise e The torque reading will increase As brake power is applied load is applied to the motor The applied torque increases as the Decrease Increase Dial is turned clockwise For most motors loading is indicated by motor speed reduction 8 Reduce the torque load to zero by turning the Decrease Increase Dial counterclockwise Desired results e torque reading will decrease 9 Press the BRAKE ON OFF Button to OFF 10 Turn off power to the test motor Note If the desired results did not occur please see Chapter 7 Troubleshooting 4 Manually Controlled Operation 4 1 SETTING DESIRED OPERATING PARAMETERS Note See Appendix B Front Panel Display Menu Flow Charts
35. ometers and electronic products are earth grounded to ensure personal safety and proper operation Check line voltage before operating the 6200 Make sure that dynamometers and motors under test are equipped with appropriate safety guards Revisions To This Manual The contents of this manual are subject to change without prior notice Should revisions be necessary updates to all Magtrol User s Manuals can be found at Magtrol s web site at www magtrol com support manuals htm Please compare the date of this manual with the revision date on the web site then refer to the manual s Table of Revisions for any changes updates that have been made since this edition REVISION DATE 1st Edition rev A March 2014 TABLE OF REVISIONS Date Edition Change Section s 03 03 14 1st Edition rev A Torque Offset and Gain procedure updated 6 3 2 03 03 14 1st Edition rev A Basic Calibration Process updated 03 03 14 1st Edition rev Accessory Torque Speed Output diagram updated 2 2 1 Table of Contents SAFETY PREGAU TIONS d c ta REVISIONS TO THIS MANUAL ien eee treten cea IV REVISION DATE initi ie teet Rea n Huet tee ete RE RE IV TABLE OF REVISIONS rnt tere REIR RE ER REG ERREUR ER HERR EG PORE IV e m VII PURPOSE MANUAL VII WHO S
36. ontrol a dynamometer and to transmit data from motor testing directly to the computer ABOUT THE GPIB INTERFACE Magtrol instruments use the GPIB IEEE 488 Standard for computer to instrument interfacing because GPIB parallel interface is faster than serial interfaces The GPIB enables testers to access up to 15 instruments on one port Because typical motor testing requires that at least five separate parameters must be synchronized a system of easy fast access to more than one instrument is essential e GPIB has rigid data formatting and hardware standards These standards help to ensure that all functions will work properly when the hardware and software are installed Note The GPIB interface is not standard on most computers An interface card and driver software must be installed Magtrol recommends National Instruments Corporation hardware and software An IEEE 488 cable must be installed between the computer and the 6200 INSTALLING THE GPIB IEEE 488 Connector CABLE CAUTION MAKE SURE BOTH THE COMPUTER AND THE 6200 ARE TURNED OFF BEFORE INSTALLING THE GPIB CONNECTOR CABLE 1 Connect one end of a high quality double shielded cable to the 6200 GPIB connector 2 Connect the other end to the GPIB interface in your PC O v m gt O z Magtrol Model 6200 Open Loop Dynamormeter Controller Chapter 5 Computer Controlled Operation 5 2 CHANGING THE GPIB Primary AD
37. otor Testing Capability e Interfaces RS 232 and IEEE 488 High Speed Data Acquisition 120 torque and speed points per second via IEEE bus approx 60 sec via RS 232 e High Quality Easy to Read Vacuum Fluorescent Readout Displays torque speed power and auxiliary values e Current Regulated Supply Provides up to 1 amp output e Adjustable Torque Units English Metric and SI are standard e Dynamometer Overload Protection e Internal Data Storage Up to 100 data points e Auxiliary 5 V DC Analog Input For additional transducer e Closed Box Calibration e Rack Mounting 19 482 6 mm with handles DESCRIPTION Magtrol s Model 6200 is an Open Loop Controller designed for use with any Magtrol Hysteresis Dynamometer The unit provides open loop control of the dynamometer via an internal current regulated power supply With a high quality vacuum fluorescent readout the Model 6200 displays torque speed SYSTEM CONFIGURATION Hysteresis Dynamometer ORDERING INFORMATION 6200 Loop Dynamometer Controller 120 VAC 6200A Open Loop Dynamometer Controller 240 VAC and mechanical power values of the motor under test In plac of mechanical power it can also display auxiliary transduce readings via the 5 V DC analog input These displaye values can be stored internally or output via the RS 232 IEEE 488 interface PASS FAIL MOTOR TESTING The Model 6200 comes with an easy to use motor testin Pass
38. s BRAKE button ON Adjust output current up to a value at least 25 of the maximum torque rating of the dynamometer in use if possible Reduce output current to O If you require additional assistance please contact Magtrol Customer Service at 1 716 668 5555 26 Z i z gt z Ie m Appendix A LabVIEW Programming Examples Magtrol offers a comprehensive motor testing software program to satisfy most of your programming needs To order your software call Magtrol Sales at 1 716 668 5555 A 1 SIMPLE READ Sequence Sequence guuguuuguguuuuf Qmno1 xpuugugagaguugugugugugo 09090900 GPIB Write High speed mode Output data stop Not Sequence tel 1 0 1 en While Loop Sequence T guugugugugugu1m 3 aagagagaaoguouguog From Exponential Fract Eng String Subset direction B B HB BH BM BH HM B BH B EH NH B BM BM BM BH H MH NH NH M NM NH BH B M 27 gt 0 0 m 2 Oo m Appendix A LabVIEW Programming Examples Magtrol Model 6200 Open Loop Dynamormeter Controller A 2 CURRENT STABILIZED Sequence opsspassaaucasouuudug stop caa Sequence Tf 0000000000044 3 0 3 GPIB Write Reset curren
39. t to 0 Sequence Set current to 10 6 Sequence gGugauguuuguguUmN pog usugusgguuuuug While Loop Sequence 3 gguguguuuuN1m1 susgugugsgug From Exponential Fract Eng GPIB Read 28 gt 0 0 2 Oo m Appendiix B Front Panel Display Menu Flow Charts The following flow charts are a reference for navigating through the key setup functions of the 6200 Open Loop Dynamometer Controller For step by step setup instructions refer to the corresponding chapters in this manual B 1 SETUP MENU LOW LIMIT A J gt ON HIGH LIMIT 0 99999 0 99999 0 99999 HIGH LIMIT 0 99999 SETUP PASS FAIL SPEED P F OFF 0 99999 HO GU CE HH WW Gi HIGH LIMIT 0 99999 UE P F 0 99999 6000 T 4 2 gt 5 INPUT UNITS gt 0 0 m 2 Oo m Appendix B Front Panel Display Menu Flow Charts Magftrol Model 6200 Open Loop Dynamormeter Controller B 2 POWER UNITS MENU B 3 AUX SETUP MENU 0 10000 UNITS VOLT 30 gt 0 0 2 Oo m Magtrol Model 6200 Open Loop Dynamormeter Controller Appendix B Front Panel Display Menu Flow Charts B 4 TORQUE UNITS MENU TORQUE UNITS gt 0 0 m 2 Oo m 31 Appendix C Schematics C 1 ENCODER SWITCH BOARD
40. th your equipment e Delivery note with Magtrol SA s address as listed above Three pro forma invoices with e Your VAT number e Value for customs purposes only e Description of returned goods Origin of the goods in general Switzerland e Noticed failures 4 A cost estimate for repair will be sent to you as soon as the goods have been analyzed If the repair charges do not exceed 25 the price of a new unit the repair or calibration will be completed without requiring prior customer authorization 35 Testing Measurement and Control of Torque Speed Power Load Force Weight j MAGTROL INC 70 Gardenville Parkway Buffalo New York 14224 USA Phone 1 716 668 5555 Fax 1 716 668 8705 E mail magtrol magtrol com Tension Displacement MAGTROL SA Route de Montena 77 1728 Rossens Fribourg Switzerland Phone 41 0 26 407 3000 Fax 41 0 26 407 3001 E mail magtrol magtrol ch www maodgtrol com Subsidiaries in Germany France China India Worldwide Network of Sales Agents BUREAU VERITAS Certification
41. the resulting torque reading may be incorrect Z i z gt z Ie m 23 Chapter 6 Calibration Magftrol Model 6200 Open Loop Dynamormeter Controller 1 Connect the chosen dynamometer to the 6200 using the 14 pin signal cable and the 2 pin brake cable Attach the calibration beam to the dynamometer shaft Enter the calibration mode Press the BRAKE ON OFF button ON to apply full loading to the dynamometer pin and level the beam as illustrated in the following Un zb e Hang the weight on the calibration beam Torque Weight W x Distance D Weight W Torque Distance D Figure 6 1 Alternative Calibration 6 Press the DISPLAY button 7 Adjustthe gain by turning the Decrease Increase Dial until the displayed voltage equals the reference voltage Note The magnitude of change per revolution can be increased by pressing the UP 4 button or decreased by pressing the DOWN button 8 Remove the weight for ZERO adjustment Press the UNITS DISPLAY button 10 Adjust the Increase Decrease Dial until the display indicates 0 mVDC gt 2 Note The mV output of the dynamometer will be equivalent to the Weight gt times Distance on the calibration beam disregarding any decimal S m point Example Magtrol s HD 400 6 Dynamometer has a full scale torque of 40 0 oz in The distance from the center of the dynamometer shaft to the pin on the calibra
42. tion beam is 5 inches Placing an 8 oz weight on the pin will produce a torque of 40 0 oz in The mV output of the dynamometer will be equivalent to 8 oz multiplied by 5 inches yielding an output signal of 400 mV 24 Magtrol Model 6200 Open Loop Dynamormeter Controller Chapter 6 Calibration 11 Repeat steps 5 through 10 12 After completing calibration press BRAKE ON OFF button OFF to remove loading from the dynamometer 13 Remove the calibration beam from the dynamometer shaft 14 Proceed with desired motor testing Z i z gt z Ie m 25 7 Troubleshooting Problem Reason Solution Mechanical power reads much higher or lower than expected Torque units are incorrect Set torque input units to match the specifications on dynamometer nameplate No GPIB communication Setup error and or hardware fault Check GPIB address of Controller GPIB cable should be functioning and attached to Controller and computer interface card No RS 232 communication Setup error and or hardware fault Check Baud rate of Controller Pinout of serial cable Cable attachment to Controller and serial interface port of computer Dynamometer shaft does not turn smoothly when BRAKE is OFF Salient poles were set up on the rotor by having brake current applied with no shaft rotation Start the motor and bring up to speed Pres
43. ton 5 Adjustthe gain by turning the Decrease Increase Dial until the displayed voltage equals the reference voltage Note The magnitude of change per revolution can be increased by pressing the UP 4 button or decreased by pressing the DOWN gt button 6 Apply 0 000 VDC 7 Press the UNITS DISPLAY button 8 Adjust the Decrease Increase Dial until the display indicates 0 mVDC 9 Repeat steps 3 through 8 to complete this procedure 10 Press SHIFT 11 Record the T ZERO correction factor for future reference 12 Press SHIFT 13 Record the T GAIN correction factor for future reference 14 Speed Verification Connect the function generator output to Pin 10 of the dynamometer input connector z i 2 gt Z Ie m Connect the function generator common to Pin 8 of the dynamometer input connector Apply a square wave TTL signal of 1000 Hz Verify the 6200 Speed readout displays 1000 0 01 of applied frequency Apply several additional frequencies 10 kHz 50 kHz and verify the Speed readout displays the applied frequency 0 01 22 Magtrol Model 6200 Open Loop Dynamormeter Controller Chapter 6 Calibration 6 3 3 Accessory Torque OFFSET AND GAIN 1 Connect the DMM common to Pin 4 of the Accessory Torque Speed Output connector 2 Connect the DMM high to Pin 2 of the Accessory Torque Speed Output connector 3 Apply 0 000 VDC 4 Adjust R24 OFFSET on the
44. ts 120 240 V 60 50 Hz Max Compliance Voltage 45 VDC INPUTS AND OUTPUTS Auxiliary Input 5 VDC Accessory Torque x2VDC Torque Speed Output Speed 60 TTL pulses rev 50 duty cycle Ctrl Out 0 3 VDC ENVIRONMENT Operating Temperature 18 to 25 Relative Humidity lt 80 Temperature Coefficient 0 00196 of range C FRONT PANEL Displays Torque Speed and Mechanical Power Values Ready for Rack Mounting 1 096 1 E Desired Power Units Internal Enables Pass Fail Testing W Hp or AUX Memory of Torque Speed or Auxiliary Input IN 8 668 Set Desired Torque Units oz in 02 ft Ib in Ib ft g cm kg cm Nmm Nm REAR PANEL Connector for Optional Auxiliary Input Accepts Magtrol Readout x5 VDC Transducer RS 232 and GPIB IEEE 488 Interfaces for Connection to PC ny MAGTROL INC BUFFALO NY Connector for Model 5241 Power Supply For Use With Any Magtrol for HD 825 Dynamometer only Hysteresis Dynamometer Due to the continual development of our products we reserve the right to modify specifications without forewarning 11 2 Controls 2 1 2 1 1 2 1 1 1 FRONT PANEL The front panel provides a power switch nine control buttons a Decrease Increase Dial and Vacuum Fluorescent Display VFD
Download Pdf Manuals
Related Search
Related Contents
Insight User Manual v.2.0 Samsung Laserprintere Farveprinter CLP-350N Brugervejledning OWNER INSTALLATION AND USER MANUAL Series 3000 Models Automne 2013 - Outremangeurs Anonymes Samsung RH7000JC Foodshowcase, capacitate 583l Manual de utilizare Zip - Superzip - Zip SF3 USER MANUAL MANUEL DE L'UTILISATEUR Aspirador com saco da classe A de eficiência 8051 OCD ICE User Manual ダウンロード Copyright © All rights reserved.
Failed to retrieve file