Home

Detecting Vivid Colors - Thermo Fisher Scientific

1. 4 For 1 liter dissolve 10 g tryptone 5 g yeast extract and 10 g NaCl in 950 ml deionized water Adjust the pH of the solution to 7 0 with NaOH and bring the volume up to 1 liter Autoclave on liquid cycle for 20 minutes at 15 psi Allow solution to cool to 55 C and add antibiotic if needed Store at room temperature or at 4 C LB agar plates 1 2 3 Prepare LB medium as above but add 15 g L agar before autoclaving Autoclave on liquid cycle for 20 minutes at 15 psi After autoclaving cool to 55 C add antibiotic if needed and pour into 10 cm plates Let harden then invert and store at 4 C Composition 10 g Tryptone 5 g NaCl 5 g Yeast Extract 1 Combine the dry reagents above and add deionized distilled water to 950 ml Adjust pH to 7 0 with 1 N NaOH and bring the volume up to 1 liter For plates add 15 g L agar before autoclaving Autoclave on liquid cycle at 15 psi and 121 C for 20 minutes Allow the medium to cool to at least 55 C before adding the Blasticidin to 50 100 ug ml final concentration Store plates and unused medium at 4 C in the dark Plates and medium containing Blasticidin S HCl are stable for up to 2 weeks Continued on next page Recipes Continued Cell Lysis Buffer 4X SDS PAGE Sample Buffer Composition 50 mM Tris pH 7 8 150 mM NaCl 1 Nonidet P 40 1 This solution can be prepared from the following common stock solutions For 100 ml combine
2. 1 M Tris base 5 ml 5 M NaCl 3 ml Nonidet P 40 1 ml 2 Bring the volume up to 90 ml with deionized water and adjust the pH to 7 8 with HCl 3 Bring the volume up to 100 ml Store at room temperature To prevent proteolysis you may add 1 mM PMSF 1 uM leupeptin or 0 1 uM aprotinin before use 1 Combine the following reagents 0 5 M Tris HCl pH 6 85 ml Glycerol 100 4 ml B mercaptoethanol 0 8 ml Bromophenol Blue 0 04 g SDS 0 8 g 2 Bring the volume to 10 ml with sterile water 3 Aliquot and freeze at 20 C until needed 39 Blasticidin Molecular Weight Formula and Structure Handling Blasticidin Preparing and Storing Stock Solutions 40 The formula for Blasticidin S is CiyH2sNsOs HCL and the molecular weight is 458 9 The diagram below shows the structure of Blasticidin NH2 Sn es HOOC O CH3 HCl NH NH2 O Always wear gloves mask goggles and protective clothing e g a laboratory coat when handling Blasticidin Weigh out Blasticidin and prepare solutions in a hood Blasticidin may be obtained separately from Invitrogen Catalog no R210 01 in 50 mg aliquots Blasticidin is soluble in water Use sterile water to prepare stock solutions of 5 to 10 mg ml Dissolve Blasticidin in sterile water and filter sterilize the solution Aliquot solution in small volumes suitable for one time use see next to last point below and freeze at 20 C for long term storage or store at 4 C fo
3. Pick 10 colonies and culture them overnight in LB medium containing 100 ug ml ampicillin Isolate plasmid DNA using your method of choice If you need ultra pure plasmid DNA for automated or manual sequencing we recommend using Invitrogen s PureLink HQ Mini Plasmid Purification Kit Catalog no K2100 01 See page viii for ordering information Analyze the plasmids by sequencing to confirm the presence and correct orientation of the insert To confirm that your gene of interest is in frame with the N or C terminal fluorescent fusion you may sequence your expression construct using the following primers included with the kit Expression Clone Primer pcDNA 6 2 C EmGFP or YFP GW TOPO T7 Promoter pcDNA 6 2 C EmGFP or YFP GW TOPO FP 2 Reverse pcDNA 6 2 N EmGFP or YFP GW TOPO FP 1 Forward pcDNA 6 2 N EmGFP or YFP GW TOPO TK PolyA Reverse Refer to page vii for the sequences of the primers and the diagrams on pages 8 9 for the location of the primer binding sites Once you have identified the correct clone be sure to purify the colony and make a glycerol stock for long term storage We also recommend that you store a stock of plasmid DNA at 20 C 1 Streak the original colony out for single colonies on an LB plate containing 100 ug ml ampicillin Isolate a single colony and inoculate into 1 2 ml of LB containing 100 ug ml ampicillin Grow at 37 C with shaking until culture reaches stationar
4. expression vector via an LR and BP reaction The V5 epitope tag for detection of recombinant protein using Anti V5 antibodies N terminal fusion vectors only The Herpes Simplex Virus thymidine kinase polyadenylation signal for proper termination and processing of the recombinant transcript fl intergenic region for production of single strand DNA in F plasmid containing E coli SV40 early promoter and origin for expression of the Blasticidin resistance gene and stable propagation of the plasmid in mammalian hosts expressing the SV40 large T antigen Blasticidin resistance gene for selection of stable cell lines pUC origin for high copy replication and maintenance of the plasmid in E coli Ampicillin bla resistance gene for selection in E coli For maps and features of the pcDNA 6 2 EmGFP or YFP GW TOPO vectors see pages 32 35 Continued on next page Overview Continued Green Fluorescent Green Fluorescent Protein GFP is a naturally occurring bioluminescent protein Protein GFP GFP and Spectral Variants EmGFP and YFP derived from the jellyfish Aequorea victoria Shimomura et al 1962 GFP emits fluorescence upon excitation and the gene encoding GFP contains all of the necessary information for posttranslational synthesis of the luminescent protein GFP is often used as a molecular beacon because it requires no species specific cofactors for function and the fluorescence is easily detected using fluorescence m
5. 01 CAT Antiserum 50 ul R902 25 Anti GFP Antibody rabbit polyclonal sera 100 ul A6455 Anti GFP Antibody rabbit IgG fraction 100 ul A11122 Anti V5 Antibody 50 ul R960 25 Anti V5 HRP Antibody 50 ul R961 25 Anti V5 AP Antibody 50 ul R962 25 WesternBreeze Chemiluminescent Kit 20 reactions WB7106 Anti Rabbit WesternBreeze Chromogenic Kit 20 reactions WB7105 Anti Rabbit Overview Description The Vivid Colors EmGFP or YFP GW TOPO Mammalian Expression Vector Kits combine TOPO Cloning with the brightness of Emerald Green Fluorescent Protein EmGFP or Yellow Fluorescent Protein YFP derived from Aequorea victoria GFP to express a fluorescent tagged protein of interest Users can easily make an EmGFP or YFP N or C terminally tagged expression plasmid by amplifying the gene of interest with Taq polymerase and performing a 5 minute TOPO Cloning reaction into p DNA 6 2 EmGFP or YFP GW TOPO vector followed by transformation of competent E coli After screening clones for directionality of the insert the expression plasmid can be transfected into the mammalian cell line of choice to express a fusion protein Your N or C terminal fluorescent tagged protein of interest can be visualized using fluorescence detection methods or detected using commercially available antibodies in Western blot analysis A choice of kits allows you to fuse your gene of interest to an N terminal or C terminal tag for easy detection and
6. 2 N EmGFP or YFP GW TOPO vectors The complete sequences of these vectors are available for downloading from www invitrogen com or by contacting Technical Service page 41 gt Comments for CMV promoter EmGFP or YFP FP 1 forward priming site attB1 site TOPO cloning site attB2 site V5 epitope TK polyA reverse priming site TK polyadenylation signal f1 origin SV40 early promoter and origin EM7 promoter Blasticidin resistance gene SV40 early polyadenylation signal pUC origin c Ampicillin b a resistance gene c bla promoter c pcDNA 6 2 lt 4 i N EmGFP YFP TOPO pcDNA 6 2 N EmGFP TOPO 5900 bp 174 761 882 1598 1594 1614 1614 1638 1653 1666 1690 1698 1739 1773 1791 1776 2037 2073 2501 2526 2834 2889 2955 2962 3354 3512 3642 4025 4698 4843 5703 5698 5802 pcDNA 6 2 N YFP TOPO 5902 bp 174 761 882 1598 1594 1614 1614 1638 1653 1666 1690 1698 1739 1773 1791 1776 2037 2073 2501 2528 2836 2891 2957 2964 3356 3514 3644 4027 4700 4845 5205 5700 5804 Continued on next page Map and Features of pcDNA 6 2 N EmGFP YFP GW TOPO Features Vivid Colors pcDNA 6 2 N EmGFP GW TOPO 5900 bp and YFP GW TOPO 5902 bp vectors contain the following elements All features have been functionally tested and the vectors have been fully sequenced Feature Benefit Human cytomegalovirus CMV immediate early promoter enhancer
7. EmGFP or YFP GW TOPO vectors are functionally qualified using the control reagents included in the kit Under conditions described on pages 29 30 a 500 bp control PCR product is amplified TOPO Cloned into the vector and transformed into One Shot TOP 10 Chemically Competent E coli included with the kit Each lot of vector should yield greater than 85 cloning efficiency Primers are lot qualified by DNA sequencing using the dideoxy chain termination technique One Shot TOP10 Chemically Competent cells are tested for transformation efficiency using the control plasmid included in the kit Transformed cultures are plated on LB plates containing 100 ug ml ampicillin and the transformation efficiency is calculated Test transformations are performed in duplicate Transformation efficiency should be greater than 1 x 10 cfu ug plasmid DNA In addition untransformed cells are tested for the appropriate antibiotic sensitivity and lack of phage contamination 47 Notes 48 Notes 49 References Andersson S Davis D L Dahlb ck H J rnvall H and Russell D W 1989 Cloning Structure and Expression of the Mitochondrial Cytochrome P 450 Sterol 26 Hydroxylase a Bile Acid Biosynthetic Enzyme J Biol Chem 264 8222 8229 Ausubel F M Brent R Kingston R E Moore D D Seidman J G Smith J A and Struhl K 1994 Current Protocols in Molecular Biology New York Greene Publishing Associates and
8. Gly CTI GAA Leu TATA 3 end of CMV promoter l y GTCTATATAA GCAGAGCTCG TTTAGTGAAC TGT att B1 TACCGGTGAT EcoRV TTGACC TCCATAGAAG ACACCGGGAC m ATCCTCGAGACC TAC AAG EmGEP or YFP l TCG AGC CCA TCA ACA AGT TTG TAC AAA AAA GCA GGC TCC GAA TTC GCC AGC TCG GGT AGT TGT TCA AAC ATG TTT 1 Ser Ser Pro Ser Thr Ser Leu Tyr Lys att B2 TT CGT CCG AGG CTT AAG CGG Lys Ala Gly Ser Glu Phe Ala PCR AAG GGC GAA TTC GAC CCA GCT TIC TTG TAC AAA GTG GTT GAT AAC PRODUCT TTC CCG CTT AAG CTG GGT CGA AAG AAC ATG TTT CAC CAA CTA TTG V5 epitope Lys Gly Glu Phe Asp Pro Ala Phe Leu Tyr Lys Val Val Asp Asn GGG CCC Gly TGA KKK AAG CCT ATC CCT AAC CCT CTC CTC GGT CTC GAT TCT ACG CGT ACC GGT TAG TAA TTC GGA TAG GGA TTG GGA GAG GAG CCA GAG CTA Lys Pro Ile Pro Asn Pro Leu Leu Gly Leu Asp Ser Pmel TK poly A reverse priming site i l GTTTAAACGG GGGAGGCTAA CTGAAACACG GAAGGAGACA AGA 1 P TGC GCA TGG CCA ATC ATT Thr Arg Thr Gly REX Continued on next page Designing PCR Primers Continued TM Points to Consider If you are cloning your PCR product into the peDNA 6 2 Before Cloning C EmGFP GW TOPO or pcDNA 6 2 C YFP GW TOPO vector the design into C Terminal for your PCR should contain a Kozak translation initiation sequence with an Vectors ATG initiation codon for proper initiation of translation Kozak 1987
9. Kozak 1991 Kozak 1990 An example of a Kozak consensus sequence is provided below The ATG initiation codon is shown underlined G A NNATGG Other sequences are possible but the G or A at position 3 and the G at position 4 are the most critical for function shown in bold TOPO Cloning Use the diagram below to help you design your PCR product for TOPO Site for C Terminal Cloning into the peDNA 6 2 C EmGFP GW TOPO or the Fusion 710 770 830 890 932 1693 pcDNA 6 2 C YFP GW TOPO vectors The complete sequences of the vectors are available from www invitrogen com or by contacting Technical Service page 41 Putative CAAT TATA 3 end of CMV promoter transcriptional start 4 I CAAATGGGCG GTAGGCGTGT ACGGTGGGAG GTCTATATAA GCAGAGCTCT CTGGCTAACT T7 promoter priming site li 1 AGAGAACCCA CTGCTTACTG GCTTATCGAA ATTAATACGA CTCACTATAG GGAGACCCAA att B1 T 1 GCTGGCTAGT TAAGCTGAGC ATCAACAAGT TTGTACAAAA AAGCAGGCTC CGAATTCGCC att B2 I i CTT PCR AAG GGG GAA TTC GAC CCA GCT TTC TTG TAC AAA GTG GTT GAA PRODUCT TTC CCC CTT AAG CTG GGT CGA AAG AAC ATG TTT CAC CAA Lys Gly Glu Phe Asp Pro Ala Phe Leu Tyr Lys Val Val FP 2 Rev priming site Hpal Pmel GAT GCT GTT AAC ATG GTG AGC TGA TAA GTT TAAACGGGGG AGGCTAACTG CTA CGA CAA TTG EmGFP or YFP EER ARE Asp Ala Val Asn BEE ff ES AAACACGGAA GGAGACAA Producing PCR Products Introduction Materials Supplied b
10. One Shot TOP10 The following reagents are included in the One Shot TOP10 Chemically Reagents Competent E coli kit Box 2 Transformation efficiency is gt 1 x 10 cfu pg plasmid DNA Store the contents of Box 2 at 80 C pUC19 Control DNA 10 pg pl in 5 mM Tris HCI 0 5 mM EDTA pH 8 50 pl S 0 C Medium 2 Tryptone 6 ml 0 5 Yeast extract 10 mM NaCl 2 5 mM KCl 10 mM MgCl 10 mM MgSO 20 mM glucose Genotype of F mcrA A mrr hsdRMS mcrBC 80lacZAM15 AlacX74 recAl araD139 A ara TOP10 Strain leu 7697 galU galK rpsL Str endAl nupG vii Accessory Products Additional Products viii The products listed in this section are available from Invitrogen and may be used with Vivid Colors pcDNA 6 2 EmGFP or YFP GW TOPO Mammalian Expression Kit Ordering information is provided below Product Amount Catalog no Platinum Taq DNA Polymerase 100 reactions 10966 018 250 reactions 10966 026 500 reactions 10966 034 Tag DNA Polymerase Recombinant 100 units 10342 053 250 units 10342 012 500 units 10342 020 Platinum Taq DNA Polymerase High Fidelity 100 units 11304 020 500 units 11304 011 One Shot TOP10 Chemically Competent E coli 10 reactions C4040 10 20 reactions C4040 03 One Shot TOP10 Electrocompetent E coli 10 reactions C4040 50 20 reactions C4040 52 PureLink HO Plasmid Miniprep Kit 100 reactions K2100 01 Lipofectamine 2000 0 75 ml 11668 027 1 5 ml 11668 019 Blasticidin 50 mg R210
11. Wiley Interscience Boshart M Weber F Jahn G Dorsch H sler K Fleckenstein B and Schaffner W 1985 A Very Strong Enhancer is Located Upstream of an Immediate Early Gene of Human Cytomegalovirus Cell 41 521 530 Brownstein M J Carpten J D and Smith J R 1996 Modulation of Non Templated Nucleotide Addition by Tag DNA Polymerase Primer Modifications that Facilitate Genotyping BioTechniques 20 1004 1010 Chen C and Okayama H 1987 High Efficiency Transformation of Mammalian Cells by Plasmid DNA Mol Cell Biol 7 2745 2752 Chu G Hayakawa H and Berg P 1987 Electroporation for the Efficient Transfection of Mammalian Cells with DNA Nucleic Acids Res 15 1311 1326 Cole C N and Stacy T P 1985 Identification of Sequences in the Herpes Simplex Virus Thymidine Kinase Gene Required for Efficient Processing and Polyadenylation Mol Cell Biol 5 2104 2113 Felgner P L Holm M and Chan H 1989 Cationic Liposome Mediated Transfection Proc West Pharmacol Soc 32 115 121 Felgner P L a and Ringold G M 1989 Cationic Liposome Mediated Transfection Nature 337 387 388 Izumi M Miyazawa H Kamakura T Yamaguchi I Endo T and Hanaoka F 1991 Blasticidin S Resistance Gene bsr A Novel Selectable Marker for Mammalian Cells Exp Cell Res 197 229 233 Kimura M Takatsuki A and Yamaguchi I 1994 Blasticidin S Deaminase Gene from Aspe
12. be reduced to 50 mM NaCl 2 5 mM MgCh to prevent arcing during electroporation Dilute the stock Salt Solution 4 fold with water to prepare a 300 mM NaCl 15 mM MgCl Dilute Salt Solution Use the Dilute Salt Solution to set up the TOPO Cloning reaction as directed on the next page Continued on next page Setting Up the TOPO Cloning Reaction Continued Materials Needed You should have the following materials on hand before beginning e Your PCR product freshly prepared e pcDNA 6 2 EmGFP or YFP GW TOPO vector supplied with the kit Box 1 stored at 20 C e Salt Solution supplied with the kit Box 1 or Dilute Salt Solution see previous page e Sterile water supplied with the kit Box 1 Performing the The table below describes how to set up your TOPO Cloning reaction 6 ul to TOPO Cloning use for transformation of either chemically competent or electrocompetent Reaction E colt Note The red color of the TOPO vector solution is normal and is used to visualize the solution Reagent Chemically Competent Electrocompetent E coli E coli PCR Product 0 5 to 4 ul 0 5 to 4 ul Salt Solution 1 ul Dilute Salt Solution 1 ul Sterile Water Add to total volume of 5 ul Add to total volume of 5 ul TOPO Vector 1 pl 1 pl Final Volume 6 ul 6 ul Store all reagents at 20 C when finished Salt solution and water can be stored at room temperature or 4 C 1 Mix reaction gently and incubate for 5
13. minutes at room temperature 22 23 C Note For most applications 5 minutes will yield a sufficient number of colonies for analysis The length of the TOPO Cloning reaction can be varied from 30 seconds to 30 minutes For routine subcloning of PCR products 30 seconds may be sufficient For larger PCR products gt 1kb or if TOPO Cloning a pool of PCR products increasing the reaction time may yield more colonies 2 Place the reaction on ice and proceed to Transforming One Shot Competent E coli next page Note You may store the TOPO Cloning reaction overnight at 20 C 13 Transforming One Shot Competent E coli Introduction Selecting a One Shot Chemical Transformation Protocol Materials Needed Note 14 Once you have performed the TOPO Cloning reaction you are ready to use your construct to transform competent E coli One Shot TOP10 Chemically Competent E coli are included with the kit Box 2 to facilitate transformation You may also transform One Shot Electrocompetent cells if desired see page viii for ordering information Protocols for transforming chemically competent and electrocompetent E coli are provided in this section Two protocols are provided to transform One Shot TOP10 chemically competent E coli Consider the following factors and choose the protocol that best suits your needs If you wish to Then use the Maximize the number of Regular chemical
14. promoter c 6355 6459 6357 6461 c complementary strand Map of pcDNA 6 2 C EmGFP or YFP GW CAT Map The map below shows the elements of Vivid Colors pcDNA 6 2 C EmGFP and YFP GW CAT vectors The plasmids were generated by PCR amplification of the CAT gene followed by TOPO Cloning into the peDNA 6 2 C EmGFP or YFP GW TOPO vectors The complete sequences of these vectors are available for downloading from www invitrogen com or by contacting Technical Service page 41 T7 attB1 oye Elu Y EmGFP or YFP pcDNA 6 2 C EmGFP YFP GWICAT pcDNA 6 2 pcDNA 6 2 C EmGFP GW CAT C YFP GW CAT Comments for 6471 bp 6471 bp CMV promoter 174 761 174 761 T7 promoter priming site 802 821 802 821 attB1 site 854 878 854 878 CAT gene 893 1552 893 1552 attB2 site 1563 1587 1563 1587 EmGFP YFP 1601 2320 1601 2320 TK polyadenylation signal 2335 2606 2335 2606 f1 origin 2642 3070 2642 3070 SV40 early promoter and origin 3097 3405 3097 3405 EM7 promoter 3460 3526 3460 3526 Blasticidin resistance gene 3533 3925 3522 3925 SV40 early polyadenylation signal 4083 4213 4083 4213 pUC origin c 4596 5269 4596 5269 Ampicillin b a resistance gene c 5414 6274 5414 6274 bla promoter c 6269 6373 6269 6373 c complementary strand 37 Recipes LB Luria Bertani Medium and Plates Low Salt LB Plates with Blasticidin 38 Composition 1 0 Tryptone 0 5 Yeast Extract 1 0 NaCl pH 7 0 1
15. service invitrogen com For country specific contact information visit our web site at www invitrogen com
16. the vector codon numbering starts at the first amino acid after the initiation methionine of the fluorescent protein so that mutations appear to be increased by one position For example the S65T mutation actually occurs in codon 66 of EmGFP Continued on next page Overview Continued EmGFP and YFP Fluorescence Filter Sets for Detecting EmGFP or YFP Fluorescence The fluorescent proteins from the Vivid Colors pcDNA 6 2 EmGFP or YFP GW TOPO vectors have the following excitation and emission wavelengths as published in the literature Tsien 1998 Fluorescent Protein Excitation nm Emission nm EmGFP 487 509 YFP 514 527 The fluorescence signal from EmGFP and YFP can be detected with standard FITC filter sets However for optimal detection of the fluorescence signal you may use a filter set which is optimized for detection within the excitation and emission ranges for each of the fluorescent proteins These filter sets and their manufacturer are listed below Fluorescent Filter Set for Protein Fluorescence Manufacturer Microscopy EmGFP Omega XF100 Omega www omegafilters com YFP Omega XF1042 Omega www omegafilters com Chroma 41028 Chroma www chroma com Continued on next page Overview Continued How TOPO Works The plasmid vectors pcDNA 6 2 EmGFP or YFP GW TOPOS are supplied linearized with e Single 3 thymidine T overhangs for TA Cl
17. transformation transformants protocol page 15 Clone large PCR products gt 1000 bp Obtain transformants as quickly as Rapid chemical transformation possible protocol page 16 Note This procedure is less efficient the total number of transformants obtained may be lower than that obtained with the regular chemical transformation protocol In addition to general microbiological supplies i e plates spreaders you will need the following e TOPO Cloning reaction From Step 2 previous page e One Shot TOP10 E coli either chemically competent supplied with the kit Box 2 or electrocompetent purchased separately see page viii e 0 C Medium supplied with the kit Box 2 e pUC19 positive control supplied with the kit Box 2 e 42 C water bath chemically competent cells only e Electroporator with cuvettes electrocompetent cells only e 15 ml sterile snap cap plastic culture tubes electrocompetent cells only e For each transformation reaction 2 selective LB or low salt LB plates containing either 100 ug ml ampicillin or 50 ug ml Blasticidin see page 38 for a recipe to prepare selective LB and low salt LB plates e 37 C shaking and non shaking incubators There is no blue white screening for the presence of inserts Most transformants will contain recombinant plasmids with the PCR product of interest cloned into the vector Sequencing primers are included in the kit to allow you to sequence across
18. x 10 cfu ug DNA Addition of 3 A Overhangs Post Amplification Introduction Before Starting Procedure TOPO Cloning DNA amplified by proofreading polymerases into TOPO Cloning vectors often results in very low cloning efficiencies Proofreading polymerases remove the 3 A overhangs necessary for TOPO Cloning A method for adding 3 As post amplification is provided below You will need the following items Taq polymerase A heat block equilibrated to 72 C Phenol chloroform optional 3 M sodium acetate optional 100 ethanol optional 80 ethanol optional TE buffer optional This is just one method for adding 3 A overhangs Other protocols may be suitable 1 After amplification with a proofreading polymerase place vials on ice and add 0 7 1 unit of Taq polymerase per tube Mix well It is not necessary to change the buffer Incubate at 72 C for 8 10 minutes do not cycle Place the vials on ice The DNA amplification product is now ready for ligation into p DNA 6 2 EmGFP or YFP GW TOPO Note If you plan to store your sample overnight before proceeding with TOPO Cloning extract your sample with an equal volume of phenol chloroform to remove the polymerases Ethanol precipitate the DNA and resuspend in TE buffer using the starting volume of the PCR 31 Map and Features of pcDNA 6 2 N EmGFP YFP GW TOPO Map 32 The map below shows the elements of the Vivid Colors pcDNA 6
19. 1mM DTT 0 1 Triton X 100 100 ug ml BSA 30 um phenol red 10X PCR Buffer 100 mM Tris HCI 50 ul pH 8 3 at 42 C 500 mM KCl 25 mM MgCl 0 01 gelatin dNTP Mix 12 5 mM dATP 10 ul 12 5 mM dATP 12 5 mM dATP 12 5 mM dATP neutralized at pH 8 0 in water A O E Control PCR template 50 ng pl in TE buffer pH 8 0 Control PCR primers 100 ng ul each in TE buffer pH 8 0 T7 promoter sequencing primer 100 ng ul in TE buffer pH 8 0 pcDNA 6 2 C EmGFP or YFP GW TOPO only FP 2 Reverse sequencing primer 100 ng ul in TE buffer pH 8 0 20 ul pcDNA 6 2 C EmGEFP or YFP GW TOPO only Salt Solution 1 2 M NaCl 50 ul 0 06 M MgCl FP 1 Forward sequencing primer 100 ng ul in TE buffer pH 8 0 20 ul pcDNA 6 2 N EmGFP or YFP GW TOPO only TK PolyA Reverse sequencing primer 100 ng ul in TE buffer pH 8 0 20 ul pcDNA 6 2 N EmGFP or YFP GW TOPO only pcDNA 6 2 EmGEP or YFP GW CAT Control 10 5 ug l in TE buffer pH 8 0 Plasmid Continued on next page vi Kit Contents and Storage continued Primers Each pcDNA 6 2 EmGFP or YFP GW TOPO Mammalian Expression Vector Kit contains the following primers to sequence your insert Kit Primer Sequence pMoles Supplied pcDNA 6 2 C EmGEFP or 5 TAATACGACTCACTATAGGG 3 YFP GW TOPO FP 2 Reverse 5 TCACCATGTTAACAGCATCAA 3 pcDNA 6 2 N EmGFP or FP 1 Forward 5 ACAAGGGCTCGAGCCCATCAA 3 ETS TORS TK PolyA Reverse 5 CTTCCGIGTTTCAGTTAGC 3
20. Allows efficient high level expression of your recombinant protein Andersson et al 1989 Boshart et al 1985 Nelson et al 1987 EmGFP or YFP N terminal fusion to the gene of interest for fluorescent detection FP 1 Forward primer binding site Allows sequencing of the insert attBl and attB2 sites Allows recombination with apDONR plasmid to create a Gateway entry clone TOPO Cloning site Allows insertion of your PCR product in frame with EmGFP or YFP V5 epitope Allows detection of recombinant fusion protein with Anti V5 antibodies Southern et al 1991 TK Poly A Reverse primer binding site Allows sequencing of the insert Herpes Simplex Virus Thymidine Kinase TK polyadenylation signal Allows efficient transcription termination and polyadenylation of mRNA Cole and Stacy 1985 fl origin Allows rescue of single stranded DNA SV40 early promoter and origin Allows efficient high level expression of the Blasticidin resistance gene and episomal replication in cells expressing the SV40 large T antigen EM7 promoter Allows expression of the Blasticidin resistance gene in E coli Blasticidin bsd resistance gene Allows selection of stable transfectants in mammalian cells Kimura et al 1994 SV40 early polyadenylation signal Allows efficient transcription termination and polyadenylation of mRNA pUC origin Allows high copy number replication and grow
21. Buffer see page 39 for a recipe Other cell lysis buffers may be suitable Vortex 4 To lyse cells perform 3 freeze thaw cycles by incubating the samples in a dry ice ethanol bath for 2 minutes then incubating the sample in a 37 C water bath for one minute Perform this step 3 times to ensure complete cell lysis without protein degradation 5 Centrifuge the cell lysate at 10 000 x g for 10 minutes at 4 C to pellet nuclei and transfer the supernatant to a fresh tube Assay the lysate for protein concentration Note Do not use protein assays utilizing Coomassie Blue or other dyes NP 40 interferes with the binding of the dye with the protein 6 Add SDS PAGE sample buffer see page 39 for a recipe to a final concentration of 1X and boil the sample for 5 minutes 7 Load 20 ug of lysate onto an SDS PAGE gel and electrophorese Use the appropriate percentage of acrylamide to resolve your fusion protein Polyacrylamide To facilitate separation and visualization of your recombinant fusion protein by Gel polyacrylamide gel electrophoresis a wide range of pre cast NuPAGE and Electrophoresis Novex Tris Glycine polyacrylamide gels and electrophoresis apparatus are available from Invitrogen For more information refer to www invitrogen com or contact Technical Service page 41 Western Blot To detect expression of your recombinant fusion protein by Western blot Detection of analysis you may use an antibody to your protein of interest a
22. Headquarters Invitrogen Corporation Invitrogen Japan Invitrogen Ltd 1600 Faraday Avenue LOOP X Bldg 6F Inchinnan Business Park Carlsbad CA 92008 USA 3 9 15 Kaigan 3 Fountain Drive Tel 1 760 603 7200 Minato ku Tokyo 108 0022 Paisley PA4 9RF UK Tel Toll Free 1 800 955 6288 Tel 81 3 5730 6509 Tel 44 0 141 814 6100 Fax 1 760 602 6500 Fax 81 3 5730 6519 Tech Fax 44 0 141 814 6117 E mail E mail jpinfo invitrogen com E mail eurotech invitrogen com tech_service invitrogen com MSDS Requests To request an MSDS visit our Web site at www invitrogen com On the home page go to Technical Resources select MSDS and follow instructions on the page Continued on next page 41 Technical Service Continued Limited Warranty 42 Invitrogen is committed to providing our customers with high quality goods and services Our goal is to ensure that every customer is 100 satisfied with our products and our service If you should have any questions or concerns about an Invitrogen product or service contact our Technical Service Representatives Invitrogen warrants that all of its products will perform according to specifications stated on the certificate of analysis The company will replace free of charge any product that does not meet those specifications This warranty limits Invitrogen Corporation s liability only to the cost of the product No warranty is granted for products beyond their listed expiration date
23. No warranty is applicable unless all product components are stored in accordance with instructions Invitrogen reserves the right to select the method s used to analyze a product unless Invitrogen agrees to a specified method in writing prior to acceptance of the order Invitrogen makes every effort to ensure the accuracy of its publications but realizes that the occasional typographical or other error is inevitable Therefore Invitrogen makes no warranty of any kind regarding the contents of any publications or documentation If you discover an error in any of our publications please report it to our Technical Service Representatives Invitrogen assumes no responsibility or liability for any special incidental indirect or consequential loss or damage whatsoever The above limited warranty is sole and exclusive No other warranty is made whether expressed or implied including any warranty of merchantability or fitness for a particular purpose Purchaser Notification Introduction Limited Use Label License No 19 Gateway Cloning Products Gateway Clone Distribution Policy Use of the Vivid Colors pcDNA 6 2 N or C EmGFP or YFP GW TOPO Vectors is covered under the licenses detailed below The purchase of this product conveys to the buyer the non transferable right to usethe purchased amount of the product and components of the product in research conducted by the buyer whether the buyer is an academic or for profi
24. and the control Cloning Reactions vector set up two 6 ul TOPO Cloning reactions as described below What You Should See Transformation Control 30 Reagent Vector Only Vector PCR Insert Control PCR Product 1 ul Sterile Water 4 ul 3 ul Salt Solution or Dilute 1 ul 1 ul Salt Solution TOPO vector 1 ul 1 ul Incubate at room temperature for 5 minutes and place on ice 2 Use 2 ul of the reaction to transform two separate vials of One Shot competent cells using the procedure on page 14 3 Spread 10 50 ul of each transformation mix onto LB plates containing 100 ug ml ampicillin and X gal When plating small volumes add 20 ul of S O C Medium to ensure even spreading Be sure to plate two different volumes to ensure that at least one plate has well spaced colonies 4 Incubate plates overnight at 37 C The vector PCR insert reaction should produce hundreds of colonies Greater than 85 of these will be blue The vector only reaction should yield very few colonies lt 15 of the vector PCR insert plate and these should be white pUC19 plasmid is included to check the transformation efficiency of the One Shot competent cells Transform one vial of One Shot TOP10 cells with 10 pg of pUC19 using the protocol on page 14 Plate 10 ul of the transformation reaction plus 20 ul of S O C on LB plates containing 100 ug ml ampicillin The transformation efficiency should be 1
25. ause Solution Few or no colonies obtained from sample reaction but transformation control yielded colonies Incomplete extension during PCR Include a final extension step of 7 30 minutes during PCR Longer PCR products will need a longer extension time Excess or dilute PCR product used in the TOPO Cloning reaction Reduce or concentrate the amount of PCR product PCR primers contain 5 phosphates Do not add 5 phosphates to your PCR primers Used a proofreading polymerase or a Taq proofreading polymerase mixture for PCR Use Tag polymerase to add 3 A overhangs to your PCR product by following the method on page 31 Large PCR product e Increase the amount of PCR product used in the TOPO Cloning reaction e Increase the incubation time of TOPO Cloning reaction from 5 minutes to 30 minutes e Gel purify the PCR product to remove primer dimers or other artifacts PCR reaction contains artifacts i e not a single band on an agarose gel e Optimize your PCR conditions e Gel purify your PCR product PCR product does not contain sufficient 3 A overhangs even though you used Taq polymerase e Increase the final extension time to ensure that all 3 ends are adenylated Taq polymerase is most efficient at adding a non template 3 A next to a C and less efficient at adding a nontemplate 3 A next to another A Brownstein et al 1996 e Y
26. ave TOPO Cloned perform the control reactions detailed on pages 29 30 in parallel with your samples We have found that including salt 200 mM NaCl 10 mM MgCl in the TOPO Cloning reaction increases the number of transformants 2 to 3 fold In addition incubating the reaction mixture for greater than 5 minutes in the presence of salt can also increase the number of transformants This is in contrast to earlier experiments without salt where the number of transformants decreases as the incubation time increases beyond 5 minutes Including salt in the TOPO Cloning reaction allows for longer incubation times because it prevents topoisomerase I from rebinding and potentially nicking the DNA after ligating the PCR product and dissociating from the DNA The result is more intact molecules leading to higher transformation efficiencies You will perform TOPO Cloning in a reaction buffer containing salt i e using the stock salt solution provided in the kit Note that the amount of salt added to the TOPO Cloning reaction varies depending on whether you plan to transform chemically competent cells provided or electrocompetent cells see page viii for ordering information e If you are transforming chemically competent E coli use the stock Salt Solution as supplied and set up the TOPO Cloning reaction as directed on the next page e If you are transforming electrocompetent E coli the amount of salt in the TOPO Cloning reaction must
27. bute such Gateway expression clones for a nominal fee 10 per clone payable to Invitrogen We would ask that such distributors of Gateway entry and expression clones indicate that such clones may be used only for research purposes that such clones incorporate the Gateway Technology and that the purchase of Gateway Clonase from Invitrogen is required for carrying out the Gateway recombinational cloning reaction This should allow researchers to readily identify Gateway containing clones and facilitate their use of this powerful technology in their research Use of Invitrogen s Gateway Technology including Gateway clones for purposes other than scientific research may require a license and questions concerning such commercial use should be directed to Invitrogen s licensing department at 760 603 7200 Product Qualification Introduction Vector TOPO Cloning Efficiency Primers One Shot TOP10 Chemically Competent E coli This section describes the criteria used to qualify the components of the Vivid Colors pcDNA 6 2 EmGFP or YFP GW TOPO Mammalian Expression Vector Kit e Prior to adaptation with topoisomerase I the parental supercoiled vectors are qualified by restriction enzyme digestion to verify identity and structure e Each control vector is qualified by restriction enzyme digestion to verify identity and structure After adaptation with topoisomerase each lot of the pcDNA 6 2
28. e information about Lipofectamine 2000 and other transfection reagents go to www invitrogen com or contact Technical Service page 41 In general recombinant protein can be visualized by UV fluorescence at 24 hours post transfection see page 22 However for some cell lines protein may be detected in as little as 6 8 hours after transfection 19 Creating Stable Cell Lines Introduction Linearizing the Plasmid Blasticidin Determining Blasticidin Sensitivity 20 The Vivid Colors pcDNA 6 2 EmGFP and YFP GW TOPO vectors contain the Blasticidin resistance gene to allow selection of stable cell lines If you wish to create stable cell lines transfect your expression construct into the mammalian cell line of choice and select for stable transfectants using Blasticidin General information and guidelines are provided below To obtain stable transfectants we recommend that you linearize your pcDNA 6 2 EmGFP or YFP GW TOPO expression construct before transfection While linearizing the vector may not improve the efficiency of transfection it increases the chances that the vector does not integrate in a way that disrupts elements necessary for expression in mammalian cells Cut at a unique site that is not located within a critical element or within your gene of interest Restriction site information for plasmid vectors is available at www invitrogen com Blasticidin S HCl is a nucleoside antibiotic isolated from St
29. e the appropriate concentration of antibiotic that kills your cells within 1 3 weeks after addition of Blasticidin Continued on next page Creating Stable Cell Lines Continued Generating Stable Cell Lines Once you have determined the appropriate Blasticidin concentration to use for selection you can generate a stable cell line expressing your Vivid Colors pcDNA 6 2 EmGFP or YFP expression construct 1 TM Transfect the mammalian cell line of interest with the peDNA 6 2 EmGFP or YFP expression construct using your transfection method of choice 24 hours after transfection wash the cells and add fresh growth medium without Blasticidin 48 hours after transfection split the cells into fresh growth medium without Blasticidin such that they are no more than 25 confluent If the cells are too dense the antibiotic will not kill the cells Antibiotics work best on actively dividing cells Incubate the cells at 37 C for 2 3 hours until they have attached to the culture dish Remove the growth medium and replace with fresh growth medium containing Blasticidin at the predetermined concentration required for your cell line see previous page Feed the cells with selective media every 3 4 days until Blasticidin resistant colonies can be identified Pick at least 10 Blasticidin resistant colonies and expand them to assay for recombinant protein expression Refer to page 40 for instructions on
30. ements All features have been functionally tested and the vectors have been fully sequenced Feature Benefit Human cytomegalovirus CMV immediate early promoter enhancer Allows efficient high level expression of your recombinant protein Andersson et al 1989 Boshart et al 1985 Nelson et al 1987 T7 promoter priming site Allows in vitro transcription in the sense orientation and sequencing through the insert attB1 and attB2 sites Allows recombination with a pDONR plasmid to create a Gateway entry clone TOPO Cloning site Allows insertion of your PCR product in frame with EmGFP or YFP EmGFP or YFP C terminal fusion to the gene of interest for fluorescent detection T7 Promoter Forward primer binding site Allows sequencing of the insert FP 2 Reverse primer binding site Allows sequencing of the insert Herpes Simplex Virus Thymidine Kinase TK polyadenylation signal Allows efficient transcription termination and polyadenylation of mRNA Cole and Stacy 1985 fl origin Allows rescue of single stranded DNA SV40 early promoter and origin Allows efficient high level expression of the Blasticidin resistance gene and episomal replication in cells expressing the SV40 large T antigen EM7 promoter Allows expression of the Blasticidin resistance gene in E coli Blasticidin bsd resistance gene Allows selection of stable transfectants in mammalian cel
31. gently Do not mix by pipetting up and down and take care not to introduce bubbles Transfer the cells to a 0 1 cm electroporation cuvette 3 Electroporate your sample using your own protocol and electroporator Note If you have problems with arcing see below 4 Immediately add 250 ul of room temperature S O C Medium to the cuvette 5 Transfer the solution to a 15 ml snap cap tube and shake for at least 1 hour at 37 C 6 Spread 10 50 ul from each transformation on a prewarmed selective LB plate To ensure even spreading of small volumes you may add 20 ul of S O C Medium to the transformation mixture We recommend that you plate two different volumes to ensure that at least one plate contains well spaced colonies Incubate plates overnight at 37 C To prevent arcing of your samples during electroporation the volume of cells should be between 50 ul and 80 ul 0 1 cm cuvettes or 100 and 200 ul 0 2 cm cuvettes If you experience arcing during transformation try one of the following suggestions Make sure that the salt levels in the TOPO Cloning Reaction are reduced as suggested on page 13 e Reduce the voltage normally used to charge your electroporator by 10 e Reduce the pulse length by reducing the load resistance to 100 ohms e Ethanol precipitate the TOPO Cloning reaction and resuspend it in water prior to electroporation Selecting Clones Analyzing Positive Clones Sequencing Long Term Storage 1
32. how to prepare and store Blasticidin 21 Detecting Vivid Colors Fusion Proteins Introduction Filters for use with EmGFP YFP 22 You can perform detection and analysis of your recombinant protein of interest from the expression clone in either transiently transfected cells or stable cell lines Once you have transfected your expression clone into mammalian cells you may e Detect protein expression and localization directly in cells by fluorescence microscopy or other methods that use light excitation and detection of emission See below for recommended fluorescence microscopy filter sets e Detect protein expression by Western blot of cell lysates using an antibody See the table on the next page for suggested antibodies Both the EmGFP and YFP can be detected with standard FITC filter sets However for optimal detection of the fluorescence signal you may use a filter set which is optimized for detection within the excitation and emission ranges for each of the fluorescent proteins These filter sets are listed in the table below Fluorescent Protein Filter Set for Fluorescence Microscopy EmGFP Omega XF100 YFP Omega XF1042 Chroma 41028 For information on obtaining these filter sets contact Omega Optical Inc www omegafilters com or Chroma Technology Corporation www chroma com Continued on next page Detecting Vivid Colors Fusion Proteins Continued Antibodies for Detection of Rec
33. icroscopy and standard filter sets Commonly GFP is fused to a protein of interest and upon expression the localization of the fusion protein can be detected in cells GFP can also function as a reporter gene downstream of a promoter of interest Modifications have been made to the wild type GFP to enhance its expression in mammalian systems These modifications include nucleic acid substitutions that correspond to the codon preference for mammalian use and mutations that increase the brightness of the fluorescence signal resulting in enhanced GFP Zhang et al 1996 Mutations have also arisen or have been introduced into GFP that further enhance and shift the spectral properties of GFP such that these proteins will emit fluorescent color variations reviewed in Tsien 1998 The Emerald GFP EmGFP and Yellow Fluorescent Protein YFP are such variants of enhanced GFP The EmGFP and YFP variants have been described in a published review Tsien 1998 and the amino acid changes are summarized in the table below The mutations are represented by the single letter abbreviation for the amino acid in the consensus GFP sequence followed by the codon number and the single letter amino acid abbreviation for the substituted amino acid Fluorescent Protein GFP Mutations EmGFP S65T S72A N149K M153T 1167T YFP S65G 572A K79R T203Y Mutations listed are as described in the literature When examining the actual sequence
34. ield gt 85 blue colonies on LB plates containing ampicillin and X gal The following reagents should be prepared before performing the control reaction e Prepare stock X gal solution 40 mg ml X gal in dimethylformamide e For each transformation you will need two LB plates containing 100 ug ml ampicillin and X gal To add X gal to previously made LB plates warm the plate to 37 C add 40 ul of the stock X gal solution with a sterile pipette spread evenly and let dry 15 minutes Store plates at 4 C protected from light 1 Ina0 5 ml microcentrifuge tube set up the following reaction in a 50 ul volume Overlay reaction with 1 drop of mineral oil if required Reagent Amount Control DNA Template 1 pl 10X PCR Buffer 5 pl 50 mM dNTPs 0 5 ul Control PCR Primers 0 1 ug ul each 1 ul Sterile Water 41 5 ul Taq polymerase 1 unit ul 1 ul Total Volume 50 ul 2 Amplify the control PCR product using the following cycling parameters Step Time Temp Cycles Initial Denaturation 2 min 94 C 1X Denaturation 1 min 94 C Annealing 1 min 60 C 25X Extension 1 min 72 C Final Extension 7 min 72 C 1X 3 Remove 10 ul from the reaction and analyze by agarose gel electrophoresis A discrete 500 bp band should be visible Continued on next page 29 Performing the Control Reactions Continued Control TOPO Using the control PCR product generated in the steps above
35. invitrogen Vivid Colors pcDNA 6 2 EmGFP and YFP GW TOPO Mammalian Expression Vectors For TOPO Cloning and expression of PCR products fused to EmGFP or YFP in mammalian cells Catalog nos K 359 20 K 360 20 K 361 20 K 362 20 Version B 14 December 2010 25 0849 ii Table of Contents Kit Contents anid Storage aiei a aE a en Run add Hunt v Accessory Products wee ea re E E S E E e a a E belle viii OVERVIEW N eae A E EE E NN 1 Methods cisco cil 7 Designing PCR Primers s iiien eieo cc Beak notes acopio AA dt ei 7 Setting Up the TOPO Cloning Redio ae 12 Transforming One Shot Competent 2 6018 dni 14 Selecting Clones s ir cate ea eh estate T Id E Aa Si distecseaetestatte 17 Transtecing Cells roire a E E a A Stam EA E ee 18 Creating Stable Cell Lines ss monona an E EEE AE E E Soe var beta beso db cb vendita beets 20 Detecting Vivid Colors Fusion Proteins nen in 22 Troubleshooting dida meo lH NEM TR Aa ER EERS 26 PAPDOM A O 29 Performing the Control Reachons iein a e a E E RE E RO eE nara Aa O EEA 29 Addition of 3 A Overhangs Post Amplification eeessssenensnensesenennnnnnn 31 Map and Features of peDNA 6 2 N EmGFP YEP GW TOPOS sad a E EN 32 Map and Features of ppDNA 6 2 C EmGFP YFP GW TOPO ae n des ee dea 34 Map of pcDNA 6 2 N EmGFP or YEP GW CAT inoccosiososinci nasneci ci ndogori ninovendono danes todonenicnsacdiocancic n 36 Map of pcDNA 6 2 C EmGFP or YFP GW CAT nnonenensnsnssnsnnenenensnnennnene
36. ks Once you have generated your expression vector you must isolate plasmid DNA for transfection Plasmid DNA for transfection into eukaryotic cells must be clean and free of contamination from phenol and sodium chloride Contaminants will kill the cells and salt will interfere with lipid complexing decreasing transfection efficiency We recommend isolating plasmid DNA using the PureLink HO Mini Plasmid Purification Kit Catalog no K2100 01 Other methods of obtaining high quality plasmid DNA may be suitable Continued on next page Transfecting Cells Continued Methods of Transfection Recombinant Protein Expression For established cell lines consult the original references or the supplier of your cell line for the optimal method of transfection We recommend that you follow exactly the protocol for your cell line Pay particular attention to medium requirements when to pass the cells and at what dilution to split the cells Further information is provided in Current Protocols in Molecular Biology Ausubel et al 1994 Methods for transfection include calcium phosphate Chen and Okayama 1987 Wigler et al 1977 lipid mediated Felgner et al 1989 Felgner and Ringold 1989 and electroporation Chu et al 1987 Shigekawa and Dower 1988 For high efficiency transfection in a broad range of mammalian cell lines we recommend using Lipofectamine 2000 Reagent Catalog no 11668 027 available from Invitrogen For mor
37. ld be designed to be in frame with the V5 epitope pcDNA 6 2 C EmGFP GW TOPO or Express your protein of e Should contain a Kozak pcDNA 6 2 C YFP GW TOPO interest fused to EmGFP consensus sequence or YFP at the C terminus Should not contain a stop codon Continued on next page Designing PCR Primers Continued Points to Consider Before Cloning into N Terminal Vectors TOPO Cloning Site for N Terminal If you are cloning your PCR product into the peDNA 6 2 N EmGFP GW TOPO or pcDNA 6 2 N YFP GW TOPO vector you may express the V5 epitope located at the C terminal end of the fusion by omitting a stop codon in your gene of interest The V5 epitope is a 14 amino acid epitope GKPIPNPLLGLDST derived from the P and V proteins of the SV5 paramyxovirus Southern et al 1991 Fusion proteins containing the V5 epitope can be detected using specific antibodies see page viii for ordering information Use the diagram below to help you design your PCR product for TOPO Cloning into the pcDNA 6 2 N EmGFP GW TOPO or the pcDNA 6 2 N YFP GW TOPO vectors The complete sequences of the vectors are available from www invitrogen com or by contacting Technical Service Fusion page 41 CAAT i or 710 CAAATGGGCG GTAGGCGTGT ACGGTGGGAG 770 830 1599 1650 1698 1755 CGTCAGATCG CCTGGAGACG CCATCCACGC Xbal BamH1 CGATCCAGCC TCCGGACTCT AGAGGATCCC FP 1 Fwd priming site GGC CCG
38. ls Kimura et al 1994 SV40 early polyadenylation signal Allows efficient transcription termination and polyadenylation of mRNA pUC origin Allows high copy number replication and growth in E coli Ampicillin bla resistance gene B lactamase Allows selection of transformants in E coli 35 Map of pcDNA 6 2 N EmGFP or YFP GW CAT Map The map below shows the elements of Vivid Colors pcDNA 6 2 N EmGFP and YFP GW CAT vectors The plasmids were generated by PCR amplification of the CAT gene followed by TOPO Cloning into the p DNA 6 2 N EmGFP or YFP GW TOPO vector The complete sequences of these vectors are available for downloading from www invitrogen com or by contacting Technical Service page 41 EmGFP or YFP Elia os attB2 pcDNA 6 2 N EmGFP YFP pcDNA 6 2 pcDNA 6 2 N EmGFP GW CAT N YFP GW CAT Comments for 36 6557 bp 6559 bp CMV promoter 171 758 174 846 EmGFP YFP 882 1598 882 1598 attB1 site 1614 1638 1614 1638 CAT gene 1653 2312 1653 2312 attB2 site 2323 2347 2323 2347 V5 epitope 2355 2396 2355 2396 TK polyadenylation signal 2423 2694 2423 2694 f1 origin 2730 3158 2730 3158 SV40 early promoter and origin 3183 3491 3185 3493 EM7 promoter 3546 3612 3548 3614 Blasticidin resistance gene 3619 4011 3621 4013 SV40 early polyadenylation signal 4169 4299 4171 4301 pUC origin c 4682 5355 4684 5357 Ampicillin b a resistance gene c 5500 6360 5502 6362 bla
39. n Anti GFP Recombinant antibody available from Invitrogen see previous page or an Anti V5 antibody if Fusion Proteins your fusion protein contains this epitope see page 8 for this option The ready to use WesternBreeze Chromogenic Kits and WesternBreeze Chemiluminescent Kits are available from Invitrogen to facilitate detection of antibodies by colorimetric or chemiluminescent methods see page viii for ordering information The N or C terminal peptide fusion containing EmGFP or YFP will add Note approximately 27 kDa to your protein The fusion peptide including the V5 epitope will add approximately 4 kDa to your protein if it is included in your fusion construct Continued on next page 24 Detecting Vivid Colors Fusion Proteins Continued Detecting CAT Protein If you use the provided positive control vector in your experiment you may assay for CAT expression using your method of choice CAT Antiserum is also available separately from Invitrogen see page viii for ordering information Other commercial kits are available for assaying CAT expression The molecular weight of the EmGFP or YFP CAT fusion protein is approximately 57 kDa 25 Troubleshooting Introduction The table below lists some potential problems solutions that may help you troubleshoot protein expression with a Vivid Colors pcDNA 6 2 EmGFP or YFP TOPO vector construct TOPO Cloning Reaction and Transformation Problem Possible C
40. n on a prewarmed selective LB plate To ensure even spreading of small volumes you may add 20 ul of S O C Medium to the transformation mixture We recommend that you plate two different volumes to ensure that at least one plate contains well spaced colonies Incubate plates overnight at 37 C Continued on next page 15 Transforming One Shot Competent E coli Continued Rapid One Shot Chemical Transformation Protocol One Shot Electroporation Protocol u EN Y RECO Nous I 16 Use the alternative protocol below to rapidly transform One Shot TOP10 chemically competent E coli Before beginning prewarm LB or low salt LB agar plates containing 100 ug ml ampicillin or 50 ug ml Blasticidin at 37 C for 30 minutes 1 Add 4 ul of the TOPO Cloning reaction into a vial of One Shot TOP10 chemically competent E coli and mix gently Do not mix by pipetting up and down Incubate on ice 5 minutes Spread 50 ul of cells on a prewarmed selective plate and incubate overnight at 37 C Use ONLY electrocompetent cells for electroporation to avoid arcing Do not use the One Shot TOP10 chemically competent cells for electroporation We recommend using One Shot TOP10 Electrocompetent cells for electroporation Cat no C4040 50 1 Add 2 ul of the TOPO Cloning reaction from the previous section into a sterile microcentrifuge tube containing 50 ul of electrocompetent E coli with a sterile pipette tip and mix
41. n the manufacture of such protein If the purchaser is not willing to accept the limitations of this limited use statement Life Technologies is willing to accept return of the product with a full refund For information on purchasing a license to use this product for purposes other than those permitted above contact Licensing Department Life Technologies Corporation 5791 Van Allen Way Carlsbad California 92008 Phone 760 603 7200 For additional information about Invitrogen s policy for the use and distribution of Gateway clones see the section entitled Gateway Clone Distribution Policy on page 46 Continued on next page 43 Purchaser Notification Continued Limited Use Label License No 51 Blasticidin amp the Blasticidin Selection Marker Limited Use Label License No 127 GFP with Heterologous Promoter Limited Use Label License No 198 Fluorescent Proteins and Stable Cell Lines Expressing Such Proteins but not for vectors that contain the genes for such fluores cent proteins 44 Blasticidin and the blasticidin resistance gene bsd are the subject of U S Patent No 5 527 701 sold under patent license for research purposes only For information on purchasing a license to this product for purposes other than research contact Licensing Department Life Technologies Corporation 5791 Van Allen Way Carlsbad California 92008 Phone 760 603 7200 Fax 760 602 6500 This product and its use is the s
42. nann 37 NN 38 Blasticidin ini 40 Technical Services ia a idad 41 Purchaser Notification wiii ii ns totes it qt 43 Gateway Clone Distribution POr nee ne 46 Produet Qu litieation EA AA A A ida 47 Notes O NN 48 References it A la 50 iii iv Kit Contents and Storage Types of Kits This manual is supplied with the following kits Product Catalog no Vivid Colors pcDNA 6 2 C EmGFP GW TOPO Mammalian Expression K359 20 Vector Kit Vivid Colors pcDNA 6 2 N EmGFP GW TOPO Mammalian Expression K360 20 Vector Kit Vivid Colors pcDNA 6 2 C YFP GW TOPO Mammalian Expression K361 20 Vector Kit Vivid Colors pcDNA 6 2 N YFP GW TOPO Mammalian Expression K362 20 Vector Kit Shipping and The pcDNA 6 2 EmGFP and YFP GW TOPO Mammalian Expression Vector Storage Kits are shipped on dry ice Each kit contains two boxes as described below Upon receipt store boxes as detailed below pcDNA 6 2 EmGFP or YFP GW TOPO Cloning Reagents One Shot TOP10 Chemically Competent E coli Continued on next page Kit Contents and Storage Continued TOPO The pcDNA 6 2 EmGFP and YFP GW TOPO Mammalian Expression Vector Cloning Reagents cloning reagents Box 1 are listed below Note that the user must supply Taq polymerase Store the contents of Box 1 at 20 C pcDNA 6 2 EmGFP or YFP GW TOPO vector 5 10 ng linearized plasmid DNA in 20 ul TOPO adapted 50 glycerol 50 mM Tris HCI pH 7 4 1mM EDTA
43. nology Experimental Outline The Gateway Technology is a universal cloning system that takes advantage of the site specific recombination properties of bacteriophage lambda Landy 1989 to provide a rapid and highly efficient way to move your gene of interest into multiple vector systems Once an expression vector is created by TOPO Cloning into a pcDNA 6 2 EmGFP or YFP GW TOPO vector the gene of interest is flanked by attB sites see cloning region maps pages 8 9 The expression vector can be used to generate an entry clone by BP recombination with a donor vector The gene of interest can then be shuttled to numerous expression vectors by LR recombination For more information about the Gateway Technology refer to the Gateway Technology with Clonase II manual available at www invitrogen com or by contacting Technical Service page 41 To TOPO Clone your gene of interest into the peDNA 6 2 EmGFP or YFP GW TOPO vector you will perform the following steps 1 Generate a PCR product with Taq polymerase 2 TOPO Clone your PCR product into peDNA 6 2 EmGFP or YFP GW TOPO vector and use the reaction to transform E coli 3 Pick colonies isolate plasmid DNA and screen for insert directionality by sequencing expression clones 4 Transfect your expression clone into the mammalian cell line of choice for transient or stable expression of your gene of interest 5 Visualize fusion proteins by fluorescence micr
44. ombinant Protein You may detect expression of your recombinant fusion protein using an antibody against your protein of interest or by using the following antibodies available from Invitrogen Note You can use an antibody against the V5 epitope ONLY for pcDNA 6 2 N EmGFP GW TOPO and YFP GW TOPO if you have included the V5 epitope in your fusion construct See page 9 for details on this option Antibody Description Epitope Catalog Number Anti GFP Rabbit polyclonal Recognizes A6455 antiserum GFP and derivatives Anti GFP Rabbit polyclonal IgG Recognizes A11122 GFP and derivatives Anti V5 Mouse monoclonal IgG gt Detects 14 R960 25 amino acid V5 epitope Anti V5 HRP Mouse monoclonal IgG Detects 14 R961 25 conjugated to HRP amino acid V5 epitope Anti V5 AP Mouse monoclonal IgG Detects 14 R692 25 conjugated to AP amino acid V5 epitope Continued on next page 23 Detecting Vivid Colors Fusion Proteins Continued Preparing Cell To detect your fusion protein by Western blot you will need to prepare a cell Lysates for lysate from transfected cells A sample protocol is provided below Other Western Blot protocols may be suitable To lyse cells Detection 1 Wash cell monolayer 5 x 10 to 1 x 10 cells once with phosphate buffered saline PBS Catalog no 10010 023 2 Scrape cells into 1 ml PBS and pellet the cells at 1500 x g for 5 minutes 3 Resuspend in 50 ul Cell Lysis
45. oning e Topoisomerase covalently bound to the vector this is referred to as activated vector Tag polymerase has a nontemplate dependent terminal transferase activity that adds a single deoxyadenosine A to the 3 ends of PCR products The linearized vector supplied in this kit has single overhanging 3 deoxythymidine T residues This allows PCR inserts to ligate efficiently with the vector Topoisomerase I from Vaccinia virus binds to duplex DNA at specific sites and cleaves the phosphodiester backbone after 5 CCCTT in one strand Shuman 1991 The energy from the broken phosphodiester backbone is conserved by formation of a covalent bond between the 3 phosphate of the cleaved strand and a tyrosyl residue Tyr 274 of topoisomerase I The phospho tyrosyl bond between the DNA and enzyme can subsequently be attacked by the 5 hydroxyl of the original cleaved strand reversing the reaction and releasing topoisomerase Shuman 1994 TOPO Cloning exploits this reaction to efficiently clone PCR products Topoisomerase s CCCTT INAGGG GGGAR PCR Product TTCCC HO a Topoisomerase Once the PCR product is cloned into a pcDNA 6 2 EmGFP or YFP GW TOPO vector and the transformants are analyzed for correct orientation and reading frame the expression plasmid may be transfected into mammalian cells for expression of the GFP fusion protein Continued on next page Overview Continued The Gateway Tech
46. oscopy or by Western blot The following sections of this manual provide instructions and guidelines for these steps Methods Designing PCR Primers Introduction Note Points to Consider When Designing TOPO Cloning provides a highly efficient 5 minute one step cloning strategy TOPO Cloning for the direct insertion of Taq polymerase amplified PCR products into a plasmid vector No ligase post PCR procedures or PCR primers containing specific sequences are required The section below will help you design primers to produce your PCR product for cloning into pcDNA 6 2 EmGFP or YFP GW TOPO vectors Do not add 5 phosphate to your primers for PCR The PCR product synthesized will not ligate into the vectors Cloning efficiencies may vary depending on the primer nucleotide sequences To obtain the fusion protein that you want from the expression plasmid consider the options below before designing your entry clone For more PCR Primers information on the TOPO cloning sites of the vectors see the next pages To create an expression clone using And you wish to Then your insert pcDNA 6 2 N EmGFP GW TOPOS or Include the N terminal e Should contain a stop pceDNA 6 2 N YFP GW TOPO fluorescent fusion and codon NOT the V5 epitope pcDNA 6 2 N EmGFP GW TOPO or Include the N terminal Should not contain a pcDNA 6 2 N YFP GW TOPO fluorescent fusion and the stop codon V5 epitope e Shou
47. ou may redesign your primers so that they contain a 5 G instead of a 5 T 26 Continued on next page Troubleshooting Continued TOPO Cloning Reaction and Transformation Continued Problem Possible Cause Solution Large number of incorrect inserts cloned PCR cloning artifacts e Gel purify your PCR product to remove primer dimers and other artifacts e Optimize your PCR conditions e Include a final extension step of 7 30 minutes during PCR Few or no colonies obtained from sample reaction and the transformation control gave no colonies One Shot competent E coli stored incorrectly e Store One Shot competent E coli at 80 C e If you are using another E coli strain follow the manufacturer s instructions Insufficient amount of E coli plated Increase the amount of E coli plated Transformants plated on selective plates with the wrong antibiotic Use the appropriate antibiotic for selection Continued on next page 27 Troubleshooting Continued Detection of Vivid Colors Fusion Proteins Problem Possible Cause Solution Recombinant fusion protein not expressed No Kozak consensus sequence added to C terminal fusion Make sure a Kozak consensus sequence is present see page 9 Gene of interest not in frame with fluorescent protein Make sure gene of interest is in frame with fluorescent protein No fl
48. primers and template Be sure to include a 7 30 minute extension at 72 after the last cycle to ensure that all PCR products are full length and 3 adenylated 3 Use agarose gel electrophoresis to verify the quality of your PCR product You should see a single discrete band of the correct size If you do not see a single band refer to the Note below If you do not obtain a single discrete band from your PCR reaction try the following e The PCR Optimizer Kit Catalog no K1220 01 from Invitrogen can help you optimize your PCR to eliminate multiple bands and smearing e Gel purify your fragment before performing the TOPO Cloning reaction We recommend using the S N A P Gel Purification Kit from Invitrogen Catalog no K1999 25 Alternatively refer to Current Protocols in Molecular Biology Unit 2 6 Ausubel et al 1994 for other common protocols for isolating DNA fragments 11 Setting Up the TOPO Cloning Reaction Introduction Note Using Salt in the TOPO Cloning Reaction 12 Once you have produced the desired PCR product you are ready to TOPO Clone it into p DNA 6 2 EmGFP or YFP GW TOPO vector and use this plasmid for transformation of competent E coli It is important to have everything you need to set up the reaction so that you can obtain the best results We suggest that you read this entire section and the next section about transformation before beginning If this is the first time you h
49. product to a third party who has a license from Life Technologies under the patents identified above to distribute such materials Transfer of such materials and or information to collaborators does not convey rights to practice any methods claimed in the foregoing patents or patent applications Commercial Purposes means any activity by a party for consideration and may include but is not limited to 1 use of the product or its components in manufacturing 2 use of the product or its components to provide a service information or data 3 use of the product or its components for therapeutic diagnostic or prophylactic purposes or 4 resale of the product or its components whether or not such product or its components are resold for use in research Life Technologies Corporation will not assert a daim against the buyer of infringement of the above patents based upon the manufacture use or sale of a therapeutic clinical diagnostic vaccine or prophylactic product developed in research by the buyer in which this product or its components was employed provided that none of i this product ii any of its components or iii a method claim of the foregoing patents was used in the manufacture of such product Life Technologies Corporation will not assert a claim against the buyer of infringement of the above patents based upon the use of this product to manufacture a protein for sale provided that no method claim in the above patents was used i
50. pt return of the product with a full refund For information on purchas ing a license to use this product for purposes other than those permitted above contact Licensing Department Life Technologies Corporation 5791 Van Allen Way Carlsbad California 92008 Phone 760 603 7200 or outlicensing lifetech com Continued on next page Purchaser Notification Continued Limited Use Label LicenseNo 267 Mutant Green Fluorescent Products Limited Use Label License No 272 Humanized GFP Limited Use Label License No 358 Re search Use Only This product and its use is the subject of one or more of U S Patent Nos 6 090 919 5 804 387 5 994 077 and foreign equivalents This product is the subject of one or more of U S Patent Numbers 5 786 464 5 795 737 5 874 304 and 6 114 148 and foreign equivalents licensed by Life Technologies Corporation This product is sold for research use only Not for therapeutic or diagnostic use in humans The purchase of this product conveys to the purchaser the limited non transferable right to use the purchased amount of the product only to perform internal research for the sole benefit of the purchaser No right to resell this product or any of its components is conveyed expressly by implication or by estoppel This product is for internal research purposes only and is not for use in commercial ap plications of any kind including without limitation quality control and commercial services such as
51. purification of recombinant fusion proteins see table below Vector Fusion Peptide Fusion Tag Benefit pcDNA 6 2 N EmGFP N terminal EmGFP Fluorescent GW TOPO Detection and Detection with Antibodies y Detection with C terminal Optional V5 Antibodies pcDNA 6 2 N YFP N terminal YFP Fluorescent GW TOPO Detection and Detection with Antibodies Detection with C terminal Optional V5 Antibodies pcDNA 6 2 C EmGFP C terminal EmGFP Fluorescent GW TOPO Detection pcDNA 6 2 C YFP C terminal YFP Fluorescent GW TOPO Detection The Vivid Colors EmGFP or YFP GW TOPO Mammalian Expression Vector Kits include a positive control expression plasmid for transfection and expression optimization pcDNA 6 2 EmGFP or YFP GW CAT Continued on next page Overview Continued Features of the The Vivid Colors pcDNA 6 2 EmGFP or YFP GW TOPO vectors contain the Vectors following elements Human cytomegalovirus immediate early CMV promoter enhancer for high level gene expression in a wide range of mammalian cells Emerald Green Fluorescent Protein EmGFP or Yellow Fluorescent Protein YFP derived from Aequorea victoria GFP for N or C terminal fusion to the protein of interest for fluorescent detection TOPO Cloning site for rapid and efficient cloning of Tag amplified PCR products attBl and attB2 sites to allow recombination based transfer of the gene of interest into any Gateway
52. r short term storage Aqueous stock solutions are stable for 1 2 weeks at 4 C and 6 8 weeks at 20 C pH of the aqueous solution should be 7 0 to prevent inactivation of Blasticidin Do not subject stock solutions to freeze thaw cycles do not store in a frost free freezer Upon thawing use what you need and store the thawed stock solution at 4 C for up to 2 weeks Medium containing Blasticidin may be stored at 4 C for up to 2 weeks Technical Service World Wide Web Visit the Invitrogen Web Resource using your World Wide Web browser At the site you can e Get the scoop on our hot new products and special product offers e View and download vector maps and sequences e Download manuals in Adobe Acrobat PDF format e Explore our catalog with full color graphics e Obtain citations for Invitrogen products e Request catalog and product literature Once connected to the Internet launch your Web browser Internet Explorer 5 0 or newer or Netscape 4 0 or newer then enter the following location or URL http www invitrogen com and the program will connect directly Click on underlined text or outlined graphics to explore Don t forget to put a bookmark at our site for easy reference Contact Us For more information or technical assistance call write fax or email Additional international offices are listed on our Web page www invitrogen com Corporate Headquarters Japanese Headquarters European
53. reporting the results of purchaser s activities for a fee or other form of consideration For inform ation on obtaining additional rights please contact outlicensing lifetech com or Out Licensing Life Technologies 5791 Van Allen Way Carlsbad California 92008 45 Gateway Clone Distribution Policy Introduction Gateway Entry Clones Gateway Expression Clones Additional Terms and Conditions 46 The information supplied in this section is intended to provide clarity concerning Invitrogen s policy for the use and distribution of cloned nucleic acid fragments including open reading frames created using Invitrogen s commercially available Gateway Technology Invitrogen understands that Gateway entry clones containing attL1 and attL2 sites may be generated by academic and government researchers for the purpose of scientific research Invitrogen agrees that such clones may be distributed for scientific research by non profit organizations and by for profit organizations without royalty payment to Invitrogen Invitrogen also understands that Gateway expression clones containing attB1 and attB2 sites may be generated by academic and government researchers for the purpose of scientific research Invitrogen agrees that such clones may be distributed for scientific research by academic and government organizations without royalty payment to Invitrogen Organizations other than academia and government may also distri
54. reptomyces griseochromogenes which inhibits protein synthesis in both prokaryotic and eukaryotic cells Takeuchi et al 1958 Yamaguchi et al 1965 Resistance is conferred by expression of either one of two blasticidin S deaminase genes bsd from Aspergillus terreus Kimura et al 1994 or bsr from Bacillus cereus Izumi et al 1991 These deaminases convert blasticidin S to a nontoxic deaminohydroxy derivative Izumi et al 1991 Blasticidin is available separately from Invitrogen see page viii for ordering information For information on preparing and handling Blasticidin see the Appendix page 40 To successfully generate a stable cell line expressing your protein of interest you first need to determine the minimum concentration of Blasticidin required to kill your untransfected host cell line Most mammalian cells are killed by 2 10 ug ml Blasticidin Test a range of concentrations to ensure that you determine the minimum concentration necessary for your cell line see protocol below Refer to page 40 for instructions on how to prepare and store Blasticidin 1 Prepare 6 plates of cells so that each plate will be approximately 25 confluent 2 Replace the growth medium with fresh growth medium containing a range of Blasticidin concentrations 0 1 3 5 7 5 and 10 ug ml 3 Replenish the selective media every 3 4 days and observe the percentage of surviving cells Count the number of viable cells at regular intervals to determin
55. rgillus terreus BSD A New Drug Resistance Gene for Transfection of Mammalian Cells Biochim Biophys ACTA 1219 653 659 Kozak M 1987 An Analysis of 5 Noncoding Sequences from 699 Vertebrate Messenger RNAs Nucleic Acids Res 15 8125 8148 Kozak M 1991 An Analysis of Vertebrate mRNA Sequences Intimations of Translational Control J Cell Biology 115 887 903 Kozak M 1990 Downstream Secondary Structure Facilitates Recognition of Initiator Codons by Eukaryotic Ribosomes Proc Natl Acad Sci USA 87 8301 8305 Nelson J A Reynolds Kohler C and Smith B A 1987 Negative and Positive Regulation by a Short Segment in the 5 Flanking Region of the Human Cytomegalovirus Major Immediate Early Gene Molec Cell Biol 7 4125 4129 50 References Shigekawa K and Dower W J 1988 Electroporation of Eukaryotes and Prokaryotes A General Approach to the Introduction of Macromolecules into Cells BioTechniques 6 742 751 Shimomura O Johnson F H and Saiga Y 1962 Extraction Purification and Properties of Aequorin a Bioluminescent Protein from the Luminous hHydromedusan Aequorea Journal of Cellular and Comparative Physiology 59 223 239 Shuman S 1994 Novel Approach to Molecular Cloning and Polynucleotide Synthesis Using Vaccinia DNA Topoisomerase J Biol Chem 269 32678 32684 Shuman S 1991 Recombination Mediated by Vaccinia Virus DNA Topoisomerase l in Escherichia coli i
56. s Sequence Specific Proc Natl Acad Sci USA 88 10104 10108 Southern J A Young D F Heaney F Baumgartner W and Randall R E 1991 Identification of an Epitope on the P and V Proteins of Simian Virus 5 That Distinguishes Between Two Isolates with Different Biological Characteristics J Gen Virol 72 1551 1557 Takeuchi S Hirayama K Ueda K Sakai H and Yonehara H 1958 Blasticidin S A New Antibiotic The Journal of Antibiotics Series A 11 1 5 Tsien R Y 1998 The Green Fluorescent Protein Annu Rev Biochem 67 509 544 Wigler M Silverstein S Lee L S Pellicer A Cheng Y C and Axel R 1977 Transfer of Purified Herpes Virus Thymidine Kinase Gene to Cultured Mouse Cells Cell 11 223 232 Yamaguchi H Yamamoto C and Tanaka N 1965 Inhibition of Protein Synthesis by Blasticidin I Studies with Cell free Systems from Bacterial and Mammalian Cells J Biochem Tokyo 57 667 677 Zhang G Gurtu V and Kain S 1996 An Enhanced Green Fluorescent Protein Allows Sensitive Detection of Gene Transfer in Mammalian Cells Biochem Biophys Res Comm 227 707 711 2005 2010 Invitrogen Corporation All rights reserved For research use only Not intended for any animal or human therapeutic or diagnostic use 51 8 invitrogen Corporate Headquarters Invitrogen Corporation 1600 Faraday Avenue Carlsbad CA 92008 T 1 760 603 7200 F 1760 602 6500 E tech
57. t entity The purchase of this product does not convey a license under any method claims in the foregoing patents or patent applications or to use this product with any recombination sites other than those purchased from Life Technologies Corporation or its authorized distributor The right to use methods claimed in the foregoing patents or patent applications with this product for research purposes only can only be acquired by the use of ClonaseTM purchased from Life Technologies Corporation or its authorized distributors The buyer cannot modify the recombination sequence s contained in this product for any purpose The buyer cannot sell or otherwise transfer a this product b its components or c materials made by the employment of this product or its components to a third party or otherwise use this product or its components or materials made by the employment of this product or its components for Commercial Purposes The buyer may transfer information or materials made through the employment of this product to a scientific collaborator provided that such transfer is not for any Commercial Purpose and that such collaborator agrees in writing a not to transfer such materials to any third party and b to use such transferred materials and or information solely for research and not for Commercial Purposes Notwithstanding the preceding any buyer who is employed in an academic or govern ment institution may transfer materials made with this
58. t of this product or its components for Commercial Purposes The buyer may transfer information or materials made through the employment of this product to a scientific collaborator provided that such transfer is not for any Commercial Purpose and that such collaborator agrees in writing a not to transfer such materials to any third party and b to use such transferred materials and or information solely for research and not for Commercial Purposes Commercial Purposes means any activity by a party for consideration and may include but is not limited to 1 use of the product or its components in manufacturing 2 use of the product or its components to provide a service information or data 3 use of the product or its components for therapeutic diagnostic or prophylactic purposes or 4 resale of the product or its components whether or not such product or its components are resold for use in research Life Technologies Corporation will not assert a claim against the buyer of infringement of the above patents based upon the manufacture use or sale of a therapeutic clinical diagnostic vaccine or prophylactic product developed in research by the buyer in which this product or its components was employed provided that none of this product or any of its components was used in the manufacture of such product If the purchaser is not willing to accept the limitations of this limited use statement Life Technologies Corporation is willing to acce
59. th in E coli Ampicillin bla resistance gene B lactamase Allows selection of transformants in E coli 33 Map and Features of pcDNA 6 2 C EmGFP YFP GW TOPO Map 34 The map below shows the elements of the Vivid Colors pcDNA 6 2 N EmGFP or YFP GW TOPO vectors The complete sequences of these vectors are available for downloading from www invitrogen com or by contacting Technical Service page 41 Comments for CMV promoter T7 promoter priming site attB1 site TOPO cloning site attB2 site FP 2 reverse priming site EmGFP YFP TK polyadenylation signal f1 origin SV40 early promoter and origin EM7 promoter Blasticidin resistance gene SV40 early polyadenylation signal pUC origin c Ampicillin bla resistance gene c bla promoter c c complementary strand pcDNA 6 2 C EmGFP TOPO 5814 bp 174 761 802 821 854 878 893 906 930 930 950 944 1663 1678 1949 1985 2413 2440 2748 2803 2869 2876 3268 3426 3556 3939 4612 4757 5617 5612 5716 pcDNA 6 2 C YFP TOPO 5814 bp 174 761 802 821 854 878 893 906 930 930 950 944 1663 1678 1949 1985 2413 2440 2748 2803 2869 2876 3268 3426 3556 3939 4612 4757 5617 5612 5716 Continued on next page Map and Features of pcDNA 6 2 C EmGFP YFP GW TOPO Features Vivid Colors pcDNA 6 2 C EmGFP GW TOPO 5814 bp and YFP GW TOPO 5814 bp vectors contain the following el
60. the insert in the TOPO Cloning site to confirm orientation and reading frame Continued on next page Transforming One Shot Competent E coli Continued Preparing for Transformation One Shot Chemical Transformation Protocol For each transformation you will need one vial of One Shot competent cells and two selective LB plates Equilibrate a water bath to 42 C if using chemically competent E coli or set up your electroporator if using electrocompetent E coli Warm the vial of S O C Medium to room temperature Warm selective LB plates at 37 C for 30 minutes Thaw one vial of One Shot cells on ice for each transformation Use the following protocol to transform One Shot TOP10 chemically competent E coli 1 Ne Add 2 ul of the TOPO Cloning reaction into a vial of One Shot Chemically Competent E coli with a sterile pipette tip and mix gently Do not mix by pipetting up and down Note If you are using the pUC19 control plasmid for transformation use 1 ul 10 pg Incubate cells plasmid mix on ice for 5 30 minutes Note Longer incubations on ice seem to have a minimal effect on transformation efficiency Heat shock the cells for 30 seconds at 42 C without shaking Immediately transfer the tubes to ice Add 250 ul of room temperature S O C Medium Cap the tube tightly and shake the tube horizontally at 200 rpm in a 37 C shaking incubator for 1 hour Spread 10 50 ul from each transformatio
61. ubject of one or more of U S Patent Nos 5 491 084 and 6 146 826 and foreign equivalents This product is sold under license from Columbia University Rights to use this product are limited to research use only and expressly exclude the right to manufacture use sell or lease this product for use for measuring the level of toxicity for chemical agents and en vironmental samples in cells and transgenic animals No other rights are conveyed Not for human use or use in diagnostic or therapeutic procedures Inquiry into the availability of a license to broader rights or the use of this product for commercial purposes should be directed to Columbia Innovation Enterprise Columbia University Engineering Terrace Suite 363 New York New York 10027 This product and its use is the subject of one or more of U S Patent Nos 5 777 079 6 066 476 and 6 319 669 and foreign equivalents The purchase of this product conveys to the buyer the nontransferable right to use the purchased amount of the product and components of the product in research conducted by the buyer whether the buyer is an academic or for profit entity No rights are conveyed to modify or clone the gene encoding GFP contained in this product The buyer cannot sell or otherwise transfer a this product b its components or c materials made by the employment of this product or its components to a third party or otherwise use this product or its components or materials made by the employmen
62. uorescence signal detected after transfecting control or experimental expression clone Transfected control gives fluorescent signal but experimental expression clone does not Incorrect filters used to detect fluorescence Fusion protein interferes with EmGFP or YFP Be sure to use the recommended filter sets for detection of fluorescence see page 4 Try fusing EmGFP or YFP to the other end N or C terminal of your protein Recombinant protein is not detectable with specific antibodies EmGFP or YFP interferes with fusion protein Try fusing EmGFP or YFP to the other end N or C terminal of your protein Recombinant protein is not localizing correctly within cells EmGFP or YFP interferes with fusion protein Try fusing EmGFP or YFP to the other end N or C terminal of your protein Mutation in localization signals or critical elements in your gene of interest Confirm sequence and reclone if needed 28 Appendix Performing the Control Reactions Introduction Before Starting Producing the Control PCR Product We recommend performing the following control TOPO Cloning reactions the first time you use the kit to help you evaluate your results Performing the control reactions involves producing a control PCR product expressing the LacZa fragment using the reagents included in the kit Successful TOPO Cloning of the control PCR product in either direction will y
63. y User Polymerase Mixtures 10 After you have designed primers to amplify your gene of interest you are ready to produce your PCR product for TOPO Cloning into a pcDNA 6 2 EmGFP or YFP GW TOPO vector You will need the following reagents and equipment e Tag polymerase such as Platinum Tag Catalog no 10966 018 e Thermocycler e DNA template e Primers for PCR product You may use an enzyme mixture containing Taq polymerase and a proofreading polymerase however Taq must be used in excess of 10 1 to ensure the presence of 3 A overhangs on the PCR product We recommend using Platinum Taq DNA Polymerase High Fidelity available from Invitrogen see page viii for ordering information If you use polymerase mixtures that do not have enough Tag polymerase or use a proofreading polymerase only you can add 3 A overhangs after amplification using the method on page 31 Continued on next page Producing PCR Products Continued Producing PCR Products Note 1 Set up the following reaction in a 50 ul volume Use less DNA if you are using plasmid DNA as a template and more DNA if you are using genomic DNA as a template Reagent Amount DNA template 10 100 ng 10X PCR Buffer 5 ul 50 mM dNTPs 0 5 ul PCR Primers 100 200 ng each Sterile water to final volume of 49 ul Taq polymerase 1 unit ul 1ul Total Volume 50 ul 2 Perform amplification using the cycling parameters suitable for your
64. y phase Mix 0 85 ml of culture with 0 15 ml of sterile glycerol Transfer to a cryovial and store at 80 C 17 Transfecting Cells Introduction Positive Control Plasmid Plasmid Preparation 18 This section provides general information for transfecting your expression clone into the mammalian cell line of choice We recommend that you include the positive control vector peDNA 6 2 EmGFP GW CAT or pcDNA 6 2 YFP GW CAT below and a mock transfection negative control in your experiments to evaluate your results Each kit contains a positive control plasmid expressing CAT for use in mammalian cell transfection and expression see pages 36 37 for maps and to optimize recombinant protein expression levels in your cell line These vectors allow expression of an N or C terminally tagged chloramphenicol acetyl transferase CAT fusion protein that may be detectable by fluorescence microscopy Western blot or functional assay The control vector is supplied at 0 5 ug ul in TE pH 8 0 You can transfect mammalian cells with this stock or propagate and maintain the plasmid as described below 1 Use 1 ul of the control vector to transform a recA endA E coli strain like TOP10 DH5a JM109 or equivalent 2 Select transformants on LB agar plates containing 100 ug ml ampicillin Prepare a glycerol stock of a transformant containing plasmid for long term storage see previous page for a protocol for preparing glycerol stoc

Detecting Vivid Colors - Thermo Fisher Scientific

Contents

Download Pdf Manuals

Related Search

Related Contents