USB to RS-232 Converter with galvanic isolation ADA - CEL-MAR
Contents
1. 12 6 3 EMERGENCY DRIVER UNINSTALLATION EEEE a a 13 6 3 1 EMERGENCY DRIVER UNINSTALLATION IN WINDOWS 98 ME 2000 13 6 3 2 EMERGENCY DRIVER UNINSTALLATION IN WINDOWS XP 2003 Vista 7 2008 13 mu CER er EEEN en TT ce On en I DEN aed PORT Pr 13 7 1 BAUD RATE SELECTION FOR PROFIBUS COM PORT a a a 13 7 2 SELECTION OF COM PORT GREATER THEN CON9 a a 13 ONER STON ce YO 13 9 RS232 INTERFACE PIN DESCRIPTION OF D SUB9 MALE SOCKETI a 14 10 SPECIFICA MONI be bailar A GA X A Ka kaz PL AE 14 ADA I9110 CEL MAR Zaklad Informatyki i Elektroniki 1 GENERAL INFORMATION Thank you for your purchase of CEL MAR Company product This product has been completely tested and is covered by a two year warranty on parts and operation from date of sale If any questions or problems arise during installation or use of this product please do not hesitate to contact Technical Support at 48 41 362 12 46 or e mail suppo2. 4 S re OI sae scence wre seine unu u ia mn nu nux 4 j IA 4 4 1 CONVERTER CONNECTION TO RS 232 INTERFACE OF 4 4 2 CONNECTION TO COMPUTER S USB INTERFACE ccc ccccececcecceccccccccceceacecuacccuscacceuacacuauucuaceanecuacecuncaccusancuuecucuacaanuaaenancs 5 4 3 POWER SUPRPLY a a a a a a a aaa a a ge sagesse se se ass sspe penu 5 5 DRIVERS INSTALLATION IN SYSTEM WINDOWS a a a aa 5 5 1 EXAMPLE DRIVER INSTALLATION IN WINDOWS 7 SYSTEM 5 6 DRIVER UNINSTALLATION a aa aa aa a a e se sa sessa e ese genua 11 6 1 DRIVER UNINSTALLATION IN WINDOWS 98 ME SYSTEMS a 11 6 2 DRIVER UNINSTALLATION IN WINDOWS 2000 XP 2003 VISTA 7 2008 SYSTEMS 12 6 2 1 EXAMPLE DRIVER UNINSTALLATION IN WINDOWS 7 SYSTEMS
3. ps em fee s m mona Ree 10 SPECIFICATION Parameters KA WORA PA e WA SEGA 3 __ Cable DB9F DB9M multi core 9x0 34 shielded op to 15m or twisted cable 9 pairs UTP 9x2x0 5 24AWG shield inside large interferences STP 9x2x0 5 24AW G Standards USB1 1 USB2 0 EIA 232 CCITT V 11 Maximum baud rate up to 921 6 kbps Standard up to 1500 kbps Profibus Transmission type Asynchronism half duplex or full duplex PWD green LED power supply RX red LED received data yellow LED transmitted data additional signals RTS CTS DTR DSR DCD RI Power W W Resistance to disruptions according to the standard PN EN 55024 Emission of disruptions according to the standard PN EN 55022 Casing Matra 0000000 OSOS Wg T Transmission line Standard USB extension cable A A Optical Signalization Electromagnetic compatibility 14 Zaklad Informatyki i Elektroniki ADA 19110 CEL MAR ADA I9110 CEL MAR Zaklad Informatyki i Elektroniki Dear Customer Thank you for purchasing CEL MAR Company product We hope that the ADA I9110 converter and this user manual help simplify your network of 1 Wire sensor for industrial applications We also wish to remind you that CEL MAR Company are a manufacturer of the widest selections of data communications products in the world in applications such as data transmission converters in R
4. USB Bus will be uninstalled h after uninstallation reboot the computer 12 ADA I9110 CEL MAR Zaklad Informatyki i Elektroniki 6 3 EMERGENCY DRIVER UNINSTALLATION If there are problems with correct operation of drivers or converter and or on computer was installed driver other devices this type you can use special software form delivered CD ROM to clean the system form files and entries in the system registry This can be done after uninstallation descried in point 6 1 and 6 2 6 3 1 EMERGENCY DRIVER UNINSTALLATION IN WINDOWS 98 ME 2000 Emergency driver uninstallation in Windows 98 ME 2000 system have to be done according follow steps a disconnect converter from computer b from CD ROM delivered with converter copy to hard disk the folder WindowsWin 98ME 1 09 06VFTClean for Windows 98 ME or Windows Win 2000 FTClean for Windows 2000 c from FTClean folder run the application FTClean exe and follow the Tooltip d after finishing reboot the computer 6 3 2 EMERGENCY DRIVER UNINSTALLATION IN WINDOWS XP 2003 Vista 7 2008 Emergency driver uninstallation in Windows XP 2003 Vista 7 2008 system have to be done according follow steps a disconnect converter from computer b login the Administrator account c from CD ROM delivered with converter copy to hard disk the folder WindowsWin XP 2003 Vista 7 2008 2 06 CDMUninstaller d from CDMUninstaller folder run the application uninstall bat e after finishing reboot
5. CEL MAR 9110 Zaklad Informatyki i Elektroniki User Manual 19110 USB to 5 232 Converter with galvanic isolation ADA Over Sor L p ADA 19110 USB TO RS 232 ME RN CONVER s 80305076 26765670 PWR 1 Copyright 2001 2012 CEL MAR sp j i io ada i9110 en v3 22 ADA I9110 CEL MAR Zaklad Informatyki i Elektroniki Contents T OENEPALLINFORMATION 3 1 MWARPRANIEDINFORMATION u a Zad MAJ ZG u L u 3 1 2 GENERAL CONDITIONS FOR SAFE USE aa a a 3 1 3 iN 1 l 3 1 4 ENVIRONMENTAL 1 non Sade ECO SEE akad WWO A GW kd 3 1 5 SERVICE AND MAINTENANCE 2 c cccccccccccccsceccaccacacccceceaceauacucuacuscanananuacuaeuauaneauanuauauusceauaneauauuaeuauacecuacuauatuseaanacaauacscenuusceccenes 3 2 PRODUCT INFORMATION cccccccccccecccccccecccccccuuccccccccaucuucueuuaueuauuaucuucuuaeuuuausuuceeuuuuusucuususuuaueeuuvausuuseeauauecusuusucuusuecuauvausuusuecuueneunnsnes 3 gt LL PROPERMED 3 VANS C VW
6. COMPUTER S USB INTERFACE ADA I9110 converter connection to computer should be done by use USB cable with A type connector 4 3 POWER SUPPLY ADA I9110 converter is fed from USB port of PC After connection to USB port of computer green LED PWR should be ON If doesn t you should check the computer is running the connection of converter cable to PC hibernation mode of PC isn t ON 5 DRIVERS INSTALLATION IN SYSTEM WINDOWS Converter 19110 is purchased with the driver package Installer for Windows systems on CD ROM For installation follow the steps below a insert the CD ROM to optical driver of the computer b the installation wizard will run automatically if not double click ADAUSBDRV exe c following the steps of installation wizard will be installed the Drivers and Uninstaller for the Windows systems 98 ME 2000 XP 2003 Vista Win7 2008 d connect the convert to USB port of computer and follow the steps of installation wizard 5 1 EXAMPLE DRIVER INSTALLATION IN WINDOWS 7 SYSTEM Together With ADA I9110 converter is delivered CD ROM with drivers for the system Windows 98 ME 2000 XP Vista 7 2008 for the baud rates a Standard b Profibus Driver installation have to be done from the account with Administrator permissions For the Drivers installation in Windows 7 system follow the steps bellow 5 ADA 19110 CEL MAR Zak ad Informatyki i Elektroniki a insert the CD ROM to optical
7. RS 232 interface 4 1 CONVERTER CONNECTION TO RS 232 INTERFACE OF DEVICE Connection should be done in use of shielded cable RS232 extender ended DB 9M male plug max lengths up to 15m DSR6 m RIS7 4DTR ALS 5 GND Fig 2 Signal configuration of RS 232 interface in converter DB 9M mail connector CEL MAR Zaklad Informatyki i Elektroniki ADA 19110 Device with RS 232 Computer ADA I9110 DTE interface RS232 RS232 DB 9M DB 9M connector connector USB cable DCD 1 1 DCD type A B RX 2 _ b 2 RX Nc RZE Jem DSR 6 6 DSR RTS 7 7 RTS CTS 84 8 CTS RI 9 9 RI GND 5 5 GND Transmission direction Fig 3 Converter connection to DTE type device e g PC with RS 232 interface Modem with RS 232 Computer ADA I9110 DCE interface RS232 RS232 DB 9M DB 9M connector connector USB cable DCD 1 1 DCD type A B RX 2 2 RX RZE ae i SE SZ type A type B DTR 4 gt 4 DTR DSR 6 6 DSR RTS 7 gt 7 RTS CTS 8 8 CTS RI 9 9 RI GND 5 5 GND Transmission direction Fig 4 Converter connection to DCE type device e g modem with RS 232 interface 4 2 CONNECTION TO
8. S232 RS485 RS422 USB Current Loop Fibre Optic and Ethernet Converters and many others We welcome your feedback so please contact us to tell how you like our products and how we can satisfy you present and future needs Tel RTP 48 41 362 12 46 CEL MAR sp j CU qe 48 41 361 07 70 Zak ad Informatyki i Elektroniki WE TE http www cel mar pl en str ciegiennego 219C Office 1 Office cel mar pl 25 116 Kielce POLSKA Sales department sales cel mar pl Technical information support cel mar pl 16
9. Tx RTS CTS DTR DSR DCD RI Baud rate bps 300 600 1200 2400 4800 9600 19200 38400 57600 115200 230400 460800 921600 PROFIBUS baud rate bps 300 bps 600 bps 1200 bps 2400 bps 4800 bps 9600 bps 19200 bps 93750 230400 bps 187500 460800 bps 500000 921600 bps Transparent for all protocols MODBUS DNP PROFIBUS and other Any format of byte defined with the specification of RS232 interface Automatic data flow control RTS TOGGLE function Power supply from the USB port 2 5kV optoisolation in signal channel between USB and RS 232 interface 1kV or 3kV galvanic isolation in power supply channel between USB and RS232 RS 232 interface connection via DSUB 9 male connector Connection USB interface via USB type A connector USB interface socked B type Interface casing Casing dimensions W x D x H 84mm x 23mmx 59mm ADA I9110 CEL MAR Zaklad Informatyki i Elektroniki 2 2 DESCRIPTION ADA I9110 converts USB to RS 232 without interfering in the format of transmitted data Converter uses transmission lines as Rx Tx RTS CTS DTR DSR DCD RI and GND ground to communicate with RS 232 interface devices and it is automatically detect by the computer system after connecting to USB network Plug amp Play device This converter doesn t required external power supply it is powered from USB bus and it uses asynchronism baud rate up to 921 3 kbps ADA I9110 has implemented optoisolation in signal chann
10. driver of computer b the installation wizard will run automatically if not double click ADAUSBDRV exe form the CD ROM After running the installer the wizard installation window will appear Welcome to the ADA USB Package Virtual Serial Ports Drivers for Windows Setup Wizard This will install ADA USB Package Virtual Serial Ports Drivers for Windows version 2 06 00 on your computer It is recommended that you close all other applications before continuing Click Next to continue or Cancel to exit Setup Press Next 181 setup ADA USB Package Virtual Serial Ports Drivers for Windows Select Components Which components should be installed Select the components you want to install dear the components you not want to install Click Mext when you are ready to continue BJ STANDARD Drivers for Windows XP 2003 Vista 7 2008 PROFIBUS Drivers for Windows XP 2003 Vista 7 2008 Current selection requires at least 5 4 MB of disk space Select STANDARD Drivers and press Next CEL MAR Zaklad Informatyki i Elektroniki ADA 19110 Ready to Install Setup is now ready to begin installing ADA USB Package Virtual Serial Ports Drivers for Windows on your computer Click Install to continue with the installation or dick Back if you want to review change any settings setup type Instalation of Package ADA USB Virtual Serial Ports Drivers Selected components STANDARD Drivers f
11. el between USB and RS 232 and 1kV or 3kV galvanic isolation in the power circuit Purchasing the converter you will also receive drivers for Windows 98 ME NT 2000 XP Vista Linux Installing this software on Operating System it add the additional COM port about the next free number witch can be used as standard COM port It is virtual COM port therefore some software use DOS can work improperly but it s considerably faster then standard port baud rate up to 921 6 kbps 3 CONFIGURATION Converter can be configured by using TOG switch Fig 1 to operate with data flow control of RTS TOGGLE type or without this control Converter ADA I9110 can be connected to the converter ADA 1040 RS232 to RS485 RS422 using the RTS TOGGLE control type allowing correct operating on 2 wires RS 485 bus control operation of the 485 transmitter using the RTS signal from ADA I9110 Options TOG Switch are described in the Table bellow TOG Switch Description ON Operating of RTS line in RTS TOGGLE mode of RS232 interface of ADA I9110 OFF Standard operating of RTS line RS232 interface of ADA I9110 ru E OFF ADA os aon ADA I9110 c USB TO RS 232 le c ISOLATED CONVERTER Tx Rx gt e LO PWR RTS CTS C DCD RI 23mm lt q p 84mm Fig 1 ADA I9110 view 4 INSTALLATION This chapter will show you correctly connection of the ADA I9110 to USB and
12. l Home Uninstall or change a program View installed updates uninstall a program select it from the list and then click Uninstall Change or Repair Eg Turn Windows features on or 4 Organize Uninstall Change Publisher A Windows Driver Package CEL MAR ADA USB Serial Converter 10 22 2009 2 06 00 CEL MAR AG Windows Driver Package CEL MAR ADA Virtual USB Serial Port 10 22 2009 2 06 00 CEL MAR n j 1 CEL MAR Product version 10 22 2009 2 06 00 Now you can connect ADA I9110 to computer port After connection will appear the Tool tip with Your device is ready to use To see the details press the Tooltip and will appear information window where you can see which COM port was assigned to converter 1 Driver Software Installation Your device is ready to use ADA USB Serial Converter d Ready to use ADA USB Serial Port COMMS i Ready to use After this installation RS232 port of ADA I9110 converter is available in the system as normal COM port You have to remember about specified baud rate for communication If during installation you selected driver for Standard baud rates you would be able to use 300 bps 600 bps 1200 bps 2400 bps 4800 bps 9600 bps 19200 bps 38400 bps 57600 bps 115200 bps 230400 bps 460800 bps 921600 bps If during installation you selected driver for Profibus baud rates you would be able to use 300 bps 600 bps 1200 bps 2400 bp
13. mplete E ou n gt Don t install this driver software You should check your manufacturer s website for updated driver software for your device Install this Only Install driver software obtained from your manufacturer s website disc Unsigned software from other sources may harm your computer or steal information xe See details Press Install this driver software anyway Installation of drivers for Virtual Port will start 9110 Press Finish Press Finish VCP Driver Installer CEL MAR Zaklad Informatyki i Elektroniki Congratulations You are finished installing your ADA device The drivers were successfully installed on this computer You can now connect your device to this computer If your device came with instructions please read them first Driver Name Status w CEL MAR ADA USB Serial Converter 1 Ready to use w CEL MAR ADA Virtual USB Serial Port Ready to use 4 Tn Completing the ADA USB Package Virtual Serial Ports Drivers for Windows Setup Wizard Setup has finished installing ADA USB Package Virtual Serial Ports Drivers for Windows on your computer Click Finish to exit Setup The driver for ADA I9110 have been installed This can be checked in Uninstall or change a program 10 ADA 19110 CEL MAR Zak ad Informatyki i Elektroniki Pal k Control Panel Programs k Programs and Features Control Pane
14. ng wires Do not make connection with wet hands Do not adapt open or make holes in casings of the device Do not immerse device in water or no other liquid Do not put the fire opened on device sources candles an oil lamps and the like Complete disable from the supply network is only after disconnecting the power supply circuit voltage Do not carry out the assembly or disassembly of the device if it is enabled This may result to short circuit and damage the device 1 3 CE LABEL The CE symbol on the device CEL MAR means compatibility with electromagnetic compatibility Electromagnetic Compatibility Directive EMC 2004 108 WE Declaration of Conformity is available by contact with Technical Service email support cel mar pl phone 48 41 362 12 46 1 4 ENVIRONMENTAL PRESERVATION This sign on the device inform about putting expended device with other waste materials Device should send to the recycling In accordance with the act about the Electronic Appliance Expended from day 29 of July 2005 1 5 SERVICE AND MAINTENANCE The ADA I9110 converter does not require the servicing and maintenance Technical support is available at number 48 41 362 12 46 in 8 00 16 00 from Monday to Friday or e mail supportQcel mar pl 2 PRODUCT INFORMATION Converter is delivered with user manual CD ROM with software 2 1 PROPERTIES Conversion of USB to RS 232 standard Compliant with USB1 1 and USB 2 0 standard Transmitted signals Rx
15. or Windows XP 2003 Vista 7 2008 Press Install Wee Setup ADA USB Package Virtual Serial Ports Drivers for Windows Please wait while Setup installs ADA USB Package Virtual Serial Ports Drivers for Windows on your computer Finishing installation Welcome to the VCP Driver Installer This wizard will install VCP drivers for your ADA USB device Sar cm To continue click Next lt Back Press Next will be installed Drivers for USB Bus ADA I9110 CEL MAR Zaklad Informatyki i Elektroniki VCP Driver Installer Installing the software for your ADA USB device Please wait while the drivers install This may take some time to complete 69 Windows Security 6 Windows can t verify the publisher of this driver software b Don t install this driver software You should check your manufacturer s website for updated driver software for your device gt Install this driver software anyway Only Install driver software obtained from your manufacturer s website disc Unsigned software from other sources may harm your computer or steal Information iw See details Press Install this driver software anyway Installation of drivers for USB Bus will start ADA I9110 CEL MAR Zaklad Informatyki i Elektroniki VCP Driver Installer Installing the software for your ADA USB device Please wait while the drivers install This may take some time to co
16. rt cel mar pl 1 1 WARRANTED INFORMATION The 19110 converter is covered by a two year warranty from date of sale In case of being damaged it will be repair or the damaged component will be replace The warranty does not cover damage caused from improper use materials consumption or any unauthorized changes If the product does not function is damaged or not operate in accordance with the instructions will be repaired All warranty and no warranty repairs must be returned with paid transport and insuring to the CEL MAR Company CEL MAR Company under no circumstances won t be responsible for ensuing damage from improper using the product or as a result of random causes the lightning discharge the flood the fire and the like CEL MAR Company is not be held responsible for damages and loss including loss of profits loss of data pecuniary losses ensuing from using or the impossibility of using this product In specific cases CEL MAR Company discontinue all warranties and in particular do not follow the user manual and do not accept terms of warranty by the user 1 2 GENERAL CONDITIONS FOR SAFE USE The device should be installed in a safe and stable places eg electroinstallation cabinet the powering cable should be arranged so as not to be exposed to trampling attaching or pulling out of the circuit Do not put device on the wet surface Do not connect devices for nondescript powering sources Do not damage or crush poweri
17. s 4800 bps 9600 bps 19200 bps 9375 Obps if you select 230400bps 187500 bps if you select 460800bps 500000 bps if you select 921600bps 6 DRIVER UNINSTALLATION 6 1 DRIVER UNINSTALLATION IN WINDOWS 98 ME SYSTEMS In this system driver uninstallation have to be done according follow steps a disconnect converter from computer b select menu Start Setting Control Panel Add Remove Programs c select from list ADA USB Serial Converter Driver and press Change Remove e reboot the computer 11 19110 CEL MA R Zaklad Informatyki i Elektroniki 6 2 DRIVER UNINSTALLATION IN WINDOWS 2000 XP 2003 VISTA 7 2008 SYSTEMS In this system driver uninstallation have to be done according follow steps a disconnect converter from computer b login as the Administrator c select menu Start gt Setting gt Control Panel gt Add gt Remove Programs d select from the list Windows Driver Package CEL MAR ADA Virtual USB Serial Port e press Change Remove Virtual USB Serial Port driver will be uninstalled f select from the list Windows Driver Package CEL MAR ADA USB Serial Converter g press Change Remove driver converter of USB Bus will be uninstalled h after uninstallation reboot the computer 6 2 1 EXAMPLE DRIVER UNINSTALLATION IN WINDOWS 7 SYSTEMS Windows 7 system driver uninstallation have to be done according follow steps a disconnect converter from compu
18. ter b login the Administrator account c select menu Start gt Control Panel gt Programs gt Uninstall d select from Windows Driver Package CEL MAR ADA Virtual USB Serial Port km mE Control Panel Programs k Programs and Features ncr za Control Panel Home Uninstall or change a program View installed updates To uninstall a program select it from the list and then click Uninstall Change or Repair E Turn Windows features on or e w Uninstall Change Publisher AG Windows Driver Package CEL MAR ADA USB Serial Converter 10 22 2009 2 06 00 CEL MAR A Windows Driver CEL MAR ADA Virtual USB Serial Port ZNANO FFL MAR llar Uninstall Change ADi CEL MAR Product version 10 22 2009 2 06 00 e press Uninstall Change Virtual USB Serial Port driver will be uninstalled f select from the list Windows Driver Package CEL MAR ADA USB Serial Converter Control Panel Home ae Uninstall or change a program View installed updates To uninstall a program select it from the list and then click Uninstall Change or Repair Hg Turn Windows features on or Et Organize Uninstall Change Mame Publisher Erw Windows Live Essentials 2011 Uninstall Change 4 T E I CEL MAR Product version 10 22 2009 2 06 00 gl press Uninstall Change driver converter of
19. the computer 7 USING After property connection according to section above you can start using the converter During the data transmission LEDs should blink and they indicate appropriately RTS Request To Send line condition of RS232 converter port CTS Clear To Send line condition of RS232 converter port DTR Data Terminal Ready line condition of RS232 converter port DSR Data Set Ready line condition of RS232 converter port DCD Data Carrier Detect line condition of RS232 converter port LED ON status signal equal 1 logical LED OFF status signal equal 0 logical 7 1 BAUD RATE SELECTION FOR PROFIBUS COM PORT For setting correct Profibus baud rate after installation Virtual Port driver for Profibus in application using virtual port COM follow table below Set baud rate bps Actual baud rate bps Profibus 230400 937500 460800 187500 921600 500000 7 2 SELECTION OF COM PORT GREATER THEN COM9 If virtual port COM of converter will install in Windows OS as COM10 or greater then in application using this port you should type COM port address as COM10 8 VERSIONS ADA 19110 Galvanic isolation ere ape Product symbol 19110 2 1kv 1 2 galvanic isolation 1kV 3kV 2 13 CEL MAR Zaklad Informatyki i Elektroniki 9 RS232 INTERFACE PIN DESCRIPTION OF D SUB9 MALE SOCKET Pin DB 9 SIGNAL DESCRIPTION ADA I9110 connector 28 s osr
Download Pdf Manuals
Related Search