Home

PRIMERGY BX300 スイッチブレード取扱説明書

image

Contents

1. 0000 O O 000 VLAN Basic VAN DO DD DD CU 61 Information 0000 VLAN Current Table 0 VMANgooo000000000000000 VLAN 62 JUUDDUUDUDUBDDUUDGUnDDUDGUuDDDU VLAN Static List 64 VLAN Static Table oo VANDODODODO E VLAN Static 68 Membership by Pot 00000000000000000000 PviDn VLAN VLAN Port 000000 PVIDO VEANO0O00000 69 Configuration VLAN Trunk 0000000000 VIDO 69 Configuration IGMP 72 IGMP Configuration JUDDUDGUUUUGGDGUuDDDUUDDUUDUUUDUDUu unu 72 Multicast Router Port VLAN IDU 75 Information Static Multicast Router 76 Port Configuration 00000000 IP Multicast JUDDUDGUUUUGDUDDUDupDUUDUUUDUDu unu 79 Registration Table uuugaaggHagHHH MOOG VLANIDO O IGMP Member Port 0000 VEANTO D0 000000000000000 77 Table DD Port 80 Port Information 80 Trunk Information TOO 0000000000 80 Port Configuration 0000000000 82 Trunk Configuration
2. DO O O Speed Link Activity 0000 OU U LL IUDUUUUDUUDUUUUDUUDUUUUUUU Uu TTT eem wll 00 12 VDC 3 A max gung 11 A max 3 3 VDC 0000 36 W max 0000 32 4 VA OOOO 116 kJd hD O 110 BTU Ri mult 00 270 mm 00 115 mm 38 mm WII UU 0000000 10 1000BASE XO 000000 3 1000BASE T 000000000000 RJ 45 0 0 0 0100 ohmO OOOO SU EE 50000000000 1 Mbytes VILDI 26 Gbps 32K MAC address entries LED 0000 160000000 0000000000000 mol In band 00000 Telnet Web based HTTP or SNMP Out of band O00000 RS 232 console port O D HH O D HH B D D B D D T 000000000 TFTP in band MIBO OOO MIB II RFC 1213 Bridge MIB RFC 1493 Ethernet Like MIB RFC 1643 RMON MIB RFC 1757 private MIB RMON OOO 0000 1020309 Statistics History Alarm Event ood VLANs 32 maximum Jumbo Frames 9 KB maximum Port Trunks Port Mirroring mn 00000000 IEEE 802 3 Ethernet IEEE 802 36 Fast Ethernet IEEE 802 30 GigabitEthernet 1000BASE T IEEE 802 1D Spanning Tree Protocol and traffic priorities IEEE 802 1p priority tags IEEE
3. D Factory Default Config ctgj O Web Flash File D Configuration D D D D D D D D IP DI D DE D D 0o00000000000000000000000000000000000 000000000000000000000000000 Transfer from Server 000000000 Transfer Configuration File from Server TETP Server IP Address 10 1 0 99 Source File Name S31 cfg Destination File Name startup Transfer from Server e CLI UUUDDUD TFIPHDDD IP 00000000 Console copy tftp 8082000 115 TFTP server ip address 192 168 1 19 Source configuration file name startup2 0 Startup configuration file name startup startup2 0 113 2000000000000 O Web ON 0n 0000 00 0000 000000 0000000 000000000 000000000000 Apply Changes D H D D D D D D D Start Up Configuration File File Name startup2 0 al Apply Changes 39 3 e CLI TFIPp000 Pg000000000000000000000000000 pod 0000000000000 00000000000000000 Console copy tftp startup config 115 TFTP server ip address 192 168 1 19 Source configuration file name startup2 0 Startup configuration file na
4. DO DO IGM DO L3 U O O O IGMP O O 000000000000000 Console config ip Lomp snooping query max response time 20 Console config 000000 ip igmp snooping version 188 P40000000000 ip igmp snooping query time out DUUDUDDDDUDDDDUDUDUDUDDDDDDDUDUDDDUDDDDDUDUDUDUDDDUDUD pod0000000 Mr 000000000 D ip igmp snooping query time out seconds no ip igmp snooping query time out seconds O 9 0 000000 e 000000 300 0000000 Global Configuration UDUDUDUD I6MP200000000000 0o00 B Lr Console config ip Lomp snooping query time out 0 Console config 000000 ip igmp snooping version ip igmp snooping version R I lt ip igmp snooping version 1 2 no ip igmp snooping version IGMP Version 1 1 IGMP Version 2 2 IGMP Version 2 Global Configuration 43000000000 g
5. gt Jt ip igmp snooping query count count no ip igmp snooping query count count 0000000020 100 0000000 0000000 Global Configuration 100000000000000 Console config ip igmp snooping query count 10 Console config ip igmp snooping query interval OO ip igmp snooping query interval seconds no ip 1800 snooping query interval 00000 seconds 1250 0000600 0000000 1257 0000000 Global Configuration 43000000000 g 187 e I oo000000000 1000000000000000 Console config ip igmp snooping query interval 100 Console config ip igmp snooping query max response time PONDO NDN DD 000000000000 00000000000000 OO ip igmp snooping query max response time seconds no ip igmp snooping query max response time seconds D O D D D D B O D O D D O D DO DUDU SD 300 0000000 10 0000000 Global Configuration 000000000 p0000000000000000000 16MPrv20 000000000
6. r3 CO 3 El o 20 o HD GEI 2 5 pcm Do E AG r3 r3 sls aa D B ae H Aa o Ed EE a r3 9508020 ao o oo o ru Bags say CES oo L1 a E TE a pj bin uu oo D oo a GAMAN oo o r3 EXE CO EXE EIE DD of Ex a o GE e ana eo D oo E a uu EE D El ae a ia Ei oda OA o m o Ga ADI uu oo o oo a ES ao D o Eit o EE rr oo o oo H a OOo goo oo o EEE a EZE a a Oo CJ oo o oo Aa r3 CO p000 Ge DONG AR D oo H 00007 00 D 24 SUE o o c3 a JENG n E EE 5 nooo ao o oo lt 3 i E Oo HS r3 oad ono a oo a oong oO E D H oOo 754 ga oO Bic 2A oda oo a Ca TQ z 2 El BEY EIS El oc O Gada DO CH oO ooo lt OY DD uuu ooo 004020 CH UU ot O lt mar o0 o EE Ec ooo H DO jon m ooo Em E CJ HE gt of oo Gada a m lt S V OOO oo ul oO ooo o A Oo OOO Bee Ene 2 Samana o ooo p HB DO E EE E EH o poe EE oo D ooo AB ORA O a eo ae e oo EXE v EE GS Ej oO HO D o ooo 226 32 a DIE oo og oon HD oo m o 5 a a ooo o ooo TODO
7. ooo 3 dodo a ooon DD a s DD lt MO e J000000000000000 3 11 1 DO VLAN I OOOO 61 3 11 VLAN l VLANT OOO Q0 IEEE 802100000000 4094 VLAN IDO Maximum Number of Supported VLANs vEAND l Web VLAN Version Number Maximum VLAN ID Maximum Number of Supported VLANs 32 VLAN Version Number Maximum VLAN ID O0 VLANQ D VLAN Basic Information D D D D D D D D e CLI Console show bridge ext 171 Max support vlan numbers 32 Max support vlan ID 4094 Extended multicast filtering services No Static entry individual port Yes VLAN learning IVL Configurable PVID tagging Yes Local VLAN capable No Traffic classes Enabled Global GVRP status Disabled GMRP Disabled Console 3 11 2 000 VLAND D O We000000000000000 VLAN ID 0000000 VLAN pj 1 4040 DO 0009000000000 D LB Up Time at Creation OO VLANDU ng o go 00 0000000000000 Status OO VANgO go og o0 0000 0000000000 Permanent D D D D D D D D D D OD D Egress Ports 0000 lt Untagged Ports 0000
8. PONDO 0000000000000 00000000 0000000000 Simple Network Management Protocol SNMPJ D 000000000000 Un OD 0000000000000 00 000000000000 000000 OO 000000000 000000 000000000000 000000 oooOoOooooooooooooooooooooooooooag oooooooooooooooooooooooooooooooag ooooooooooooooooooooooooooooooag OO 3 3 1 0000000 Community String Access Mode Read Only D D D D D D D O D D DO DO D D D D D D D D O 010 co00000000MBp0000000000000000 Read Write 0800000000000000000000000 NMPpo000000000000000000 0000 3200000 O Web SNMP 0000000 H Community Sting D 000000000000 0000000 Access Mose BO D D D O D D D D D D D D O D O D OD D D D Add ODDODODO SNMP Community SNMP Community Capability 5 Current New private RW public RO lt lt Add community String batman Remove access Mode Read Write y 3 3 SNMP 1 U O 33 0000000000 batman O D O O D read write 0 Console config snmp
9. SNMP 0 100000 100000 RFC No Title RFC 1215 coldStart warmStart linkDown linkUp authenticationFailure RFC 1493 newRoot topologyChange RFC 2819 rising Alarm fallingAlarm 5 SNMP OO 6 Contents 6 1 UU UI DUU 000000 D O CLI poo 00 System 27 System Name none string hostname 123 255 00 Object ID 1 3 6 1 4 1 Read Only show system 129 259 6 10 39 Location None string snmp server location 133 255 0 System Up Time None Read Only snmp server contact 133 Switch 29 Serial Number NA Read Only show version 130 Number of Ports 13 Read Only Hardware Version NA Read Only Internal Power Status Active Read Only Loader Version NA Read Only Boot ROM Version NA Read Only Operation Code NA Read Only Version Role Master Read Only IP 30 Management VLAN 1 1 4094 interface 144 ip address 157 IP Address Mode Static Static ip address 157 BOOTP DHCP IP Address 0 0 0 0 KAKAK 0 J 255 O 255 255 0 0 0 Subnet Mask O 25
10. cO FUJITSU T4988618882163
11. Console config ip igmp snooping vlan 1 mrouter ethernet 1 Console config 43000000000 18 ip igmp snooping vlan static po00000Mrpo000000000 D ip igmp snooping vlan vlan id static ip address interface no ip igmp snooping vlan vlan id static ip address inter face vlan id VLANIDQ O00 10 4094 1000000000000 PONDO interface ethernet unit port port D D D D port channel chamnel id 10000000 lobal Configuration oo oi DCH Console config ip igmp snooping vlan 1 static 224 0 0 12 ethernet 5 Console config ip igmp snooping querier O O O O O L3 O O EE ip igmp snooping querier no ip igmp snooping querier a a DU D onf O 0 lobal Kei e o 3 GEE 0000 BAAD E Oooo 186 E Console config ip igmp snooping querier Console config ip igmp snooping query count
12. DO 7 2 000000000 LED DD UDUODUUDUODUUDUODUUDUODUUDU 210 HOUUUUUUUUUUUUUU 7 3 EJ El EN So 2 pH DE Zu o CI ES EE 2G o Io o a Ed E DH NO n O Qu qa a too DO oF E Io HJ EI coa mu oF oO DH E c3 coo mua El EI DH EE oo H H H ya D ooo H 5 o ya coo Ed HD CO DIE o o EJ GE CH ooo oo H mn O moal DO p E Oy a O OO uH E To SES r3 coo mau EI pH COOC DO aa CH Ooo HEITA Lr oo o So E EFE CC CDI m ma o Pu St CC CDI HD oo Er FET NOH Et oo o Pu IC aa p cp No Pu Joo IC aa DIE No BRO E a Foor JE 005000 DC HO H p oooet ICH oo 000 oo Oo Om GIE es 1 Ooo a
13. 414 TU show interfaces status ethernet 0 0 shew TT interfaces TT status D 0 D D O O D ethernet 1500000000 000000 50 OOOO PrivilegedExecQ 0000000 Consolesenable Console show startup config oono Console config username admin password smith 96 40000000000 configure 000000 0000000 000000000000 configure O O I config 000000 00000 00000 ooo ooo ooo ooo 200000000000 O
14. Management VLAN D D D D D D D D D DO D O D O D O D O D D D D D IP Address Mode 0000000 rt Static Dynamic Host Configuration Protocol DHCPITI O O O Boot Protocol BOOTPI D DUDU POOOOOOOOOOOOOOOO DHCP 0 0 BoorrOOOOOOOOOOOOOOOOOOOOOO IP BOOTP DHCP IPD D U O O UDUODUUDUODUUDUODUUDUODUUDUODUUDU Du PONDO Oo a a a MAacggodg 30 30000000 20000000 O Web prgood0000000000000000P 0000000000000 00000000000 App 0000000000 IP Configuration Management VLAN 1 IP Address Mode Static y IP Address 192 168 1 5 Subnet Mask 255 255 255 0 Gateway IP Address 192 168 1 254 MAC Address 22 22 22 22 22 22 e CLI 0d00000000Pg0 000000000000 00000000000 OO Console config Console config interface vlan 1 177 Console config if ip address 192 168 1 5 255 255 255 0 157 Console config if exit Console config ip default gateway 192 168 1 254 159 Console config B DHCP OO BOOTP 0000000 DHCPQ OO BOOTP O OOO0d00 LJ n Ou LJ n Ou LJ n Ou LJ n Ou LJ n Oy LJ n Ou Web orpoo00
15. OO HDH H JEJ HD O ELEI o ping host count count size size host OOOO PONDO com OOOOOOOOOOOOOIO 18000000050 size 1000000000000000 329 52000000 0 32bytes UUUUDDUDUUDUUDUUDDUODUDUDDUODUDUDUOD UD 000008 0000000 Pp00000000000000000 0000000 Normal Exec Privileged Exec 000000000 Pigpoo000000000000000000000000000000 0000 pini 0000000000 Normal response UO D O D D D D D D O O O 00 1000 UDUUDDUUDUDUDUOD 160 40000000000 Destination does not respond DD DD D O D O O B O DD D O timeout O O 000000 Destination unreachable 0 D D D D D D D D D O D O D O D O D D D D D Network or host unreachable O O D O D O O O D D O D D I D Console ping 10 1 0 19 Type ESC to abort PING to 10 1 0 19 by 5 32 byte payload ICMP packets timeout is 5 seconds response time 0 ms response time 0 ms response time 10 ms response time 10 ms response time 10 ms Ping statistics for 10 1 0 19 5 packets transmitted 5 packets received 100 0 packets lost 0 Approximate round trip times Minimum O ms Maximum 10 ms Average
16. Apply Changes 000000000 000000000000 Start Up Operation Code Image File File Name V02014 gt Apply Changes 36000000000 37 e CLI TFIPO 000 IP 000 D 0 corfi D 00 9 0000000 00000 000000 Console copy tftp file 115 TFTP server ip address 10 1 0 99 Choose file type 1 config 2 opcode lt 1 2 gt 2 Source file name v10 bix Destination file name V10000 Console config Console config boot system opcode V10000 118 Console config exit Console reload 113 reload 3 62 DODODODODODO Trrpo0o0000000000000000000000000000000 poda oa ago ooo ooo 000000000 0000000000 0000000000000000 040000000000 20000 nee EM en 0 L UDUUDUUDUUDUUDUUDUUDUUDUUD UU UDUUDUUDUUDUUDUUDUUDUUDUUD UD DO 38 3000000 200000000000 0000060
17. 3 116 DOOOOOOO VEAND DE D D Acceptable Frame Type ooo oo ooo oo ooo HE ooo oo Hon oo ooo oo ooo oo ooo oo ooo oo ooo Ej oo H R HE oooh gt oo ooo oo cuc pH o Onda a o ooo oo oo oo onoooo oo oo oo DD o4 DD El COD H 2 CH o0 5 o0 aa e aa 902 onoooo HE Se See E ES Sie EE ee DODOO soo H 200 5 CH 400 y AASA oo 69 3 11 VLAN l VLAND DD D DD STP O Trunk Member N0000 VLAN Stat O Mode Acceptable Fame Type 000000000000 Hybrid 0000 O E 4 2 13 VEAN H 00 0 D IB switchport mode T gt 179900000 Mode 0000 30000000 70 Web O VLAN JO 000000 VLAN Trunk Configuration 9 O O O VLAN Port Configuration D D D D D D D D D O D O D O D O B O D D D O D O D D D D Apply D D D D D D D B D Acceptable Frame Ingress GVRP GARP Join GARP Leave GARP LeaveAll Trunk PVID Type Filtering Status
18. no switchport mode a o trunk 0000 vVraNOOOOOOOOOOOOOOOOOOOOO2O hybrid 000000 VELANDO o OD 000000000000000 000000000000000 0000000000 dip ppp ugpnaggggaaggagnmgaaguunpvi g 0000000 Interface Configuration Ethernet Port Channel 000000000 OJOOOOOO switchport acceptable frame types 0000000000 Hun E 000080 10080800000 0000000 0000000000000 OOOOOOOO Console config interface ethernet 1 1 Console config if switchport mode hybrid Console config if 000000 switchport acceptable frame types 43000000000 B 179 switchport allowed vlan SE switchport allowed vlan add vlan id tagged untagged remove vlan id no switchport allowed vlan add vlan id VLAN O O remove vlan id 00 0 0 VLAN OQ VLAND D D D D O D 10 4094 0000000000000 00 0000000000 VLAN10g0 0000000000 0080000000000 00 00 nfiguration Ethernet Port Channel 0000 hport mode 000 a COOC a 00000 El 5 a DD a 2 E
19. GC 187 snooping query interval ip igmp snooping query max response time ip igmp po0000000000000000 GE 189 snooping query time out ip igmp 6 GC 199 snooping version showipigmp ceMPO0O00000000000000 PE nap snooping show ipigmp PE 139 snooping mrouter show bridge IGMPD DD DD OD MAGDDDDDDDDDDDDDDD PE 191 multicast DO 0000000000 4 2 16 Broadcast Storm Control 0 uuu O O OOO broadcast GC 192 show interface uguggaggggggugggguug NE PE 152 switchport 4200000000 g 109 4 3 p00000000 WT 4 3 1 General H enable 0000000 Privileged Exec NU Hn D D D d D D B B B d d D D D D D D privileged mode D D D DO D D D D D O D O D O D D D O 000000000 0000000 41400000000 gt 0o0000000000000 g enable level level D D DD DD 000000000000 Normal Exec 15 Privileged Exec Privileged Exec 00000 158000000000 0000000 OOO 15 0000000 Normal Exec 00000000 D0000 privileged O D D D DO HO DO D ID O D Normal E
20. OOO D dbeeD D D D D O D O D D OD D O PI DD ODODOO0O0N BOOTP 00 po00000000000000000000 BOOTP DHCP J POO Console config Console config interface vlan 1 Console config if ip address 192 168 1 5 255 255 255 0 Console config if exit Console config ip default gateway 192 168 1 254 Console config ooo 0000 00000 PONDO e 0000000000000000 0 0000000000000000 DO DO PINO DON 000000000000000 0000000000000 1 Privileged Exec 000000000000 0000 TI interface van WON 0 000000000000000 00000M Enter O O DUDU 2 ip address ip address netmask 000000000 ip address 000000 IPO00 netmask 0000000000000 000000000 3 Dem 00O000000000000000000001 0 Enter 0 44000 000000000000 U l 95 IP0000 ip default gateway gateway O 0 O O LT Enter 0O O O OOOO gateway 0000000000000 POOD isan a sn maa CC Oooo Oooo Oooo LJ ESI E T E 5 copy running config startup config O D Enter D D 1 U U 0000000000000 4500000
21. 0000000 None e 0000000 Privileged Exec E Console show startup config building startup config please wait snmp server community private rw snmp server community public ro username admin access level 15 username admin password 7 21232f297a57a5a743894a0e4a801fc3 username guest access level 0 username guest password 7 084e0343a0486ff05530df6c705c8bb4 enable password level 15 7 1b3231655cebb7alf783eddf27d254ca no broadcast vlan database vlan 1 name DefaultVlan media ethernet state active interface ethernet 1 1 switchport allowed vlan add 1 untagged switchport native vlan 1 bridge group 1 portfast interface vlan 1 ip address 0 0 0 0 255 0 0 0 line console no login line vty end Console 126 40000000000 000000 show running config H show running config UDUODUUDUODUUDUODUUDUODUUDUOD e 0000000 None 0000000 Privileged Exec 000000000 00000000 show startup configg D D 0000000000000000 e D Console show running config building running config please wait snmp server community private rw snmp server community public ro username admin access level 15 username admin password 7 21232f297a57a5a743894a0e4a801fc3 username guest access level 0 username guest password 7 084e0343a0486ff05530df6c705c8bb4 enable p
22. 00000 00 ip default gateway gateway no ip default gateway gateway 000000000000 PONDO 0000000 D onfiguration 00000 C OO PIDDIDDDIDDI D Console config ip default gateway 10 1 0 254 Console config 000000 show ip redirects H show ip interface D ooo Ebo ES ooo H lt E o ga a EJ E mn DU 0100 Ooo Ooo Oooo mo Console show ip interface IP address and netmask 10 1 0 54 255 255 255 0 on VLAN 1 and address mode User specified Console 43000000000 g 159 000000 show ip redirects H show ip redirects DO 0000000 0000 0000000 Privileged Exec D Console show ip redirects ip default gateway 10 1 0 254 Console e 000000 ip default gateway
23. oo Et E oOo oo EX CA oo oo r3 ad ad o ooo oc oc o ooo E ca COCO COCO a BA GO E AAO m F Ooo oo Eu oOo oOo a E ABA EE oo El r3 oO ad ad r3 E ooo oc oc H o ooo FE HD H COCO COCO Et AR ooo Se ES H oo H ENEE oo ooo EE CUTE L3 LL OO DEL COCO oo Oo EJ EJ E EJ L3 LL oo poopooo LE L3 LL oo DOC DD oo OO DD oo CO DD oo DOC DD AR CO DD oo AAO EE HAHAA lt lt oo OO feels lesen oo EZE LaL oo EZE o0 o LL oo EEE oo oH ooo EJE ooo E El o0 CEE EE o0 ooo oo o CCT oo FEE oo oH ooo AE ooo oo oo GO Er E FrEE ooo EZE OE oo ooo aY EL EST oo ooo ooo HE ooo ooo o0 ooo FET oag oag ngo ngo ngo ooo ooo ooo oon con ngo CO ngo ngo ooo ooo ooo ngo ngo ngo ooo acc HAL ooo ooo ooo CO eat ngo 000 AD O 2000000000000 EX ESLESTESILEESI EI L3 C3 L3 E C3 L3 AAO aa Nara Yn aaa EE L3 C3 L3 000 L3 C3 L3 000 C3 L3
24. 02 30000000 Web VLAN Current Table D D O D O D D D O O O O D D D D D O O D VLAN 00000 VLANID 2 Y Up Time at Creation 0 d 19 h 39 min 31 s Status Permanent Egress Ports Untagged Ports Unitl Port2 MCLITOOOOO00000000D VLAN 0000000 VLAN ID ID 4040 DO 0009000000000 D ll Type 00 VLANIIDDDDDUDUDDDDBDUDUDUUDUDDU Static 000000000000 Name VLAND 15000 Status OO VLANDUDUDUDDUDUDUDDDUDDDUDDUUD Active VLAN OOOO Suspend VAND D D D DO D D D D D D D D O H O D D D ED Ports Channel groups CLI VAN QD 00000000 Console show vlan id 1 182 VLAN Type Name Status Ports Channel groups 1 Static DefaultVlan Active Eth1 1 Eth1 2 Eth1 3 Eth1 4 Eth1 5 Eth1 6 Eth1 7 Eth1 8 Eth1 9 Eth1 10 Eth1 11 Eth1 12 Eth1 13 Console 3 11 VLAN D D 63 3 11 3 VLAND OG 0000000 VLAN ID 0000000 vLAND ID 10 4040 0000000000000000 OO Name VLAND 32000 Status OO Enable VLANO OOOO Disable VIAND D D D D D D D D D D D D D O D D D O J State OO VLAND DN N00 NONONO CAO tr II Active VLAN OOOO Suspend VIAND D D D D D D D DD DD D OD D D D D D 00 Web D
25. Leaming 0000000000000000 Forward Delay 1 000000 Forwarding D D D D D D DO DO D D DO D D D 000000000 oo Broken UU D D D D D O D D D O D D D 000000000000 u D Forward Transitions 0000 Learning 0 D D D D D UO UO UD L Designated Cost UDUDUDUD Designated Bridge bd Designated Port Ooo og og og og og og og og Bru og Bru Bru og On Bru Bru og og og og og MACD D D D D O O O D D D O D O O 0010 UDUUDUUDUUDUUDUUDUUDUUDUU UDUUDDUUDUUDUUDUDUDUODUUDUODUD 5 Web HJ O T STA Trunk Information O O O O STA Port Information O 50 3000000 Trunk Port Status Forward Transitions Designated Cost Designated Bridge Designated Port L Forward Designated Designated Trunk Pont Bot Status Transitions Cost Designated Bridge Port Member Ll Blocking H 22 32768 222222222222 1281 2 Blocking 0 22 32768 222222222222 128 2 3 Blocking 0 22 32768 222222222222 128 3 4 Blocking
26. ip igmp snooping D ip Lomp snooping no ip 1800 snooping 00000 00000 lobal Configuration UDUUDIoMPDUDDUUDDUDUDUD DUU a Console config ip Lomp snooping Console config 4 184 ip igmp snooping vlan mrouter UUUUDDUUDUUDDUUDUDUDDUODUDUDDUODUDUDUOD 00000 po00000Mrpo00000000 D ip igmp snooping vlan vlan id mrouter interface no ip igmp snooping vlan vlan id mrouter interface vlan id VLAN ID 1 4094 interface ethernet unit port pol 0000 port channel channel id 10 000000 B e 0000000 o e 0000000 Global Configuration o IGMP o 320000 D
27. nuu PANG ET ET ET EZ EE pe EST EZ EST E EE EEE rau C3 C3 E3 E3 E3 C3 Ooo Oo gH O aH C3 C3 C3 E3 E3 E3 C3 E EVE Ea ARA AA nuu O aH C3 E3 E3 E3 C3 o Geo C3 C3 E3 E3 E3 C3 O C3 C3 C3 E3 E3 E3 C3 ET E Oooo Oo HD e EZ H HD E aes ESTE ET AN E C3 E3 E3 E3 C3 Ooo a o C3 C3 C3 Ooo odo C3 C3 E3 E3 Ooo E E ENEE gt aao AA E3 E3 C3 C3 C3 C3 C3 podd0 000000000 00000000000000000000 Microsoft Corporation 0 D D D D D D D 0000000000000 D D All Rights Reserved Copyright FUJITSU LIMITED 2002 DADO DD O DD ODO poda nooo 0000000000000 000000000000000 a OOo DO Oo 0000 UDUD 0000 DUDU Aa ARA CH BA o H r3 TAA HDD oO EJ JAO O HE o ooo H HE o a Et AB EJ a AA BE
28. Console Console Console config if exit Console config interface vlan 1 config if ip address 10 1 0 1 255 255 255 0 config ip default gateway 10 1 0 254 po0000 00000 00000 OO CC OO CC Oo CC O RJ 00000 000060 CC 00000 00000 00000 O rpood000 000000 000000000000 D Teme D D 0 D D U oo renetlQOOOOOOOOOOOOOO PO 00000000050 po000000000 admini OO guest O O OOOO OOOO 0000 0000 O D D lUUDUuuD O O admin 0 0O guest 1 O O O Normal Exec D 0 O O 3 0000 Ooo vy00000000000 0000 O D PrivilegedExec 00000000 4 DO DU Oo Lr 000 Telnet DDD D D Username admin Password Vty 0 CLI session with the Switch Blade is opened To end the CLI session enter Exit 4 1PO0D0DO0D0 000000000000 93 Teln
29. H LO rrr Dir 000 Roo H o 00000 o L FOOD 9 DD 5 OO O 03500050000 o 9 opooooo H L1 e 3000000 72 IGMP Query o00p 0 o H oo DOA O GA See Ooo no aT a no aT a oz o O gogogaga DOA O BO E Ska rr lt Dich Bg no ele Se a noon a Co o DOO Oa DIE EC SA og o000p m HAD joo DOS Sota ae OSO mada aa oo noon aa o 04 SSS Ea O Go ELE a Se CDD DI ee on aa e a a OOS o0 EE Saad SSS mada oo HOA COD aro 00 GA 3 OOOO BAAD o aoanaoagd EJLETCEIEYEEELE ETE a EEE o 0000000 IGMP Status U U P Act as IGMP Querier oo CH CH oo CH CH oo CH CH oo ca ca oo CH CH oo CH CH oo CH CH oo CH CH oo CH CH oo CH CH oo og ca oo os CH oo ar CH EE oO oo a og oo EJ o9 oo CH o oo o5 EE oo oa oe AO oo E o0 oo oo oo H o0 8 oo r3 rara oo oF ooo oo os ooo oo oo 000 aa gono ooo san 5 So OOO o0 56 ooo 300 TO ooo 800 500 noo Soon Som noo A OO goo COD 2 00200 Sono oo Soo IGMP Report Delay Oy HS B Br um o Bu Er E oo r3 Og oo r3 Bu oo El mad FAR H Dr
30. D description string no description string 000000 000000 000000 000000000000 00000010 64000 00000000 0o 00000000 Interface Configuration Ethernet Port Channel e Jd P00 0000000000000 50000000000 Console config interface ethernet 1 5 Console config if description 3 Console config 1f H speed duplex 10001000000 130 110 0000 100 10 0000000 DO quu speed duplex 1000full 100full 100half 10full 10half no speed duplex 1000fung 1000Mbps D D 0000000000 100full D D D D D O D D D 0 100half 100Mbps D D D D D D D D D D 00000000000 10Mbps 00000000000 DUDUDUDUDUDUDUDUDUDUDUDU D D D D D D D D O 1000190000000 139 110 1000840100000 100 00010 4 146 0000000 C Interface 00000000 Oooo D onfiguration Ethernet Port Channel speed duplex D D D D O D O D D D D O O O O O O D D D D O O D O D D D I no negotiation po000000 ug 000000000
31. lo lo IE CB 2 CHIC E CHIC UI IDDIE IC CHIC HH olo2 IDDIE IC olo so Broadcast Storm 109 Control 4200000000 B 101 NE Normal Exec PE Privileged Exec GC Global Configuration IC Interface Configuration LC Line Configuration VC VLAN Database Configuration 4 2 1 General D uu UU uu poo enable privileged 0000000000 NE ng disable privileged 0 0000 normal D D D D D OD O D PE 111 configure global configuration D D O O O D O D D DI PE 111 show history UDUUUUUUUDUDDUUUUI NE PE 112 reload OOOOOOOOO PE 113 end Privileged Exec 00000000 GC 113 IC LC VC exit OO configuration D D D D D D D 000 113 quit CLINOO000000000 NE PE 114 help u t NA O UDUUUUUUDUUDUUUUDUUUDUUDUU UI poo NA 4 2 2 Flash File D D D 0000 00 ooo ooo copy PE 115 0000 TAPOODO000000000000000 delete DO0000000000000000000 PE 116 dir D0000000000000000000000 PE 117 whichboot 000000000000000 PE 118
32. symmetric 1 0000000 000000000000 00000000 asymmetricOOOOOOOOOOOOOOOOOOO symmetic D D OD 000000000000000 0000000 000 10 10 1000full DDD n 13 10half 10full 100half 100full 1000full 00000000 Interface Configuration Ethernet Port Channel 10000 100half 10041000000 000000 Console config interface ethernet 1 11 Console config if capabilities 100half Console config if capabilities 100full Console config if capabilities flowcontrol Console config if 148 40000000000 B flowcontrol 0Mrpog0000000 DO flowcontrol no flowcontrol t 000000000 oo On a nooo oO Qu oooo o 20 El BAAS Er SA oo CDD a go oo ooog ENENGE AO 0000p 00 90 oo Ju oo BOOOG aaa oo D 20000 Nd oo es ee a HES No oo SoBe HA GO A N0003 0000 Do Oo ag 000p Diop u 2 DOOR pO no Og 3 OOOO FT ET NG DE 5 E KE aji ran ESI E E e E os R NON Do of d BESA HEGGA E Oooo oF
33. OO logging on no logging on 0000000 Disabled e 0000000 Global Configuration 000000000 O O I logging history D D D D D D D O D O D 0000000000000 0000000000 D Console config logging on Console config 000000 logging history clear logging RAMD OOO 2480000000000 4060000000000 UDUODUUDUODUUDUODUUDUODUUDUOD 4 120 H logging history Do0o00000000U0 Simple Network Management Protocol 00000000 PN 000000000000 000000000000 000000000 0M dgd0 00000000 00000000 0000000000000 OO e 00 logging history flash ram level no logging history flash ram fliasppo000000000000000000000000000000 DO ran 00000 rRaMpgogo000000000000000000000 lvli000900000000000000000000000000 00 pad uu UO uu OOOO 0 OOOO LOG_EMERG emergencies O O alerts 1 LOG ALERT OO critical 2 N0000 LOG CRIT O O O errors 3 0000 LOG_ERR O D warnings 4 0000 LOG_WARNING O O notifications 5 LOG NOTICE O D informational 6
34. 41 3700000000060 Dynamic Address Table Dynarnic Address Counts 1 00 10 B5 62 03 74 VLAN 1 Unit 1 Port 11 Dynamic Current Dynamic Address Table e CLI 180000000000000000000000 Console show bridge 1 ethernet 1 11 154 Interface Mac Address Vlan Type Eth 1 11 00 10 b5 62 03 74 1 Learned Console 42 30000000 372 UOUOOOOOOO O Web O Address Table Static Addresses D O O BH D D D D D D D DP D E MAC VLAN D D 0 0 T Add Static Address 0 D D D D D D UUUDDUD Static Address Counts 0 none Current Static Address Table Interface Port 12 y Trunk zl T MAC Address 00 d4 00 00 d4 a3 VLAN Hx Add Static Address Remove Static Address e CLI UUDUDUDDDUDDUUGUDDDUUDUDDDBDUDDUDUDDUDUDUDDDUDDUDUD Console config bridge 1 address 00 d4 00 00 d4 a3 vlan 1 forward ethernet 1 13 delete on reset 153 Console config 3700000000060 43 3 7 3 Dana H 3000 2180000000000000000 180 000000000 O Web D Address Table Address Aging O0 D D D 0000000000000000 00000 App 0000000000 Aging Time 18 2184 300 seconds O CLI
35. OOo OOo OOo 000 000 Console config bridge 1 hello time 5 Console config H bridge max age podd00000000000000000000000000 max ageQ O 5 c AEN Mr p000000000 bridge bridge group max age seconds no bridge bridge group max age bridge group D D D D D D O D O D D D D D D 10 seconds 0000000000 60 4000 00000000 6000002x hello time 18 00000000 000000000 40000002x forward time DO 00000000 e 0000000 200 0000000 Global Configuration 000000000 000000000000 0000 root port ngagagi e D Console config bridge 1 max age 40 Console config 166 M 40000000000 H bridge priority gog0g00 0000000000000 00 0000000000000 0d000 000000 00000000000 Mr 000000000 bridge bridge group priority priority no bridge bridge group priority bridge group 000000000000000 10 000000000000000000 655351 DDDDDDD 32768 000000 Global Configuration 000
36. 0000000 Name 00000000000 2 Type DoOo0000000000U0 1000Base SX 1000Base TX T bd Admin Status g00000000000000000 g Oper Status a OOOOOOOOOOOOOOOOOOOOOOOO Port Information J 00000 O Web O Port O O Trunk Information O O O Port Information 000000000 a a a 0000000000000 00 0 Trunk Information 80 3000000 Admin Oper Speed Duplex Flow Control acit nhi haga Type st atus st atus st atus st atus Autonegotiation Eie 1 Admin Oper Speed Duplex How Control MS Trunk Pe Name Type Status Status Status Status Autonegotiation Member 1 Enabled Down 1000full None Enabled 2 ES Enabled Down 1000full None Enabled m 0 3 agi Enabled Down 1000full None Enabled 4 Enabled Down 1000ful None Enabled 5 1000855 Enabled Up 1000ful None Enabled e CLI 1380000 000000000 Consolettshow interfaces status ethernet 1 13 150 Information of Eth 1 13 Basic information Port type 1000t Mac address 22 22 22 22 22 2e Configuration Name Port admin status Up Speed duplex Auto Capabilit
37. E Er HG EE a 5 Oooo EH H nog o g jm D pp AA 00000 o 2 O 500000 DO pd a o 5 r3 rarararard oo 100 HE E 98 r3 o 0 ODODO DO goong o EE O00 Sooo 8 o ca EO Ei 500105 509000 D g o O0 OO og o D O ao maaa oo o 0002 Do 04 rm pa Et Console config interface ethernet 1 11 Console config if flowcontrol Console config if no negotiation Console config if capabilities flowcontrol symmetric 149 43000000000 B show interfaces status OO show interfaces status interface interface ethernet unit port uni IDD 1000 port channel channel id 10000000 vlan vlan id D O 10 4094 e 0000000 DO e 0000000 Normal Exec Privileged Exec D Console show interfaces status ethernet 1 11 Information of Eth 1 11 Basic information Port type 1000t Mac address 00 00 e8 00 00 0a Configuration Name Port admin status Up Speed duplex Auto Capabilities 10half 10full 100half 100full 1000full Broadcast storm status Enabled Broadcast storm limit 256 packets second Flow control status Disabled Lacp status Disabled Current status Link status Up Operation speed duplex 1000full Flow control
38. nooo Ooo 0000 0000 OOO OO o Console config bridge 1 spanning tree Console config 164 N4 OOOOOOOOO H bridge forward time podd0000000000000000000000000000000 forward time D 0000000000 0000 09000000000 00 bridge bridge group forward time seconds no bridge bridge group forward time bridge group N D D D D D O D D D D D D O D 10 seconds D HL D D D AT 3000 0000040000 0000000000000 00000000 15 Global Configuration 000000000 0000000000000 0000000000000 listening learning o gt forwarding DD D D D DO D D O D D D D D D D D O D O D O D O D D D D Dodd 00000 000000 00000000000 000000000 Dodd 00000 000000 0 00000000000 00000000 o P00 000000000000000 00000000000000000 o Dodd 00000 0000000000000 oO o Console config bridge 1 forward time 20 Console config H bridge hello time 0000000000000 000000000000 000000000000 gd000 000000000000 0000000000000 OO bridge bridge group hello time time no bridge bridge group hello time bridge group 000000000000000 10 ima OQOOOOOIO 1000 0000 100000 max age 2 080 00000000000 0000000 20 0000000 Global Configuration 43000000000 OOo OOo Ooo Ooo OOo Ooo
39. 50000 srenunua anadnpa config interface ethernet 1 5 config if bridge group 1 priority 0 config if bridge group 1 path cost 50 config if bridge group 1 portfast Console Console Console Console 144 168 167 169 30000000 39 UOOUOUOUUUUUUE u fFf 0 fTe A o amp A Bridge MB D D D D D D O O O D O D D D O O O O O O O D D D O B O D DUU 0000000000000 0 0 Extended Bridge Configuration JO D D D D D OO 0000000 Extended Multicast Filtering Services GMRP GARP Multicast Registration Protocol VO 0000000000000 3 go0000 00000000 00000000000 Traffic Classes H OD 00000000 000000000000 00000000 D 3100000000000 500000000 F Static Entry Individual Port o N00 0 103720000000000 80000000 VLAN Learning Independent VLAN Learning D D D D D D D D O D D D D D O D D 010 Configurable PVID Tagging 00000000 vLaNIgo0 00000000000 0000000000 VLANDUDDUDDUDU I 3 11 VLAN D OM 2 5900000000 x Local VLAN Capable pod 0080000 000000 0 0000000000 000000000 00000000 Traffic Classes Do
40. 82 Broadcast Control JUDDUDGUUUDUG DUDDDDGDGUDUUUDUDUu unu 84 Mirror JUDDUUDGUUGUGSDUUGUDDUDUuUDUDUUDUDU unu 85 Trunk 86 Trunk Configuration 86 Statistics Ethernet D RMONO 87 30000000 32 OOOO a eee 3 2 1 OOUOOUOUUUUO UDUUDUUDUODUUDUODUUDUODUUDUODUUDUODUU 0000 0000000 System Name D O00 0 Object DD D D D D D ID Location OOO 00000000000 o Contact D D OD O System Up Time 0 0000000000 g0000 00000000 000000000 O0000 25500 Web O Systm 000000000 System Name Location 9 O O Contact DUDU System Name R amp D5 Object ID 1 3 6 1 4 1 259 6 10 39 Location C 8 Contact Bill Martin System Up Time 0 days 1 hours 59 minutes and 18 73 seconds IANS Connect to textual user interface 320000 27 28 e CLI System Name Location Y Y Contact D D D D D Console config hos Console config end C
41. EE EE EE an EST E TE T 1 L3 C3 L3 E3 C3 E E TEZEEZEE T EE L3 C3 L3 E3 C3 E3 E3 C3 C3 L3 BSE EBBJEI A E3 C3 ELE EET Ey EET wai gam EST L3 C3 L3 C3 E3 C3 L3 C3 L3 E3 C3 ET EST 3 ET ENEE SA RAE AA L3 C3 E3 E3 C3 vi EEE vii EEE ENEE L3 OHH OO ETE ES EJE BER OO aaa OO AA E Oooo Oooo a NN aa NG aaa NG pa UDUODUUDUODUUDUODUUDUODUU AA Oooo 20000000000 DUDU podd0000000000000 O a a a a a 0000000000 PRIMERGY 0000000000000 viii JOUDUUD OD
42. Telnet 800000000 D console line DUDU D O D D D D D O D D DO DO D OD D D D D a 0000 O g 0000000 show users 0000000 VO O Console config line console Console config line 000000 show line show users 136 login HD EO ooann M login local no login username D 0000 00000 B ni ine Q ine configuration Ooo qu DD DJ Oe H O Console config line login local Console config line 000000 username password H password UDUUDUUDUDDUUDUDDUUDUDDUODUDDUODUDUDUD OO password 0 7 password no password 007000000000000 000000 0170000000000 password Line D D D D D D DD DD DO DO 0010 2000 43000000000 137
43. noo o ao ooo goo noo nooo noo ooon noo ganda ooo noo Hoo H D I password thresh DU 00000 oo EE Line Configuration Console config line password 0 secret Console config line login password thresh H exec timeout Mrpg00000000 DO exec timeout seconds no exec timeout seconds 000000000000000 655350 000000000000 du C D D U LI Telnet 10 DU 00000 Line Configuration 40000000000 138 p0000000000000000 Teteer UD 00000000000 Telnet 000000000000000000000 D 20000000000000000000000000 Console config line exec timeout 120 Console config line H password thresh OO password thresh threshold no password thresh B threshold 1200000000 D 0o00 o
44. 4000000000000 Console config bridge group 1 aging time 400 155 Console config 44 30000000 ND OD OD 3 8 EEE c3 rbd m rur c3 card m r3 OO CDI O OC OD m rm rm rmn rmn DOD c3 c rab rm jum rm mn rmn rm m rmn odd c3 crac rm DD AO rrr FB AFE manang N DD C3 p C3 PAGBABAGO C3 E C3 Acad AA C3 C3 CDD CH CDD C3 C3 C3 r3 p C3 Y a a ET saa C3 m 3 8 1 0000000000 read only 000000000000 Bridge ID rH o o Ej Ea o oo H oo H oo o O So o o oo o o ooo E H ooo H H ooo H o o ooo o H ooo H o o o
45. A ah yon sa Kua En A n 194 5200 AN SAN KA a NGA Nad a Ka Dara a a dayan 195 5 3 MIB ees de 0 E None ue 196 BSc DRAN BR tata 198 193 bi O dNNS uu 2 o0000000000000000 PANDONGA 0a Tami OOO PONDO NDN DN NDN NDN PONDO NN DUN DON ND NOO M 838200000 0000000 400000000000000 5 SNMPQ 0000000000 Management Information Base MIB MB DOO 000052000 000 MBM 1850000 0000000000 oooooooom323POOOOOOOM 300OOOO 3 pod0000 gt 330p0 00000000000 4 oo0000000000000000000000000000 DO BO DO dd 000 000000000 00000000000 PD NDN NDN NN DON NN DD 00000000000 1 SNMP 1 O LI D DI DL D 5 1 mi m Bo Do
46. OD 100 1000 OOO 1000Mb 000 000 000 000 D 10000000000 000000000 1000BASETO 00000000 3000000000 IEEE 802 3ab Gigabit Ethernet OOO 1 5 1 1 5 2 Oo 26Gbps 00000 32 0000 0 MACD D D D D D D O D O D D D OD D O D O 010 9 1500000 15 3 00 Telnet SNMP RMON 700 Web 08000000000 0000000000000 000000000000 00000000 00000000000 00000000000000 320 VLAND 000000000000000 VLAN OO 802 100 00 VLAND 000000s 008000400000 00000000000000 Internet Group Management Protocol D a 29 HHI OCH oOoOoooog oo Oooo lav cod oO oO 4 000 O SNMPQoODo 0000000000000 Oooo CC Oooo oO Ooo Ooo H Ooo BE PANA an E EL ELE El D 10 1 6
47. enable password Privileged Exel 00000000000 UUDDUDDDBDDDDUDDBDUDUDBDUDUDUUDUDBDUDUDUDDDII enable password D D D D D D O D O D D D O D O D D D D D O D D B D D D O D D O 0 o o o obl o enable password level level 0 7 password no enable password level level level level PrivilegedExecQ 0D 000 150000 00 4000000000 fI7F000000000007000000000 password privileged 000000000 00000000000 00000 800000000000 00 22000 0000000 15000 DOBO DO DD DD 0000 000000000000 TelnetQ O super 0o00 e 0000000 Global Configuration 000000000 DO 10000000 00000000000 000000000 TAPOD 0000000 0000000000000 UDUDUDUDUDUDUDUDUDUUUUUUUUUUUUUUU DOB0 000000000000 00000000 0000000000 DOBo0 Dg 00000000000 00000000 0000000000 00000000000 00000000 00000000 43000000000 p 119 D Console config enable password level 15 0 super Console config 000000 enable H logging on ADO 0000000000000000000000000000 DO000000000000SNMP0 0000000 SNMP
48. 0000000000000000 OOO H show bridge ext 0000000 DO e 0000000 Privileged Exec B Console show bridge ext Max support vlan numbers 32 Max support vlan ID 4094 Extended multicast filtering services No Static entry individual port Yes VLAN learning IVL Configurable PVID tagging Yes Local VLAN capable No Traffic classes Enabled Global GVRP status Disabled GMRP Disabled Console 0000000000 43000000000 g 171 4 3 12 Priority OOO EE AO oo doo nood HERA odo 3 nood dao odo 3 noo doo oo 3 nood BAADA odo 3 do odo BGR 5 ooo oo 3 ooo nood doo oo Oooo 3 noo 3 ooo Soe a EE odo 3 ooo EIE A BAG FES GSA no dao EXE Ecl EA E EIL E nao 3 mood 3 ooo noo dao doo 3 odo 3 ooo rcm dao odo 5 CDD 6 000 CO H OD switchport priority default DO switchport priority default default priority id no switchport priority default default priority id D D D D D
49. C3 C3 L3 E3 C3 EE EE Ee es GA Sc C3 C3 EI C3 OE ET C3 mun C3 AALAGA OCC LEMET EEE ET JB c3 rrr CDI oO a rrr OOO CDI L3 les HEAD COD Z BOO tooo gt CODE EXE can on Jean Oooo DIO L3 Oooo Onno um Oooo S R Oooo Onno ee a fe a CI EES Onno Oooo C3 E3 L3 C3 uwa APA ABA CG BG EEE ETE EP EST C3 C3 L3 C3 L3 3 12 1 Gadang Gadan Gadang Gadan Gadang a e SOO 80090 H 2 Ooo Ba EDO 2000 mena Po One rt
50. a 5 5 a 0000 VLAN J a a tagged untagged 100000050 native VLANQ LU DO ENEE 1 rooo oo gt 290000 gt Z Ooo FJAR DU 000 000 000 DU 000 000 DU 000 bi E DO DO DO DO eu ET FEI P E ON E EJ lt a lt a C3 C3 L3 L3 e rbidden 00000000 00000 VLANQ DDD po00000 U DO O forbidden DOO L3 L3 L3 L3 C3 C3 C3 OOO L3 L3 L3 L3 C3 C3 C3 OOO L3 L3 L3 C3 C3 C3 OOO 46160605000 EEE L3 zs oOo L3 L3 OOO SA al OOO000 VLAN 19 205000 600000 100000 VEAND D D allowed 000000000000000 0000 Console Console config interface ethernet 1 1 config if switchport allowed vlan add 1 tagged config if switchport allowed vlan add 2 tagged config if switchport allowed vlan add 5 tagged config if switchport allowed vlan add 6 tagged config if Console Console Console Console 180 g 40000000000 H switchpor
51. 7007000 000 D 00000000 000000000 Weighted Fair Queuing 000000 Class of Service EL 00000 000000 IBEB802 1p 0 0 0 P pgo00 00000000000 DO oO DO DO DO DO DO 0 O EE O O O o O Oo O E 802 DO 1 L3 L3 L3 L3 L3 L3 L3 L3 a moO Ooo EK EE EECH E Priority 0 0000000 I onfiguration Ethernet Port Channel gt a Si o Q CH Q 9 0 43000000000 173 D 000000 coso 001020 CosOOOOOOOOOO 30 CS 000000000 100 4450 DH D HOD HDD 2 OOS 6070 DD HD DD D DD 3000000000000 000 Console config interface ethernet 1 1 Console Console config if queue cos map 0 0 12 config if queue cos map 1 3 config if queue cos map 2 4 5 config if queue cos map 3 6 7 config if Console Console Console e 000000 show queue cos map H show queue cos map UDUODUUDUODUUDUODUUDUODUUDUODUUDUODUU DO DUO show queue cos map interface interface ethernet unit port 1000 pol 00000 port channel channel idQ 10000000 e 0000000 UU e 0000000 Privileged Exec H Console show queue cos map ethernet 1 11 Information of Eth 1 11 Que
52. B delete 0000000 000000000000 0000 0000000 DD delete filename filename DUDU O D D DD D OD D OD 010 0000000 None e 0000000 Privileged Exec e 000000000 ROMO DUDU O 000000 00 OD 00000000 0000000 Factory Default Config cfg 00000000 L3 4 16 po000000000000000 DU Console delete test2 cfg Console B dir 00 dir boot rom config 006006 filename boot rom 0 QQ ROM config 000000 opcode D H O O O O O OO OO DD DD HDD 000 000 DUDU 0000000 None rH EJ H 0o00 Privileged Exec HD o 0 D file name po00000 file type 00000000 Boot Rom Operation Code 0 0O Config file startup size e D Console dir file name file type startup size byte se diag1075 Boot Rom image Y
53. LOG INFO D UO 7 000000000 LOG DEBUG debugging Flash errors level 3 0 RAM debugging level 7 0 Global Configuration 000000000 UUUDUDDDBDDDBDUDUDUDBDDDBDDDUDUDDRAMIDDBDD podd0000000 000000000000 000 000 000 O EO Console config logging history ram 0 Console config 43000000000 g 121 B 000000 snmp server enable traps snmp server host clear logging Dodd 00000 0 0 0000 000000 00000000000 D0 clear logging flash ram fliasppo000000000000000000000000000000 DO ram 00000 RAMDUDUDUDUDUDUDUDUDUDUDUDU e 0000000 None 0000000 Privileged Exec D Console clear logging Console 000000 show logging H username UUDUDDDUDDDDUDUDDUDDDDBDDDDUDDDDDDDUDUDUDUDUDDBDBDUD po00000 p000000 OO username name access level level nopassword password 0 7 password no username name name 000000000800 00000000050 access level level DO D D O D D D D 0000000000 2000000 000000000000 OO Normal Exec 15 Privileged Exec 00000 10 1400000000 nopassword D D D D D O D O D D D D O O O O D O D D D D D NON NDN OO DO 7000 0000000000000 password password D 000000000000000800000000 122 40000000000 ormal Exec 0 O O O guest Privileged Exec 000000000 Normal Exec
54. O 192 BESSEREN SR 193 SJESNMP H a Sel Ll le ade e abas 194 SL E H EIER alee ada lS ae Cee ca bes 195 196 198 199 200 209 210 210 211 1 ph ENB Contents DD 1 1 PRIMERGY BX300 000000 PRIMERGY 30 D D D D D O O D O D D D O O O O O D D D D D D D O D 00000 UDUODUUDUODUUDUODUUDUOD 00000 00000 00000 El EEE 00000 00000 00000 00000 a a El OO ET EJ 00 DO DO DO 200 CDD rrr L3 ELE Sere rrr L3 L3 r3 rrr rrr L3 L3 IEEE Ji a rrr L3 r3 rrr Bov BETRA man Na PRIMERGY BX300 0000000 CDD o GOGO DD El DD oo YOON AN 25 mada aao E AA ES EISE ES HEIA Ett i P oom Er ee a E Ep rrr madagang rrr Ses SS M cn m rrr oetioeti oc El op aao Ee EE ae oo 2052022000 oo S5 o8
55. PONDO DD DD DD NDN NDN O Console Menu D Console Redirection 0000000000000 UUUDDDBDBDDDUUDUDUDU 2 poDo0000000000000000000000000000 Normal Exec D D D D D D D O D O D D D O D OH O H D O D D 0 0 rf 00000 O D enable O Console f 0000800000000000000000 Privileged Exec J 0000 EVE 3 D Consoles D D O O O O O O O O O O O O O O O O O O O 0 5 00000m avi OD OO DO00000000000000 4 oo0000000000000000000 EE User Access Verification CLI session with the Switch Blade is opened To end the CLI session enter Exit Consolesenable Console O Privileged Exec Mode D D D O D D D D D 40000000000 92 B Telnet O Telnet IPQ OO D D L3 L3 O U uu O OO U un 10 1 0 1 0 OO OO OO IPQ OO U p L3 ETNI FRIE 10 D D D DO DO DO L3 L3 C3 aad ooo oOo Telnet 00000000000000000 PONDO
56. 36 88 Web D Statistics OOOOOOOOOOOOOOOOOOOOOOOM Query O O UUUUUDUDDUDUDUDUU Refres 0000000000 00000000 Interface o Port 13 z Trunk 4 Query Interface Statistics Received Octets 1925892 Received Unicast Packets 16943 Received Multicast Packets 0 RacolvediBrosdesst 138 Packets Receiver Discarded 0 Received Unknown Packets 0 Packets Etherlike Statistics Alignment Errors 0 Late Collisions 0 FCS Errors D Excessive Collisions 0 Single Collision Frames Internal MAC Transmit 0 Errors Multiple Collision Frames 0 Carrier Sense Errors 0 SQE Test Errors O Frames Too Long 0 Deferred Transmissions D Internal MAC Receive Errors 0 RMON Statistics Drop Events DiJabbers Received Bytes 10049208 Collisions 0 Received Frames 0 64 Bytes Frames 25400 Broadcast Frames 144 65 127 Bytes Frames 3004 Multicast Frames 6007 128 255 Bytes Frames 154 CRC Alignment Errors 0 256 511 Bytes Frames 4748 Undersize Frames 0 512 1023 Bytes Frames 1225 Oversize Frames 0 1024 1518 Bytes Frames 3886 Fragments Refresh 3000000 e CLI 000000000 1300000000000000 Console show interfaces counters ethernet 1 13 151 Ethernet 1 13 Iftable stats Octets input 868453 Octets output 3492122 Unicast input 7315 Unitcast output 6658 Discard input 0 Discard output 0 Error input 0 Error output 0 Unknown protos input 0 QLen
57. Console config in Console config if Console config if terface ethernet 1 11 speed duplex 100half e 000000 negotiation H negotiation E negotiation no negotiation DO a DO sooo ooo fa ce OOO Conf 000 000 OOO DU DU DU LL B iguration Ethernet Port Channel MDI MDI X 0000000000 ngagagi Console config in Console config if Console config if negotiation 1 terface ethernet 1 43000000000 B 147 H capabilities DOdd00d00 0000000000 000000000 00000000000 pogo 000000 000000000000 00000000000000 Bra 0000000000000 0000000000000 00000 00000 capabilities 1000full 100full 100half 105011 10half flowcontrol no capabilities 10half flowcontrol symmetric 1000full 100ful1 1002815 10full symmetric 1000full 1000Mbps 100full 100Mbps D D D D O D D DD 100half 100Mbps D D O D D D 1ofull D D D D D D O U 10half D D D D D D D O D flowcontrol D 00000000
58. DO ea speed 760 D D D D D D D O O D D B O D D D D D D D D D D stopbits 1 2 21010000000 220000000 12000000 Line Configuration Console config line speed 57600 DO Console config line stopbits U 0 D O D O O D D utu 40000000000 142 e AF 2H000000000000000000000000000000 Console config line stopbits 2 Console config line B show line DON DON DD 000000000000 d show line console vty console 000000000 vv po000000000000000000000 0000000 U vyp0000 00000000000 0000000 E Normal Exec Privileged Exec console D podd0 000000000000 0000000000000000 Console show line Console configuration Password threshold 3 times Interactive timeout Disabled Silent time Disabled Baudrate 9600 Databits 8 Parity none Stopbits 1 Vty configuration Password threshold 3 times Interactive timeout 65535 Console 43000000000 143 B 4 3 6 interface D 0 pod00000000000000000000000000VLANgo 0000 pod0000000000000 B Interface OO interface interface interface ethernet unit port 1000
59. oo y H O5S00500 GAS Ig ED y o m o oo o H S54 a e am e e NA aaa y o H H Er H o0000 y E E E ar os OOOO rtm Eg mad Ei iii m o H a a HD a HD S DODODOS ooo 6 O00000 2 m SEs OD o 5 St H Ga o E EX o S Fai e E 9 poo jeje AS H H r3 Sc on os as o HO 250 NOD EI A o rn E 380 7 ooooooog o H H 0 gt Ehr K m o oc E 5 A SA S CAE 5 l NON E z e a oo a op dE NON A 5 Q Soo 3 t NOOD No H HA o 5 nmn S 3 5 5 EX 0000500002 ma H H cap ELLE NAA EAE EES O HA 5 CH oo o s HU al 2 S GABRJAR A 2 313 300 lt 2 DOO AA r3 Ba E 3 5 oo wl 2 DOON HD oo D E XE a o oo o o a E 2 ama a CDD OA 8 o CDD oo E E o oo o HDD 5 CDD E g O onon 8oo o oon NON DE x uo 3 gt nooo 5050500500500 O Oo 6 r3 A 2 Do soo SC SUOO zk RR 2 d 5 Q 2 5 Oso epp go 2 0000 sil L3 EE 5 noo a ce o AA L3 CDD EICH O 6 185 190 Static 000 1 0 VLAN1Q O NN 000000 00000000 Eth 1 11 Console config ip igmp snooping vlan 1 mrouter ethernet 1 11 Console config exit Console show ip igmp snooping mrouter vlan 1 VLAN M cast Router Port Type e CLI 30000000 76 3123 VANDOO0O0D0 00000000000 0 3 12 1 IGMPO D O O O O O O 00 2
60. O Soo san Ho CJ o Eo E 0000 800 O C Z nm lt doo E H o CI e e E D ES co N 00 Autonegotiation Port Capabilities 0000000000000000000000000000000000 00000000000000000000000000000000000 000000000000000010 1000 1000Mbps O O O D D D D D 000000000000000000 10half 10Mbps D OO O O OO O O O O OO OO O O DD iofunn 10Mbps O D O O O O O O O O OO OO OO O 010 100half 100Mbps D O DO OO OO O OOO 000000 100Mbps O D D O O O O O O O O O O O O O O 00 1000full 1000Mbps D D D O O O OO OO DO OO O O HL D Sm DOO00000000000000000000 Trunk pDo0go00000000000000000000000000000000 o po0o000000000000000000031580000000000 gt 86 QOHOOUOU00000000D Ei Speed Duplex Mode 0 O Flow Control 00000000 0000 9000000000000000000000000000 DOgO DO AD DO 00 DO 0D 000000000000 oo000 O Web O Port O Trunk Configuration O O O O Port Configuration D D D D D oo0o000000000000000000 40000000000 Trunk Name Admin Speed Flow Control Autonegotiation Name Admin Speed Duplex Flow Control Autonegotiation Trunk iu Sec Ce Ee Eu Hon ee EE Ekel ecl an Kin Fan E e roma ag 313000060 83 e CLI Console config interface ethernet 3 14
61. Performing Power On Self Tests POST E UART Loopback fest PASS Flash Memory Checksum 1686 PASS CPU SEE Testi nel PASS MPC850 clock Timer and Interrupt Test PASS WatchDog Timer and Interrupt Test PASS DRAM Test a naa 8 PASS H PLX9054 Access Test PASS H BOM Chip TESE 30 io bands iu Uya Berg ge els PASS Switch Driver Initialization PASS Swtch Internal Loopback Test PASS SSS AA os DONE Console H show users IPO00000000000000 0000000000 Teme 0000000000 e 0000000 None 0000000 Normal Exec Privileged Exec 43000000000 129 E Console show users Username accounts Username Privilege Online users Line Username Idle time h m s Remote IP addr 0 console 0 00 00 1 vty 0 admin 0 04 37 10 4 0 49 Console B show version UDUUDUUDUODUUDUODUUDUODUUDUODUUDUODUU UDUUDUUD 00000000 None 0000000 Normal Exec Privileged Exec I Console show version Uniti Serial number 2 Hardware version 2 Number of ports SES Main power status up Agent master Unit id 1 Loader version V0 0 5 0 Boot rom version 1 0 0 75 Operation code version 0 2 0 14 Console 130 40000000000 4 3 4 SNMPQ OOO OO EE O H show snmp po00000000000
62. pot 0000 port channel channel id 10 60 vlan vlan id QQ 1 4094 000000 00000 al Configuration CO oi D S c 10000000000000000000000dn Console config interface ethernet 1 1 Console config if 4 144 B shutdown UDUUDUUDUUDUUDUUDUUDUUDUDDUUDUODUUDU pod000000000 p000000000 D shutdown no shutdown D guration Ethernet Port Channel DU 000 DU 000 sooo C SO n et erface Co 00 DO DO DO OO COOC podpo0 00000000000 500000000 Console config interface ethernet 1 5 Console config if shutdown Console config if H clear counters UDUODUUDUDDUUDUDDUODUDUUDDUDUUD UD clear counters interface interface ethernet unit port port 00000 500000000000 Console clear counters ethernet 1 5 Console 43000000000 145 H description podd000000000000000000000000000000000
63. ES Ooo CH ELUEET E E ETE Ooo CH ELETEJI E Ooo CH Ez Td EZ D EEE D ET E Ooo CH 000 000 EXEJET EZ DO DO DO DO x ka ENE ENEE E LEE EZ ENEE E LEE EE Ooo Ooo Ooo 5 1300000000 0000000000000 AAAH HA L3 L3 L3 L3 EI L3 L3 L3 L3 EE EE AA ARA EEE ELE EEE BJ Arr fs be oc ca L3 L3 L3 L3 O LAN o BSS e O 22 oo O n za o 45 um CH oo 2 CH 3 o Co umm soon a Co mum sogo a Ta OO Soo 200 o Hn Bo sage a Sa gO oo Dood o Hm Z E o E lt o lt song BSS o Er 623 SSES o Co ma no 940 Ta E E Bos E o oo SEI o o o um H r3 o zoo DI er lt HA a tB vere AR J AA E Soong doon
64. ES o0 m r3 o E r3 r3 rH m r3 Er r3 o0 m r3 EXE r3 El oOo m H o0 g el o oH o o0 mn r3 oo o od m ect oo o o0 mnm EJ oon HE o0 g nud oo o o0 mnm H oo oo an mang oo o oop r3 mang ae o0 m Ba Al o o0 mnm r3 0005 oo odo 0005 oo r3 5 o0 o D 20005 oo r3 oo 20005 oo o 5 oo H o ooo o EXE Zei um ood oo H ENEE ooo duug EJ E o ZS o0o00702 DD DC Ac o ra BAS Bm oo CDD D n D nooo n 00 B B AAO EE ram EI titi EE 500509 Good EJ EB Aja oo 20003 Oooo AG a a 300g 500 go noo 050050500000 D DD e Se E STP VLAN I D 183 43000000000 20000 10000 00000000 0000 Console config interface ethernet 1 11 Console config if channel group 1 Console config if exit Console config interface ethernet 1 12 Console config if channel group 1 Console config if exit 4 3 15 IGMP Snooping 1 D D O IGMP D Internet Group Management Protocol
65. IEEE 802 3x0 N00 00000000 BSE 0000000000000 0000000000000 7 1300000000 1 4 D D UI DUU uu uu System Settings Mgt VLAN VLAN Web Mat Enabled DHCP Disabled BOOTP Disabled Traps Authentication failure and link up down enabled SNMP Communities public Read only private Read Write User Name admin D OO console none Telnet on HTTP on guest 0 LJ O console none Telnet on HTTP on Password admin 0 0 O O admin guest 0 0 O guest IP Settings IPO O00 0 0 0 0 Subnet Mask 255 0 0 0 Port Status Admin Status Enabled Port Speed 1000BASE SX 1000 Mbps 1000BASE T 10 100 1000 Mbps auto negotiate Duplex Mode 1000BASE SX full duplex 1000BASE T full duplex auto negotiate Flow Control Disabled Port Priority Default ingress priority 0 Spanning Tree Protocol Enabled 00000 0000000 D O IEEE 802 100 000000 Fast Forwarding 000 1 10 Enabledr D D O D D D O O00 11 13 Disabled Address Aging 300 Virtual LANs Default VLAN PVID 1 for untagged frames Tagging RX All frames TX Untagged frames Ingress Filtering Disabled Multicast Filtering IGMP Snooping Disabled Act as Querier Disabled CJ CJ CJ CJ CJ 1 5
66. PRIMERGY 90 D D 00000000000000 PRIMERGY 90 D D 00000000000 PRIMERGY 90 0 00 0000000000 0000 PRIMERGY BX300 000000000 00000000 PRIMERGY BX300 D D 0000000000000 0000 00000 ooo UUD DU D D Boo D000000000000000000 poo po 00000000 0000000000000000 F AAR AA KEE SES OOOO ng iD Doo C p Els 9 e EBA N CH NNN IA EE LE L3 r3 noo noo si CH e st In om oi m 20 UI 210000 2 2 1000BASE 2 3 1000BASE 23100 2 4 1000BASE 000000000000000000 Eh E E EE U Im du e mc EL E E O Da cn cn cn e en cn eo en e oc Y i i in NO NO NO NO NO Sr CS C ES lt 00 06 00 00 o0 00 00 pP i Wd p DQ hihihi Rg H EJ 3 gt s Cais z NE SE uo SP Reus z E DEI oiiii i iii CIC r LE a IE s fol SE e E TO EJ S a o E Poi pes 13 m nu x L3 r3 G Lp SL EJ ir O S di Ee m Zo GRUB a em co L3 r3 pee mimg ae og SOE man O Po gu 1 ID EK X H OU ood E im A HOR EJ Hn P Po PPP iPod oo on
67. Timer Timer Timer GARP GARP GARP Ha PVID 2 Ingress OVRE Join Leave LeaveAll drunk Mode rame Type Filtering Status Timer Timer Timer Member 1 fi ALL y MT Enabled F Enabled 1000 Hybrid 2 fi ALL y T Enabled F Enabled 1000 Hybrid 3 fi ALL y T Enabled F Enabled 1000 Hybrid 4 fi ALL Y Enabled Enabled 1000 Hybrid 5 fi ALL gt F Enabled F Enabled 1000 Hybrid e CLI 000000PvD39 000 10000000000000000000000 g0008000000 0000000 Console config interface ethernet 1 1 144 Console config if switchport native vlan 3 181 Console config if switchport acceptable frame types tagged 178 Console config if switchport ingress filtering 177 3 11 VLAN D D 71 312 00000000 a L3 C3 C3 L3 L3 E Pes EE EE E PAALALA C3 C3 Ey es ELE ES L3 C3 C3 L3 El EA ES ET TI HEITE E3 L3 C3 L3 C3 AASA PE ey E I G El C3 E3 L3 E3 LES EST E em EE EJ ET EZE E3
68. boot system 95 118 102 M 0000000000 4 2 3 System Management OOO UD enable password Ui 10 o lo GC 119 GC 120 ooogg GC 121 00 logging on logging history oola PE 122 GC 122 GC 123 GC 124 0000000 GC 125 clear logging CO CO JOO username hostname Jumbo Frame L3 L3 CJ mo COO NGA LES CIT CJ E PTE E 0 ET ES L3 JOO OJO OO L3 L3 O JO Joo 2 BSE JO Joo L3 JOO OJO JO ja L3 O JO E ead E ELE E CO CJ JOO CJ JOO OO E IE e CI CT ECH MET 13 0 L3 00 JOO CJ JOO ig IL CO CJ O JOO ig ja ip http port ip http server GC 125 D OO O I OO O OO 2 TU EM ELE ET LL Tg show startup 0000000000 configuration 0 0000000 PE 126 config show running OOOO configuration 440000000 PE 127 config 0000000000 show log
69. 0000000000000 privileged 00000000000 Norma Exec 00 D O Console gt Privileged Exec 00 0 O Consoles 00000000 Privileged Exec JJ D O D D D D O O D O D O D D D D B O O O D D D a a E El a CJ a CJ El a User Access Verification CLI session with the Switch Blade is opened To end the CLI session enter Exit Console gt enable Console H Configuration 0 O Configuration 0000000 O O privileged 0000000000000 00000000 0000000000000 0000060 copy running config T startup config Configuration 0000300 Global Configuration UUDDUDUDBDBDUDDUUDDBDUDDDUDDDI hesname TT snmp server community N 0000000 Interface Configuration 0000000000000 DUU LD speed duplex negotiation D D O 0000 Line Configuration 4 1PO0D0D0D0 000000000000 99 OOOOOOOOOOOOOOOOOOO DU 00 parity databits OOOO 0000 Global Configuration OO D D D D D Gloval Configuration Privileged Exec O O configure O O O Console confie D D 000000 DU DU Console configure Console config Interface Line Configuration Y Y VLANQ 0 0 0 0 0 OO Global Configuratio
70. SET oem rtt ee eec C bere 55 SAT NANGI nee ee aaa a qha 59 312000 KN 72 SAMO Mr KE MEN 80 5 5 An DC ul a a 6 SAE ERE BNEW DR mene id 87 21 Web D D O D O D O D OD 3 1 po000000000000000 aTr wep 00000000000000 0000 Web Netscape Navigator 61 I O D D D O O O O O D D O O O O O O D O D D D D O O O O D D D 00000 O Web DUU 000000 eb 0 OO Internet Explorer 5 0 0 Bru OU UW O 4 podd0 000000 00000000000000000 OO NDN NDN 000000000 00000000000 os H bridge group port OO000 00000 3000000 22 Web 000000000000000 000000 1 1 3 c r3 an HINH r3 aaga r3 Aa apa r3 aaga an HOH o H lt Tz H R ke EJ aa 5 5 oong o p EHE 3 Cor o ada H 5 e L3 p H rs 5 5 L3 Cp 0 o EE g L3 p a Ada g CD o ooo 5 8 Co Pou z 5 E NOH g 3 3 CDD o c S r3 CH md ANNE o ENE 2 E 5 3 See o E oe p200 E 5 5 2 Ed oo ca l Saa 2 a e 2 L3 Cp 20 0 A RA 3 gt H CD aA S500 BEA 3
71. Table Interface Port 1 000 10 13 bridge address 153 Trunk 1 255 0 MAC Address NA VLAN 1 1 4094 Address Aging 44 Aging Time 300 seconds 18 2184 bridge group aging seconds time 202 600000000 OG CLl u ut 00 STA 45 STA Information 45 Spanning Tree State enabled Read Only show bridge group 170 Bridge ID NA Read Only Max Age 20 seconds Read Only Hello Time 2 seconds Read Only Forward Delay 15 seconds Read Only Designated Root NA Read Only Root Port NA Read Only Root Path Cost NA Read Only Configuration Changes NA Read Only Last Topology Change NA Read Only STA Configuration 45 Switch 48 Spanning Tree State enabled enabled bridge spanning tree 164 disabled Priority 32768 O 65535 bridge priority 167 When the Switch Becomes Root 48 Hello Time 2 seconds 1 10 seconds bridge hello time 165 Maximum Age 20 seconds 6 40 seconds bridge max age 166 Forward Delay 15 seconds 4 30 seconds bridge forward time 165 STA Port Information 49 Port Status NA Read Only show bridge group 170 Forward Transitions NA Read Only Designated Cost NA Read Only Designated Bridge NA Read Only Designated Port NA Read Only Trunk Member NA Read Only show interfaces 1
72. a speed LC 142 stopbits 10000000000000000000000000 LC 142 snow line J00000000000000000 NE BE 149 104 40000000000 4 2 6 Interface D D O 0000 O E d OOO interface GC 144 shutdown 00000000000000000 IC 145 clear counters OOOOOO000000000000 PE 145 description 00000000000000000000 Ic 146 146 speed duplex negotiation fic 147 capabilities po0000000 0000 IC 148 flowcontrol 000000000000000000000000 IC 149 show 000000000000000000000 NE PE 150 interfaces status o show interface QOOQOOOOOOOOOOOOOOOOOO NEPE 451 counters H H show NE PE 2 o interfaces E switchport H H H 4 2 7 Address Table D D 0 uu O uu poo bridge address GC 153 PE 154 clear bridge opa rar D SEL E D rar rar D rn
73. ethernet unit port pot D D D d l port channel channel id 10 D D D D D O address MAC ODO mask MAC D D D D D D D D D O 0 vlan id VLAN ID 00010 4094 sort address vlan interface 0 000000 DO Privileged Exec 000000000 MACH D D D 0000 00000000000000000000 MAC Tyep0000000000000000 Leamed 0000000000 Permanent D D D D D Delete on rese OO D O D O 00 D O B O 0000000000000 Console show bridge 1 Interface Mac Address Vlan Type Eth 1 11 00 10 b5 62 03 74 1 Learned Console H bridge group aging time B podd000000000000000000 0000000000 bridge group bridge group aging time seconds no bridge group bridge group aging time ID seconds D D DO 0B DU DD HL BH 180 21840 000000 D Lu eu o CJ 00000 al Configuration a CC o 2o00 Qo Console config bridge group 1 aging time 300 Console config 43000000000 155 Ig show bridge group aging time UUDDUDUDDUDUDDUDUDDBDUDUDBDUDUDBDUDDDUDUDUUDBDUDUUDUDUUDBDUDULU
74. ooo HOS ooo BOS ooo E EXC ES ooo OO ooo zl ES Se mah ai pm 007 DOA ooo cam OD o EI o0 Ba cog goo Tag o gu 0 oOo HO D 2005 D Oct oo a aOR oo a aaa ooo 5 mugs ooo E oo Si ooo g rata g Aj OO go ooo S Io s a AG m sabo ooo o onog20 ooo 3 EXT ES ETE ooo 65700 SSeS EU tir BSE DO comm C3 r3 9 r3 Hoon 88 Sey a 3 o000 93 oogoo o00 0 n m j E 000000 D Show history D D D D D O D O B O O O O D D D O O O O O D D D D D D D O D Exec 0000000 0000000 El 0000 OOOO 0000 OOOO 0000 EAA a DO nooo a B a O a El Exec Configuration 0080000000000 D ill F 5 Dono goo o 40000000000 98 uut Hut Exec Normal Privileged Configuration Global Interface Line VLAN Configuration 0 00000000000 Q0 Privieged Exec 00000000 uu B Exec 000 Normal Exec 000000000 000000 000000 0000000000000 0000900000000 Privileged Exec LL D DO D DO D D D D D D D D D 000000000 O O LT enable
75. r3 O DD aS LIEBE 2 ooo o gt ART oo o O oonga Oooo o B aaa pc o Oooo o gt o oo ooo x X sF Bags Oooo 8 o 5 o aire oO gt nooo ug o z o SS EE 2 5 o Bono H D nj co a DAN B Ee SOOO 3 5 m A OOOO of H o Doo DD Di o ooooo0g OOOO Oo o0 AS 3 DODODO ag Dog EXEd r1E3EdEd EI E3 EJ o HDD DD Coppi CDD rra s aaa ooo DOON DE A Bl HA E 000 BE oOo es CO A I c JI l o o o Hello Time Maximum Age EZE e cn cs Ji ELE ET E OI an a ran 6 ea E E ENE ERA E EE El Forward Delay 3000000 46 SAO DOON 0000000000 Web O STA STA Information D D O D D D O Spanning Tree Spanning Tree State Enabled Designated Root 32768 222222222222 Bridge ID 32788 222222222222 Root Port o Max Age 20 Root Path Cost o Hello Time 2 Configuration Changes 1 Forward Delay 15 Last Topology Change Dd2h18min55s e CLI UDUDUDUDUDUDIUDUDUSnmUDnUDUDUDUDUDUDUD DO CJ Console show bridge group 1 170 H Bridge group information Spanning tree protocol ieee8021d Spanning tree enable disable enable Priority 32768 Hello Time sec 2 Max Age sec 20 Forward Delay sec 215 Designated Root 32768 0000e8a00090 Curent root port 0 Curent root co
76. switchport port channel Trunk Priority Configuration See Port Priority Configuration 56 Traffic Class 57 Priority NA 00 7 queue cos map 173 Traffic Class NA 003 VLAN 59 VLAN Basic Information 61 VLAN Version Number 1 Read Only NA Maximum VLAN ID 4094 Read Only show bridge ext 171 Maximum Number of 32 Read Only Supported VLANs VLAN Current Table 62 Up Time at Creation NA Read Only show vlan 182 Status Permanent Read Only Egress Ports 10 13 Read Only Untagged Ports 10 13 Read Only NA 204 M eL D D LU LU LU DEDI uui uu CLI uut 00 VLAN Static List 64 Current 1 Read Only show vlan 182 VLAN ID none 1 4094 vlan 176 VLAN Name none string 1 32 Status disabled enabled disabled VLAN Static Table 65 VLAN 1 1 4094 vlan 176 Name DefaultVlan string 1 0 32 Status enabled enabled disabled Membership Type untagged tagged untagged switchport allowed 180 none vlan forbidden switchport forbidden 181 vlan VLAN Static Membership by Port Interface Port 1 Port 1 13 interface Trunk 1 Query NA Read Only show vlan 182 Member NA Read Only switchport allowed 180 Non Member NA Read Only vian VLAN Port Configuration 69 PVID 1 1 4094 Switchport native vlan 181 Acceptable Frame all all switchpor
77. 0 oF oo oo 700 ng Pango 20 EE E Sooo ru Tana o pos dogg 00 ERES PEL ooo oon do San ooo ADA dogg 00 Ci THE Say od ELE Dodo 000 Foon 00 Hoo DD Boog 4000 oo San oon og OR 7005000 gt 0500500 Too DD non nono 00 200 000 00 OOO OU 00 OOO OU 00 OOO O00 RO OOO OOo e RMOND D D D O D D 0 0 0 00000 44 20000000000 E EEE EE EE 610 44 CETE 4 0 4 4 SEI TEE EEE EE 4 01 aan Ez TI EEE EE L3 BAGA 00000
78. 0000000000000000 000000000 O Web D Switch 000000000 Main Board Serial Number 2 Number of Ports 13 Hardware Version 2 Internal Power Status Active Management Software Loader Version v0 0 5 0 Boot ROM Version 1 0 0 75 Operation Code Version 0 2 0 14 Role Master e CLI Console show version 130 Uniti Serial number 2 Hardware version 2 Number of ports 13 Main power status up Agent master Unit id ed Loader version NO 0 Boot rom version 1 0 0 75 Operation code version 0 2 0 14 Console 320000 29 3 233 IPODODODO rpood0d0 000000000000 000000000000 Oooo Oooo Oooo Ooo UUUUDDUUDUUDUUDUUDUUDUUDUODUU DU UUUUDDUUDUUDUUDUUDUUDUDUDUODUU DU podo00000 000000000000 000000 PO00000000000000000000 OOOO goog 000 rg0000000000000B00TPp D D DHePp 00000000 Po00000000000 0000 400 10000000 2355000000000Ccci000000000 0000000 Management VLAN po000000000000 000000 Management D D D O D D D O O O O O D D D D D OD D
79. 010 00 Apply 000000000 Passwords old Password New Password Confirm Password e CLI 0000000 read only 0000 o 157 read write DU 00800000000000000000000000 Console config username bob access level 15 122 Console config username bob password smith Console config 34000000000 DD 35 HOUUUUUUUOO 3 5 L1 Lr OOo CU 3 oag E BJR OOO CU OOOO Ei aad O H qgHHED 1 ie OOH ir ODO OYRA OO E ea O 00 Oooo L3 00 O 00 cosa PSS wan NN am e a Oooo Oooo JEN mz ESI e SE Eg GG e G e e Oooo Oooo Oooo naaa an een NG ESTEE HDR Oooo Oooo HHJ RC ST nn fl a L3 L3 C3 C3 C3 ELECTED EJ ESL E TE ARA L3 C3 C3 L3 C3 C3 L3 e Web O Jumbo Frame NO BD D D D DD HD DO D D DUU D D Enabled OOOO OD Apply OU HD
80. 02000 o adan no 205250809 00 lt pay 252020000 no TCR 0000000 oos 320490000000 508 A 5 a aaa D E SOS anja ji o 2 S D Era 5 8 DD CT o 5 a o m Da RODOS za a os e008 S arama D D o 5 go000cn m rj o s ssc sssssc D co H pj Es ET EE mm mom malam D v L E o oo lo BOBO KOYA CT Ol 1 2 1 2 1 120000000000 122 00000 pogo 00000000000 000000000000 tepg00000000000000 PONDO ooo go 000000 000000000000 00000000 00000 000 11 E 10 100 1000BASE TO 00 0 D DDUD12 1 t ME 000 18 LE P LAND OOOO AQ Amber 0 0 00 1000Mbps 0 0 0 O D Green 0000 100Mbpso 0 D O 10Mbpsg 000 0000 D Green 000000000000 D0 Green 000000000000 n 0000000000000000 00000 D Amber 0000000000000000 0000000000000000 4 102000000 000000 CJ CJ CJ CJ CJ CJ CJ CJ 1 3
81. 134 TAT ap DECHE bas 210 HEET K d BP Bb o etr 183 MODO titan 86 183 s GING 12 130 29 mAT TEAN e ott ttt 94 HEITE HERE ER E 115 WB BABE OI BN OTAD st 84 192 agan NAAN yuya 80 144 WEE 6 Gagana amana ashpa qasa 17 UP RR KN a oo AAA sss 55 172 24 BADE oh ee eet 72 184 MAAN HEEN ns 75 185 EU BY TID ee EE 85 162 HE AAA 23 35 94 MEOD Ee BENGE n 35 B BOOTP datar ea Ga NE ga dan 31 157 C ELE nn ideo he NT 92 HT bl DIN saa nhe 92 Configuration O sss 99 D DHCP saan a apaa hu a as 31 157 IGMP tica 72 184 157 31 E ETE sinun 30 95 157 EED EE 4 T Telnet HD assit ette 93 V SAND WEE 59 175 W Web D D D D D D ge etes 24 RSR 22 KH 24 MAGA kaa 23 HOT DN N SERRE 23 AAO a GANANG 25 LU D 1000BASE T RE 17 000000 1000BASE TOD O00000 vee 20 216 PRIMERGY BX300 0000000 umm B7FH 0521 01 00 000 20020 90 D gg 0000000 Printed in Japan e 000000000000000 000000000000000 e O 0000000000000000000000000000000000 e 0000000000 e P 0209 1
82. 2000000000 18 000000000 19 2 3 1000BASE T 0000000 1000BASE 2 3 o m R CO SC ONG m oO E COroz 0 F3 F3 F3 oO Ooo Zn COD ir o DE AA 8 ooooo o 090 S r3 a oog COD Hrg lt v 2 go co Ooo oo no don do Sc 2 o imi E pa E a ES Soog2a ao WEE EECH SS H R ZOO QF Es ELE a Y EI 5 HU Er E DOO pnmHmum5ga 2 Tang OOOHAu 050428 opo OOO gj 8 of ap O obo nG EI Doc EJ OOOns Fj o A ooo SE CDI 5 4 02980907 r3 maang 8 r3 ET E ooo gt ad Palit kat 5 o El E g AO D 2 o o oo o o odo o LO 5 OS vam Ee Ei DI d 5 nG COD 3 p E EE E p 3 H E B CDI YES OO Ago lt o n E 02 CET 0500 m o r3 lt o oo ono Da DODAZO L3 SAD ANE as5ouosgn H EE E SC Se ee Aa CJ HD CJ 2 3 1 24 1000BASE T I 000000 L IFI PCpO BO pg O DDD O DO DO 0000000000 000000000000 00000000000 0 1000BASE TQO D DO DO D MomprxOOOOOOO lt 0
83. 720 O O O O O O O O 000000 0 icmp snooping IGMP Query JOO O DO00000000000000000000000000000000000 000000000000000000000000000000000000 DO000000000000000000000000000000000 VLAN 0000000000 vLang0000000000000000000000 UD 00000 00000 00000 e Lr O UUUDDUD Interface VLANID r3 CH d Q CH r3 CH r3 CH 4 5 CH r3 CH r3 CH r3 CH r3 E a Oo EXE a a a El FIR a a oog EI D0 000000000000 P00000 O Web O IGMP O O IGMP Member Port Table O IGMP D D D D D D D D O D AN OOOO POOOOOOOOO OM 000000000 0000 OOOO UD Ooo 000 UDUUDDUUDUDUDUOD 000 VL DU IGMP Member Port List New Static IGMP Member Port WLAN 1 224 1 3 5 Unit 1 Part 1 Interface Port VLAN ID if lt lt Add E Multicast P 224 1 3 6 Remove ek l Port El 312000000000 77 78 VLANI0 GOD ON O VLAN 1 Console config ip Lomp snooping vlan 1 static 2
84. 73344 v02014 Operation Code X 1025024 Factory Default Config cfg Config File Y 1613 iun p Total free space 1851392 Console delete diag1075 43000000000 g 117 B whichboot 0p000000O00000000000000000000000000000 0000000 None 0000000 Privileged Exec so 00000 whichboot DUDU D B D D D O D D O D D OO DD D D D D D 0 0 w aM gt 1700000000 Console whichboot file name file type startup size byte E diag1075 Boot Rom image Y 73344 v02014 Operation Code Y 1025024 Factory Default Config cfg Config File Y 1613 Console H boot system UDUUDUUDUODUUDUODUUDUODUUDUODUUDUODUU 0000 DO DO boot system boot rom config opcode filename boot rom ROM config 000000 00000000 filename DO 0000000000000 0000000 None 0000000 Global Configuration 000000000 DO 18 P40000000000 D Console config boot system config startup Console config O00000 dir whichboot 4 3 3 System Management O O UUUUUUUUUDUUDUUDUUDUUDUUDUDUDUDUDUDUDUDUD
85. 802 3ac VLAN tagging IEEE 802 1Q VLAN Bridge Management IEEE 802 3x full duplex flow control ISO IEC 8802 3 SNMP RFC 1157 RMON RFC 2819 MIB II RFC 1213 Bridge MIB RFC 1493 Extended Bridge MIB RFC 2674 Ether Like MIB RFC 2665 Interface MIB RFC 2863 Entity MIB RFC 2737 Private MIB IGMP Snooping parts of RFC 1112 2236 IP ARP ICMP UDP TCP TFTP Telnet Traps 12 102000000 000000 CJ CJ CJ CJ 1 8 1 HEH EELER BEER ET EPOR HEH AAA 00 000 OO0411CLIN00000000MO0000000M 9200 D00000000000000041200000000M0 4 2 3 5 3 4 20000000000 Oo EE Oo Oo Ooo Oo Oo Oo ama BOE L3 r3 Op oong Oop BOE L3 r3 BE HE Oop L3 L3 r3 BAG Oop LL mal CO Dom man man man man Dom Do
86. D 22 32768 222222222222 128 4 5 Blocking 0 22 32768 222222222222 128 5 e CLI srrgo000000000 50000 Console show bridge group 1 ethernet 1 5 170 Bridge group information Spanning tree protocol Spanning tree enable disable Priority Hello Time sec Max Age sec Forward Delay sec Designated Root Current root port Current root cost Number of topology changes Last topology changes time sec Hold times sec Admin status enable STA state blocking Path cost 4 Priority 128 Designated cost 4 Designated port 128 5 Designated root Designated bridge Fast forwarding enable Forward transitions 18 Console ieee8021d enable 32768 2 20 15 32768 0000e8000001 13 4 325 32768 0000e8000001 32768 222222222222 18 38000000 51 CJ a a CI EJ a a 52 BM SADOODO DO DO DO 0D OO O Web d STAG D 0 0 00 D STA Trunk Configuration O O O O STA Port Configuration Trunk Type STAState Priority Path Cost Fast Forward r r SO Port Type STAState Priority Path Cost Fast Forward Trunk 1 t000Base Sx No Link 28 bh T Enabled 2 to00Base Sx No Link 128 4 Enabled 3 1000Base 8X No Link fe ff F Enabled 4 1000Base SX No Link ps h F Enabled 5 1000Base sx Blocking 128 fA I Enabled e CLI
87. D D D D P000 0000000000 SNMPPP NDN 000000000 00000 10 00 snmp server enable traps D D D D D D O D D D O D D D D P0 000000000000000 D snmp server enable traps O O O O O I snmp server host DD OOO0000 P0000 l 0000000000000000 SNMP podd 00000 000000 000000 0000000000000 1 O UU snmpeserver hos D D D D D D D D D D D D D D D U D ugpnagaggaaggggaagagugmgagaugug MBOOOOOOO 0000000 MBOOOOOOOOOOOOOOOOOOOOOOOO poda 0000000000 0000000000 MBOOOOOOO odo 0000 000000000000 00000000 EO snmp server enable traps 0 0000000000000000 vi Console config snmp server enable traps link up down Console config 000000 snmp server host B 43000000000 135 4 3 5 Line D D CUNODO einer D 00000 exec timeout password 00000 00000 00000 00000 thresh 00000 line console vty console 000000000 vwy0000000000000000000U0 000000 O 000000 obal Configuration UDUDUDUD Inet DUDUDUDUD
88. NG ga D show history D D O O D O D D D O D O B O D O D D D D D D Ooo 000 000 O EJ Console show history Execution command history 2 config 1 show history Configuration command history 4 interface vlan 1 3 exit 2 interface vlan 1 1 end Console O O 000000 Normal Exec 9 Privilege Exec 00000000 Execution D 0000000000000 DO D D DO D O D O D D D D D 0000000000000 Configuration D D n 000000000000 Execution 0 HU DUU D 200000000co e0 00000000 Console 2 Console config Console config 112 P40000000000 B reload uunuunnununnuunnuununnuunn 000000000000000 Power On Self Test OOO 0000 ppm Copy running config startup config 000000000 DO D000000 None 0000000 Privileged Exec 000000000 DOpag dog gon og 00 gd 00 000 0000000000000 H D00000000000000000000000 Console reload System will be restarted continue lt y n gt y H end 000000000000 Privileged Exec 00000000 0000000 None 0000000 Global Configuration Interface Configuration Line Configuration VLAN Database Configuration Interface Configuration 0 O Privileged Exec 000000 Console config if end Console B exit DUDUDUDUDUDUDDUDUD
89. Threshold frames count 16 y 30000000 Ooo O L3 L3 rcc CC L3 L3 CC L3 L3 OOO L3 L3 rcc OOO OOO OOO OOO L3 L3 a Oo SEI SER a GGC oono OOo Ooo OOo OOO CH OH EI I EJ oog 111 Ooo Ooo O CC 00000000 16064 128 256pps e CLI po0000ep00000000000000000000000000 Console config 8020860886 frame count 64 192 Console config 314 00000000000 Op0g00 0000000 000000000 00000 000000000000 ON 000000000 000000000000 00000000000 0000 00000000000 000000000 00000000 000000000 DUDU o CJ CJ 000000000 o 0000000000000 000000000000 000000000 o OO Web O Mirror DU DUDU DUDU D D DL 000000 000000000000 OO DOON O NM Ad NOD OODODO Mirror Sessions New none Source Port 1 d Type Px y Been Tre rig e CLI O interface D NO D D O D O D DUDU DUDU DU D M port monitor D D D D D D 00080800000 0000000000000 Console config inte
90. VLAND VLAN Static List O O Enable 00000000 000000000 VANDO VLANTI D D D 000000000 Current New 1 Defaultvlan Enabled VLAN ID 1 4094 3 2 Finance Enabled Add L MLANName R amp D Status Iv Enable O CLI 00000000 Console config vlan database 175 Console config vlan vlan 5 name R amp D media ethernet state active 176 Console config vlan VLAN 1 DefaultVLAN 0 0000000000000 64 30000000 3114 UDUDUDUDUDUDUDUDUDDUDUUUDDDUUI OU 00000 Port 000 Trunk 0000 ID VLAN 0000000 vLAND mp 10 4040 00000 0000000000 Oo Name VLAN 32000 State OO Enable VLAN I OOOO Disable VIAND D D D D D D DD D D D D D D D D D O DJ Membership Type OOOOOOOOOOOOOOOO Tagged VLANJDDDUDDDDDUDDDDUDDUDUDUDU cost DD 0000000 Untagged VLANJDDDDDDDDUDDUDDUDDUDUDUDU uuu 12800000000000000 10000000000000 uuu Forbidden 0000000
91. e 0000000 o 0000030000 0000000 o Line Configuration a El Ei DOBo0 Dog 0000000 0000000000 0000000000 0000000000000000 M0 silent time 80000000000 Tee 000000000 so D DO Console config line password thresh 5 Console config line 000000 silent time 43000000000 139 silent time password thresh D D D D O silent time seconds no silent time second D D DO DO0D 00000000000 655350 000000000 000000 000000 silent time 000000000000 000000 ne Configuration 00000000 assword thresh 00000000 3 CO D D p 25 D gpguenggmnuaupnugnuanugpnguanadnpudud Console config line silent time 60 Console config line 000000 password thresh aatabitsdOOOOOOOOOOOOOOOOO gt PH databits 7 8 no databits M100000 7000 81100000 8000 0000000 100000 8000 0000000 Line Configuration 4 140 000000000 D databits O0 00000000000000 7000000000000
92. ethernet 1 6 both Console config if 000000 show port monitor 162 40000000000 H show port monitor OO show port monitor interface interface ethernet unit port aipoo000000000000 1000 e pot 00000 0000000 Privileged Exec 4 H gd000 00000000 00000000000 a Console config interface ethernet 1 11 Console config if port monitor ethernet 1 6 Console config if end Console show port monitor Port Mirroring H ieu A AO NEL A AN Destination port listen port Eth1 11 Ci Source port monitored port Eth1 6 Mode RX TX Console 43000000000 163 4 3 10 Spanning Tee D 0 0 SP 000000 00000000000 sSPOOOOOOOOOOOOOOOOOOO 00000 Global Configuration Interface Configuration Privileged Exec bridge spanning tree bridge group path cost show bridge group bridge forward time bridge group priority bridge hello time bridge group portfast bridge max age bridge priority H bridge spanning tree OOOUO0000000 bridge bridge group spanning tree no bridge bridge group spanning tree bridge group D D D D D D D O D D D D O D O D 10 0000000 a s a po000 C al Configuration a A T L3 L3 r3 L3 rro L3 L3 OOOO
93. hep 000000000 000000000000000000000000 OM 100000000000 000000000000 0000000000 OD 00000000000 2000000 0000000000000 000000 0000 00000000000 D Normal Exec Privileged Exec 9 D 0 O 0 O O O O Global Interface Linef VLAN Database D D O D D D D D D O D O D O D 0000000000000 pa agaganpnagagpnanpugagpabnnH Hub DD I sow 0000 Console show bridge Bridge information bridge ext Bridge extend information gvrp Show gvrp information of interface history Information of history interfaces Information of interfaces ip Ip line TTY line information logging Show the contents of logging buffers queue Information of priority queue port Monitor port queue Strict queue of priority radius server Radius server information running config The system configuration of running snmp SNMP statistics startup config The system configuration of starting up system Information of system users Display information about terminal lines version System hardware and software status vlan Switch VLAN Virtual Interface Console show 4 1PO0D00D0D0 000000000000 97 D show interfaces 0 0000000000000000 Console gt show interfaces Information of interfaces counters Information of interfaces status counters status Information of interfaces switchport switchport mn 0000000000000 ooo F O oo ooo r3 85 3 ooo O B5 rn aan CO ooo END
94. output 0 Extended iftable stats Multi cast input 0 Multi cast output 17027 Broadcast input 231 Broadcast output 7 Ether like stats Alignment errors 0 FCS errors 0 Single Collision frames 0 Multiple collision frames 0 SQE Test errors 0 Deferred transmissions 0 Late collisions 0 Excessive collisions 0 Internal mac transmit errors 0 Internal mac receive errors 0 Frame too longs 0 Carrier sense errors 0 Symbol errors 0 RMON stats Drop events 0 Octets 4422579 Packets 31552 Broadcast pkts 238 Multi cast pkts 17033 Undersize pkts 0 Oversize pkts 0 Fragments 0 Jabbers 0 CRC align errors 0 Collisions 0 Packet size lt 64 octets 25568 Packet size 65 to 127 octets 1616 Packet size 128 to 255 octets 1249 Packet size 256 to 511 octets 1449 Packet size 512 to 1023 octets 802 Packet size 1024 to 1518 octets 871 Console CJ a a H EJ a a 89 36 90 3000000 4 RAE EUREN CH FJ D Contents 4100000 o NR MES Ca am a bane tere 92 LAS AA AA RA 101 AAA RA 110 NDN NN UU 1 4 4 1 1 0000000 EUR HI 00000000000
95. server community batman rw 132 Console config 3 332 34 N0000 NN 00000000000 000000000 0000000500000 00000 000000000 Web OO00000000000000000000000000000 CANNON DOON NN ON 00000000000 OOOOOOOOOOOOOO Web gsNMPOOOOOOOOO Community String T D O O 000000000000 I Trap Manager IP Address 9 O O DI Trap Manager 0000000000 dl Enable Authentication Traps D Add D B DL D DO UU UL D Trap Managers Trap Manager Capability 5 Current New none Add Trap Manager IP address Remove Trap Manager Community String Enable Authentication Traps Y e CLI pogo 0000000000000 0000000000000000000 Console config snmp server host 10 1 19 23 batman 134 Console config snmp server enable traps authentication 135 30000000 34 uuunnnunnnnunununnuununnuununnuunuununnuununnuunnun uuunnnununnnunununnunuununnununnuunnuunnnunuununnunununun uuunnnununnununununnunuununnuununnuunnuununnunuununnunuun uuunnnununnpnununununnunununnunuununnuunnuununnunuunnnunuunun uuunnnununnpnununununnunuununnpnuununnuunnuununnunununnunununun uuunnnununnuu l 0000000000000000 guest 00 00 DD guest 0000 90000000000000000000000 admin D 0000000 admin NO O Web H EJ O Security D D D D D DO D D D O D D D D D D D D D D D D D OD D D D D D
96. to 255 octets 691 Packet size 256 to 511 octets 0 Packet size 512 to 1023 octets 0 Packet size 1024 to 1518 octets 0 Console 43000000000 g 152 H show interfaces switchport OO show interfaces switchport interface interface ethernet unit port 1000 pol 00000 port channel channel idQ 10000000 000000 000000 ormal Exec Privileged Exec CO GC 100000000000 Console show interfaces switchport ethernet 1 11 Information of Eth 1 11 Broadcast threshold Enabled 256 packets second Lacp status Enabled VLAN membership mode Hybrid Ingress rule Disabled Acceptable frame type All frames Native VLAN 1 Priority for untagged traffic 0 Gvrp status Disabled Allowed Vlan 1 u Forbidden Vlan Console 40000000000 4 3 7 Address Table O00 H bridge address 00000 VLANgO 1000000000000 M p000000000 O HDH O O H o O H H bridge bridge group address mac address vlan vlan id forward interface action no bridge bridge group address address vlan vlan id bridge group N D D D D D O D D D D D D O D 10 mac address MAC DO ODO ylan id VLAN IDG 00010 40940 interface B ethernet unit port umi UD UD UO UO 1
97. 0 0000100 00000800 7 Console config line databits 7 Console config line 000000 parity w parity I DUUDUDDUUDUDUUDUDUUI DUUDDDDDDDDUDUDDUDDDDDDUDUDDDBDBDDDUDUDUDUDUDBDBDUDUL po00000000 0000000000 e 00 parity none even odd no parity none 000000 even 000000 edd 0 00000 000 000 ooo EO DC D ation 5 dq C DU UDUUDUUDUODUUDUODUUDUODUUDUOD Ooo Ooo Console config line parity none Console config line 43000000000 g 141 B o EEE EEE EEE E ENE EJ OO GEHA OH L3 ua es ea Oooo Oooo Oooo SEVER TE Ez O El EZE 3 O speed bps no speed N 9600 57600 38400 19200 115200bps 9600bps Line Configuration
98. 00 GRP 000000 VLANT U UL u None uuu Trunk Member HH D H VLAN Static Table D D D D D D D D OD D 00000 3 11 VLAN l 65 bi 0000000 Web Port Tagged Untagged Forbidden None Trunk Member Trunk Tagged Untagged Forbidden None 7 2 Name Finance Status Y Enable 3000000 66 e CLI 0000 Console config vlan database 175 Console config vlan vlan 2 name Finance media ethernet state activel76 Console config vlan exit Console config interface ethernet 1 1 144 Console config if switchport allowed vlan add 2 tagged 180 Console config if exit Console config interface ethernet 1 2 Console config if switchport allowed vlan add 2 untagged Console config if exit Console config interface ethernet 1 13 Console config if switchport allowed vlan add 2 tagged Console show vlan 182 VLAN Type Name Status Ports Channel groups 1
99. 000 port 00000 port channel channel id 10000000 action 0968 D D D D D D D D D O D D D OD D O D D D D D D permanent 00000000000 0000000 DUU IT permanent J UU 000000 Global Configuration e D Console config bridge 1 address 00 e0 29 94 34 de vlan 1 forward ethernet 1 1 delete on reset Console config 43000000000 153 clear bridge clear bridge bridge group bridge group D 000000000000 10 DO Privileged Exec D Console clear bridge 1 Console H show bridge DO DO 400 po0ogo0000000000000000000 000000000000 DO show bridge bridge group interface address mask vlan vlan id sort address vlan interface D D D D D D C D UD D 10 interface
100. 000 Interface Configuration Ethernet Port Channel 000000000 allowed VAND D 0000000 ANDUODUD DUU UD forbidden VLANQ D D D D DO 000000000 10 VLAN3Q00000000000000000 Console config tinterface ethernet 1 1 Console config if switchport forbidden vlan add 3 Console config if B show vlan DoO0000000000VvLaNgog00000 00 show vlan id vlan id name vlan name id VIANDD D D D D D D D D D vwlan id D 000 VLANQ IWOOO010 4040000009000 00000000 name VIAND D D D BL D D D D O D vlan name 100 32000 ASCH I gg 0000 VLAN D D D D O D D 00 xec Privileged Exec 000 DO E DODODOVLANIgo0D00000000000000 Console show vlan id 1 VLAN Type Name Status Ports Channel groups 1 Static DefaultVlan Active Eth1 1 Eth1 2 Eth1 3 Ethl 4 Eth1 5 Eth1 6 Eth1 7 Eth1 8 Eth1 9 Eth1 10 Eth1 11 Eth1 12 Eth1 13 Console 182 P40000000000 4 3 14 Port Trunking 0 O po000000 H channel group DON DN NDN DN 000000000000 000000 o DO channel group channel id T Q D o Y y H 0 g bei Es 9 O channel id D D 0000000000000000000 o o r3 rmn o0 gp Soe ADA r3 mad r3 r3 rH m oa HD r3 rmn El EE
101. 0000 Wwego000000000000000000000000000 pDo0odo0000000000000000000000000000000000 po0ogo0000000000000000000000000000000000 oo000 0000 OO 000 System 27 Switch 29 IP 30 SNMP NO 0000000000000 00000000000 33 o P00 000000000000000000 o Security goo0o00000000000 35 LI L1 LI LI LJ LJ LJ LJ LI LJ LJ Li Li Li Jumbo Frame pgoa00800808000 00000000000 36 oO Flash File 37 Firmware 000000000000000 37 Configuration 38 Reset D0000000000 Address Table 41 Dynamic Addresses Address Table O 0000000000000000 41 Static Addresses 43 poo Address Aging 44 STA 45 STA Information 000000 SAD 000 47 STA Configuration SANDO 0000000000000 48 STA Port Information sagodooo 00000000 50 STA Trunk Information STAQODOOOODODODODO 50 STA Port Configuration STAN 52 STA Trunk saga 00000000000 52 Configuration Bridge Extension 53 Priority 55 Port Priority DO000000000000000000000 55 Configuration Trunk Priority 000000000000000 000000000 55 Configuration Traffic Class IEEE 802 1p D D D O D O O DO D O D O D O O D O O O 0 57 000 VLAN 59 3 1 WebD 0000000000 25 26
102. 00000 IEEE 802 3ab D D D D D D D 0000 10000000000000000000 EEE 802 3ab 1000BASE pod NON 0000000000000 1000Mbps I 0 poO00000001000BASE TO ND D H O D D D D D O R450000000000000000000 1000Mbps D D D D D D O D D O D D O 0 O 1009 00000 se 000000000050 R4450000000000R44500000 ODO NDN NN DN NN DON DN DD 00000000000 CEE ESE EGE ELE BDH 2 000 450000000000 000000000000000 3 000000000000000 P 450000000000000 17 2 2 1000BASETODODODODO 2 too Oso oor Foaoooan ooW SSR els ood oo0020H ono CDD DE 008 2000000 oor nooo ooo CO a a o Coop a a poo pBanmHuiniumnmngumuuu noo DO ooo anno goo noo s o0o0p0 0 o COD n0028 L3 noo 6 9 oo 5 Doo xo OOO e ESTE ESTE ey o nog 8 D sang tr 13 oe 2 10 5 30070000070 o CDD DD ei o E eo Odor o
103. 000000 UDUDDUUDUDDUUDUDDUUDUDDUODUDDUU DU Mac O a a Console config bridge 1 priority 40000 a Console config H bridge group path cost DOdBg0 Dd 00000 000000000000 00000000000000 podd0 000000000000 0000000000 OO bridge group bridge group path cost cost no bridge group bridge group path cost bridge group D D D D D D D C D CH D CL D C D 10 cosMOOOOOOOOOOOOO10 655350 00000 DOOOOOO 10Mbps T 50 600 DD DU 00Mbps 10 60 00000000000030 10 0000000 00000000000 100 000900000090 0000000000 100Mbp D D D D D 9900000 1800 U 000 15 43000000000 p 167 50 O po000000000000040000003 00000 rface Configuration Ethernet Port Channel D HD L DOODO c DO DO DO DO DO DO OOOO OH OOOO OOOO L3 L3 Lc L3 COOC podd0000000000000 D a Console config interface ethernet 1 5 Console config if bridge group 1 path cost 50 Console config if H bridge group priority UDUUDUUDUUDUDDUUDUODUUDU M p000000000 HH O
104. 000000 1000BASE TD MDIQ MprxOOOOOOOOOOOOOO 1000BASE TU D D D D D D D D D D D O D D 9 D D 4000000000000 1000BASE T 00000100 0000 se0000000000000 UTPO 0000 MD O MDI X 0 1 Transmit Data plus TD1 Transmit Data plus TD2 2 Receive Data minus RD1 Receive Data minus RD2 3 Transmit Data plus TD2 Transmit Data plus TD1 4 Transmit Data plus TD3 Transmit Data plus TD4 5 Receive Data minus RD3 Receive Data minus RD4 6 Receive Data minus RD2 Receive Data minus RD1 7 Transmit Data plus TD4 Transmit Data plus TD3 8 Receive Data minus RD4 Receive Data minus RD3 20 2000000000 3 AA AA NAN CJ D D L3 a Contents A CT Aert md et tr ee acne ts 22 al a ska 27 SS SNMP Ue E AA eese GN 33 3 400 a eebe 35 3 500 oo bd ood An 36 6 tee wera oa ane rege x nee aaa 37 aaah Ul tee tas Sa talo tite aaa 41 3 800 FEELER A Gs eee one ee PAA A 45 3 9 TR I III sa chit Peer th ee s 53 310 B ED
105. 000000000 000000000 snmp server host D D 000000000 I snmp server host 0 0 D 0 0 0 0 E D snmp server community 0000000 0000032000 DO 00000 bal Configuration D samp served OO D D DD D Suen O server enable traps D D D D O D D D O D O D OD O O 0000000 10 00 snmp server enable traps 0000000000 snmp server host JO 0000000000000000 0 snmp server enable traps D D D O D D D O B O D O D D D D D D D 0000 Console config snmp server host 10 1 19 23 batman Console config 000000 snmp server enable traps 134 g 40000000000 H snmp server enable traps D Simple Network Management Protocol DO000000SNMPp00000 00000000000 0000 SNMPO0 OO 0 DU OO0d DU 0000 s E snmp server enable traps authentication link up down no snmp server enable traps authentication link up down authentication TOO 000000000000000 link up dowa D J D O D D D D O O O O O O D D D O OO DO D 00170 DU oooooooooooooooooooooa OOOO 8000000000000000000000000000 0000000 Link up down D D D D D D D D D D D 100000000000000 0000000 Global Configuration 000000000 O Snmp server enable traps D D D D D D O D D DO B D B D D D D
106. 00000000000 Priority Traffic Class Web O Priority D Traffic Class Priority Traffic Class o f e NAS 2 oa f aa E oa 5 E en o TE oa 7 os e CLI 000000cs0 010000 20 CosOOOOOOOOOO 000 cos 0 4050 9 DD DD D H D D D ep 70 DD DH D HOOD 3000 00000000000 0000 Console config interface ethernet 1 1 144 Console config if queue cos map 0 0 1 2 173 Console config if queue cos map 2 4 5 Console config if queue cos map 3 6 7 Console config exit Console show queue cos map ethernet 1 1 174 Information of Eth 1 1 Queue ID Traffic class Console config if queue cos map 1 3 wW Console 58 3000000 VLAN I 3 11 o onog o Ong Bi El Ea DD Ho im Sogo Ec H Ho DAHA oa ElEX zoo qu Dogo EI e EE ma E Er ED Ej ETE oo gt DD qu zou mGa ma 95020200 n Doo Doc BO aran qu jo 0570 ma pena H CZ pem Es ma 02000 qu oo A Dog oo ng DOO 90 DOG 4 0 OO pg EIE a ama Ska EX pt m oo c B OO oo E Se H oOo 982000 BE oo Esc EXE ET O CDD HOO q
107. 0000000000000 MB 00000000 MBOOOOOOOOOOOOOOOOOOOOOOOOOO MIB O mu 00000 UNICORN portMgt portTable portEntry portindex No Access Port List 1 13 1 portName Read Write String 0 64 NA portType Read Only 4 1000BASE SX Ports 1 10 100BASE SX 6 1000BASE T Ports 11 13 1000BASE T portSpeedDpxCfg Read Write 2 halfDuplex10 1000full 3 fullDuplex10 4 halfDuplex100 5 fullDuplex100 7 fullDuplex1000 portFlowCtrlCfg Read Write 1 enabled Disabled 2 disabled 3 backPressure 4 dot3xFlowControl portCapabilities Read Write 0 portCap1 Ohalf 000 10 10 1000full 1 portCapt Ofull 000 119 13 10half 2 portCap100half 10full 100half 100full 3 poriCap100full 1000full 5 portCap1000full 14 portCapSym portAutonegotiation Read Write 1 enabled enabled 2 disabled portSpeedDpxStatus Read Only 1 error 1000full 2 halfDuplex10 3 fullDuplex10 4 halfDuplex100 5 fullDuplex100 7 fullDuplex1000 5 SNMP I O O MIB O 0000 UU 00000 portFlowCtrlStatus Read Only 1 error none backPressure dot3xFlowControl portTrunkIndex Read Only none none trunk 1 2 3 4 none 0 none 1 5 3 MB D D D D D D H O D 0 L 197 OOdwns 5 4 198 NDN NOD
108. 00000000000000000000D IP Address Model 0 DHCPJ OO O O BOOTPO O O O O O O O O O O O O O O O O O O O O 000000 DO0000000000000000000Pr000000000000000 0000000000000000 DD DD CD Restat DHCPO D O O O D O O 0D0000000000000000000000000 00000000000000000000000000 show 0000 ipinterface000000000000000000000000 320000 31 32 IP Configuration Management VLAN 1 gt IP Address Mode BOOTP gt IP Address 192 168 1 5 f Subnet Mask Gateway IP Address 132 168 1 25 MAC Address 22 22 22 22 22 22 Restart DHCP e CLI 000000000000 ID IP Address Model 0 0 DHCP D D BOOTP Console config Console config interface vlan 1 177 Console config if ip address dhcp 157 Console config if end Console ip dhcp restart 158 Console show ip interface 159 IP address and netmask 10 1 0 54 255 255 255 0 on VLAN 1 and address mode DHCP Console m OHCP OO HC ng ooon g oooo onoooo onoooo L3 OOO Web DHCP UUD IP 0000 web DU e CLI 000000 Console ip dhcp restart 158 30000000 33 SNMP l LI
109. 0p000 TD lt NON CDD w 2528200 ODC CDD 3900 onooooooo CDD BE mE E EI DON amana Ass 5 BOGA B RA E Bum DODODOO nooo 2 madan an a a a a BER E pagus H NANO 5 so EI E ASAN EI EZE Ee 5 3 m H CODE CDD ZS a H nooooooo amana El Een Era EZ O a ra sso mood ca se DODO Y SOA s ss a DON ODO O EES s BAR IE Gs EEE E CDD ee HOA 300 SA o 5 8 BARA DODONG p goo Soo 90O 2 oo00000 2 DODONG SET EI Ooo SE Y oooo ooo ooo LE E E E E E O ETESLEZET ERIT E E ET a O 85 r3 F3 r3 E Bu L3 0000000 3 QD ar ooooooo Deo CDD EI DD Oooo CO ooooooo aa DI DD Oooo gt gt oooooooo aa O 000000000000 3054 DS DD NONG DD COD DC r3 3030800050 _ aaa 9 0000 Foego oo DODODOO COD KONG Do SEE ELES ETE ETE 3 DODO 000800 amp EYES El aa a AA pa AO 49 380 0000000 00000000 Dodd 00000 000000 00000000000 Port Status Disabled 1000000000 000000 0000000000 ooo Blocking 000 STAOOOOOOOOOOOOOOOOOOOO Listening D D D D D D D D D D D O D O D O D D D D D D D Dodd gg 00 00 0000 000000 00000000000
110. 189 ip igmp query max response time ip igmp query timeout D D D D OD IGMPv2 0000000 JH IGMP Version 1 D D D D D D O O D O D D D D D D D Console config ip Lomp snooping version 1 Console config H show ip igmp snooping 000000000000 GM 00 0000000000000 00000 00000 rivileged Exec D OO yao CO 000 a D 16MPpo00000000000000 Console show ip igmp snooping Service status Enabled Querier status Enabled Query count 2 Query interval 125 sec Query max response time 10 sec Query time out 300 sec IGMP snooping version Version 2 Console H show ip igmp snooping mrouter OD 0000000000000 00000000 0000000000 00000000 DO DO DO DO show ip igmp snooping mrouter vlan vlan id vlan id VLANIDO 0 D 0 10 4094 e 0000000 00000000 0000000 Privileged Exec 190 40000000000 e D UDUODUUDUDDUUDUDDUUDU vraANIDDODDUDDUUO Console show ip igmp snooping mrouter vlan 1 VLAN M cast Router Ports Type 1 Eth 1 11 Static Console H show bridge multicast Aa show bridge bridge group multicast vlan vlan id user igmp snooping 0 D D 00000000 vlan id VLAN IDI 1 0 40949 0 000000 0d 000000000 0000000000 igmp snooping
111. 24 0 0 12 ethernet 12 186 Console config exit Console show bridge 1 multicast vlan 1 191 VLAN M cast IP addr Member ports Type 1 224 0 0 12 Eth1 12 USER ak 224 1 2 3 Eth1 12 IGMP Console 30000000 3124 DODODO DO DO DO DO D 0000000 0000 VLAN QD OO NO Pg0000000000000000000 ngagagi 0000000 VLAN ID VLANJUDDDUDUD Multicast IP Address PONDO Multicast Group Port List VLAND D D O Web D IGMP IP Multicast Registration Table D 0 D 1 D O D D D VLANIDO O O 00000 IPgo000 000000 00000000 00000000000 0008000000 0000 VLAN ID 1 y Multicast IP Address 224 1 3 5 y Multicast Group Port List Uhnit1 Portl User DOO ELE E OO DOO EEE Ooo Ooo Ooo OOO L3 ODO ODO L3 Ooo Console show bridge 1 multicast vlan 1 191 VLAN M cast IP addr Member ports Type 1 224 0 0 12 Eth1 12 USER 1 224 1 2 3 Eth1 12 IGMP Console 312000000000 79 313 0000 u It 3 13 1 DOOOUUUU Port Information Trunk Information
112. 3 gt boss BB z le l E oo oom Ho o SO Sg o L3 L3 E3 a v 8 E b Ka BO Oooo las 0 un Oooo o00 20 0 GA ooon iw OJO oo Oooo E ess fe fe Bes Hoong gi 2 uma Yvan RAR Oooo E L3 L3 rur o Oooo CD Oooo CD 28000 oofoo Bono masan a ric rn E E nmm o0 A 23 3 1 Web 0000000000 0000000 podd0 000000 0000000000 CJ o lh Ea Fo rR ES ou o E Ciy 2 ng 0 a CT ADA SA og 25550000 E m m P mim o o H D o cum mu 052422200 SKS KK El EE EE goals Geo Zeg 5 ea ET A a 29020 50 0 o 0 e EE LI gt Baa m eo ojojo r mo EE EZE lt ojojojo o Boo foo madana NO PA ag ag o x00000 l op SSSSS salon oo SE 550855528 eo e o ajo Oci yoo ci Ei Di E D Oooo HO e Aoooo tan boda ru ZELT ceo SE an 6 o 2 z lt O cs 9mm E ol gt se 22 y 3 1 2 10 DO Active Mode zx Port 14 z o g na SEI EK Ze ras D Link Up J Link Down 30000000 24 313 OOOUUUU 0
113. 4 Console config if description RD SW 13 146 Console config if shutdown 145 Console config if no shutdown Console config if no negotiation 147 Console config if speed duplex 100half 146 Console config if flowcontrol 149 Console config if negotiation Console config if capabilities 100half 148 Console config if capabilities 100full Console config if capabilities flowcontrol 3 133 DODODO DO DO DO 0D 0000000 84 L3 L3 L3 C3 C3 L3 L3 L3 C3 C3 ap C3 L3 C3 C3 L3 C3 L3 C3 C3 L3 L3 L3 C3 C3 L2 L3 L3 C3 C3 L3 L3 L3 C3 C3 L3 L3 L3 C3 L3 OOO L3 L3 L3 C3 C3 L2 L3 L3 C3 C3 L3 C3 L3 c3 C3 L3 L3 L3 C3 C3 L3 L3 L3 C3 C3 L3 C3 L3 c3 C3 L2 C3 L3 C3 C3 L3 L3 L3 C3 C3 L3 L3 L3 C3 C3 L3 L3 L3 C3 L3 L3 C3 L3 C3 C3 OOO L3 L3 L3 C3 L3 L3 C3 L3 L3 L3 L3 C3 L3 Ooo Ooo Ooo oog ECVE oono oog oono oono Ooo Ooo Ooo Ooo a OOo Ooo HID CC OOo Ooo 00000000 00000 34 EI E E O Ooo Ooo O Ooo Ooo CC O Ooo O BJ EI EYRI EI Ooo O OOO Oo Oooo c Oooo O Oooo c Oooo c Web D Port O Broadcast Control 00000 000000 Apy 0000000000 Broadcast Control Status Disabled y
114. 405000 Sy ano 09402900 Dor p ma SABAS SA a220 05902900 Dor p ma Don DD Dor Sano 054295000 Dor A ooo o CDD o0 o ooo A Tana pics ETE nuu E 60000 260510 Danan CDD DC s0000 rg 25000 058 SOO Do DDD Dor Oo 0950 50500007 1 Hoooo oo ooo as 00 g DODODO DOGO QO CO 2 o 05 D0 07 0000 ooo o Do JE aaa B min ma ooo o ODS SASSO s EV EST ET EST ooo 8 00 042900050 00 o Os Os DD Do 5 2 d OS NS OD QD a COD Console config jumbo frame Console config 40000000000 124 ip http port 000 Teroo000 00000 00000 ip http port port number no ip http port 0000000000000000 655350 000010 00 0000000 Global Configuration Console config ip http port 9 Console config 000000 ip http server ip http server M p000000000 a a a Oc oog oog oog oog Oo HH HH FJ ip http server no ip http server 0000000 Enabled e 0000000 Global Configuration D Console config ip http server Console config 000000 ip http port 43000000000 125 H show startup config
115. 5 ip default gateway 159 0 0 0 0 Gateway IP Address MAC Address NA Read Only show system 129 SNMP 33 SNMP Community 33 Community String public RO string 1 32 snmp server 132 private RW community Access Mode Read Only Read Only Read Write 200 600000000 00000 00 00000 D CLI 000 Trap Managers 34 Trap Manager IP None 00 255 snmp server host 134 Address Trap Manager None string 1 32 Community String Enable Authentication Enabled Enabled snmp server enable 135 Traps Disabled traps Security 35 Password admin string O 8 username 122 0000005 Flash File 37 Firmware 37 Transfer Operation Code Image File to Server TFTP Server IP 0 0 0 0 0 255 copy file tftp 115 Address Source File Name file name of string 1 0 31 current code Destination File Name None string 1 0 31 Transfer Operation Code Image File from Server 37 Current Operation NA string 1 20 show version 130 Code Version TFTP Server IP 0 0 0 0 0 255 copy tftp file 115 Address Source File Name None string 1 0 31 Destination File Name currentcode string 1 31 file O E o Remove Operation Code Image File File Name current string 1 0 31 delete 116 opcode file El o Start Up Operation Code Image File 37
116. 52 Switchport port channel STA Trunk Information See STA Port Information 49 STA Port Configuration 52 Type NA Read Only show interfaces status 150 Priority 128 O 255 bridge group priority 168 Path Cost 4 1 65535 bridge group path cost 167 Fast Forwarding Port 1 10 enabled bridge group portfast 169 enabled disabled 0 0 D Port 11 13 110 13000 disabled Trunk NA Read Only show interfaces status 0 5100000000 203 a E CJ D H ES uai Hu CLI uut 00 STA Trunk Configuration See STA Port Configuration 52 Bridge Extension 53 Bridge Capability 54 Extended Multicast No Read Only show bridge ext 171 Filtering Services Traffic Classes Enabled Read Only Static Entry Individual Yes Read Only Port VLAN Learning IVL Read Only Configurable PVID Yes Read Only Tagging Local VLAN Capable No Read Only Bridge Global Settings 54 Traffic Classes enabled Read Only show bridge ext 171 GMRP disabled Read Only GVRP disabled Read Only Priority 55 Port Priority Configuration 56 Default Priority 0 0 7 switchport priority 172 default Number of Egress 4 Read Only show queue cos map 4 Traffic Classes Trunk NA Read Only show interfaces 152
117. 6 ms r3 Console o CJ a 000000 interface 5 43000000000 g 161 4 3 9 Mirror Port D O port monitor poddg000000000000000000000000000000000 D ID no 0 DU D D UD D U 00 port monitor interface rx tx both no port monitor interface interface ethernet 00000 um OOOOOO000000000 1000 por D OD 0 Rg0000000000000 000000000000 00 both D D DD 0000000000 00000 OD 0000000 0000000000 go000000000000 00000000 Interface Configuration Ethernet 000000000000 000000000 DO DO DO DO O C3 rc OOOO L3 L3 C3 OOo O OOO OOo a a a a a a a a a a a a a El HDH a a a O a a a a a a a H a a a a a a a O a a a a El a a a OOOO OOOO OOOO OOOO OOOO OOOO OOOO OOOO OOOO OOOO H H L3 Oo 10000000000 O O HJ a DO 000 O HD O 000 000 Console config interface ethernet 1 11 Console config if port monitor
118. B7FH 0521 01 PRIMERGY BX300 44 gt Z L F CO FUJITSU DUDU 0000 2002 9 C3 C3 C3 E3 E3 E3 C3 OO og a aa Y EST ETE A Fe aa EGG GWAA ELE C3 C3 E3 E3 E3 C3 L3 C3 C3 C3 C3 C3 E3 E3 E3 E ME Ee NE NA e ES NG ET ESI EI ENEE on e n3 C3 C3 E3 E3 E3 C3 E3 E3 C3 L3 C3 C3 G a G Ooo Ooo Ad E3 C3 L3 EEE ERA 410 011 501 rad za C3 C3 E3 C3 BEY C3 C3 E3 E3 E3 C3 O aH L3 C3 C3 E3 C3 OER nuu aa E aan E EER NG ec EIGI E aga E3 L3 C3 C3 E3 C3 aj san a ft E TEZ E BRA O aH BEY EEE J rama i san aza ms D ETE DH C3 C3 C3 E3 E3 E3 C3 Ooo rad
119. D D O D O D LB O D D D O D D D D D D D D 00 OO 0000000 Privileged Exec H 00000000000 10 VLAN 10 OOOO0000000000dO Console show bridge 1 multicast vlan 1 igmp snooping VLAN M cast IP addr Member ports Type Console 43000000000 g 191 B 4 3 16 Broadcast Storm Control M p000000000 broadcast frame count rate no broadcast rate 000000000000 0000000000000 0 0000 00000 160 640 1280 256 0000000 Disabled 0000000 Global Configuration Broadcast Storm Control 0 IPD Oooo OOO L3 c3 c3 rc COOC L3 L3 c3 c3 r3 40000000000000000000 Console config broadcast frame count 64 Console config 4 192 5 SNMP Contents 5 1 SNMP
120. D D O O DO D D D O O O O O D D D D D D D D o oo aS COD p oo 20590 0 anna o H HE Se a 3 pu oo eee OP DDDD go oo Too DD at oo Sogo oooooo ga oo Poyo oo Dodo ga oo Poyo oo Dodo ga oo Pogo pr oo Fogo 200000 oF oo 205054 200000 pH BE A 000000 y oo Code aaa ef o EXE Saba ASA H El gt EZ Er oo Foes 200000 oo 3 Tose y 225500 lt oo 5 Pos Y 5 Bd zd 5 oo 3 Dog gg 2250000 Tf oo D 0025 225500 So oo E OE oooooo0 O oo Don E O ma 5 a Do El a a H Oooo DOO r3 oo 2 SA oo a o ia E ooo EE a E oo gt amam Ag EXER ee E E oo Oo00007 onoo000000 o 0000 0 DD NANO DON LO S a SES SOO oe coo sa Bana AO Aa a AL 5 000008 0 0500 BEFECIEHAJE LOA O nmammuru urumuuuunuuuuumuugyurnu D ABBAR DDDDDDD EI AA Sere ee H 40000000000 172 00 Console config interface ethernet 1 3 Console config if switchport priority default 5 H queue cos map SHOOOOOU000000000000 cosh 0 P000 000000000 DO DO I no D HOD BU DD D queue cos map queue id cos1 cosn no queue cos map queue id D DO D D DD D D D U ID 3000 3 00000 Cosi 000
121. DD oo ALE tale ga 800000000 O CO OO OOO OR 000000 50 a r3 zr CODE DIE ooo CJ oo oO SARA ASS SAO A jenjem cos eon cl mami a E EET e D L3 a a NA ooo H a O O CJ NG o AE co 55 310000000000 Web O Priority OOOO O O O Trunk Priority Configuration O O O Port Priority Configuration D D D D O D D D D D D D D O HO D D O D D D D D D D D D App 0 000000000 Trunk Default Priority Number of Egress Traffic Classes Port Default Priority Number of Egress Traffic Classes Trunk lb en 2 p e 4 3 0 en 4 4 on 4 5 6 on 4 e CLI 000000000 3000000000000000000 50000000 000 Console config interface ethernet 1 3 144 Console config if switchport priority default 5 172 56 3000000 Weighted 3 102 OPO 0000000000000 Fair Queuin 57 D 000 310000000000 UL 000 100 l 00010 Queue uu mad 80000 00000 DD 00000 3030000 coso 070
122. DU DD U Jumbo Frame Support Status Enabled 1 e CLI D jumbo frame D D D O D O O O D O D O B O D D D D O D D D O O D D D DUU 124 Console config jumbo frame Console config 30000000 36 36 000000000 WT IPITPUDDUODUUDUDUDDUODUDUDDUODUDUDDUODUDUDUO DUU 00000 00000000 Trrrpg00000000000000000000000 DODBO0 0 DD 00D 0000000000000 000000000000 poda ooo go DO 000000 00000000000000 0000000 pogo 200 000000001000 0000000000000000 00000000000 000000000 10 31000 00000 e 20000 3 6 1 CJ a a CI EJ a a DUDU UU Destination File Name 00 D D 00 OOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOO O Web Flash File Firmware FrPOOOO OOOO Transfer from Server Transfer Operation Code Image File from Server Current Operation Code Version 0 2 0 14 rre Server IP Address 10 1 0 99 source File Name V10 bix Destination File Name C v02014 y10000 Transfer from Server
123. File Name current code string 1 0 31 boot system opcode 118 file Configuration 38 Transfer Configuration File to Server TFTP Server IP 0 0 0 0 00 255 copy file tftp 115 Address Source File Name Factory string 1 31 Default Config cfg Destination File Name None string 1 31 6100000000 201 uu CLI uut OU 00 Transfer Configuration File from Server 39 copy tftp file 115 255 0 0 0 0 0 TFTP Server IP Address Source File Name None string 1 31 Destination File Name None string 1 31 Remove Configuration File File Name None string 1 0 31 delete 116 Start Up Configuration File 39 File Name current config string 1 0 31 boot system config 118 file Copy Running Config to File 40 File Name None string 1 31 copy running config 115 file Reset None None NA reload 113 Address Table 41 Dynamic Addresses 41 Query by All All show bridge 154 Interface MAC Address VLAN Address Table Sort Key Address Interface Address VLAN Dynamic Address 0 Read Only NA Counts Current Dynamic NA Read Only show bridge 154 Address Table Static Addresses 43 Static Address Counts 0 Read Only NA Current Static Address NA NA show bridge 154
124. GC 167 bridge group IC 167 path cost bridge group IC 168 priority bridge group 00000000 FastFowarding 400000 IG 169 portfast show bridge PE 170 group 000000000000 106 400000000 4 2 11 Bridge Extension O 0000 DO coo 000 show bridge OOOO 00900 00000 RE 2 ex 4 2 12 Priority 0 OOO 0000 O E OOO OOO switchport 0000000000000000000000000 Ic 1 2 priority defaut OOODOODO000000000000000000 queue cos 173 map oo show queue PE 174 4 cos map show PE 152 interfaces switchport r3 o o 4 2 13 VLAN OOO o o H r a OOOO OO ud Hd o vlan database VJANDD O O DO D O O O O HDD VLAND O O D D O GC 175 vlan VIDODDUDUDUDDDVLANDDUDDDUDUU VC 176 interface vlan P000 GC 177 sw
125. ONDO 000000 00000000 000SsTagoo 0000 op0000000000 O Fast forward 0000000000000 OD 00000 da a000 000000000000 OOO 10 100 0 Enable 0000000000 E Console config interface ethernet 1 5 Console config if bridge group 1 portfast Console config if B 43000000000 E 169 H show bridge group 00 show bridge group bridge group interface bridge group 000000000000000 10 interface ethernet unit port mi 00000000000000 1000 pori D B DD J port channel channel id 10000000 e 0000000 UU 0000000 Privileged Exec AN Console show bridge group 1 ethernet 1 11 Bridge group information 170 Spanning tree protocol ieee8021d Spanning tree enable disable enable Priority 32768 Hello Time sec 2 Max Age sec 20 Forward Delay sec 15 Designated Root 32768 0000e9000066 Curent root port s13 Curent root cost 4 Number of topology changes 469 Last topology changes time sec 2167 Hold times sec 1 Admin status enable STA state broken Path cost 4 Priority 128 Designated cost 4 Designated port 128 11 Designated root 32768 0000e9000066 Designated bridge 32768 0000e9000066 Fast forwarding Forward transitions Console disable 0 40000000000 4 3 11 Bridge Extension O
126. Oooo mada ooo oooo no doo noo no CO no CO no rc c5 rc ms HA eS SA rc run rc run rcrum os oo a oO 0500 a co a a CH Ogon DODODIDIDIDIDIDIE CH EXC ETE a co a oz jan A og oo a af e CH CSO DODODIDIDIDIDIDIE 0500 ELEILELIEJE EE ea r andan a o r aan ana aaa nooo pEipmuiuuuunuiunrurt ooog a 3 EEE E ooog ric run rcrum 1060505000 a ooog a ooog jen o sc A s 00 64 HABA A OOOO EBAGI EA E ce DD 3 ran Ma lt Ooo B lt IDDIE B IEEE 802 1D0 00000 IEEE 802 1D MUUU ELE a CH CH un Bra i a E CH DAA Ooo CH
127. SNMP po 000000000000 0000000 None a a O Privileged Exec unu x 0 a a EJ a OO 3 ELE oOo O a a E Console show snmp SNMP traps Authentication enable Link up down enable SNMP communities 1 private and the privilege is read write 2 public and the privilege is read only 0 SNMP packets input 0 Bad SNMP version errors Unknown community name Illegal operation for community name supplied Encoding errors Number of requested variables Number of altered variables Get request PDUs Get next PDUs 0 Set request PDUs 0 SNMP packets output 0 Too big errors O 00 O CH O o No such name errors Bad values errors General errors Response PDUs Trap PDUs oo SNMP logging disabled Console 43000000000 g 181 H snmp server community DU D Simple Network Management Protocol 0000 Mrpg00000000 po000000 snmp server community string ro rw no snmp server community string string 000000 D D DO DO EL EEE DO DO DO e 00 DU public 0000000000 MImpDUDUDDUUDUDUDUDUDU DO private 000000000000 00000 0000000 Global Configur
128. STPO OO BPDU 100000000000000000 Console config interface ethernet 1 Console config if switchport ingress filtering Console config if H switchport acceptable frame types UDUUDUUDUUDUUDUUDUUDUUDUUDDUUDUDUDDUUDU OO switchport acceptable frame types all tagged no switchport acceptable frame types adOOOOOOOOOOOOOOOOOOOOOOOOOOOOOO tagged D D D D D O D D DO D D B O D DO B O D D D D 00000000 all 0000000 Interface Configuration Ethernet Port Channel 000000000 0000 BD UD ut Lr switchport moe 000000000000000 4 178 10000000000000000000000000 Console config interface ethernet 1 Console config if switchport acceptable frame types tagged Console config if 000000 switchport mode H switchport mode B switchport mode trunk hybrid
129. Static DefaultVlan Active Eth1 1 Ethl 2 Eth1 3 Ethl 4 Eth1 5 Eth1 6 Eth1 7 Eth1 8 Eth1 9 Eth1 10 Eth1 11 Eth1 12 Eth1 13 2 Static Active Eth1 1 Eth1 2 Eth1 13 Console 3 11 VLAN l 67 CJ a a CJ E a a 3 115 DODODO DO 000 000000000000 0000000 Interface 00000000000 IDU Member VLAN Non Member VEAND Web D VLAND 0 O VLAN Static Membership by Pot 0 D O 000000000000 00 Pont O 00 Trunk go000000000000000 VLAN UD LANID Q 0000000 00000 000000 Remove D D D D oooOoooooooooo VLAN D Apply U 000000 lt Il L3 p3 Bes BJ DO DO D ul DO DO Interface Port 3 Y C mud Query Member Non Member Man 1 Vlan 2 Add Remove e CLI 00000000 300000000000 30 vLan20 000000000 Console config interface ethernet 1 3 144 Console config if switchport allowed vlan add 1 tagged 180 Console config if switchport allowed vlan remove 2 68 3000000 PVID ae VLAN IDO wok OO00000000 EE 42 13 B switchport model 19 00000000000 Dodd po 0000000000 PVip 0000 aman
130. UD show bridge group bridge group aging time bridge group D 000000000000 10 e 0000000 UU e 0000000 Privileged Exec D Console show bridge group 1 aging time Aging time 300 sec Console 156 M 40000000000 4 3 8 IPOOOO IPUDDUODUDDUODUDDUODUDDUUDUO DUU Oooo Oooo Oooo E oog oong a a a E O O L3 O H ip address ip address netmask bootp dhcp no ip address B ip address PO OOO OOOO POND 00000000 000000000000 DUDUDUDUDUDUDUDUDUDUDUDUDUDUDUDUDU ooo bootp BOOTPO IPD D D OD DUDU dhep DHCP IPD D D UI U IP D 0 0 0 0 netmask 255 0 0 0 00000000 Interface Configuration VLAN 000000000 00000000 000 T BOOTP 0 0 DHC 000 1Pgo00000000 255000 4000000000000000 DO 00000000000 BOOTP 00 DHCPOOOOUOUUOO pod00000000000000000000000000B00TP DHCP Pgod00000000000000000000000000 00000000000 lt dhcp re
131. UDUDUUDUDUUDUDUDUDUUDUBDUUDUUDUUDUUUDUDUUDUDUDD DUDU None 43000000000 g 113 114 O dtt Global Configuration 0 O O Privileged Exec D O D O 09 CH 0008000000 0000000 Console config exit Console exit Press ENTER to start session User Access Verification Consoles Wout None Normal Exec Privileged Exec DBDnaDnapnaun D quit exit 0000000000000000000000000 O Console quit Press ENTER to start session User Access Verification Console gt 40000000000 4 3 2 F lash File 0 O O copy 00000 FahQOOO TFrPpg000000000 poddo0 0000000 0000000000000 pod 000 000000000000 00000 TFIPp000000 a L3 L3 C3 L3 C3 L3 L3 L3 L3 L3 L3 L3 L3 C3 L3 C3 S L3 C3 L3 E ES Es Be ET EZ L3 L3 OOo yoo DO D FTP HEO DU D copy file file running config startup config tftp copy running config file startup conf
132. assword level 15 7 1b3231655cebb7a1f783eddf27d254ca a a E El a HH a CJ E a vlan database vlan 1 name DefaultVlan media ethernet state active 1 interface ethernet 1 1 capabilities symmetric no switchport broadcast switchport allowed vlan add 1 untagged switchport native vlan 1 43000000000 127 interface vlan 1 ip address 10 1 0 1 255 0 0 0 1 1 l line console line vty end Console 000000 show startup config H show logging UU D show logging flash ram fliasppo000000000000000000000000000000 DO ram 00000 RAMDUDUDUDUDUDUDUDUDUDUDUDU e 0000000 None 0000000 Privileged Exec E Console show logging flash Syslog logging Disable History logging in FLASH level errors Console 128 MN 40000000000 H show system 0000000 None 0000000 Normal Exec Privileged Exec D Console show system System description Unicorn Intelligent Switch System OID string 1 3 6 1 4 1 259 6 10 39 System information System Up time 0 days 0 hours 55 minutes and 54 91 seconds System Name Switch System Location Boston System Contact Charles MAC address 00 00 e8 00 00 01 Web server enable Web server port 80 POST result a
133. ation 000000000 O snmp server community D D 00000000000 SNMP SNMPv1 0 O O 000000 no snmp server community 0 DD D D O SNMP D D D D D O D KN Console config snmp server community alpha rw Console config 4 132 H snmp server contact M p000000000 Oo Oo HH HO HDH HH AE HH HH Oc Oc HH oog oog ENE snmp server contact string no snmp server contact string 0000000000000000000000255000 e 0000000 DO 0000000 Global Configuration Console config snmp server contact Paul Console config 000000 snmp server location H snmp server location 00 p000000000 00000 00000 OO snmp server location text no snmp server location te 25 e 0000000 UU ANDIN Global Configuration gt NM Console config snmp server location WC 19 Console config 000000 snmp server contact 43000000000 133 H snmp server host DoO000000000U0 t Simple Network Management Protocol 00000000 OD 0000000 000000000000 000000000000 s db snmp server host host addr community string no snmp server host host addr host addf 00000000000000 P0D0000000000 000000000 50000000000 community string D D D D D 000
134. bled capabilities 148 10 000 10 Capabilities ooo 1000f 1000f 10 uu 110 OOO 110 13 10h f 10h f 100h f 1000f 13 100h f 1000f Trunk Member NA Read Only show interfaces 152 switchport port channel Trunk Configuration See Port Configuration 82 Broadcast Control 84 Broadcast Control disabled enabled broadcast 192 Status disabled Threshold 16 frames 16 64 128 256 pps 5100000000 207 ug OU CLI u ut 00 Mirror 85 Mirror Sessions none Read Only show port monitor 163 Source Port 1 10 13 port monitor 162 Target Port 1 10 13 Type Rx Rx Tx Both Trunk 86 Member List none Read Only show interfaces status 150 port channel Trunk 1 Read Only interface port channel 144 Port 11 11 12 channel group 183 Statistics 87 Interface ODO 1 000 10 13 show interfaces 151 0000 1 counters 208 BSUOUUUUUUU e Contents HOUUUUUUUOO 1 7 OOUOO000000000g DU O720000000000000M gt 20000000000000000 OO CJ 3
135. dd 00000 0 00000 000000 000000000000 tr 3102 9908000800000 00000000000 0 gt 570000 000 0 GMRP GARP Multicast Registration Protocol DO 0000000000000 Dodd 00000 0 00000 000000 0000000000000 000000000 GmrPgo0000000000 Internet Group Management Protocol IGMP D D D D DO DO O D O D O D D D O D D D D 0000000 hd GVRP GARP VLAN Registration Protocol GVRP D D Hd BH B O dH D B D D DI I 3900000000000 53 54 Web O Bridge Extension DO D D D D D D D Bridge Capability Extended Multicast Filtering Services No Traffic Classes Enabled Static Entry Individual Port Yes WLAN Learning ML Configurable PVID Tagging Yes Local VLAN Capable I No Traffic Classes E Enable GMRP Enable GVRP F Enable e CLI Console show bridge ext Max support vlan numbers 32 Max support vlan ID 4094 Extended multicast filtering services No Static entry individual port Yes VLAN learning IVL Configurable PVID tagging Yes Local VLAN capable No Traffic classes Enabled Global GVRP status Disabled GMRP Disabled Console 171 30000000 310 00000000
136. dl OOU000 VLAN vlan id 1050 VLANQ 5 VLAND D DD DB go 0000000000000 Console config vlan database Console config vlan vlan 105 name RD5 media ethernet Console config vlan 000000 show vlan VLAN 1 DefaultVLAN D D D D D O D D D D D O D 176 40000000000 B interface vlan interface vlan vlan id 10000 VLAN 000010 440000000000000 OO 00000 la x IS EI 00000 al Configuration D VLAN I N0000 po0000000000VLANO POO OGE QO CO CH 2 DU DU 00000 Console config interface vlan 1 Console config if ip address 192 168 1 254 255 255 255 0 Console config if 000000 shutdown H switchport ingress filtering 000000000 000000000 000 O no 0010 000000000 0000 s KH switchport ingress filtering no switchport ingress filtering 0000000 DO 0000000 Interface Configuration Ethernet Port Channel 43000000000 B 177 D a OOOO gt T Oo L pod00000000000000000 VLANI O podd000000000000000 D 0000 0000000000000 uat 00
137. e notification Authentication failure D D 0 D 0 STA root change notification STA root change 000000 STA topology change notification STA topology change 0000000 RMON rising alarm notification RMON rising D D ED O D D D D D D RMON falling alarm notification RMON falling 8040000000 Device over heat O 100 Uniti Port YY 00000 10000 NON 1 88000000 O 20 VLAN 0 O VLAN ID value XX 1 40940000000 212 S 00000000000 172 55 173 113 Bana Sa SANG 5 E N io SE s x ig I 6 I P boi ob Pt a E CO in io noo HR O ooo o o Pc BA H ipm O man H oo des ooo H GA O Bae o CODE io ooo o DIGAE O ooo o onoooo ipn ooo o CODE o ooo El aj ara 3 e a oo NGA D o D CODE D HE D man SAANG m a e E 58 1 N 5 Pl Keren Dues che wt c Eod 2 b H r Pio ie PP Pii d Pim Pig pi o ki PPP Pj i P in o ki PP iid im aa o ki Po bb bd io ma o ki Ll i bd io o0 io PPP o pop SE ooo B k E SES ooo EE 2 ooo io ooo AA Sie See SES AA oo imm ooo QO Oo HG man AANO oo ooo FAAR SABRI OE EIER EAT CODE 000 oooo0oogo CODE onoooooo noooooooo CODE D HARGA D EHAO 213 E 11 199 8 AE AAA BOE NN ED m 55 172 E Br ne oreet AN Da 11 a Baal eR e 87 KAN TAMA NE
138. erface E RE 105 42 7 Address Table El E T gaan its 105 42 8 IP ET E E E eec tb e d dete bee E 106 4 2 9 Mirror Port Dr 7 Eis rrr i rrt 106 4 2 10 Spanning Tree sese 106 4 2 11 Bridge Extension O O 107 2 2 T2 Priority dl ll et ete teet eer 107 42 13 VEAN E FO sese oet te v iO NBA 107 4 2 14 Port Trunking H ana la gg Ska NA SAN PA a a aa aa 108 4 2 15 IGMP Snooping an 109 4 2 16 Broadcast Storm Control O O 109 A A AA 110 4 31 General J EL lia sabes 110 4 3 2 Blash Eile i E E E e iet ta 115 4 3 3 System Management O eere 119 43 4 SNMP HI E nfi eee una ee t eot etre eec 131 Ske DIT Eae aet KA DAAN maana tera etes 136 4 3 61nterface HIR E Rr arre eret 144 4 3 7 Address Table T 153 4 38 IP EL HF El a ce ee ite emite it ee etes 157 4 3 9 Mirror Port 7 Pr E D 162 4 3 10 Spanning Tree E 164 4 3 11 Bridge Extension O 171 4 3 12 Priority U U LE rettet 172 4333 VEAN ett t Te te a etie 175 4 3 14 Port Trunking O O 183 4 3 15 IGMP Snooping O O eese 184 4 3 16 Broadcast Storm Control
139. et 0000 40000000000000 0000 4 1 2 00000000 O username 0000000 0000 9000000 000000000 0000000 ODUUDUUDUUDDUUDUUDDUUDUDUDDUU OOO CC 2 D configure D O D D Ente O O O D O D D O O 3 Privileged Exec 1 0 0 D 0 0 0 O username admin password 0 password 0 0000000000 password NA D O D D O D D U 0080000 Enter 00000000 D Normal Exec D D 00 opy running config startup config O D D D O O OD D D O D D OD O O I o n OO OC OO Oo KA o capo 000000000000 000000000 0000 79000000000000000000000000000 0000000000000000coy 0000000000 DD 94 40000000000 4 1 3 IPD D D HL E D D urggunagapnunnuapupnpn uapBaupnpDa P Ppo0000000000000 gab 00000 0000000 O A A oOnoooo E33 EL ce kanan ES r od g A o 000000000
140. g Bal ERE ES AO cod ma oon g 2 6 Bas HEM S aaa HE E BE Se oo Dc EE SBS H S SOS ma SE OO 9092 madah nooo nooo nooo 5 SNMP I O l 194 52 0000 LI o Q o gt rTF MIB ID D MIBO D RFC D 0000 UD 1213 MIB II system group interfaces group ip group icmp group tcp group udp group snmp group 1493 Bridge MIB dot1dBase group dot1dStp group dot1dTp group dot1dStatic group 2863 Interfaces Evolution MIB ifXTable group ifStackTable group 2819 RMON MIB statistics group history group alarm group event group 2665 Etherlike MIB dot3StatsTable group 2737 Entity MIB entityPhysical group 2674 P bridge dot1dExtBase group dot1dPriority group dotidGarp group 2674 Q bridge dot1qBase group dot1qTp group dot1qStatic group dotiqVlan MB00000 0000 00000 unicorn MIB 01 00 00 52000000 MIB 195 bi D D dNNS 53 MIBUOUOUUUUUUUUUU MIpUDUDUUDUDUUSNMPDDUDUDUDUDDDDUDUDUDODUUDUDUDODUUDUDUU 00000000000 PotMg 00
141. g interface ethernet 1 12 Console config if channel group 1 Console config if end 150 Console show interfaces status port channel 1 Information of Trunk 1 Basic information Port type 1000t Mac address 22 22 22 22 22 2c Configuration Name Port admin status Up Speed duplex Auto Capabilities 10half 10full 100half 100full 1000full Flow control status Disabled bi Current status Created by User Link status Up Port operation status Up Operation speed duplex 1000full Flow control type None Member Ports Eth1 11 Eth1 12 Console 0000000 316 00000000000 Interfaces Group MIB Ethernet like MB D D D O D O O O D DO D O O D D D D O OOOOOOOOOOOOOOOOOORMONMBOOOOOOOOOOOOOO 00000000 OC Interfaces MB Ethernet like MIB B H1 D O O O D O D 1 D Dodd 00000 000000 000000 000000000000 0000 Dodd 00000 000000 000000 000000 000000000 RMON QOOOO 203 SNMP oooo9 OOOO 9090000000000000 87
142. ging OOO O O O O O O O PE 128 show system NE PE 9 show users Telnet OO00000000000000000 1PO00 NE PE 129 paa 0000000 0000000000000 Telnet 80000000000 show version NE PE 0 4200000000 103 4 2 4 SNMPOOOO 0000 ut OOO show snmp NE PE 1 GC 132 community snmp server GC 133 contact snmp server SNMPI OD 000000000000 GC 134 host snmp server 00000000000 00000 GC 133 location snmp server 000 SNMPO OD 000000000000000 GC 135 enable traps 425 Line I 0000 O d OOO line GC 136 login 0000000000 000000000000 LC 137 password LC 137 exec timeout LC 138 password LC 139 thresh silent time 00000000000 passwordthresh A 0000000 LC 140 00000000000000000000000000 databits pao 008000000000 1000000000 LC 140 wiy oooon 0000000000000 GC
143. how ip igmp snooping 190 mrouter Interface ODO 1 000 10 13 ip igmp snooping vlan 185 mrouter 1 0000 VLAN ID 1 1 4094 IP Multicast Registration Table 77 VLAN ID 1 1 4094 show bridge multicast 191 Multicast IP Address none Read Only Multicast Group Port none Read Only List IGMP Member Port Table 77 IGMP Member Port List none Read Only show bridge multicast 191 Interface Port 1 Port 1 13 ip igmp snooping vlan 6 static 00001 VLAN ID 1 1 4094 Multicast IP NA x x x x O 255 206 600000000 ug OO CLI u ut 00 Port 80 Port Information 80 Name none Read Only show interfaces status 150 Type NA Read Only Admin Status enabled Read Only Oper Status NA Read Only Speed Duplex Status 1000full Read Only Flow Control Status none Read Only Autonegotiation enabled Read Only NA Trunk Member NA Read Only show interfaces 152 Switchport port channel Trunk Information See Port Information 80 Port Configuration 82 Name none string 1 64 description 146 Admin Status enabled enabled shutdown 145 disabled Speed Duplex NA 000 10 10 speed duplex 146 1000f OOd 110 13 10h f 100h f Flow Control disabled enabled flowcontrol 149 disabled Autonegotiation enabled enabled negotiation 147 disa
144. ies 10half 10full 100half Broadcast storm status Disabled Broadcast storm limit 0 counts frame Flow control status Disabled Lacp status Disabled Current status Link status Up Port operation status Up Operation speed duplex 100full Flow control type None Console 100full 1000full 31300000 81 CJ a a CI EJ a a 3132 00000000000 EJE Trunk Configuration Port Configuration D O D D D O D D D D I I 00 man o CDD NO E ooo oO oo ES man o NONG oo a g man CH DD oo SS noo o ia a a oo man o NONG oo SE ooo CDD oon 5 H o NANA D Has o ooo o NON ao AGE man m o DD aa 5 ooo o oO oo o D ooo o o DD pru ooo o O DD oo aga ca ooo CH O oo o ooo o o DDDDDc Do Hao o man o a an a AA 200 ULO o ooo o naaa a E L El o ooo o x EXEC E EHE O HR o ooo o oo Hau o ooo o og 20 nau o nooo o nA IEEE Hau r3 nooo r3 Ep o COD mn o aaa oo oana o COD o O aaa aa Oooo E HO E o 000708 O00 DE r3 rcr r3 o oo oo oO o oooO o oo 404 o HARA EE ap a ES ct ELE Oooo o nooo oo HEHHTA o 0000 OO 4s O0 000000 O00 H o nooo 00 0 DODODO OO o o nooo 400 Sa
145. ig tftp copy startup config file running config tftp copy tftp file running config startup config file running config D D D D D D D D O O O O D D O B O D O D D D D D D D D 000 D 00000000000000 DD L ifpoTFPeOOOOOOOOOOOOOOOOOOOOOOOOOGO 0000000 None O O O a O DO DO 000 podd0000000000000 OOO startup config 0000000 DU 000 000 000 BOO TFrPpg00000000000000 0000 00000 5g 2 a e dg ES 43000000000 g 115 e D UDUODUTPIPDUDDUODUDDUODUDDUOUDUO DUU Console copy file tftp Choose file type 1 config 2 opcode lt 1 2 gt 1 Source file name startup TFTP server ip address 10 1 0 99 Destination file name startup 01 Console UDUODUUDUODUUDUODUUDUODUUDUODUUDUOD DU Console copy running config file Destination configuration file name startup Write to FLASH Programming NWrite to FLASH finish Success Console UDUODUUDUODUUDUODUUDUODUUDU Console copy tftp startup config TFTP server ip address 10 1 0 99 Source configuration file name startup 01 Startup configuration file name startup Console
146. itchport 177 ingress oo filtering switchport 178 acceptable ooogg frame types switchport 00000000 179 mode og switchport 000000000000000 Ic 180 allowed vlan switchport 000000 PVD 00000 MANO d D U D IC 181 native vlan og switchport 0000000000000 VANDO000000 Ic 181 forbidden vlan 4200000000 B 107 0000 OO 000 000 show vlans VLANDDDDDDDDD NE PE 181 show OOOO NE PE 150 interfaces status vlan 4 2 14 Port Trunking OOO 0000 O O unt uu interface port GC 144 channel 000000000 channel group O00000000000000 IC 183 show 0000000000000 NE PE 150 interfaces status port channel 108 40000000000 4 2 15 IGMP Snooping O00 UD DO Ui Wolo lo ip igmp IGMPPOO000000000000 a 184 snooping ip igmp poo0Do0000000000000000 GC 185 snooping vlan mrouter ip igmp snooping vlan static ip igmp snooping querier ip igmp GC 187 snooping query count GC 186 D liemPpod000000000000000o GC SE B ip igmp
147. j DO r3 Oooo ooo IC aa 5 prp HD oo oo NON ia a AO DO El O EJ CI Ole e e LL E EJ OOO OO OC onooo E ESEEST EI EI COOC O EG L3 CDD DC 5 ENE C3 C3 E303 C3 jeni an AR mz CO ma an gos noona Ea EE s Sg A r1 H O OOO 00000000 Factory Default Config cfg D HH D D D U OOO OM boot system T 1189000000000 boot system OO 000000 N 211 74 OUUUUUU zz N0000 System coldStart notification System warmStart notification pogo o 00000000000 Du Unit 1 Port YY link up notification Unit 1 Port YO B D D D D D D D D Unit 1 Port YY link down notification Unit 1 Port YY O D D D B D D D U Du Trunk 1 link up notification Tunk100000000000000 Trunk 1 link down notification Tunk TO 0000000000000 VLAN XxX link up notification VLANXX D D D D D D D D D D D D D D VLAN XX link down notification VLANXX D D D D D D D D D D O Authentication failur
148. l D D D podd00000000000000000 D Telnet Web 8000000000000 H Ooo DUDU Ouest 0 guest admin 15 admin CI a gt D figuration D SEE Fae ONE L3 L3 C3 C3 OOOO L3 L3 C3 C3 CH Lic EFJ aco Console config username bob access level 5 Console config username bob password 0 smith Console config H hostname pod0000000000000000000000000 o hostname name no hostname name 000000000255000 UUUDUDUD None Global Configuration D Console config hostname Server Chassis 35 Console config 43000000000 123 H Jumbo Frame DO jumbo frame no jumbo frame ooo Tana GD Og OE a gado E oo 0540090 BA CDD a O y Sy ano O5j00o0 8 os CDD Og aa a a Do Sano Sano Fc pg ED ono CDD 059
149. m aja rni lt gt PAB o show bridge NONONO 000000000000 PE 194 bridge group GC 155 aging time show bridge PE 156 group aging time 4200000000 gy 105 428 IPOOOO oooo Oo ooo 000 ip address 0000 IC 157 ip dhcp restart BOOTPO 00 DHCPOOOOGG0000000000 PE 158 ip default GC 159 gateway 00000000000000000 show ip 0000 PO00000000 PE 159 interface show ip PE 160 redirects ping icermgoo000000000000000000000 NE PE 160 4 2 9 Mirror Port OOO 0000 00 ooo D d port monitor 000000000000000 IG 162 show port PE Tes monitor 4 2 10 Spanning Tree O 0000 Oo ooo bridge GC 164 spanning tree bridge forward AA O OO O OO O OO 900010 GC 165 time bridge hello 00000000000000000 GC 165 time bridge max 00000 GC 166 age bridge priority QOO0000000000000000
150. m IJ Eien HAR ooo Ooo r3 L3 L3 r3 DUDU 0000 DUDU 036200000000000 13 180000 14 2 AUEREN SE EJ Contents 2 100 OO ia SE are Ae tee 16 2 2 1000BASE T NEI DDR 17 2 3 1000BASE T Mal o A 19 2 4 TOOOBASE T DH OH 0 LET eee Ret 20 2 agan c3 00005 ogo ooo 00005 SSB 00005 rib rip num ooo e e BAD O00004 ooo ram SE E rna SE COU EE o900 z soos of oo SEE EE EE r3 ooo ondo a Sa Es red oo00 ooo jala ooo EXEJEJ Al ooo cnr T ooo c3 ooch c3 en o c3 o 00000 00000 00000 00000 DODOMA 00 AA EEE GOGA a a J El a a 2000000000 16 1000BASE 2 2 000000000 0000 unu un EE ooo z mang ooo DODOR ooo DIESETE 9 ooo cobol DOT Son H oo nonum EIE oo amp fesse 8886 o HAO 5 1000Mbps D 00000000
151. me startup startup2 0 Console config Console config boot system config startup2 0 118 Console config exit Console reload 113 cupodo0000000000000000000000 OOOO 9000000000000000000000000000 0 Web 00000000 Copy to File D Copy Running Config to File File Name 051902 ctg Copy to File e CLI Console copy running config file 115 destination file name 051902 cfg Console Console config Console config boot system config 051902 cfg 118 Console config exit Console reload 113 30000000 UND DD NN NN 3 7 c El EJ El E D D El D D D 3 3 7 1 D MAM DH DD UU D VLAN J O Web Address Table Dynamic Addresses O T Interface MAC Addressl D D 0000000000 Query DU DUU DUU DU Query by gt Pon 11 zl C Trunk M Interface MAC Address Tal F VLAN Address Table Sort Key Address y Query DUUDUDDDBDDBDUDUDD
152. n DO QO LQ interface T line T vlan database ED D 00000000000 OOU000 Console config i T Console config lineH T Console config DD 0000000000000 DD II tL Endl D 0000000 Privileged Exec D D D D D D D D Console config interface ethernet 1 5 config if exit config line console config line Console Console Console OOOOOOOOOOOOOOOOOOOOOOOOOOOOOO pad add ga oda ag 000000000 0000000000 OOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOO Og Og D Ctrl 0 AD 10000000000 O Ctrl 0 BO D Ctrl 0 ED 10000000000 O Ctrl 0 FO O Ctrl 0 PO PO 0000000000 O Ctrl 0 UN 10000000 D Ctrl 0 WO NOD 0000000000000 Delete 0 O O O O NOD 0000 000000000000000 Back Space 100 40000000000 42 WT I 000 Spamning Tree 107 107 Bridge Extension Pri
153. o S Pipe CE TA a oo ooo mad EJ e TERE UNAN ma Ag man des Ee M m aie a 9 oO mad mad des E NG ini oo mad mad HA a a oo mad man oOo Pond ono 004 Oooo E o0 10 00 H lt alam H oo J nog O00 iE agan oo Coc 3 oo EES peo oes COCO aoaoga HD mr L3 oo 000 HABA Ng Dir L3 C3 E3 C3 C3 C3 EJ oo 00 P EE SS Se a ENE DOO Hoo ipmpmmggduadg ood O O ec a fe Ja gana a H CC D lt O 00 H AG F z Se OSO SOO 4300007200200 r3 o gada HEO o E ie Zoe on a PG AK MO cs nn t A O gt 1120002022 eu Z 6 6 40 Een oi en Ee ei eo poo A eegen een Mag fen Aan O S lt e e e ci c ci c c o v Soe EE e que eer Elsa uu Beete eh 3 noo E E Os a o aw b 4 tuo pz oo A Hoo Ced eno eo eo en cn cn c en cn cn cn eo en en 91 A h alip L E a ua m xii 4 1 1 CLI O Be Ee a aa agak 92 4120 MAO Be Eo usus l v MATANG BA oe Ae 94 El AENEAN E ET 95 A E EE BN eee tet 96 a 2E TUE E ET sss ya m ebat 101 4 2 I Generah O E E Hasle s ee e ee verde 102 4 2 2 Flash FEile PPE E ettet hh et 102 4 2 3 System Management O 103 424 SNMP T E E B asia IBANAG a DA aa ER DA BENE eed 104 42 5 Lane E E b ssk Rr OE REED 104 4 2 6 Int
154. o Oo oog aa oog Oo EE bridge group bridge group priority priority no bridge group bridge group priority bridge group 000000000000000 10 priority D D D D D D DD 0000000000000 2550 00000000 128 00000000 Interface Configuration Ethernet Port Channel e 000000000 DON 0000000000000 000000000000000000 Dodd gg 00 00 0000 000000000000 00000000 Dodd g 000 00 0000 0000000 0000000000000 Dodd 0000 00 0000 000000 0000000000000 20000 000000000000 000000 Dodd 0000 0 0 0000000000000 e CH Console config interface ethernet 1 5 Console config if bridge group 1 priority 0 Console config if 168 40000000000 H bridge group portfast fast forward D 0 D 0 D fast forward po0000000 0000000000 gt bridge group bridge group portfast no bridge group bridge group portfast bridge group D D D D D D D D D D O D O O D 10 0000000 OOO 10 10000 000 ug 13800 00000000 Interface Configuration Ethernet Port Channel 000000000 DOD0 000000000000 00000000 Fast Forward D D D pad 0000 000000 0000000000 Blocked Listening Learning O OU UD D Forwarding D D D D D D D D opodg000 000000000000 Fast forwadQ 00000000 PN P
155. oe oo El Ooo R KA B Ogun EE r3 Du oo E Ou EE Du oo Dog oo oH Oy E JE EJ Co oo oH sad oo DS SHO oo cat oo Es Go oo Goo oo oa oo EVE Ap H gt O oo oo or g oo oo COOC EZE AG agea oo oo oga Boog oo 5 o Oro GS oo Doo goons oo Oooo gt POD san 2800 oppe SD Doo goons goo TA HO goo 2000 2 2 DO Y nono 6 oo 73 312000000000 74 D0000000000000000000000 IGMP G 0000 D0000000000000000 IGMP Report Delay O IGMP Query Timeout D D O OO 00010 Web IGMP O IGMP Configuration D D 000000000000 IGMP O D 0000 App IGMP Status F Enable Act as IGMP Querier F Enable IGMP Query Count 2 10 2 IGMP Query Interval 60 125 11125 seconds IGMP Report Delay 5 30 10 seconds IGMP Query Timeout 300 500 300 seconds IGMP Version 2 CLI Console config ip igmp snooping 184 Console config ip igmp snooping querier 187 Console config ip igmp snooping query count 10 187 Console config ip igmp snooping query interval 100 187 Console config ip igmp snooping query max response time 20 188 Console config ip igmp snooping query time out 300 189 Console config ip igmp snooping version 2 189 Console config e
156. onsole show system System description System OID string System information System Name System Location System Contact MAC address Web server Web server port POST result Console tname R amp D 5 Console config snmp server location 9 Console config snmp server contact Paul Unicorn Intelligent Switch 1 3 6 1 4 1 259 6 10 39 System Up time 0 days 2 hours 16 minutes RED 5 WC 19 Paul 22 22 22 22 22 22 enable 80 Performing Power On Self Tests POST UART LOoopback Test V naa PASS Flash Memory Checksum Test PASS CRU SEE TEBE EE EEN PASS MPC850 clock Timer and Interrupt Test PASS WatchDog Timer and Interrupt Test PASS ING E NAN Ba Ng inners PASS PLX9054 Access Test PASS BEM Chip pest A id PASS Switch Driver Initialization PASS Switch Internal Loopback Test PASS DONE and 22 59 seconds 123 133 133 129 30000000 322 0000000 O00000 Serial Number D D 000000000000 Number of Ports DO D D D D D D D D uu Hardware Version JO D D D D D D D D D O D O D O D D D D D Internal Power Status D D D D D D D D D 00000000 Loader Version OO D O D D D D D D D D D 00 Boot ROM Version D 0000000000000 Operation Code Version Y 000000000000000 Role 000000 Master D
157. oo o o o ooo o Ee o o Go o O og o ooo o On ooo o AG o ooo E o H On ooo amp o o o og 200 E o o o Oo o Hoa x ES o o og man o H H H 92 o ooo o o o o oo o ooo o o o o oo ooo o o o o oo o ooo o a eee CH oo ooo o mo r3 o oo man o SC go amp naa O A o ooo 80 SO go CO CIE o coe E m Br ooo o So SO Soo 50 ZC o 3 o0 5 DEBES 200 CID ran AKONG 40000720 Spanning Tree State 000000 45 38 sooo o nu EI aq Se Ei SEXES ENESETME gaa ET a 95 p200 nmguururu E 5 og2200 o E rm El og2000 GE 295000 0 0 DD o Ens Gool CH RES o EX o Kam era ES O59 5900 o SOG o o o 054 200 Doc o DOA o o o Og EIS Og p ric CIC 0 a Od Doc DD EJ Casa El A DOA o o D Doc a 0 CDD SAANG o a AB 9 9900 COD o 055005 065 E o D o o g220 Bia o Zopp Q DOO o 0 8559200 o4 Et ajan jen ke gt ES 5 2 FARE o 2 o7 32000 m 000p o gt 59 oS Sooo lt m Bes Soe pap OS HAE ah mang H gt
158. ority General privileged D 0000000000000000000 102 00000 8 Flash File 102 System Management Q000000000000000000000000 103 8 SNMP 104 Line 104 Interface 105 Address Table 00000000000000000000000000 105 nooooonooonoooooooooooooon o 00 2 IP 00 106 00 000000000000000000000 00 o o HN NAAN AY us ale nfl Es oF de YY CT Ka Z SHE ngi YS NE e asi e Pas A AE Sasa MES 195 a gt III m PCI E E Z oE E EI E ez E ooolol o VLAN asana ET 5 lt 9 anag 2 JB Z III EJ EJ EH EH E3 EH EH DEI Port Trunking IGMP Snoopig o 1 u oO 111 oo a oo CIE III D I IDDIE ARK CHIC E c3 B IDDIE IC CHIC E c3 B par jp IC E AG E31 C3 III EI E3 AR EI
159. rface ethernet 1 10 144 Console config if port monitor ethernet 1 13 162 Console config if 3140 00000000000 85 L3 GAL 315 00000000 00000000000 11m Trunk 1 1 Port New Appt lt lt Add Remove VLAND D OO D CoSD D D D D O DO DO D D D O DO 0010 0 1200 110 STP VELAN D D D DU sup 2000000000 1000000000 N oo ad DD ZY SE Member List Current Q Trunk O Trunk Configuration 000000000 Trunk D D D D 1 D ED 10 Web e CLI 3151 30000000 86 podp00000000000000000000000 200000000 Console config interface ethernet 1 144 Console config if channel group 1 183 Console config if exit Console confi
160. st 0 Number of topology changes st Last topology changes time sec 9736 Hold times sec 1 Admin status enable STA state blocking Path cost 4 Priority s 128 Designated cost 4 Designated port y 128 1 podBo00 0000 000000000000 00000 0000 D Curent root port Curent root 0000000000 380 0000000 UD l 47 5 O Web STA O STA Configuration 0 D D D D D O D D D O D O D D O D D O D D D D Apply 000000000 Switch Spanning Tree State Enabled y Priority 32768 When the Switch Becomes Root Hello Time 2 seconds Maximum Age 120 seconds Forward Delay 15 seconds e CLI UUUUDDUDUUDUDUDDUUDUDUDDUODUDUDDUODUDUDUDUDDHU 000000 Console config bridge 1 spanning tree 164 Console config bridge 1 priority 40000 167 Console config bridge 1 hello time 5 165 Console config bridge 1 max age 40 166 Console config bridge 1 forward time 20 165 48 30000000 3 8 2 m DON ooch Do Dg ra ABA On ng COOC D Dol COOC 4 35005 oo0p0000 oooo E 209202 SAHARA COOC e 5 m oop0op
161. sta D D D D D O D O O O OD D D OD OO OO D D DD OD O O 0010 El H 43000000000 157 IP DODO p D S oH 000000000 VLANIN OD DD N00 DN Console config interface vlan 1 Console config if ip address 192 168 1 5 255 255 255 0 Console config if 000000 ip dhcp restart ip dhcp restart po00000000000B00TPp po 0000000 UU 0000000 Privileged Exec 000000000 DROD D D O O O D D D D O O O O D D D D D D OO DO D D DU BooTPO 00 lt gt S Console show ip interface IP address and netmask 10 1 0 54 255 255 255 0 on VLAN 1 and address mode Dhcp Console configure Console config interface vlan 1 Console config if ip address dhcp Console config if exit Console ip dhcp restart Console show ip interface IP address and netmask 10 1 0 54 255 255 255 0 on VLAN 1 and address mode Dhcp Console 000000 ip address 158 gAUIDDUDUDUDUUUUI ip default gateway I no 000 Oo UUUUDDUUDUUDUUDUUDUUDUUDUUD UD
162. t acceptable 178 Type tagged frame types Ingress Filtering disabled enabled switchport ingress 177 disabled filtering GVRP Status disabled Read Only NA GARP Join Timer 20 Read Only NA centiseconds GARP Leave Timer 60 Read Only NA centiseconds GARP LeaveAll Timer 1000 Read Only NA centiseconds Trunk Member NA Read Only show interfaces 152 switchport port channel VLAN Trunk Configuration See VLAN Port Configuration 69 5100000000 205 uu OOO OU la al la uu CLI poo 00 IGMP 72 IGMP Configuration 74 IGMP Status disabled enabled ip igmp snooping 184 disabled Act as IGMP Querier disabled enabled ip igmp snooping 186 disabled querier IGMP Query Count 2 20 10 ip igmp snooping 187 query count IGMP Query Interval 125 60 125 seconds ip igmp snooping 187 query interval IGMP Report Delay 100 5 30 seconds ip igmp snooping 188 query max response time IGMP Query Timeout 300 300 500 igmp snooping query 189 seconds time out IGMP Version 2 102 ip igmp snooping 189 version Multicast Router Port Information VLAN ID 1 10 4094 show ip igmp snooping 75 Multicast Router List NA Read Only mrouter Static Multicast Router Port Configuration 76 Current NA Read Only s
163. t native vlan PIDO DOO vegg0 000000 Mrpg00000000 switchport native vlan vlan id no switchport native vlan vlan id D 0000 VLANIDII J NO 10 40940 00000 00 D D 000000 e 000000 VLAN 1 0000000 Interface Configuration Ethernet Port Channel 000000000 PVIDO 000 00000000000 acceptable frame types Y O all O O DJ O O switchport mode hybrid 000000000 PVDP 000000000000 00000000 0008000000 0000 000 DU B 000000000 10 Pv VLAN3Q 000000000000 Console config interface ethernet 1 1 Console config if switchport native vlan 3 Console config if H switchport forbidden vlan 000000000000 forbidden QO UVLANQOD000000 forbidden D D D D O D O D D D DD nol 000000000 du switchport forbidden vlan add vlan id remove vlan id no switchport forbidden vlan add vian id OOOO VEAN OO remove vlan id D 00 VLANO OQ 000010 40940 0000000000000000 M0 43000000000 g 181 0000000 forbidden 0 D 00 VEAND D D D D O OD D DUU 0000
164. type None Console 4 150 show interface counters OO show interfaces counters interface interface ethernet unit port 1000 pol 00000 port channel channel id 0000000 DO e 0000000 Normal Exec Privileged Exec D Console show interfaces counters ethernet 1 11 Ethernet 1 11 Iftable stats Octets input 19648 Octets output 714944 Unitcast input 0 Unitcast output 0 Discard input 0 Discard output 0 Error input 0 Error output 0 Unknown protos input 0 QLen output 0 Extended iftable stats Multi cast input 0 Multi cast output 10524 Broadcast input 136 Broadcast output 0 Ether like stats Alignment errors 0 FCS errors 0 Single Collision frames 0 Multiple collision frames 0 SQE Test errors 0 Deferred transmissions 0 a a E El a CJ a CJ El a Late collisions 0 Excessive collisions 0 Internal mac transmit errors 0 Internal mac receive errors 0 Frame too longs 0 Carrier sense errors 0 RMON stats Drop events 0 Octets 734720 Packets 10661 Broadcast pkts 136 Multi cast pkts 10525 Undersize pkts 0 Oversize pkts 0 Fragments 0 Jabbers 0 CRC align errors 0 Collisions 0 Packet size lt 64 octets 9877 Packet size 65 to 127 octets 93 Packet size 128
165. u oo aaa o B HOO HE oo O EXE3 HO SO oo A Sree O oon goooo a oo 3 ra a i O CDD HOO qu oo O ooo o oo HOO a oo B AA m CDD HOO BE oo HEGGA O oo Hodo a oo ra H ma HOO E oo CD o EES on mn oe Ea Eg EJ odas 200150 oO gao qu COD DCH a a lt no sanan qu O ama ooo a HEV ZE EES qu COD DCH ooooo gt noo SIDD CDD ooooo o GGG ZA GOO zo BERA B ARE H noo gt CH COD DCH 9 o OOO x onoono COD ooooo o oo S SABAHA ou O Dona os os ESTE ee o o BEGJ AB a Soo mamas ooooo o AA AA mim 2 40000 noo 5 5 o acota Hoo gt 0000 gt a r3 IEEE 802 100 00000000 3200 VLAN 000 DU po00000000000 59 3 11 VLAN l gm VLANDDDDDBODOU Sea 050400000 nos nos CDe DO ID 0005050000000 L3 wen E C3 E EE EE EESTI Eres Ee ENE EE EEE E e 0000000000 e 000000 VLAN e 3000000 60
166. ue ID Traffic class wW Console 174 40000000000 4 3 13 VLAND D D O H vlan database podd0000000000000 Kay vlan database D D 00000000000 VLAND D D g g O E S g 63 E o n 2 Os HE E DOS og o Bl EJ imanam o AA wara aa ro rn Console config vlan database Console config vlan 00000 show vlan 175 43000000000 M p000000000 OO OO OO OO OO OO OO e 00 vlan vlan id name vlan name media ethernet state active suspend no vlan vlan id name state vlan name 0000 VLAN ID OO 10 0000000000 00000000 name VIAND D D HH D D B 0000 vlan name 100 32000 ASCH O O media ethernet JO D D D D D O D D D O U stat VIAND 00000000000000 active VIAND D D D D D D D D suspend D D D D D O B VLAND D D O D D D B D D D D I DO 0000000 0000000 VLAN Database Configuration no vlan vian id I D D D D D D D UD D VEAND D D D D D D HI no vlan vlan id mame L1 H1 B 1 B O D U VEAN D D O D D D D no vlan vlan id state 0 D D D D D D D D D VLAND D O D O OLD UB D D 0000000000
167. xec D 0 0 O Privileged Exec 00000000 spell D HB D D OD DO H Console enable Console O00000 disable enable password 110 B40O0U0U0U0U00000 B disable 00000000000 privileged O 000 Normal Exec D 00000000 u ut normal 000000000000000000000000000000000 privileged O O 1 000000000000 u None U DUDU Privileged Exec po0go00000000000000000000000000000000 Do0o0 gt 2000000000 E Console disable Consoles E a CJ O00000 H enable a a MW configure o a a 000000000 0 0 O Global Configuration D D D 0000000000000 Interface Configuration Line Configuration VLAN Database Configuration 000000000 000000000000 Global Configuration 0 40000000000 4140 000000000 00000000 800000000000000 None Privileged Exec e 0 Console configure Console config 000000 end 43000000000 111 H show history pod 000000000000 000000000000 0000000 DO 0000000 None ooo Normal DO DO DU xec Privileged Exec DU 100000000 10000000
168. xit Console show ip igmp snooping 190 Igmp Snooping Configuration Service status Enabled Querier status Enabled Query count 0 Query interval 100 sec Query max response time 20 sec Query time out 300 sec IGMP snooping version Version 2 Console 3000000 3122 DODODO DO DO 0D 0000000000000 0000000 Query D D D DD DD D 010 oo oo oo oo oo oo oo oo oo oo oo oo oo oo cogo o0 4H Doc cc uH o o0 uH pags Det o rc uH o HE G oo a M condo L3 c3 c CODE WUUIUUDUDUDDUUUUDDDDUDUUUUDUOUDDUUUID 0000000 VLAN ID 00000 VLAN ID 10 409411 ca Multicast Router List UUUDUDUDUDUUDDDUDUUUODUUUDDUDUDUUDDDUUUUODUD O OOOOOOOOOOOOOOOOOOOOOOOOOOOOO H OOOO Web D IGMP O Multicast Router Port Information 0000000000 00000 VLAN ID 1 Multicast Router List Unitl Port11 Static Unitl Port13 Dynamic oo L1 oo HE oO oo oo Console show ip igmp snooping mrouter vlan 1 190 VLAN M cast Router Port Type 1 Eth 1 11 Static 312000000000 75 WUUIUUDUDUDDUUUUDDDDUDUUUUDUOUDDUUUID o H R 6 p

Download Pdf Manuals

image

Related Search

Related Contents

Brûleur gaz à air soufflé Gasventilatorbrander  HP Fiber-Optic Hub Plus Reference Guide  dreamGEAR iGlowSound  modules in an S7-300  Sandero Sandero Stepway MANUAL DE  取扱説明書 - 日立工機  MANUALE UTENTE  ASUS PU551LD User's Manual  Dear Sir/Madam,  

Copyright © All rights reserved.
Failed to retrieve file