Home

massXpert User Manual

1. ATGC oligonucleotide is fragmented according to pattern a but with nucleic base decomposition and that fragmentation occurs at position 1 then the computation of the mass should occur like represented in Figure 6 10 on the next page This figure illustrates a number of things amongst which some known basics The panel on the top right hand side shows the constituents of the DNA polymer chemistry definition the caps are OH on the left end and H on the right end the circled formula is the skeleton also called backbone and the base attached to the deoxyribose ring singularizes the nucleotide That base might be adenine guanine cytosine thymine In the dna polymer chemistry definition the monomers are made of the skeleton formula C5H8O5P plus the formula of the base which is understandable Using a generalizable specification Now if we want to compute the mass of the a B 1 fragment that is fragmentation occurs according to pattern a right after the A monomer plus decomposition of the base in our case this is an Adenine we have to Apply the specification for a fragments that is remove one oxygen the O component of the formula Remove one full monomer with Side chain set to 1 this equals to the removal of both the skeleton and the side chain the adenine here Add back the skeleton the C5H805P component of the formula As for a fragments the end of the polymer sequence that gets included in
2. Figure 6 11 XpertDef fragmentation rules definition Each fragmenta tion rule is defined using a name a formula and a local logic that is a set of logical conditions which must be verified for the fragmentation rule to be applied to the fragment Using a monomer specific specification Another way of achieving what was described above is by using fragmentation rules whereby the fragment s mass computation is made conditional to one or more conditions that should be verified Figure 6 11 shows how the a B fragmentation pattern might be defined using fragmentation rules The a B fragmentation specification comprises 4 rules one rule for each available monomer in the dna polymer chemistry definition A T G and C The figures illustrates the definition of the fragmentation specification a B which stipulates that the mass of the fragment should be computed this way For the fragmentation specification part everything is like for fragments of type a that is the formula is merely O and the end is LE see above for explanations But there is one rule a B c which adds some Local logic for the frag mentation specification the formula C4H403N should be applied upon calculation of the fragment s masses if the monomer at which the frag mentation actually occurs is of Curr code C that is if it is a Cytosine The C4H403N formula is the formula of Cytosine the base not the monomer The other rule
3. Let s key in once more the key This time only two items are highlighted Asp and Asn in the code completion monomer list panel 2nd This is easy to understand there are only two monomer codes that start with the two letters A and s As that we have keyed in so far At this time we key in a last character At this point the monomer is effectively inserted in the polymer sequence as the Asp monomer left of the cursor as shown in panel 3rd UNAMBIGUOUS SINGLE MULTI CHARACTER MONOMER CODES Let s imagine that we have a polymer chemistry definition that allows up to 3 characters for the definition of monomer codes but that we have one of these monomer codes let s say the one for the Glutamate monomer that is one letter long E This monomer code is the only one in the polymer chem istry definition to start with an character In this case when we key in E well observe that the monomer code is immediately validated and that its corresponding monomer vignette is also immediately inserted in the polymer sequence This is because if there is no ambiguity XpertEdit will immediately validate the code being edited The mechanism described above means that the user is absolutely free to define only single character monomer codes in a polymer chemistry definition the behaviour of the program is thus to behave exactly as if the multi character code feature was in
4. lt name gt Acetylation lt name gt lt formula gt H C2H30 lt formula gt lt targets gt K lt targets gt lt mdf gt lt mdf gt lt name gt AmidationGlu lt name gt lt formula gt OH NH2 lt formula gt lt targets gt E lt targets gt lt mdf gt lt mdf gt lt name gt AmidationAsp lt name gt lt formula gt OH NH2 lt formula gt lt targets gt D lt targets gt lt mdf gt lt mdf gt lt name gt SulfideBond lt name gt lt formula gt H2 lt formula gt lt targets gt C lt targets gt lt mdf gt 149 lt mdf gt lt name gt Carbamylation lt name gt lt formula gt H CONH2 lt formula gt lt targets gt K lt targets gt lt mdf gt lt mdf gt lt name gt CarboxyMethylation lt name gt lt formula gt H CH2COOH lt formula gt lt targets gt C lt targets gt lt mdf gt lt mdf gt lt name gt ProtonLoss lt name gt lt formula gt H lt formula gt lt targets gt C lt targets gt lt mdf gt lt mdf gt lt name gt Chromo O lt name gt lt formula gt 0O lt formula gt lt targets gt T lt targets gt lt mdf gt lt mdf gt lt name gt Chromo H lt name gt lt formula gt H lt formula gt lt targets gt G lt targets gt lt mdf gt lt mdf gt lt name gt Chromo H3 lt name gt lt formula gt H3 lt formula gt lt targets gt Y lt targets gt lt mdf gt lt modifs gt lt crosslinkers gt lt clk gt lt name gt Disulf ideBond lt name gt lt fo
5. lt name gt N term NH2 lt name gt lt pka gt 9 6 lt pka gt lt acidcharged gt TRUE lt acidcharged gt lt polrule gt left_trapped lt polrule gt lt chemgrouprule gt lt entity gt LE_PLM_MODIF lt entity gt lt name gt Acetylation lt name gt lt outcome gt LOST lt outcome gt lt chemgrouprule gt lt mnmchemgroup gt lt mnmchemgroup gt lt name gt C term COOH lt name gt lt pka gt 2 36 lt pka gt lt acidcharged gt FALSE lt acidcharged gt lt polrule gt right_trapped lt polrule gt lt mnmchemgroup gt lt mnmchemgroup gt lt name gt Lateral COOH lt name gt lt pka gt 3 65 lt pka gt lt acidcharged gt FALSE lt acidcharged gt lt polrule gt never_trapped lt polrule gt lt chemgrouprule gt lt entity gt MONOMER_MODIF lt entity gt lt name gt AmidationAsp lt name gt APPENDICES 155 lt outcome gt LOST lt outcome gt lt chemgrouprule gt lt mnmchemgroup gt lt monomer gt lt monomer gt lt code gt E lt code gt lt mnmchemgroup gt lt name gt N term NH2 lt name gt lt pka gt 9 6 lt pka gt lt acidcharged gt TRUE lt acidcharged gt lt polrule gt left_trapped lt polrule gt lt chemgrouprule gt lt entity gt LE_PLM_MODIF lt entity gt lt name gt Acetylation lt name gt lt outcome gt LOST lt outcome gt lt chemgrouprule gt lt mnmchemgroup gt lt mnmchemgroup gt lt name gt C term COOH lt name gt lt pka gt 2 36 lt pka gt lt acidcharged gt FALSE lt acidcharg
6. pKa pH pI Perform acidity pH and isoelectric point calculations on the whole sequence or on the current selection Options Options Decimal places Set the number of decimal places to be used to display the numerical values EDITING POLYMER SEQUENCES As described earlier in the chapter about the XpertDef module a polymer chemistry definition may allow more than one character to qualify the codes of 75 massXpert Sequenc Save Ctri S SaveAs Ctri Ak S Import Raw CtrH Export to Clipboard Export to File Select export file Figure 8 4 The XpertEdit window File menu This figure shows the File menu as dropped down menu in the polymer sequence window massXpert Sequence Editor protein 1 Ehemisry Modify Monomer s Ctrl M M Modify Polymer Ctr M P Fragment Ctrl F Mass Search Ctrl M S Compute m z Ratios Ctrl M Z Determine Compositions Ctrl D pKa pH pl Pm mews Figure 8 5 The XpertEdit window Chemistry menu This figure shows the Chemistry menu as dropped down menu in the polymer sequence window 76 CHAPTER 8 XPERTEDIT Avg 90 1012866803 File Edt Chemistry Calculation Engine Sequence Name Sequence 30 Monomer List Whole Sequence Mono 3 250 4553406400 Avg 3 252 4765044865 Selected Sequence Mono 90 0555035200 Avg 90 1012866803 Gly Glycne Ala Alanine Val Valine Leu Leucine llezisoleucine S
7. 117 cross linker dictionary file establishing the relationship between any cross link and the graphical svg file to be used to render graphically that cross link onto the cross linked monomers in the sequence editor pka ph pi xml file describing the acido basic data pertaining to ion izable chemical groups in the different entities of the polymer chemistry definition The polymer sequence editor is not a classical editor There is no font in this editor when the user starts keying in a polymer sequence in the editor the small svg graphics files are rendered into raster vignettes at both the proper resolution and screen size and displayed in the sequence editor The user is totally in charge of designing the svg graphics files for each of the monomers defined in the polymer sequence editor Of course reusing material is perfectly possible There is one constraint that the monomer dictionary file lists with precision what code goes with what svg graphics file That file has the following contents for example for the protein 1 letter polymer chemistry definition as shipped in the massXpert package This file is part of the massXpert project The massXpert project is released in its entirety under the GNU General Public License and was started in the form of the GNU polyxmass project at the Centre National de la Recherche Scientifique FRANCE that granted me the formal authorization to publish it unde
8. Conveying Non Source Forms You may convey a covered work in object code form under the terms of sections 4 and 5 provided that you also convey the machine readable Corresponding Source under the terms of this License in one of these ways a Convey the object code in or embodied in a physical product in cluding a physical distribution medium accompanied by the Cor responding Source fixed on a durable physical medium customarily used for software interchange b Convey the object code in or embodied in a physical product in cluding a physical distribution medium accompanied by a written offer valid for at least three years and valid for as long as you of fer spare parts or customer support for that product model to give anyone who possesses the object code either 1 a copy of the Cor responding Source for all the software in the product that is covered by this License on a durable physical medium customarily used for software interchange for a price no more than your reasonable cost of physically performing this conveying of source or 2 access to copy the Corresponding Source from a network server at no charge c Convey individual copies of the object code with a copy of the written offer to provide the Corresponding Source This alternative is allowed only occasionally and noncommercially and only if you received the object code with such an offer in accord with subsection 6b d Convey the object code by of
9. LC 1 x fragment series For this series of fragments we do not add the left cap anymore but replace it with the right cap since the fragments hold the right end of the precursor polymer Note also that the numbering of the monomers using the variable 7 in the following mathematical expressions goes from right to left contrary to what happened for the a b c fragment series All the fragments that hold the precursor polymer right end are numbered this way so this applies to fragments z y z The mass calculation is mathematically expressed zi RC 3 Mi c CO 1 y fragment series The calculation is mathematically expressed 1 29 z fragment series In low energy CID the z fragments are expressed this way 1 which is equivalent to y N H3 in high energy CID an additional proton is often measured 1 immonium fragment series These fragments are internal fragments in the sense that they do not hold neither of the two precursor polymer s ends massXpert understands that the user is speaking of this kind of fragment when the from which end piece of data in the fragmentation specification states NE in stead of LE or RE see page 52 The mass calculation for these fragments does not take into account the monomers surrounding the one for which the calculation is done The mass for an immonium ion at position i in the pre cursor poly
10. Polymer Left Cap If checked the left cap of the polymer sequence will be taken into account Right Cap If checked the right cap of the polymer sequence will be taken into account Note that if Force is checked also then the mod ification is taken into account even when selecting a region of the sequence that does not encompass the left end monomer Left Modif If checked the modification of the polymer sequence s left end will be taken into account Note that if Force is checked also then the modification is taken into account even when selecting a region of the sequence that does not encompass the right end monomer Right Modif Same as above but for the right end modification Selections and regions Multi region If checked the sequence editor allows more than one region to be selected at any given time no limitation on the number of selected regions 72 CHAPTER 8 XPERTEDIT massXpert Polymer Sequence Editor kunitz inhibitor human mxp File Edit Chemistry Sequence name Kunitz inhibitor 32 2 mizratios Whole sequence Mono 38 960 8796232000 Avg 38 986 1030276344 Selected sequence Mono 3 132 4505584400 Avg 3 134 4356518506 Incomplete cross links 0 Polymer modifications Left end Right end E E Calculation engine Polymer 40125220 iOzTmPAO0XOEo T OmBo V Left cap Right cap Left modif C Force Right modif S
11. pair 107 108 CHAPTER 9 XPERTMINER massXpert mz Lab protein 1 letter Working lists Default ionization Perform matches between two input lists Input 1 list Input 2 list Unitary Formula Unitary charge 1 Tolerance Account Modifications H Tonization level 1 amu 1 Multipl Substrate list and modality Inuti Input 2 Perform computation in place Actions Apply Formula Apply mass Threshold Onmjz value On M value Apply threshold New list Delete list Ctrl D Figure 9 1 mzLab window The mzLab window is the central location of the laboratory From there it is possible to open any number of m z list dialog windows See text for details The mzLab window is represented in Figure 9 1 This window is divided into three distinct parts The left part Working lists contains two list widgets which will hold the names of the different working m z lists The central part contains A group box widget Default ionization where the ionization rule for the current polymer chemistry definition is detailed A group box widget Actions on a single list with a number of actions that might be performed on one list of m z ratios The right part contains a group box widget Perform matches between two input lists in which the user may perform matches between lists of m z ratios CREATING A NEw M Z LIST In order to be able to use the mzLab featur
12. 99 have a net charge near to zero The pH value for which a given polymer sequence has a net charge near to zero typically this means that the number of positive charges equals the number of negative charges is called the isoelectric point the pl Such computations are pretty computer intensive and require a very precise knowledge of the chemical structure of the different monomers that take part in the definition of the polymer chemistry A file called ph is located in the polymer chemistry definition directory This file lists all the chemical groups that are possibly charged each monomer of the polymer definition is represented by a lt monomer gt element in which data are defined for any chemical group of that monomer that might bear a charge at any given pH You can find the listing of the pka_ph_pi xml file in chapter 11 on page 123 We ll discuss any aspect of this file s contents in the next sections with enough detail that the user will be able to write one such file for her specific polymer chemistry At the moment two entities in the polymer chemistry definition might have chemical groups bearing charges monomers and modifications We will first review monomers and modifications next IONIZED GROUP S IN MONOMERS Monomers are the building blocks of polymer sequences These blocks must have at least two reactive groups so that they can be polymerized into a polymer sequence thread Reactive groups are o
13. During fall 1999 I decided that I would stop using Microsoft products for my development At the beginning of 2000 I started as a CNRS re search staff in a new laboratory and decided to start fresh I switched to GNU Linux I never looked back After some months of learning I felt mature to start a new development project that would eventually become an official GNU package GNU polyxmass The GNU polyxmass software much more powerful than what the initial massXpert software used to be was published in BMC Bioinformatics in 2006 Rusconi F GNU polyxmass a software framework for mass spectrometric simulations of linear bio polymeric analytes BMC Bioin formatics 2006 226 Following that publication I got a lot of feedback very positive in a way along the lines Hey your software looks very interesting only it s pity we cannot use it because it runs on GNU Linux and we only use MS Windows and MacOSX 2007 In december 2006 I decided to make a full rewrite of GNU polyxmass The software of which you are reading the user manual is the result of that rewrite I decided to recycle the massXpert name because this software is written in C as was the first massXpert software Also because the first MS Windows based massXpert project is not developped anymore taking that name was kind of a revival which I enjoyed However the toolkit I used this time is not the Microsoft Foundation Classes first ma
14. This feature was required for the fragmentation of oligosaccharides and also some times for proteins When the fragmentation the bond breakage reaction itself occurs at the level of certain monomers it might be necessary to be able to specify some particular chemistry that would arise on the monomer in question We have seen in the cleavage documentation that upon cleavage of a pro tein sequence with cyanogen bromide for example a particular chemical reac tion had to be applied to the oligomers that were generated with a methionine monomer as their right end monomer Well in a fragmentation specification it is possible to apply comparable chemical reactions but in a more thorough man ner Indeed while in the cleavage it was possible to say something like apply a given chemical reaction to the oligomer if the right end monomer is Xyz in the fragmentation the logical condition can be bound not only to the identity of the currently fragmented monomer but also optionally to the identity of the previous and or next monomer in the precursor polymer sequence For ex ample Apply a given chemical reaction if fragmentation occurs at the level of Xyz monomer only if it is preceded by a Yxz monomer and followed by a monomer These logical conditions are called fragmentation rules A fragmentation specification can hold as many rules as necessary All of this is described in great detail at page 52 To SuM UP To s
15. We also have two ions of identical masses one bearing one charge 4 and the other one bearing two charges 29 or negative no matter in this discussion These two ions when put in the same electric field E will feel two different forces exerted on them F and F5 It is possible to calculate these forces qE and Fa 2qE Evidently the ion that bears two charges is submitted to a force that is twice as intense as the one exerted on the singly charged ion What does this mean It means simply that the numeric result provided by the mass spectrometer is not going to be the same for both ions since the physics of the mass spectrometer takes into account the charge level of each different analyte Our two ions weigh exactly the same but the mass spectrometer simply can not know that all it knows is how a given ion reacts to the electric field it is put in And our two ions evidently will react differently Interesting posting signed by Ken I Mitchelhill in the ABRF mailing list at http www abrf org archives and a document published by the California Institute of Technology 36 CHAPTER 4 BASICS IN MASS SPECTROMETRY When we say that a mass spectrometer measures a m z ratio the z in this ratio represents the sum of all the charges this is a net charge that sit onto the analyte But what does the m stand for The molecular mass No The m stands for the mass of the whole analyte ion which is in a wor
16. and 2 offer you this License giving you legal permission to copy distribute and or modify it For the developers and authors protection the GPL clearly explains that there is no warranty for this free software For both users and authors sake the GPL requires that modified versions be marked as changed so that their problems will not be attributed erroneously to authors of previous versions Some devices are designed to deny users access to install or run modified versions of the software inside them although the manufacturer can do so This is fundamentally incompatible with the aim of protecting users freedom to change the software The systematic pattern of such abuse occurs in the area of products for individuals to use which is precisely where it is most unacceptable Therefore we have designed this version of the GPL to prohibit the practice for those products If such problems arise substantially in other domains we stand ready to extend this provision to those domains in future versions of the GPL as needed to protect the freedom of users 165 Finally every program is threatened constantly by software patents States should not allow patents to restrict development and use of software on general purpose computers but in those that do we wish to avoid the special danger that patents applied to a free program could make it effectively proprietary To prevent this the GPL assures that patents cannot be used to rend
17. belong ing to D monomer located at the left end of a polymer sequence is modified permanently with an Acetylation left end modification it should not be taken into account when computing the charge that it could bring to the polymer sequence The second lt mnmchemgroup gt element is related to the aCOOH carboxylic group of the amino acid lt name gt C term COOH lt name gt Same remark as above 104 CHAPTER 8 XPERTEDIT lt pka gt 2 36 lt pka gt Same remark as above lt acidcharged gt FALSE lt acidcharged gt Same remark as above However as we can see the value indicates that the acid conjugate form COOH does not bring any charge This means that when the basic conjugate is predominant that is when pH gt pKa it brings a negative charge the form is lt polrule gt right_trapped lt polrule gt The chemical group should not be evaluated if a monomer is linked to it at its right side That means that the current chemical group is only evaluated if the monomer bearing it is located at the right end of the polymer sequence This is easily understood as the aCOOH chemical group is involved in the formation of the inter monomer bond towards the right end of the polymer sequence The third lt mnmchemgroup gt element is related to the carboxylic group of the amino acid lt name gt Lateral COOH lt name gt lt pka gt 3 65 lt pka gt lt acidcharg
18. create sequence 70 data filtering 96 editor window 73 elemental composition 97 mass alculation engine residual chains 72 mass calculation 71 selected region 71 whole sequence 71 mass calculation engine 71 cross links 72 ionization 73 left cap 71 left modif 71 modifications 72 multi region 71 multi selection 72 oligomers 72 right cap 71 right modif 71 mass searching 93 module invocation 70 monomeric composition 97 monomer code errors 77 monomer cross linking 87 multi character monomer code 76 multi region selections 81 open sequence 70 pH 97 pl 97 pKa 97 sequence editor sequence import 73 sequence editor chemical simulations 74 find sequence motif 74 79 keyboard selections 81 mouse selections 81 multi region selection 81 number display 74 sequence editing 74 178 sequence export 73 sequence import 79 simulations m z calculations 97 monomer modification 83 oligomer fragmentation 92 polymer modification 86 sequence cleavage 88 spectrum calculation 90 XpertMiner 107 114 available calculations 112 mining m z ratios 107 module invocation 107 new input list creation 108 one input list 112 tracing the data 114 two input lists 113 amino acid 17 app bundle 10 author 6 author address 6 Belghazi M 2 Bioinformatics 2 BMC Bioinformatics 2 bug reports 6 cleavage 23 CMake 9 CNRS 2 6 condensation 17 cracker 5 cyanogen bromide 23 52
19. data customization 115 desolvation 34 desorption 34 disulfide bond 49 finished state 16 fluorescent protein 49 format 40 file mxp 41 xml 40 fragmentation 23 25 nucleic acid 29 protein 26 Free Software 3 free software 5 INDEX Free Software Foundation 4 General Public License 5 GNU polyxmass 2 4 6 hacker 5 installation 7 GNU Linux 7 Mac OS X 10 MS Windows 10 isotopic peak 64 ldd 8 m z calculator 63 massXpert app bundle 10 mass spectrometer analyzer 34 ion source 34 mass spectrometry 33 MinGW 11 monose 21 non reducing end 20 nucleic acid 18 left right caps 19 left right ends 18 phosphodiester bond 19 nucleotide 18 polymer chemistry 15 protein 17 amide bond 17 left right ends 17 left right caps 18 Qt libraries 3 relocation 7 11 residue 17 Rusconi F 2 saccharide 20 left right caps 21 left right ends 20 reducing end 21 sugar bond 20 trans esterification 19 Trolltech 3 INDEX units atomic mass unit amu 35 dalton Da 35 mass to charge ratio m z 35 unified mass scale 35 user manual 13 179
20. instruct that the background of the button should be of the lawngreen color while the text label should be of the black color These buttons might be used in two distinct ways Upon clicking the button its formula is evaluated and the corresponding masses are added to or subtracted from the Result Masses Upon simultaneous clicking the button and keeping the key pressed its formula is inserted into the Formula line edit widget In this case the formula is not evaluated and the Result Masses are not modified The last feature insertion only of the formula in the Formula line edit widget is of particular use when computing masses of complex polymers for which one might desire to have the full chemical formula stored before clicking the Apply button In the author s experience this feature is most convenient when calculating masses of complex branched glycans THE LOGBOOK RECORDER Each time an action that is chemically relevant from a molecular mass point of view is performed the program dumps the calculations to the XpertCalc recorder window Figure 7 4 The recorder can be shown hidden by using the Show Recorder check box widget The text in the recorder window is editable for the user to edit the XpertCalc output and selectable also so that pasting to text editors or word processors is easy via the clipboard THE M Z RATIO CALCULATOR It very often happens that the massist doing electrospray analyzes is faced with a
21. massXpert the massist s program Simulating and analyzing flying species Copyright 2007 2008 Filippo Rusconi massX pert version 3 1 0 User Manual This User Manual is distributed at http www massxpert org Filippo Ph D Charg de recherches au CNRS CENTRE NATIONAL DE LA RECHERCHE SCIENTIFIQUE UMR CNRS 5153 UR INSERM 565 USM MNHN 0503 Mus um national d Histoire naturelle 43 rue Cuvier F 75231 Paris CEDEX 05 France massXpert User Manual Copyright 2007 2008 2009 2010 2011 by Filippo Rusconi http www massxpert org This documentation and all its accompanying files are a part of the massXpert project They are software and are an integral part of the software they document The massXpert project is released in its entirety under the GNU General Public License and was started at the Centre National de la Recherche Scientifique CNRS Bordeaux FRANCE in the form of the GNU polyxmass software suite The CNRS granted me the formal authorization to publish GNU polyxmass under this Free Soft ware License Because massXpert is a derivative work of GNU polyxmass being a mere rewrite of the software using the Trolltech Qt libraries instead of the GNU lib gobject libgdk libgtk libraries it is also published under the GNU General Public License This software is free software you can redistribute it and or modify it under the terms of the GNU General Public License
22. 177883 1 0 537 31481 1 a 1 008 84404 3 662 366 1 662 366 1 0 Gia 324180193 1 5 331587 2 882366 1 0 pari a ne a0 8 221 461 3 662 366 1 0 R Newilist GREEN Delete lis Curd Mass type Mass type 288842 1 289342 1 0 Mono Avg Mono Aug Mass type Fragments Fragments Mono Avg Figure 9 6 mzLab s match operation output list dialog window text for details OUTPUT OF THE CALCULATIONS Calculations involving matches between two input lists produce an output that is displayed in an output m z list which is different from an input m z list Figure 9 6 shows the results after having performed a match operation between an input m z list obtained from the mass spectrometer Input 1 list and an input m z list obtained by simulating a cleavage with trypsin Input 2 list The output m z list dialog window holds all the matches along with the original data and the error TRACING THE DATA When the data used for filling an input m z list come from a massXpert based simulation it is possible to trace back the m z z pair items to the correspond ing sequence in the polymer sequence editor that gave rise to these oligomers in the first place This is only possible if The way the data were fed into the input m z list was by dragging oligomers from the tree view widgets as described earlier The polymer sequence window is still opened when the tracing back is tried In order to trace back any given item in an input or
23. 1912 2 1913 06 191135 Modi Coordinates false False 2585 21 2 61 85 true 2585 21 3 103 125 true 2585 21 4 170 192 true 2585 21 5 203 227 true 2585 21 6 204 228 true 2585 2147 394 415 true 2585 21 8 404 429 false 2585 2149 543 566 false 2585 21 10 590 613 false 2585 21 11 591 614 true 2585 2142 615 637 false 2585 2143 721 743 true 2585 2144 778 798 true true true true true False False true Error 0 932251 0 947368 0 912676 0 867189 0 867189 0 0380349 0 0158532 0 101208 0 829833 0 829833 0 90933 0 0979379 0 127858 Mono 2582 27 2584 29 2584 31 2582 54 2582 54 2583 48 2583 43 2583 39 2584 25 2584 25 2584 3 2583 35 2583 43 Avg 2 584 07 2585 95 2585 91 2584 13 2584 13 2585 04 2585 02 2584 9 2585 83 2585 83 2585 91 2584 9 2585 13 Progress Details Mass Search Details Sequence Last Oligomer Data Name 2585 21414 Coordinates 778 798 Mono 2 583 4267314400 Mass AVG 2585 1278580254 Overall Progression Current Mass 2585 Mass Searches Oligomers tested 3258235 Oligomers found 114 95 Figure 8 20 Searching masses in a polymer sequence This figure shows the window in which to search for masses in a polymer sequence 96 CHAPTER 8 XPERTEDIT massXpert Polymer Cleavage Configuration of the cleavage Actions Available cleaving agents Partial cleavages Io
24. 2007 Filippo Rusconi This is the modification_dictionary file where the correspondences between the name of each modification and their graphic file pixmap file called image used to graphicallly render them in the sequence editor are made Also the graphical operation that is to be performed upon chemical modification a monomer is listed T for transparent and 0 for opaque See the manual for details The format of the file is like this 120 CHAPTER 10 DATA CUSTOMIZATION dk dt Phosphorylation T phospho svg where Phosphorylation is the name of the modification T indicates that the visual rendering of the modification is a transparent process 0 indicates that the visual rendering of the modification is a full image replacement 0 like opaque phospho svg is a resolution independent svg file Each line starting with a character is a comment and is ignored during parsing of this file This file is case sensitive Phosphorylation T phospho svg Sulphation T sulpho svg AmidationAsp 0Aasparagine svg Acetylation Thacetyl svg AmidationGlu 0 glutamine svg Oxidation T oxidation svg There are two ways to render a chemical modification of a monomer Opaque rendering the initial monomer vignette is replaced using the one listed in the file for the modification This is visible in the AnidationGlu 0 glutamine svg line when a monomer is typically that would be a Glu monomer is
25. 3 8 0 9 0 using software from the Free Software Foundation FSF The main libraries used were libglib libgobject libxm12 and libgtk Since mid 2002 the development was performed on a Debian GNU Linux system http www debian org which I find to be the ultimate highly configurable easy to use distribution on earth massXpert is still developed using the De bian GNU Linux system using Free Software libraries that allow cross platform computer program development with unprecedented ease Qt libraries from the Trolltech company http www trolltech com Developing for GNU Linux has been utterly exciting and extremely efficient ORGANIZATION OF THIS MANUAL After having quickly described the installation of massXpert this manual aims at providing the required conceptual toolset for understanding what to expect from a computer program like massXpert and how to use it Thus the general organization of this book is Installation of the massXpert software program The basics of polymer chemistry The basics of mass spectrometry Generalities about massXpert The XpertDef module definition of atoms and of new polymer chemistries The XpertCalc module polymer chemistry aware programmable calcula tor The XpertEdit module sequence editor biochemical mass spectrometric simulations The XpertMiner module data mining calculations The data customization that massxpert is designed to not only make pos si
26. 9056090000 lt mass gt lt abund gt 1 0200000000 lt abund gt lt isotope gt lt isotope gt lt mass gt 103 9040260000 lt mass gt lt abund gt 11 1400000000 lt abund gt lt isotope gt lt isotope gt lt mass gt 104 9050750000 lt mass gt lt abund gt 22 3300000000 lt abund gt lt isotope gt lt isotope gt lt mass gt 105 9034750000 lt mass gt lt abund gt 27 3300000000 lt abund gt lt isotope gt lt isotope gt lt mass gt 107 9038940000 lt mass gt lt abund gt 26 4600000000 lt abund gt lt isotope gt lt isotope gt lt mass gt 109 9051690000 lt mass gt lt abund gt 11 7200000000 lt abund gt lt isotope gt lt atom gt lt atom gt lt name gt Silver lt name gt lt symbol gt Ag lt symbol gt lt isotope gt lt mass gt 106 9050950000 lt mass gt lt abund gt 51 8390000000 lt abund gt lt isotope gt lt isotope gt lt mass gt 108 9047540000 lt mass gt lt abund gt 48 1610000000 lt abund gt lt isotope gt lt atom gt lt atom gt lt name gt Cadmium lt name gt lt symbol gt Cd lt symbol gt lt isotope gt lt mass gt 105 9064610000 lt mass gt lt abund gt 1 2500000000 lt abund gt lt isotope gt lt isotope gt lt mass gt 107 9041860000 lt mass gt 140 CHAPTER 11 lt abund gt 0 8900000000 lt abund gt lt isotope gt lt isotope gt lt mass gt 109 9030010000 lt mass gt lt abund gt 12 4900000000 lt abund gt lt isotope gt lt isotope gt lt m
27. 984016 Lysine Glutamine 0 0363856 Glutamate Glutamine 0 984016 OK Figure 6 5 XpertDef monomer mass differences The mass difference between any two monomers in the definition is computed and displayed only if it is less or equal to a threshold see Figure 6 4 Each time a formula is either displayed by selecting a new monomer in the list or modified by editing it in its line edit widget the monoisotopic and average masses are recalculated As of version 2 3 5 it is possible to calculate the mass difference between any two monomers in the definition This is useful for example to grasp the resolution and mass accuracy requirements for a given polymer definition The user sets a threshold to filter the results The results of such a calculation are displayed in Figure 6 5 After addition of the monomers it is always a good idea to validate them by clicking onto the Validate button THE MODIFICATIONS Polymer are often either chemically or biochemically modified In nature biopoly mers are modified more often than not One of the more common modifica tions in the protein reign are phosphorylation or acetylation Nucleic acids are modified with a sheer number of chemical modifications saccharides also The massXpert software provides entire freedom to define any number of intelligent modifications that is modifications with any chemical formula but also that are knowledgeable of what monomers they can modifiy Indeed it
28. DNA fragmentation patterns most widely encountered A short DNA sequence is fragmented in the eight most widely encountered man ners such as to generate a b c d w x y z fragment ions The figure illustrates the position of the cleavage for each kind of fragment exemplified using the case of the smallest fragment possible and the mass calculation method is described for each fragment kind considering that each fragment is protonated only once 1 31 provided in these calculations it is assumed that the left end of the precursor polymer is phosphorylated 5 P and the reader should bear in mind that this precise phosphate might itself be expelled by the fragmentation The fragment naming schemed detailed earlier for proteins applies to nucleic acids in the very same manner a fragment series These fragments most often appear with base loss i LC M Mi O 1 b fragment series c fragment series c LC Mi 1 d fragment series di LC Mi HPO 1 w fragment series Wi RC O 1 z fragment series 1 y fragment series y RC HPO 1 z fragment series zi RC M Mi HPO 1 There are also a variety of fragments for which a base is lost 32 CHAPTER 3 BASICS IN POLYMER CHEMISTRY MORE COMPLEX PATTERNS OF FRAGMENTATION Before finishing with fragmentations it is necessary to describe a powerful fea ture of the fragmentation specification grammar available in massXpert
29. F lt prev mnm code gt lt curr mnm code gt D lt curr mnm code gt lt next mnm code gt E lt next mnm code gt lt comment gt comment here lt comment gt lt fgr gt lt fgs gt lt fgs gt lt name gt b lt name gt lt end gt LE lt end gt lt formula gt HO lt formula gt lt fgs gt lt fgs gt lt name gt c lt name gt lt end gt LE lt end gt 151 lt formula gt N1H2 H1 lt formula gt lt comment gt that s just a comment lt comment gt lt fgs gt lt fgs gt lt name gt z lt name gt lt end gt RE lt end gt lt formula gt N1H1 lt formula gt lt comment gt Not in CID high En frag lt comment gt lt fgs gt lt fgs gt lt name gt y lt name gt lt end gt RE lt end gt lt formula gt H2 lt formula gt lt fgs gt lt fgs gt lt name gt x lt name gt lt end gt RE lt end gt lt formula gt C101 lt formula gt lt fgr gt lt name gt x fgr 1 lt name gt lt formula gt H100 lt formula gt lt prev mnm code gt E lt prev mnm code gt lt curr mnm code gt D lt curr mnm code gt lt next mnm code gt F lt next mnm code gt lt comment gt comment here lt comment gt lt fgr gt lt fgr gt lt name gt x fgr 2 lt name gt lt formula gt H200 lt formula gt lt prev mnm code gt F lt prev mnm code gt lt curr mnm code gt D lt curr mnm code gt lt next mnm code gt E lt next mnm code gt lt comment gt comment here lt comment gt lt fgr gt lt fgs gt lt fgs gt lt name
30. Figure 8 16 Polymer sequence cleavage window This figure shows the window in which polymer sequence cleavage is performed One cleavage specifi cation is selected and the number of allowed partial cleavages is set The results are displayed in the same window The cleavage might be performed on the currently selected polymer sequence region or the whole sequence It is possible to stack oligomers from different cleavage simulation in the same window 90 CHAPTER 8 XPERTEDIT region This feature which was introduced in version 2 3 0 is useful so as to simulate a first cleavage of a polymer sequence and then a second cleavage of a selected oligomer using a different cleavage agent In protein chemistry that would be useful to explore possibilities of double sequential cleavages of a protein first with EndoAspN for example and then with Trypsin The user might want to generate oligomers for different kinds of cleavages For example it might be interesting to have in the same tree view widget the oligomers generated using first trypsin and then cyanogen bromide In order to add new oligomers to pre existing one it is simply required to check the Stack oligomers check button widget prior to clicking the Cleave button again with the new cleavage settings The Details frame widget at the bottom of the window displays a number of informative data In particular the Sequence tab widget displays the sequence of the oligomer currently selected in t
31. Next code H right cap Comment Add Remove Add Remove Move up Move down Move up Move down Adenine C5H4N5 monomer C10H12N505P mono 313 058 Guanine C5H4N50 monomer C10H12N506P mono 329 053 Cytosine C4H4N30 monomer C9H1206N3P mono 289 040 Thymine C5H5N202 monomer C10H13N207P mono 304 050 Skeleton C5H8O5P Skeleton Side chain Skeleton BASE Monomer ATGC a l monomer 0 left cap monomer 0 OH 313 1 314 a B 1 monomer 0 left cap 1x side chain monomer 0 OH monomer skeleton 314 16 17 314 C5H805P 1 179 180 This is the right result Figure 6 10 XpertDef fragmentation specifications definition Each fragmentation specification is defined using a name a formula the fragmented monomer side chain contribution the end of the polymer that is contained in the fragment and any number of fragmentation rules 56 CHAPTER 6 XPERTDEF massXpert Fragmentation Definitions r Fragmentation specifications Fragmentation rules Details a B a a Bt a B g Identity Name Formula 0 Side chain 0 E End LE Comment abasic a fragment ay FragRule Name Formula CAHAN3O Local logic Prev code Curr code Next code Comment a cytosine Add Remove Move up Move down Move Move down NETTES Validate
32. PLATFORM The Mac OS X package that is provided does not require the installation of libraries as these frameworks are included in the application bundle The user gets a disk image file format dmg which he double clicks in the Finder This will open up the contents of the image file After reading the COPYING license file the user drops the massXpert app bundle anywhere on the disk Double clicking that massXpert app bundle will launch the program Note that by using the Show Package Contents Finder menu on that massXpert app bundle the user may browse the bundle s contents and peruse the user manual that is located in the Contents gt Doc gt UserManual directory THE MS Windows PLATFORM In this system also it is possible to install software in two manners by installing a binary package or by building installing the software from source INSTALLING A BINARY PACKAGE To install the binary package a file typically in the autoinstaller exe format named something like massxpert 3 1 0 setup exe just double click onto the 11 file icon in the file manager The program is automatically made available in the system menu INSTALLING FROM A SOURCE TARBALL The building of the massXpert software package is in two steps first make sure that the system has the Qt libraries installed along with MinGW32 The packages can be installed by browsing the following link http trolltech com developer downloads qt windows Be sure to s
33. T his anecdotically happens to be identical to proteins and the exact converse of what we described previously for nucleic acids Now comes the question of unambiguously defining the structure of a sac charidic polymer It is commonly accepted that the simple ordered sequence of the named monoses in the saccharidic polymer from left non reducing end to right reducing end constitutes an unambiguous description of the glycan sequence To enunciate the sequence of a glycan one would use a symbology 22 CHAPTER 3 BASICS IN POLYMER CHEMISTRY polymer name code formula left cap right cap protein H OH Glycine G C3H301N1 Alanine A C3H501N1 Tyrosine T nucleic acid OH H Adenine A C10H1205N5P Cytosine C CoH1206Ns3P1 saccharide H OH Arabinose Ara 5 Heptose Hep Note LC left cap RC right cap Table 3 1 Quick comparison of three biopolymers with examples of monomers like this using a 3 letter code Ara Gal Hep Man Fru Arabinose is thus the monose 1 and Fructose is the last monose n 7 Incidentally this is where the ability of massXpert to handle monomer codes of non limited length comes in handy To SuM UP We made a rapid overview of the three major polymers in the living world A great many other polymers exist around us Table 3 1 tries to sum up all the informations gathered so far Note that the formulae given for the monomers are the residual
34. amidated the graphical representation of the modification process should involve the replacement of the old vignette in the sequence editor with the new one in the example the new vignette should be rendered using the glutamine svg file In other words the process involves an Opaque overlay of the vignette for unmodified Glu with a vignette rendered by using the glutamine svg file textbfTransparent rendering the initial monomer vignette is overlaid with one new vignette that is rendered using a svg file that is transparent un less for the graphical motif to be made visible of course One example is the Phosphorylation modification line Phosphorylation T phospho svg for which the monomer being phosphorylated has its vignette in the se quence editor overlaid with a Transparent one which only shows a small red P and that is rendered using the phospho svg file The way new svg files might be edited is using the following programs Inkscape GNU Linux and MS Windows Karbon on GNU Linux In general the best thing to do is to convert text to path so that the rendering is absolutely perfect 121 It is absolutely essential for the proper working of the sequence editor that the svg files be square that is width height Once the new polymer chemistry has been correctly defined it is time to register that new definition to the system To recap all the files for that defi
35. arrows Therefore it should appear to the reader how important when specifying a fragmentation it is to clearly indicate from which end of the precursor poly mer the fragment is generated in massXpert s jargon this is LE for left end RE for right end and NE for no end massXpert knows what action it should take when it encounters one of these three specifications for example if a LE 27 5 1 yl 25 71 R1 R2 R3 R4 R5 R6 H3N CH4 CO NH CH CO NH CH CO NH CH NH CH CO4 COOH al a5 b1 b5 cl c5 R1 al R1 1 0 RI Cl HjN CH CO NH3 m al m monomer 1 C101 left cap H1 m b1 m monomer 1 left cap H1 m cl m monomer 1 N1H3 left cap H1 R6 CH COOH 71 R6 zd 3HN CH COOH yl R6 ES C NH CH COOH Xl m 21 m monomer 6 N1H1 right O1H1 variant H1 m y1 m monomer 6 H2 right cap O1H1 m x1 m monomer 6 C101 right cap O1H1 Note how a z fragment is identical to a NH3 fragment In some cases high CID energy the z fragment is often seen as a species of mass z 1 R H2N C NH CH CO H canonical monomer immonium ions Figure 3 8 Protein fragmentation patterns most widely encountered An hexapeptide is fragmented in the seven most widely encountered manners such as to generate a b c x y
36. challenging task to compute by mind all the m z ratios for a given family of charge peaks To ease that daunting task XpertCalc contains a m z ratio calculator that is called by clicking onto the m z Calculation button This action pops up a window that is shown in Figure 7 5 64 CHAPTER 7 XPERTCALC massXpert Calculator s Recorder Calculator Recorder Accounting Modif Phosphorylation 1 times Done mono 1 080 5163322400 avg 1 080 8299188736 Figure 7 4 The XpertCalc recorder window This figure shows that the recorder window is a simple text edit widget that records all the mass significant operations in the XpertCalc calculator The text in the recorder may be selected and later used in an electronic logbook or printed In order to compute the m z ratios requested by the user the program needs to have some seeding data which have to be entered in the Initial Status frame widget If the calculation is to be started from a formula enter the formula in the Formula line edit widget after having checked the check box widget if not already checked When not starting from a formula simply uncheck the corresponding check box and enter the initial m z values both monoisotopic and average m z values need to be entered The user must inform the calculator about how the m z values either com puted starting from the formula or entered directly as numerical values were calculated that is what was the ionization status o
37. chemistry definition might be tested Typi cally that involves restarting the massXpert program and creating a brand new polymer sequence of the new definition type The first step is to check if the new definition is successfully registered with the system that is it should show up available definition upon creation of the new polymer sequence If not then that means that the catalogue file could not be found or parsed correctly When problems like this one occurs the first thing to do is to ensure that the console window on MS Windows it is systematically started along with the program on GNU Linux the way to have it is to start the program from the shell so as to look with attention at the different messages that might help understanding what is failing Please do not hesitate to submit bug reports see the first pages of this manual for the address where to post bug reports 6This is actually something very general as a recommendation in order to not suffer from severe headaches when you expect it less 122 CHAPTER 10 DATA CUSTOMIZATION 11 Appendices THE PROTEIN CHEMISTRY DEFINITION FILE lt xml version 1 0 encoding UTF 8 standalone yes gt lt DTD for polymer definitions used by the massXpert mass spectrometry application Copyright lt DOCTYPE lt ELEMEN lt ATTLIS lt ELEME lt ELEME lt ELEME lt ELEME lt ELEME lt ELEME lt ELEME lt ELEME lt ELEME lt
38. create a full spectrum simulation based on the oligomers pre sented in the Oligomers table widget For that click the Create spectrum menu in the drop down menu Clicking that menu will elicit the opening of the window shown in Figure 8 17 If the Isotopic cluster check box is not checked then the spectrum will not contain the isotopic cluster for each oligomer Instead a single peak will be calculated based either on the monoisotopic or on the average mass of the oligomer that is used as the peak centroid When the Isotopic cluster check box is checked the starting mass is evidently monoisotopic as the isotopic cluster is calculated starting from that mass Note that the other parameters have been explained earlier see section 7 page 64 Selecting a file to write the results that is the x y pairs making the spec trum is recommended Otherwise when the calculation is finished refer to the 91 massXpert Spectrum calculator 9 c GS Input data Log Results Input data Feedback Mass type Input data e Mono Avg Will use the resolution Isotopic cluster Spectrum 0 gaussian lorentzian Points 30 REDDE Resolution Increment 0 Output file Locale Resolution 10000 Min probability 0 0000001 _ Execute Abort FWHM Max peaks 15 Credit the isotopic pattern calculation algorithm was partly adapted from the work of Dirk Nolting nolting uni duesseldorf de Figur
39. gt imm lt name gt lt end gt NE lt end gt lt formula gt C101 H1 lt formula gt lt fgs gt lt fragspecs gt lt polchemdefdata gt lt polchemdefinition gt 152 CHAPTER 11 APPENDICES ONE EXAMPLE POLYMER SEQUENCE FILE The sequence below is not biologically relevant It is only shown here for didactic purposes Indeed no one has never seen a phosphorylated Glycyl residue lt xml version 1 0 gt lt DTD for polymer sequences used by the massXpert mass spectrometry application Copyright 2006 2007 Filippo Rusconi Licensed under the GNU GPL gt lt DOCTYPE polseqdata lt ELEMENT polseqdata polchemdef name name code author datetime polseq le modif re m lt ELEMENT polchemdef name PCDATA gt lt ELEMENT name PCDATA gt lt ELEMENT code PCDATA gt lt ELEMENT author PCDATA gt lt ELEMENT datetime PCDATA gt lt ELEMENT polseq codes monomer lt ELEMENT le_modif PCDATA gt E E E E I E lt ELEMENT re_modif PCDATA gt lt ELEMENT codes PCDATA gt lt ELEMENT monomer code prop gt lt ELEMENT prop name data gt lt ATTLIST data type str int dbl str gt lt ELEMENT data PCDATA gt 7 lt polseqdata gt lt polchemdef_name gt protein 1 letter lt polchemdef_name gt lt name gt NOT_SET lt name gt lt code gt NOT_SET lt code gt lt author gt rusconi lt author gt lt datetime gt 2007 05 20 43 40 lt datetime gt
40. is crucial that the mass type be set correctly because the type of the mass calculated for the formula will be of the same type as the type of the data Increment charge by will iterate in all the items present in the list and apply the charge increment to them One item in the list that is charged 1 will be deionized and reionized to 2 this calculation involves the ionization rule of the oligomer and thus its ionization formula Reionization will iterate in all the items present in the list and apply the new ionization rule defined in this group box widget Mass based actions which involve processing the input m z lists with nu merical data representing masses Apply mass will iterate in all the items present in the list and apply the entered mass to them Apply threshold will remove all data items in the list for which m z or M is less than the value set 113 OUTPUT OF THE CALCULATIONS Simulations performed on a single input m z list produce a m z list that is identical to the input list unless for the m and or z values which might have changed This means that it is perfectly possible to Overwrite the initial data with the newly obtained ones this is performed by checking the Perform computation in place check button widget Create a new list with the newly obtained data As a convenience for the user the new list will be an input m z list in which it will be possible to perform ulterior simulations T
41. it A patent license is discriminatory if it does not include within the scope of its coverage prohibits the exercise of or is conditioned on the non 12 13 14 173 exercise of one or more of the rights that are specifically granted under this License You may not convey a covered work if you are a party to an arrangement with a third party that is in the business of distributing software under which you make payment to the third party based on the extent of your activity of conveying the work and under which the third party grants to any of the parties who would receive the covered work from you a discriminatory patent license a in connection with copies of the covered work conveyed by you or copies made from those copies or b primarily for and in connection with specific products or compilations that contain the covered work unless you entered into that arrangement or that patent license was granted prior to 28 March 2007 Nothing in this License shall be construed as excluding or limiting any implied license or other defenses to infringement that may otherwise be available to you under applicable patent law No Surrender of Others Freedom If conditions are imposed on you whether by court order agreement or otherwise that contradict the conditions of this License they do not ex cuse you from the conditions of this License If you cannot convey a covered work so as to satisfy simultaneously your obl
42. lt isotope gt lt mass gt 130 9050760000 lt mass gt lt abund gt 21 1800000000 lt abund gt lt isotope gt lt isotope gt lt mass gt 131 9041480000 lt mass gt lt abund gt 26 8900000000 lt abund gt lt isotope gt lt isotope gt lt mass gt 133 9053950000 lt mass gt lt abund gt 10 4400000000 lt abund gt lt isotope gt lt isotope gt lt mass gt 135 9072190000 lt mass gt lt abund gt 8 8700000000 lt abund gt lt isotope gt lt atom gt lt atom gt lt name gt Caesium lt name gt lt symbol gt Cs lt symbol gt lt isotope gt lt mass gt 132 9054330000 lt mass gt lt abund gt 100 0000000000 lt abund gt lt isotope gt lt atom gt lt atom gt lt name gt Barium lt name gt lt symbol gt Ba lt symbol gt lt isotope gt lt mass gt 129 9062770000 lt mass gt lt abund gt 0 1060000000 lt abund gt lt isotope gt lt isotope gt lt mass gt 131 9050420000 lt mass gt lt abund gt 0 1010000000 lt abund gt lt isotope gt lt isotope gt lt mass gt 133 9044900000 lt mass gt 144 CHAPTER 11 lt abund gt 2 4170000000 lt abund gt lt isotope gt lt isotope gt lt mass gt 134 9056680000 lt mass gt lt abund gt 6 5920000000 lt abund gt lt isotope gt lt isotope gt lt mass gt 135 9045560000 lt mass gt lt abund gt 7 8540000000 lt abund gt lt isotope gt lt isotope gt lt mass gt 136 9058160000 lt mass gt lt abund gt 11 2320000000 lt abund gt lt isotop
43. lt mass gt 116 9029540000 lt mass gt lt abund gt 7 6800000000 lt abund gt lt isotope gt lt isotope gt lt mass gt 117 9016070000 lt mass gt lt abund gt 24 2200000000 lt abund gt lt isotope gt lt isotope gt lt mass gt 118 9033100000 lt mass gt lt abund gt 8 5900000000 lt abund gt lt isotope gt lt isotope gt lt mass gt 119 9021990000 lt mass gt lt abund gt 32 5800000000 lt abund gt lt isotope gt lt isotope gt lt mass gt 121 9034400000 lt mass gt lt abund gt 4 6300000000 lt abund gt lt isotope gt lt isotope gt lt mass gt 123 9052710000 lt mass gt lt abund gt 5 7900000000 lt abund gt lt isotope gt lt atom gt lt atom gt lt name gt Antimony lt name gt lt symbol gt Sb lt symbol gt lt isotope gt lt mass gt 120 9038240000 lt mass gt lt abund gt 57 2100000000 lt abund gt lt isotope gt lt isotope gt lt mass gt 122 9042220000 lt mass gt lt abund gt 42 7900000000 lt abund gt lt isotope gt lt atom gt lt atom gt lt name gt Tellurium lt name gt lt symbol gt Te lt symbol gt lt isotope gt lt mass gt 119 9040210000 lt mass gt 142 CHAPTER 11 lt abund gt 0 0900000000 lt abund gt lt isotope gt lt isotope gt lt mass gt 121 9030550000 lt mass gt lt abund gt 2 5500000000 lt abund gt lt isotope gt lt isotope gt lt mass gt 122 9042780000 lt mass gt lt abund gt 0 8900000000 lt abund gt lt isotope gt lt iso
44. lt polseq gt lt codes gt YG lt codes gt lt monomer gt lt code gt G lt code gt lt prop gt lt name gt MODIF lt name gt lt data gt Phosphorylation lt data gt lt prop gt lt monomer gt lt codes gt FL lt codes gt lt polseq gt lt le_modif gt Acetylation lt le_modif gt lt re_modif gt Acetylation lt re_modif gt lt polseqdata gt 153 THE PKA_PH_PI XML FILE lt xml version 1 0 encoding UTF 8 standalone yes gt lt DTD for polymer elements pka data used by the massXpert of mass spectrometry program Copyright lt DOCTYPE 2003 2007 Filippo Rusconi Licensed under the GNU GPL gt pkaphpidata lt ELEMENT pkaphpidata monomers modifs gt lt ELEMENT monomers monomer gt lt ELEMENT modifs modif gt lt ELEMENT monomer code mnmchemgroup gt lt ELEMENT modif name mdfchemgroup gt lt ELEMENT mnmchemgroup name pka acidcharged polrule chemgrouprule gt lt ELEMENT mdfchemgroup name pka acidcharged gt lt ELEMENT chemgrouprule entity name outcome gt lt ELEMENT pka PCDATA gt lt ELEMENT value PCDATA gt lt ELEMENT code PCDATA gt lt ELEMENT outcome PCDATA gt lt ELEMENT name PCDATA gt lt ELEMENT entity PCDATA gt lt ELEMENT acidcharged PCDATA gt lt ELEMENT polrule PCDATA gt gt lt pkaphpidata gt lt monomers gt lt monomer gt lt code gt A lt code gt lt mnmch
45. mass of the most abundant form of carbon the dalton is taken as identical to u but not accepted as standard nomencla ture by IUPAC or IUPAP it is abbreviaed in Da a former unit was a m u i e atomic mass unit It should be consid ered obsolete since based on an old 1 16 of 160 standard the mass of a molecule also molecular mass is expressed in daltons The symbol commonly used is not m as in or M Na Symbol is already employed for ion mass as in m z the mass to charge ratio m z of an ion is the ion s mass in daltons divided by the number z of elementary charges Hence m z is mass per charge and units of m z are daltons per charge nominal mass the integral sum of the nucleons in an atom it is also the atomic mass number exact also known as accurate mass the sum of the masses of the protons and neutrons plus the nuclear binding energy In the previous sections I used to say that a mass spectrometer s task is to measure masses Well this is not 100 exact A mass spectrometer actually allows to measure something else it measures the m to z ratio of the analyte which is denoted m z What is this m to 2 ratio all about Well we said above that a mass spectrometer has to exert forces on the ions in order to determine their m z Now let us say that we have an electric field of constant value
46. material or modified versions of it with contractual assumptions of liability to the recipient for any liability that these contractual assumptions directly impose on those licensors and authors All other non permissive additional terms are considered further restric tions within the meaning of section 10 If the Program as you received it or any part of it contains a notice stating that it is governed by this License along with a term that is a further restriction you may remove that term If a license document contains a further restriction but per mits relicensing or conveying under this License you may add to a covered work material governed by the terms of that license document provided that the further restriction does not survive such relicensing or conveying If you add terms to a covered work in accord with this section you must place in the relevant source files a statement of the additional terms that apply to those files or a notice indicating where to find the applicable terms Additional terms permissive or non permissive may be stated in the form of a separately written license or stated as exceptions the above require ments apply either way 8 10 171 Termination You may not propagate or modify a covered work except as expressly pro vided under this License Any attempt otherwise to propagate or modify it is void and will automatically terminate your rights under this License includin
47. mode it is possible to select more than one region in the polymer sequence In all cases below make sure that the Multi region checkbutton is checked in Selections and regions group box This is how these selections are performed With the mouse Left click and drag to make the first selection Go with the mouse cursor at the beginning of new selection hold the key down while left clicking and dragging to perform the second region selection Continue as may times as necessary With the keyboard Position the cursor at the beginning of the first region to be selected hold the Ctrl Shift keys down while moving 82 CHAPTER 8 XPERTEDIT the cursor with the direction keys gt t o Hold the key down and use the direction keys to go to the beginning of the new region selection press the key and hold it down while moving the cursor with the direction keys to actually perform the region selection Multi selection region mode In this mode which requires the multi region selection mode to be enabled it is possible to perform selections that overlap For example one could select the sequence MAMISGM and then select the sequence SGMSGRKAS The overlapping sequence is thus SGM Being able to select multiple regions and or to select multiple times the same region involves some configurations as far as calculating relevant masses is con cerned Indeed whatever the selection mode that is enabled each t
48. ones For example the formula of the glycyl residue corresponds to the formula of the Glycine monomer less one molecule of water Many synthetic polymers are much simpler than the ones we have rapidly reviewed and it should be clear that if massXpert can deal with the complex biopolymers described so far it certainly will be very proficient with less complex synthetic polymers Describing the formation of polymers is one thing but we also have to describe how to disrupt polymers This is what we shall do in the next section POLYMER CHAIN DISRUPTING CHEM ISTRY The polymer chain disrupting chemistry was mentioned earlier as a complex subject that was of enormous importance to the mass spectrometrist This is why that subject will be treated in a pretty thorough manner First of all it should be noted that a chemical modification of a polymer does not necessarily involve the perturbation of the chain structure of the polymer Here however we are concerned specifically with a number of chemical modifications that yield a polymer chain perturbation cleavage and fragmentation 23 A CLEAVAGE IS A CHEMICAL PROCESS by which a cleaving agent will act di rectly on the polymer chain making it fall into at least two separated pieces the oligomers As a result of the cleavage reaction groups originating in the cleav ing molecule remain attached to the polymer at the precise cleavage location A FRAGMENTATION IS A CHEMICAL PROCESS by which
49. shows up and the user enters masses to search for A number of parameters are to be detailed Targets The masses should be searched for in the whole sequence or in the currently selection region lonization When calculating masses for the potential oligomers matching the searched mass should different levels of ionization be calculated For example one find in an electrospray ionization experiment mass spectrum a peak at m z 1245 It is not possible to know the ionization level for that ion On could imagine that this value is for a monopronotonated or for a multiprotonated species If we wanted to asses this we might ask that the mass be searched for by computing a range of possible ionization levels between Start 1 and End 4 admitting that for that experiment this is what one would expect Once the masses have been searched for if results are found they are displayed in the same window in the Oligomers table view widgets the left one for the mono masses and the right one for the avg masses 94 CHAPTER 8 XPERTEDIT massXpert Polymer Fragmentation Configuration of the fragmentation Oligomer 22833 1 2 3 1 2 3 2 3 1 2 3 5222282 Polymer Figure 8 19 Oligomer fragmentation window This figure shows the win dow in which oligomer fragmentation is performed One or more fragmentation patterns might be selected in one fragmentation step massX pert Polymer Mass Search Mono Masses 1179 1848 1
50. the following oligomers would have been generated THISMWILLM BECUTMANDTHATM ALSO WILLMBE CUTM ANDTHATMALSO and so on Now the biochemist knows that when a protein is cleaved with cyanogen bromide the cleavage occurs effectively right of monomer M this we also know already and the M monomer that underwent the cleavage is changed from a methionyl residue to an homoseryl residue this chemical change involves this formula CH2S O Amongst all the oligomers generated above there are two oligomers that should not undergo the cleavage rule CH25 O ALSO and ANDTHATMALSO Indeed these two oligomers were generated by the Cyanogen Bromide cleavage but were not actually cleaved at the right side of methionyl residue because they correspond the the right end terminal part of the protein sequence even if one them does contain residue the cleavage did not occur at that residue This example should clarify why the definition clearly stipulates in the cleavage specification for CyanogenBromide that the oligomers resulting from this cleavage should undergo the CH2S O formula only if they have as their right end monomer code These cleavage rules need to be defined in a very careful way imagine that in some cyanogen bromide experiments that reagent would cleave right of C cysteine residues but with no chemical modification of the monomer In this case i
51. trans parent graphics object a red P was overlaid onto the corresponding seryl monomer vignette If the user modifies a monomer with a modification that has no corresponding svg file defined for its graphical rendering in file modifica 85 Figure 8 12 Rendering of a monomer modification in a polymer se quence This figure shows how the chemical modification of monomer s is graphically rendered The K residue is modified using an Acetylation modi fication The S residue is modified with a modification that has no associated graphical vignette The default vignette is thus used tion_dictionary then a default modification rendering is used The user is responsible for correctly reading the messages that might be published in the Messages text edit widget It is important to understand that when a monomer is modified its previous modification if any is overwritten with the new one The user is invited to experiment a bit with the monomer modification process so as to be confident of the results that she is going to obtain when real polymer chemistry work is to be modelled in massXpert If the modification to be applied is not readily available in the list of mod ifications defined in the polymer chemistry definition then it is possible by checking the Define modification check button widget to manually define a mod ification This procedure leads to the modification of the target monomer s exact
52. will be taken into account Note that only cross links fully encompassed by the selected sequence region s will be taken into account for the Selected sequence mass calculations If any number of cross links are not fully encompassed by the currently selected sequence region then that number is displayed along with the following label visible in the Selected sequence group box Incomplete cross links 73 lonization H This formula represents the ionization agent formula that is protonation Unitary charge 1 Charge brought by the ionization agent In the example a protonation brings a positive charge lonization level 1 Level of the ionization requested In the example a single ionization is requested that is a monoprotonation When any parameter listed above is changed the recalculation of the masses for both the Whole sequence and the Selected sequence is triggered and the new masses are updated in their respective line edit widgets described earlier The fact that the user can specify ionization rules should make it clear that the values that are displayed are actually m z ratios as long as one ionization is required THE EDITOR WINDOW MENU The menu bar in the polymer sequence editor displays a number of menu items reviewed below File Figure 8 4 Edit File Close Closes the sequence File Save Saves the sequence If the sequence has no filename yet the
53. z and immonium fragment ions The figure illustrates the position of the cleavage for each kind of fragment exemplified us ing the case of the smallest fragment possible and the mass calculation method is described for each fragment kind consider that each fragment bears only one positive charge 28 CHAPTER 3 BASICS IN POLYMER CHEMISTRY specification is found for a given fragmentation specification massXpert adds to the fragment s mass the mass corresponding to the left cap of the precursor polymer a fragment series If we take the a fragment series the Figure 3 8 indicates that the fragments include the left end and that their last monomer lacks its carbonyl group see top of Figure 3 8 that the 1 arrow goes between the CaH and the CO of monomer 1 So we would say that each fragment of the a series should be challenged with the following chemical treatments 1 addition of the mass corresponding to the left cap proton 2 removal of the mass corresponding to the lacking CO group This way we have the mass of fragment al If we were interested in the fragment a4 we would have summed the masses of monomers 1 to 4 added the mass of the left cap and finally removed the mass of a CO The mass calculation is thus mathematically expressed LC 4 CO 1 b fragment series Similarly the mass calculation is mathematically expressed M 1 c fragment series The mass calculation is mathematically expressed ci
54. 0 Figure 3 1 Peptidic bond formation by condensation The left end monomer is condensed to the right end monomer to yield peptidic bond A water molecule is lost during the process PROTEINS These biopolymers are made of amino acids There are twenty major amino acids in nature and each protein is made of a number of these amino acids The combinations are infinite providing enormous diversity of proteins to the living world A protein is a polar polymer it has a left end and a right end and poly merization actually occurs from left to right from N terminus to C terminus see below Figure 3 1 shows that the chemical reaction at the basis of protein synthesis is a condensation A protein is the result of the condensation of amino acids with each other in an orderly polar fashion A protein has a left end called N terminus amino terminal end and a right end called C terminus carboxyl terminal end The left end is an amino group 2HN corresponding to the non reacted amino group of the amino acid Upon condensation of a new amino acid onto the first one the carboxyl group of the first amino acid reacts with the amino group of the second amino acid A water molecule is released and the formation of an amide bond between the two amino acids yields a dipeptide The right end of the dipeptide is a carboxyl group COOH corresponding to the un reacted carboxyl group of the last amino acid to have polymerized in T
55. 0 00 that is one hundred and fourty thousands with a comma separating thousands and dot as the decimal separator During the calculation the details of that calculation are displayed in the Log tab page widget Upon clicking onto the Execute button the tab widget will automatically switch to that page The Results tab page widget is updated at the end of the calculation and will contain both the input data as a record and the results data if no output file was first selected If an Output File name was set see above the x y coordinates of the isotopic peaks pattern graph are not displayed in the Results tab page widget The results for the given example are graphed using mMass and shown in Figure 7 7 on the following page ImMass is an excellent mass spectrum viewer written by Martin Strohalm This is Free Software available at http mmass org 68 CHAPTER 7 XPERTCALC a i 90 60 30 1734 0 1734 5 1735 0 1735 5 1736 0 m z Figure 7 7 An isotopic pattern calculator output example The graph shows the isotopic pattern that should be expected to be obtained by performing a mass spectrometric analysis of a protein formula C737H1148N1880272S11 protonated ten times X pertEdit A Powerful Editor and Simulation Center After having completed this chapter you will be able to perform sophisticated polymer chemistry simulations on polymer sequences that can be edited in place along with automatic mass recalcula
56. 0 lt mass gt lt abund gt 2 3650000000 lt abund gt lt isotope gt lt atom gt lt atom gt lt name gt Manganese lt name gt lt symbol gt Mn lt symbol gt lt isotope gt lt mass gt 54 9380463000 lt mass gt lt abund gt 100 0000000000 lt abund gt lt isotope gt lt atom gt lt atom gt 132 CHAPTER 11 APPENDICES lt name gt Iron lt name gt lt symbol gt Fe lt symbol gt lt isotope gt lt mass gt 53 9396121000 lt mass gt lt abund gt 5 8450000000 lt abund gt lt isotope gt lt isotope gt lt mass gt 55 9349393000 lt mass gt lt abund gt 91 7540000000 lt abund gt lt isotope gt lt isotope gt lt mass gt 56 9353957000 lt mass gt lt abund gt 2 1190000000 lt abund gt lt isotope gt lt isotope gt lt mass gt 57 9332778000 lt mass gt lt abund gt 0 2820000000 lt abund gt lt isotope gt lt atom gt lt atom gt lt name gt Cobalt lt name gt lt symbol gt Co lt symbol gt lt isotope gt lt mass gt 58 9331978000 lt mass gt lt abund gt 100 0000000000 lt abund gt lt isotope gt lt atom gt lt atom gt lt name gt Nickel lt name gt lt symbol gt Ni lt symbol gt lt isotope gt lt mass gt 57 9353471000 lt mass gt lt abund gt 68 0769000000 lt abund gt lt isotope gt lt isotope gt lt mass gt 59 9307890000 lt mass gt lt abund gt 26 2231000000 lt abund gt lt isotope gt lt isotope gt lt mass gt 60 lt abund gt 1 lt isotope gt l
57. 00000 lt abund gt lt isotope gt lt atom gt lt atom gt lt name gt Sulfur lt name gt lt symbol gt S lt symbol gt lt isotope gt lt mass gt 31 9720718000 lt mass gt lt abund gt 94 9300000000 lt abund gt lt isotope gt lt isotope gt lt mass gt 32 9714591000 lt mass gt lt abund gt 0 7600000000 lt abund gt lt isotope gt lt isotope gt lt mass gt 33 9678677000 lt mass gt lt abund gt 4 2900000000 lt abund gt lt isotope gt 129 lt isotope gt lt mass gt 35 9670790000 lt mass gt lt abund gt 0 0200000000 lt abund gt lt isotope gt lt atom gt lt atom gt lt name gt Chlorine lt name gt lt symbol gt C1 lt symbol gt lt isotope gt lt mass gt 34 9688527000 lt mass gt lt abund gt 75 7800000000 lt abund gt lt isotope gt lt isotope gt lt mass gt 36 9659026000 lt mass gt lt abund gt 24 2200000000 lt abund gt lt isotope gt lt atom gt lt atom gt lt name gt Argon lt name gt lt symbol gt Ar lt symbol gt lt isotope gt lt mass gt 35 9675456000 lt mass gt lt abund gt 0 3365000000 lt abund gt lt isotope gt lt isotope gt lt mass gt 37 9627322000 lt mass gt lt abund gt 0 0632000000 lt abund gt lt isotope gt lt isotope gt lt mass gt 39 9623831000 lt mass gt lt abund gt 99 6003000000 lt abund gt lt isotope gt lt atom gt lt atom gt lt name gt Potassium lt name gt lt symbol gt K lt symbol gt lt isoto
58. 08 the 2nd The XpertDef chapter was updated to detail the new way of defining fragmentation specifications where the side chain is decomposed in the gas phase The section about fragmentations is now much better documented march 2008 the 30th The XpertEdit chapter was updated to include a description of the new fragmentation mass searching data in place filter ing A section is now devoted to data filtering march 2008 the 25th The XpertEdit chapter was updated to include a description of the new sequence cleavage data in place filtering march 2008 the 18th The XpertEdit chapter was updated to include a description of the find sequence motif feature march 2008 the 13th The XpertEdit chapter was updated to include a new paragraph about monomer cross linking as this is now implemented in the software february 2008 the 21th The XpertEdit chapter was updated to include a new figure of the polymer modification procedure and to describe the enhanced modification procedure february 2008 the 15th The XpertEdit chapter was updated to include a new figure of the monomer modification procedure and to describe the enhanced modification procedure december 2007 the 17th The chapter about installation of massXpert has been rewritten to reflect changes in the building of massXpert and in the installation of Debian GNU Linux and Fedora core GNU Linux packages december 2007 the 16th The chapter about polymer chemistry defi nitio
59. 1 0 Now create a directory called massxpert build with the following com mand shell prompt mkdir massxpert build Change to that directory shell prompt cd massxpert build and run the cmake configuration command shell prompt cmake massxpert 3 1 0 Build the software shell prompt make P If the build runs fine then simply become root and issue the following command shell prompt make install 10 CHAPTER 2 MASSXPERT INSTALLATION At this point the software should have installed in the destination tree usr local prefix The program should be callable immediately if the destination directory is in the path otherwise it will first be required to use the full pathname to call it like for example shell prompt home rusconi myprogs bin massxpert INSTALLING A BINARY PACKAGE Debian GNU Linux PACKAGE To install a Debian GNU Linux package just issue the following command shell prompt dpkg i massxpert_3 1 0 1_1386 deb If the documentation is needed the massxpert doc_3 1 0 1_i386 deb might be installed also using the same command line Fedora core GNU Linux PACKAGE To install a Fedora core GNU Linux package just issue the following command shell prompt rpm ivh massxpert_3 1 0 1_i1386 deb P Note that the Fedora core GNU Linux package does install the documentation along with the binary so there is no need to as for the installation of a doc package THE Mac OS X
60. 3N CH CO NH CH P us H gt N CH COOH Oligomer 1 Oligomer 2 i cyanogen bromide cleavage R1 CH R3 H3N CH CO NH CH CO NH CH COOH LY R3 pow Oligomer 2 H N CH COOH CH CH5 CH B 7 CH CO NH CH H3N CH CO NH CH OH N H O H C OH Homoserine lactone unit Homoserine unit Oligomer 1 Figure 3 7 Protein cleavage by water and cyanogen bromide A tripep tide is cleaved at position 1 either by hydrolysis top or by cyanogen bromide bottom Cyanogen bromide cleaves specifically on the right of a methionine monomer Upon cleavage the methionyl monomer gets converted into homoser ine by the cyanogen bromide reagent 25 when the cleavage reaction modifies the substrate then this should be carefully modelled How To answer this question we might start by comparing the two different Oligomer 1 species that were yielded upon the water mediated and the cyanogen bromide mediated cleavage reactions the hydrolysis generated Oligomer 1 is equal to the cyanogen bromide generated Oligomer 1 51 1 H2 O1 this is a big difference The observations we did so far might be worded this way Whenever a protein undergoes a cyanogen bromide mediated cleavage the C1H2S1 O1 chemical reaction should be applied to the resulting oligomers if and only if they have a methionine monomer at their right end In massXpert
61. 40 965 2322212366 lonization rule Formula H Charge d Level 1 Target ionization status Formula H Starting level 1 Charge 1 E Ending level 10 Actions Calculate Clipboard charge family Mono Ava 14088 7 14097 4 15654 15663 7 17610 6 17621 5 20126 3 20138 8 23480 5 23495 28176 4 28193 9 35220 2 35242 1 46960 46989 1 70439 5 70483 1 140878 140965 YO Figure 8 22 Calculation of ranges of m z ratios This figure shows the window in which to perform the calculation of different m z ratios starting from one m z value with a given ionization agent massXpert Compositions Configuration Monomeric Composition Whole Sequence Name Valine Tyrosine Tryptophan i Threonine Serine Proline To Clipboard Phenylalanine Methionine Lysine Selected Sequence AT NVHAS lt lt r Elemental Cormposition Isoleucine iu Histidine C6354H10106N170301841536 Glycine Glutamine bos Glutamate gt Cysteine Aspartate 1 Asparagine Arginine Alanine P zZzoomoor Figure 8 23 Determination of the compositions This figure shows how to determine the monomeric and elemental compositions for the whole sequence or the current selection
62. 44 The Polymer Chemical Entities gt s aa siara arupasa 45 The Monomers 2 2 4 4 2 54000 ed as 47 The ea in 48 The Cross lukers ea eA ile hk ae RA 49 The Cleavage Specifications 50 The Fragmentation 5 52 Saving The Definition 2 4 04 o Room Ry sank 58 7 XpertCalc 59 ApertCale Invocation x o Ro RR 59 An Easy Operation bopa 60 The Programmable Calculator 61 The LogBook 63 The m z Ratio Caleulator o o o o s caco leen 63 The Isotopic Peaks Calculator a 64 8 XpertEdit 69 XpertEdit eaa lees 70 XpertEdit Operation In Medias Res 4 70 The Editor Window 73 Editing Polymer Sequences 74 Multi Character Monomer Codes 76 Unambiguous Single Multi Character Monomer Codes 77 Erroneous Monomer Codes 77 Simplified Ediing 4222225 o9 RA T8 Finding s quence motifs n RR n 79 Importing Sequences 79 Importing From The Clipboard 79 Importing From Raw Text Files 81 Multi region 81 Polymer Sequence 82 Selected Monomer s Modification 83 Whole Sequence Modificatio
63. 6032500 lt mass gt lt abund gt 99 9998600000 lt abund gt lt isotope gt lt atom gt lt atom gt lt name gt Lithium lt name gt lt symbol gt Li lt symbol gt lt isotope gt lt mass gt 6 0151232000 lt mass gt lt abund gt 7 5900000000 lt abund gt lt isotope gt lt isotope gt lt mass gt 7 0160045000 lt mass gt lt abund gt 92 4100000000 lt abund gt lt isotope gt lt atom gt lt atom gt lt name gt Beryllium lt name gt lt symbol gt Be lt symbol gt lt isotope gt lt mass gt 9 0121825000 lt mass gt lt abund gt 100 0000000000 lt abund gt lt isotope gt lt atom gt lt atom gt lt name gt Decanor lt name gt lt symbol gt Dac lt symbol gt lt isotope gt lt mass gt 10 0000000000 lt mass gt 126 CHAPTER 11 APPENDICES lt abund gt 100 0000000000 lt abund gt lt isotope gt lt atom gt lt atom gt lt name gt Bore lt name gt lt symbol gt B lt symbol gt lt isotope gt lt mass gt 10 0129380000 lt mass gt lt abund gt 19 9000000000 lt abund gt lt isotope gt lt isotope gt lt mass gt 11 0093053000 lt mass gt lt abund gt 80 1000000000 lt abund gt lt isotope gt lt atom gt lt atom gt lt name gt Carbon lt name gt lt symbol gt C lt symbol gt lt isotope gt lt mass gt 12 0000000000 lt mass gt lt abund gt 98 9300000000 lt abund gt lt isotope gt lt isotope gt lt mass gt 13 0033548000 lt mass gt lt abund gt 1 0700000000 lt abu
64. 911 Oligomers Targets Whole Sequence Selected Sequence Configuration OF The Mass Search Avg Masses 2585 Tonization Start End Actions To Clipboard Searched Y 1911 1911 1911 1911 1911 1911 1911 1911 1911 1911 1911 1911 1911 1911 1911 1911 1911 1911 1911 1911 1911 1911 Name 1911 2121 1911 2142 1911 2123 1911 2184 1911 2145 1911 2146 1911 2147 1911 2148 1911 2149 1911 21 10 1911 21 11 1911 21412 1911 21 13 1911 21414 1911 21 15 1911 21416 1911 21417 1911 21418 1911 21419 1911 21420 1911 21421 1911 21422 Coordinates 47 64 54 71 72 90 93 109 94 110 119 136 121 138 123 139 140 154 141 155 150 165 163 179 191 207 304 320 364 380 367 383 368 384 374 390 405 422 504 519 599 615 750 766 Error 0 125386 0 898853 0 839447 0 900985 0 900985 0 974996 0 974996 0 963763 0 05395 0 05395 0 114056 0 977594 0 0372 0 953277 0 945232 0 908846 0 0751 0 0387 0 856128 0 0525 0 887066 0 859316 Details Mono 1911 13 1910 1 1911 84 1911 9 1911 9 1910 03 1910 03 1910 04 1911 05 1911 05 1910 89 1911 98 1910 96 1911 95 1911 95 1911 91 1910 92 1910 96 1910 14 1910 95 1911 89 1910 14 Avg 1912 37 1911 45 1913 01 1913 09 1913 09 1911 3 1911 3 1911 3 1912 29 1912 29 1912 11 1913 07 1912 24 1913 16 1913 07 1913 03 1912 05 1912 09 1911 27
65. ELEME lt ELEME lt ELEME lt ELEME lt ELEME lt ELEMEN lt ELEMEN SSE 2 2 2 gt gt 2 2 2 2 2 T T T T T T T T T T T T T T T T T T 2006 2007 Filippo Rusconi Licensed under the GNU GPL gt polchemdefinition polchemdefinition atomdefdata polchemdefdata gt polchemdefinition version NMTOKEN REQUIRED gt atomdefdata atom gt atom name symbol isotope gt symbol PCDATA gt isotope mass abund gt mass PCDATA gt abund PCDATA gt polchemdefdata name leftcap rightcap codelen ionizerule monomers modifs crosslinkers ionizerule formula charge level gt monomers mnm gt modifs mdf gt crosslinkers clk gt cleavespecs cls gt fragspecs fgs gt mnm name code formula gt mdf name formula targets gt clk name formula modifname gt 123 124 CHAPTER 11 APPENDICES lt ELEMENT cls name pattern clr gt NT fgs name end formula comment fgr gt NT clr name le mnm code le formula re mnm code re formula 7 NT name formula prev mnm code curr mnm code next mnm code comment gt NT leftcap PCDATA gt NT rightcap PCDATA gt NT codelen PCDATA gt NT charge PCDATA gt NT level PCDATA gt NT name PCDATA gt NT modifname PCDATA gt NT code PCDATA gt NT formula PCDATA gt NT targets PCDATA gt NT pattern PCDATA gt NT end PCDATA gt NT le mnm code PCDATA g
66. Major Component in this context means a major essential component kernel window system and so on of the specific operating system if any on which the executable work runs or a compiler used to produce the work or an object code interpreter used to run it The Corresponding Source for a work in object code form means all the source code needed to generate install and for an executable work run the object code and to modify the work including scripts to control those activities However it does not include the work s System Libraries or general purpose tools or generally available free programs which are used unmodified in performing those activities but which are not part of the work For example Corresponding Source includes interface definition files associated with source files for the work and the source code for shared libraries and dynamically linked subprograms that the work is specifically designed to require such as by intimate data communication or control flow between those subprograms and other parts of the work The Corresponding Source need not include anything that users can re generate automatically from other parts of the Corresponding Source The Corresponding Source for a work in source code form is that same work Basic Permissions All rights granted under this License are granted for the term of copyright on the Program and are irrevocable provided the stated conditions are met This Licens
67. PARTY WHO MODIFIES AND OR CONVEYS THE PROGRAM AS PERMITTED ABOVE BE LIABLE TO YOU FOR DAMAGES IN CLUDING ANY GENERAL SPECIAL INCIDENTAL OR CONSEQUEN TIAL DAMAGES ARISING OUT OF THE USE OR INABILITY TO USE THE PROGRAM INCLUDING BUT NOT LIMITED TO LOSS OF DATA OR DATA BEING RENDERED INACCURATE OR LOSSES SUSTAINED BY YOU OR THIRD PARTIES OR A FAILURE OF THE PROGRAM TO OPERATE WITH ANY OTHER PROGRAMS EVEN IF SUCH HOLDER OR OTHER PARTY HAS BEEN ADVISED OF THE POSSIBILITY OF SUCH DAMAGES 17 Interpretation of Sections 15 and 16 If the disclaimer of warranty and limitation of liability provided above cannot be given local legal effect according to their terms reviewing courts shall apply local law that most closely approximates an absolute waiver of all civil liability in connection with the Program unless a warranty or assumption of liability accompanies a copy of the Program in return for a fee END OF TERMS AND CONDITIONS How to Apply These Terms to Your New Programs If you develop new program and you want it to be of the greatest possible use to the public the best way to achieve this is to make it free software which everyone can redistribute and change under these terms To do so attach the following notices to the program It is safest to attach them to the start of each source file to most effectively state the exclusion 175 of warranty and each file should have at least the copyright line and a pointer to whe
68. RE For example if we wanted to model the fragmentation pattern at E for a fragment of End RE similar to what was done above with sequences DEAR and DERA we would have set the local logical like this For sequence DEAR Prev code A Curr code E Next code D For sequence DERA Prev code R Curr code E Next code D This highly flexible fragmentation specification allows for definition of highly complex fragmentation behaviours of biopolymers 58 CHAPTER 6 XPERTDEF SAVING THE DEFINITION Once the polymer chemistry definition is completed the user can save it to an XML file Prior to actually writing to the file the program checks the validity of all the chemical entities in the definition This check can be triggered manually by clicking onto the Validate button If an error is found it is reported so that the user may identify the problem and fix it The location where the file should be saved and the manner that it may be made available to massXpert is to be described in a later chapter It is in fact very important that massXpert knows where to find newly defined poly mer chemistries so as to be able to use them when sequences of that polymer chemistry are created or used Xpert Calc A Powerful Mlass Calculator After having completed this chapter you will be able to perform sophisticated polymer chemistry aware mass calculations XpertCalc INVOCATION The Xper
69. Resolution 30000 lt Min probability 0 0000001 Execute Abort Max peaks 100 FWHM 0 57786 Credit the isotopic pattern calculation algorithm was partly adapted from the work of Dirk Nolting nolting uni duesseldorf de Figure 7 6 The isotopic pattern calculator The isotopic pattern calculator is rather straight forward to use Given some initial parameters the results are displayed in the Results tab page widget the Log tab page widget will display all the details of the ongoing calculation takes a number of parameters as shown in Figure 7 6 Formula Formula of which the isotopic pattern calculation must be per formed This formula might correspond to a protein or a peptide for example z The charge of the analyte m z The mass to charge ratio that is calculated on the basis of the formula and the charge above It is considered that the formula already accounts for the ionization chemical agent if z is greater than 0 Min Probability The minimum probability value to find a given m z peak in the isotopic pattern This allows a degree of optimization when calcu lations are too long to perform by removing all isotopic peaks for which the probability of occurrence is lower than the set value Resolution Resolution of the mass spectrometer Should be of a compatible value with respect to the m z of the analyte FWHM Full width at half maximum of each peak This is calculated from the m z ratio and the valu
70. The drop down widget on the left lists all the monomers defined in the protein 1 letter polymer chem istry definition the drop down widget on the right lists all the modifica tions defined in the protein 1 letter polymer chemistry definition Each drop down widget has its corresponding count spin box widget In the example the user asked that one 1 Phosphorylation modification be applied during the calculation The line edit widget below the first row of widgets is the polymer sequence widget where the user might enter a sequence of monomers It is possible to apply many times the sequence by setting the count spin box widget value to something greater than 1 either positive or negative It is possible to perform a set of calculations in one go that is the user may ask for a formula a monomer a modification a sequence to be accounted in one single calculation operation Once all the chemical entities to be taken into account have been set the user clicks onto the Apply button all the entities are parsed in sequence and their mass equivalent are added to the result masses Other prominent features of XpertCalc are described in the following sections THE PROGRAMMABLE CALCULATOR For the scientists who work on molecules that are often modified in the same usual ways XpertCalc features a built in mechanism by which they can easily 62 CHAPTER 7 XPERTCALC ee add a phosphate group 4 Fi
71. _trapped lt polrule gt lt mnmchemgroup gt lt monomer gt lt monomer gt lt code gt K lt code gt lt mnmchemgroup gt lt name gt N term NH2 lt name gt lt pka gt 9 6 lt pka gt lt acidcharged gt TRUE lt acidcharged gt lt polrule gt left_trapped lt polrule gt lt chemgrouprule gt lt entity gt LE_PLM_MODIF lt entity gt lt name gt Acetylation lt name gt lt outcome gt LOST lt outcome gt lt chemgrouprule gt lt mnmchemgroup gt lt mnmchemgroup gt lt name gt C term COOH lt name gt lt pka gt 2 36 lt pka gt lt acidcharged gt FALSE lt acidcharged gt lt polrule gt right_trapped lt polrule gt lt mnmchemgroup gt lt mnmchemgroup gt lt name gt Lateral NH2 lt name gt lt pka gt 10 53 lt pka gt lt acidcharged gt TRUE lt acidcharged gt lt polrule gt never_trapped lt polrule gt lt chemgrouprule gt lt entity gt MONOMER_MODIF lt entity gt lt name gt Acetylation lt name gt lt outcome gt LOST lt outcome gt lt chemgrouprule gt lt mnmchemgroup gt lt monomer gt lt monomer gt lt code gt L lt code gt lt mnmchemgroup gt 157 158 CHAPTER 11 lt name gt N term NH2 lt name gt lt pka gt 9 6 lt pka gt lt acidcharged gt TRUE lt acidcharged gt lt polrule gt left_trapped lt polrule gt lt chemgrouprule gt lt entity gt LE_PLM_MODIF lt entity gt lt name gt Acetylation lt name gt lt outcome gt LOST lt outcome gt lt chemgrouprule gt lt mnmchemgrou
72. a obtained on polymers These programs are usually different from a constructor to another Also there are as many mass spec trometric data prediction analysis computer programs as there are different polymer types You will get a program for oligonucleotides another one for proteins maybe there is one program for saccharides and so on Thus the biochemist massist for example who happens to work on different biopolymer types will have to learn to use several different software packages Also if the software user does not own a mass spectrometer chances are he will need to buy all these software packages The massXpert mass spectrometric software is designed to provide free so lutions to all these problems by Allowing ex nihilo polymer chemistry definitions in the XpertDef module that is part of the massXpert program Allowing simple yet powerful mass computations to be made in a mass desktop calculator that is both polymer chemistry definition aware and fully programmable that s the XpertCalc module also part of the massXpert program 2 CHAPTER 1 PREFACE Allowing highly sophisticated editing of polymer sequences on a poly mer chemistry definition specific basis along with chemical reaction sim ulations finely configured mass spectrometric computations all taking place in the XpertEdit module that is the main module of the massXpert program Allowing customization of the way each monomer will show up graphi
73. a side effect of generating a homoserine as the right end monomer of Oligomer 1 while hydrolysis generates a genuine methionine monomer This is because wa ter reverses in a very symmetrical manner what polymerization did hydrolysis is the converse of condensation while cyanogen bromide did some chemical modification onto the generated Oligomer 1 species Nonetheless the reader might have noted that interestingly all the four oligomers do effectively have their left cap a proton and their right cap the hydroxyl This means that in both water and cyanogen bromide mediated cleavages all the generated oligomers are indeed true polymers in the sense that 1 they are a chain of monomers modified or not and 2 they are correctly capped i e they are polymers in their finished state This is important because it is the basis on which we shall make the difference between a cleavage process and a fragmentation process Thus the massXpert definition of an oligomer might be an oligomer is a polymer of at least one monomer in its finished state that was generated upon cleavage of a longer polymer When the polymer cleavage reaction precisely reverses the reaction that was performed for the same polymer s synthesis there is no special difficulty But 24 CHAPTER 3 BASICS IN POLYMER CHEMISTRY CH i H hydrolysis R1 R3 CH CO NH CH CO CH COOH CH CH CH R3 H
74. all be resolved in favor of coverage For a particular product received by a particular user normally used refers to a typical or common use of that class of product regardless of the status of the particular user or of the way in which the particular user actually uses or expects or is expected to use the product A product is a consumer product regardless of whether the product has substantial commercial industrial or non consumer uses unless such uses represent the only sig nificant mode of use of the product Installation Information for a User Product means any methods pro cedures authorization keys or other information required to install and execute modified versions of a covered work in that User Product from a modified version of its Corresponding Source The information must suf fice to ensure that the continued functioning of the modified object code is in no case prevented or interfered with solely because modification has been made If you convey an object code work under this section in or with or specif ically for use in a User Product and the conveying occurs as part of a transaction in which the right of possession and use of the User Product is transferred to the recipient in perpetuity or for a fixed term regardless of how the transaction is characterized the Corresponding Source conveyed under this section must be accompanied by the Installation Information But this requirement does not apply if nei
75. apped lt polrule gt lt chemgrouprule gt lt entity gt LE_PLM_MODIF lt entity gt lt name gt Acetylation lt name gt lt outcome gt LOST lt outcome gt lt chemgrouprule gt lt mnmchemgroup gt lt mnmchemgroup gt lt name gt C term COOH lt name gt lt pka gt 2 36 lt pka gt lt acidcharged gt FALSE lt acidcharged gt lt polrule gt right_trapped lt polrule gt lt mnmchemgroup gt lt mnmchemgroup gt lt name gt Lateral guanidinium lt name gt lt pka gt 12 48 lt pka gt lt acidcharged gt TRUE lt acidcharged gt lt polrule gt never_trapped lt polrule gt lt mnmchemgroup gt lt monomer gt lt monomer gt lt code gt S lt code gt lt mnmchemgroup gt lt name gt N term NH2 lt name gt lt pka gt 9 6 lt pka gt lt acidcharged gt TRUE lt acidcharged gt lt polrule gt left_trapped lt polrule gt lt chemgrouprule gt lt entity gt LE_PLM_MODIF lt entity gt lt name gt Acetylation lt name gt lt outcome gt LOST lt outcome gt lt chemgrouprule gt lt mnmchemgroup gt lt mnmchemgroup gt lt name gt C term COOH lt name gt lt pka gt 2 35 lt pka gt lt acidcharged gt FALSE lt acidcharged gt lt polrule gt right_trapped lt polrule gt lt mnmchemgroup gt lt mnmchemgroup gt lt name gt Lateral alcohol lt name gt lt pka gt 13 lt pka gt lt acidcharged gt FALSE lt acidcharged gt lt polrule gt never_trapped lt polrule gt lt chemgrouprule gt lt entity gt MONOMER_MODIF lt ent
76. aps The left cap is the hydroxyl group that belongs to the terminal phosphate of the 5 carbon of the sugar The right cap is the proton that belongs to the hydroxyl group of the 3 carbon of the sugar ring right formula Altogether a finished nucleic acid polymer is made of the nucleotidic chain enclosed here in the blue polygon made of the repetitive elements one of which is shown on the left and of the two caps red colored OH and H out of the box on the right a gene one would use a symbology like this for a DNA using the 1 letter code of the nitrogenous base A TGC A GTC for an RNA using the 1 letter code of the nitrogenous bases A UGC A GUC Adenine is thus the base 1 and Cytosine is the last base n 8 SACCHARIDES These biopolymers are certainly amongst the most complex ones in the living world This is mainly due to the fact that saccharides are usually heavily mod ified in living cells with a huge variety of chemical modifications Furthermore the ramifications in the polymer structure are more often the normal situation than not Interestingly these molecules are first thought of as the fuel for the cell which is certainly far from being total nonsense but it is also undoubtful that their structural role is extremely important often in combination with pro teinaceous material Another interesting aspect of their ability to form complex structures is their use as key systems for identification pro
77. as defined in the current polymer chemistry definition is selected and the targets are specified in the Targets positions text line edit widget in the form of monomer positions separated by semicolumns and a formula check the Define modification checkbox to that effect The mod ification object used is created on the fly by the program and gets saved in the file as if the user had selected a modification out of the list of available modifi cations In the example Figure 8 13 on the facing page the polymer sequence was modified on its left end using the Acetylation modification available in the polymer chemistry definition and was amidated formula OH NH2 with a manually defined modification called MyModif The polymer sequence editor window displays the left end and right end modifications as labels of buttons located in the Polymer modifications groupbox MONOMER CROSS LINKING A cross link is a covalent bond that links a monomer with one or more other monomer A monomer might be cross linked more than once The dialog win dow in which the user might define cross links is shown in Figure 8 14 Cross linkers were defined in the section about XpertDef see page 49 A cross linker might either define no modification to be applied to the cross linked monomers or the same number of modifications as there are monomers cross linked For example fluorescent proteins have a chromophore that is made by reaction of three resid
78. ass gt 110 9041820000 lt mass gt lt abund gt 12 8000000000 lt abund gt lt isotope gt lt isotope gt lt mass gt 111 9027610000 lt mass gt lt abund gt 24 1300000000 lt abund gt lt isotope gt lt isotope gt lt mass gt 112 9044010000 lt mass gt lt abund gt 12 2200000000 lt abund gt lt isotope gt lt isotope gt lt mass gt 113 9033610000 lt mass gt lt abund gt 28 7300000000 lt abund gt lt isotope gt lt isotope gt lt mass gt 115 9047580000 lt mass gt lt abund gt 7 4900000000 lt abund gt lt isotope gt lt atom gt lt atom gt lt name gt Indium lt name gt lt symbol gt In lt symbol gt lt isotope gt lt mass gt 112 9040560000 lt mass gt lt abund gt 4 2900000000 lt abund gt lt isotope gt lt isotope gt lt mass gt 114 9038750000 lt mass gt lt abund gt 95 7100000000 lt abund gt lt isotope gt lt atom gt lt atom gt lt name gt Tin lt name gt lt symbol gt Sn lt symbol gt lt isotope gt lt mass gt 111 9048230000 lt mass gt lt abund gt 0 9700000000 lt abund gt lt isotope gt lt isotope gt lt mass gt 113 9027810000 lt mass gt lt abund gt 0 6600000000 lt abund gt lt isotope gt APPENDICES 141 lt isotope gt lt mass gt 114 9033440000 lt mass gt lt abund gt 0 3400000000 lt abund gt lt isotope gt lt isotope gt lt mass gt 115 9017430000 lt mass gt lt abund gt 14 5400000000 lt abund gt lt isotope gt lt isotope gt
79. at is called the 5 3 polymerase enzymatic activity The conventional representation of a nucleic acid involves showing the 5 end on the left and the 3 end on the right horizontally Sometimes to clearly indicate that the left end is phosphorylated while the right end is not the ends are indicated as 5 P and 3 OH Figure 3 4 shows a simple way to formalize what a nucleic acid polymer is The molecule represented on the left is the monomer in the sense that the polymer is made of n monomers On the right side of that figure the polymer made of n monomers is shown as a residual chain inside the blue polygon box that got capped with OH on its left end and H on its right end red colored atoms Thus in the case of the nucleic acid polymers the left cap is a hydroxyl and the right cap is a proton This anecdotically happens to be the exact converse of what was described earlier for proteins Now comes the question of unambiguously defining the structure of a nucleic acid It is commonly accepted that the listing of the named nitrogenous bases in the nucleic acid from left 5 end to right 3 end constitutes an unam biguous description of the nucleic acid sequence To enunciate the sequence of 20 CHAPTER 3 BASICS IN POLYMER CHEMISTRY HO P O Figure 3 4 End capping chemistry of the nucleic acid polymer A nucleic acid is made of a chain of nucleotides left formula and of two c
80. ay to proceed The ionization process might involve complex charge transfer mechanisms not fully understood yet at least for certain ionization desorption methods which tend to ionize the analyte in a way not predictable by looking at the analyte s chemical structure production should not be uncoupled from one important feature of mass spectrometry solvent evaporation desolvation in case of liquid sample delivery to the mass spectrometer and sample desorption in case of solid state sample introduction The general idea is that mass spectrometry works on gas phase ions This is because it is of crucial importance for a correct mass measure ment to take place that the analyte be totally freed of its chemical immediate environment That is it should be naked in the gas phase Equally important is the fact that ions must be capable of travelling long distances without ever encountering any other molecule in their way This is achieved by pumping very hard in the two regions called analyzer and detector In this respect the source is a special region because depending on the design of the mass spectrometer it might be partially at the atmospheric pressure during mass spectrometer operation It is not the aim of this manual to provide insights into mass spectrometer design topics but the general principle is that mass spec trometry involves working on gas phase ions This is why a mass spectrometer is usually built o
81. ble but also to foster Appendices lFor an in depth coverage of the philosophy behind the FSF specifically creating a free operating system you might desire to visit http www gnu org massXpert S LICENSING The front matter of this manual contains a Copyright statement I retain the copyright massXpert and all related writings source and configura tion files programmer s documentation user manual I encourage others to make copies of the work to distribute it freely to modify the work and re distribute that derivative work according to the GNU General Public License version 3 The aim of this licensing is to favor spread of knowledge to the widest public possible Also it encourages interested hackers to change the code to improve it and to send patches to the author so that their improve ments get into the program to the benefit of the widest public possible For an in depth study of the FREE SOFTWARE philosphy I kindly urge the reader to visit http www gnu org philosophy Hacker is a specialized term to design the programmer who codes programs this term should not be mistaken with cracker who is a person who uses computer science knowledge to break information systems security barriers 6 CHAPTER 1 PREFACE CONTACTING THE AUTHOR massXpert is the fruit of years of work on my part While I ve put a lot of energy into making this program as stable and reliable a piece of software as possib
82. c pattern calculator 66 An isotopic pattern calculator output example 68 Selection of a sample polymer sequence 70 Selection of the polymer chemistry definition 71 xii 8 19 8 20 8 21 8 22 8 28 8 24 8 25 al 9 2 9 3 9 4 9 5 90 LIST OF FIGURES The XpertEdit 72 The XpertEdit window Filemenu 75 The XpertEdit window Chemistry menu 75 Multi character code sequence editing in XpertEdit 76 Bad code character in XpertEdit sequence editor 78 Finding a sequence motif in the polymer sequence 79 Clipboard imported sequence error checking 80 Clipboard imported sequence purification 81 Modification of a monomer in a polymer sequence 84 Rendering of a monomer modification in a polymer sequence 85 Modification of the left end of a polymer sequence 86 Cross linking of monomers eee 87 Graphical rendering of cross linked monomers 88 Polymer sequence cleavage window 89 Spectrum simulation for cleavage obtained oligomers 91 Simulated spectrum for cleavage obtained oligomers 92 Oligomer fragmentation window 94 Searching masses in a a polymer sequence 95 Oligomer data ltering sss go sn aa 96 Calculation of ranges of m z 98 Deter
83. cally during the program operation in the XpertEdit module Allowing polymer sequence editing with immediate visualization of the mass changes elicited by the editing activity in the XpertEdit module Unlimited number of polymer sequences opened at any given time and of any given polymer chemistry definition type in the XpertEdit module This manual will progressively introduce all these functionalities in a timely and clear manner PROJECT HISTORY This is a brief history of massXpert 1998 2000 The name massXpert comes from a project I started while I was a post doctoral fellow at the Ecole Polytechnique Institut Europ en de Chimie et Biologie Universit Bordeaux 1 Pessac France The massXpert program was published in Bioinformatics Rusconi and Belghazi M Desktop prediction analysis of mass spectrometric data in proteomic projects by using massXpert Bioinformatics 2002 644 655 At that time MS Windows was at the Windows NT 4 0 version and the next big release was going to be you ll see what you ll see MS Windows 2000 When I tried massXpert on that new version one colleague had it with a new machine I discovered that my software would not run normally the editor was broken The Microsoft technical staff would advise to buy a new version of the compiler environment and rebuild This was a no go I did not want to continue paying for using something I had produced 2001 2006
84. cation Available modifications Define modification OnAnyMonomer Name MyModif OnNoMonomer Phosphorylation Formula OH NH2 Sulphation Oxidation Target Acetylation AmidationGlu C Left end H C2H30 Acetylation AmidationAsp SulfideBond Right end OH NH2 MyModif Carbamylation CarboxyMethylation Actions ProtonLoss Chromo O Chromo H Chromo H3 Unmodify Figure 8 13 Modification of the left end of a polymer sequence This figure shows how simple it is to permanently modify a polymer sequence on either or both its left right ends It should be noted that once a monomer modification dialog window has been opened the polymer sequence should not be edited This is because the modification unmodification process takes for granted that the polymer sequence still is identical to what it was when the monomer modification dialog was opened Mecanisms are there to ensure that the irreparable does not happen but this warning is in order WHOLE SEQUENCE MODIFICATION As described above it is possible to modify any monomer in the polymer se quence whhen any modified monomer is removed the modification associated to it disappears also The modifications that we describe here are not of this kind They can be applied to either the left end of the polymer sequence or its right end or both ends at any given time But these modifications do bel
85. cesses a number of complex sugars are located on the cell walls and provide recognition patterns for the other cells to deal with Nonetheless the general picture is not that complex if the way monomers are polymerized together is the only concern which is the case in this manual As far as we are concerned in fact the polymerization mechanism is a simple condensation much like what has been described for proteins yielding a sugar bond Indeed some people use the same terminology a monomeric sugar be comes a residue once polymerized in the saccharidic chain There are two main different kinds of sugars pentoses in and hexoses in it should be noted however that there is a variety of other common molecules like sialic acids heptoses Like already seen for proteins and nucleic acids a saccharidic polymer is polar it has a left end and a right end The terminology regarding the ends of a saccharidic polymer is rather unexpected at first sight the left end is said to be the non reducing end while the right end is said to be the reducing 21 OH OH OH H H H H H OH H OH H OH H HO DH OH OH OH H H H OH H OH glucose maltose Figure 3 5 Osidic bond formation by condensation The two monomers are subject to condensation with loss of one molecule of water OH Figure 3 6 End capping chemistry of the polysaccharidic polymer A polysaccharide is made
86. ch are themselves made from combinations of small simple molecules A polymer is indeed made by covalently linking small simple molecules together These small simple molecules are called monomers and it is immediate that a polymer is made of a number of monomers A general term to describe the process that leads to the formation of a polymer is polymerization It should be noted that there are many ways to polymerize monomers together For example a polymer might be either linear or branched A polymer is linear if the monomers that are polymerized can be joined at most two times The first junction links the monomer to an elongating polymer thus making it the new end of the elongating polymer which by the way is longer than before by one unit and the second junction links the new elongating polymer s end to another monomer This process goes on until the reaction is stopped the point at which the polymer reaches its finished state A branched polymer is a polymer in which at least one monomer is able to contract more than two bonds It is thus clear that a single monomer linked three times to other monomers will yield a T structure which is nothing but a branched structure In the following sections we ll describe a number of different kinds of poly mers Each time they will be described by initially detailing the structure of their constitutive monomers next the formation of the polymer is described At each step we shall try to se
87. ck on to the Apply button the list widget item will be updated to reflect the new atom name To add a new isotope first select the atom to which it should be added Click on the Add button below the Isotopes list widget A new item will be added to the list widget with text 0 0000000000 Enter the mass abundance data in the Isotope groupbox and click Apply The corresponding item in the list widget will be updated the mass of the isotope is displayed in the list widget Each time a modification is performed in the list of isotopes of a given atom the monoisotopic and average masses are updated in the Atom groupbox Recalculation of the average mass is automatic as soon as something is modified in the list of isotopes Other buttons like Move up or Move down are self explanatory Before moving on please validate the atom definitions by clicking onto the Validate button THE POLYMER CHEMICAL ENTITIES Once the atoms have been properly defined note that such atoms are already available in the distributed package it is possible to start entering data for 46 massXpert Atom definitions Atoms Isotopes Nullor Decilor Unitor Hydrogen Helium Lithium Beryllium Decanor Bore Nitrogen 12 0000000000 13 0033548000 Oxygen Fluorine Neon Sodium Magnesium Aluminium Silicon Phosphorus Sulfur Chlorine CHAPTER 6 XPERTDEF Details Identity Carbon Symbol C IsotopefAtom Isoto
88. cleavage and charge levels from 1 to 3 That cleavage simulation yielded 123 oligomers for which a spectrum was calculated which spans the 49 7 3418 m z range Figure 8 18 shows that spectrum zoomed in the region 744 759 Four distinct isotopic clusters are visible mono m z Peptide sequence charge 744 70 HPGDFGADAQGAMTKALELFR 3 748 44 ALELFR 1 751 84 HPGDFGADAQGAMTK 2 753 98 KHGTVVLTALGGILK 2 HGTVVLTALGGILKK 2 Computing a full spectrum starting from oligomers which might have large masses gt 6000 will require a large amount of CPU The above apomyoglobin example could be handled in 20 s on a rather powerful laptop albeit with a single processor used throughout the task OLIGOMER FRAGMENTATION It happens very often that polymer sequences need to be fragmented in the gas phase in the mass spectrometer so that structure characterizations may be per 93 formed For protein chemistry this happens very often in order to get sequence information for a given peptide ion selected in the gas phase massXpert must be able to perform those fragmentations in silico Let s see how an oligomer can be fragmented using massXpert It is a matter of having a polymer sequence opened in an editor window and selecting the sequence region to be fragmented Once this is done the user selects the Chemistry Fragment menu The user is provided with a window where a number of fragmentation specifications are listed Figure 8 19 on the
89. ctures but this is of no interest to a program like massXpert which is aimed at calculating masses of polymers To enunciate unambiguously the sequence of a protein one would use a symbology like this using the 3 letter code of the amino acids Ala Gly Trp Tyr Glu Gly Lys or using the 1 letter code of the amino acids AGWYEGK Alanine is thus the residue 1 and Lysine is the last residue n 7 NUCLEIC ACIDS These biopolymers are more complex than proteins mainly because they are composed of monomers nucleotides that have three different chemical parts and because those parts differ in DNA and RNA A nucleotide is the nucleic acid s brick a nucleotide consists of a nitrogenous base combined with a ri bose deoxyribose sugar and with a phosphate group There are two different kinds of nucleic acids deoxyribonucleic acid DNA the sugar is a deoxyribose and ribonucleic acid RNA the sugar is a ribose DNA is most often found in its double stranded form while RNA is most often found in single strand form There are four nitrogenous bases for each Adenine Thymine Guanine Cyto sine for DNA in RNA only one of these bases changes Thymine is replaced by 19 Figure 3 3 Phosphodiester bond formation by esterification The arriv ing monomer on the right has its triphosphate on the 5 carbon of the sugar esterified by nucleophilic attack of the first phosphorus by the alcohol function beared by the 3 carbon of the d
90. d the measured mass This is not the molecular mass which would be M it is the molecular mass plus less the mass of the chemical entity that brings the charge to the analyte When ionizing a molecule what happens is that something brings or removes a charge In biopolymer chemistry for example often the ionization is a simple protonation deprotonation If it is a protonation that means that an electronic doublet on some basic group of the analyte captures a proton This brings the mass of a proton to the biopolymer 1 Da Conversely if it is a deprotonation loss of a proton by some acidic group say a carboxylic that becomes a carboxylate the polymer looses the mass of a proton Of course if the ionization involves a single electron transfer the mass difference is going to be so feeble as to be un measurable on a variety of mass spectrometers Let us try to formalize this in a less verbose manner by using a sweet amino acid as an example the non ionized analyte Glycine has the following formula C2H 02N the molecular mass is thus M 75 033 Da the analyte gets protonated in the mass spectrometer C gt H503Ni H the measured mass of the ion is thus m 75 033 1 00782 Da and the charge beared by the ion is thus z 1 the peak value read on the mass spectrum for this analyte will thus be with z 1 m M4 1 00782 Z 76 04 value We see here that the label on the mass spectrum
91. dcharged gt lt polrule gt right_trapped lt polrule gt lt mnmchemgroup gt lt mnmchemgroup gt lt name gt Lateral phenol lt name gt lt pka gt 10 1 lt pka gt lt acidcharged gt FALSE lt acidcharged gt lt polrule gt never_trapped lt polrule gt lt chemgrouprule gt APPENDICES 163 lt entity gt MONOMER_MODIF lt entity gt lt name gt Phosphorylation lt name gt lt outcome gt LOST lt outcome gt lt chemgrouprule gt lt mnmchemgroup gt lt monomer gt lt monomers gt lt modifs gt lt modif gt lt name gt Phosphorylation lt name gt lt mdfchemgroup gt lt name gt none_set lt name gt lt pka gt 1 2 lt pka gt lt acidcharged gt FALSE lt acidcharged gt lt mdfchemgroup gt lt mdfchemgroup gt lt name gt none_set lt name gt lt pka gt 6 5 lt pka gt lt acidcharged gt FALSE lt acidcharged gt lt mdfchemgroup gt lt modif gt lt modifs gt lt pkaphpidata gt 164 CHAPTER 11 APPENDICES GNU GENERAL PUBLIC LICENSE TEXT GNU GENERAL PUBLIC LICENSE Version 3 29 June 2007 Copyright 2007 Free Software Foundation Inc http fsf org Everyone is permitted to copy and distribute verbatim copies of this license document but changing it is not allowed Preamble The GNU General Public License is a free copyleft license for software and other kinds of works The licenses for most software and other practical works are designed to take away your freedom to share and change the
92. ditor window the Selected Monomer target radiobutton is on by default It is then simply a matter of choosing the right modification from the Available modifications list and clicking onto the Modify button The target s of a given modification as selected in the Target frame widget can be identified according to The Selected Monomer frame will display data in its two line edit widgets if a single monomer vignette was selected at the time the monomer mod ification action was invoked exactly as in Figure 8 11 on the next page Only the monomer of which the code and the position are displayed will be modified even if it is no more selected or if the sequence has changed and the monomer at the displayed position is not the same anymore The Current Selection radiobutton widget indicates that the modification should be performed on all the monomers that are currently selected that is if the selection changed after the modification window was displayed the new selection is modified not the old one The Monomers Of Same Code If a monomer code is displayed in the Selected Monomer frame all the monomers in the sequence that have that code are modified Monomers From The List All the monomers in the polymer sequence having a code corresponding to any code selected in the Available Monomers list are modified All Monomers All the monomers of the polymer sequence are modified 3Note that if a sequence was selected when
93. does not correspond to the nominal molecular mass of the analyte the ionizing proton is weighed along with the Glycine molecule Imagine now that by some magic this same Glycine molecule just gets protonated a second time Let s do exactly the same type of calculation as above and try to predict what value will be printed onto the mass spectrum the un ionized analyte Glycine has the following formula 5 5 5 1 the molecular mass is thus M 75 033 Da the analyte gets protonated in the mass spectrometer two times C2H502N 2H C gt H7O3N the measured mass of the ion is thus m 75 033 2 01564 Da and the charge beared by the ion is thus z 2 37 the peak value read on the mass spectrum for this analyte will thus be with z 2 m 2 01564 Z value 38 52 At this point it is absolutely clear that a m z is not a molecular mass By the way if the Glycine happened to be ionized negatively the calculation would have been analogous to the one above but instead of adding the mass of the proton s we would have removed it Summing up all this in a few words an ionization involves one or more charge transfer s and in most cases at least in biopolymer mass spectrometry also involves matter transfer s It is crucial not to forget the matter transfer s when ionizing an analyte This means that when an ionization process is described its description ought to be complete clearly stating
94. e usr local bin massxpert file The following are the dependencies for massXpert as obtained using the 1dd command linux gate so 1 gt Oxffffe000 libQtSvg so 4 gt usr lib libQtSvg so 4 Oxb7ebf000 libQtGui so 4 gt usr lib libQtGui so 4 0xb77a9000 libpngi2 so 0 gt usr lib libpngi2 so 0 0xb7786000 libSM so 6 gt usr lib libSM so 6 0xb777d000 libICE so 6 gt usr lib libICE so 6 0xb7766000 libXi so 6 gt usr lib libXi so 6 0xb775e000 libXrender so 1 gt usr lib libXrender so 1 0xb7756000 libXrandr so 2 gt usr lib libXrandr so 2 0xb7750000 libXcursor so 1 gt usr lib libXcursor so 1 0xb7747000 libXinerama so 1 gt usr lib libXinerama so 1 0xb7743000 libfreetype so 6 gt usr lib libfreetype so 6 0xb76d4000 libfontconfig so 1 gt usr lib libfontconfig so 1 0xb76a9000 libXext so 6 gt usr lib libXext so 6 0xb769b000 libX11 so 6 gt usr lib libX11 s0 6 0xb75af000 libQtXml1 so 4 gt usr lib libQtXml so 4 0xb7556000 libQtNetwork so 4 gt usr lib libQtNetwork so 4 0xb74c4000 libQtCore so 4 gt usr lib libQtCore so 4 0xb734e000 libz so 1 gt usr lib libz so 1 0xb7339000 libpthread so 0 gt lib i686 cmov libpthread so 0 0xb7322000 libdl so 2 gt lib i686 cmov libdl so 2 0xb731e000 libm so 6 gt lib i686 cmov libm so 6 0xb72f9000 libstdc t so 6 gt usr lib libstdc so 6 0xb720d000 libgec_s so 1 gt lib libgcc_s so 1 0xb7202000
95. e it is necessary to create at least one list of m z z pairs which is referred to by input m z list for short That kind of list is actually a tree view widget that is embedded in a dialog window The first column of the tree view widget holds the m z value and the second column the z value To create a new input m z list the user clicks onto the button labelled New list This will trigger the opening of an input dialog window where the user enters an unambiguous name for the new input m z list The new input m z list dialog window shows up empty like in Figure 9 2 on the facing page Note that upon creation of a new input m z list its name is used to refer to it in the two list widgets on the left of the mzLab window This way it will be 109 massXpert mz Lab List 1 centrin2 human PX Figure 9 2 mzLab s empty input m z list dialog window The mzLab s input m z list dialog window that shows up when the user creates a new input m z list is empty Filling that list is performed by drag and drop operations possible later to refer to the various input m z lists by their name Therefore it might make sense to use a meaninfgul name for the lists FILLING OF THE DATA IN INPUT M Z LISTS Once a new input m z list has been named and created it is necessary to fill it with m z z pairs This is performed via drag and drop operations There might be a number of different data sources to be used for the dragging of da
96. e 8 17 Spectrum simulation for cleavage obtained oligomers This figure shows how to configure the calculation of a spectrum for a set of oligomers obtained after the cleavage of a polymer sequence Results tab page widget for the same spectrum x y pairs During the calculation the Log tab page widget shows the details of the running calculation For example the following is the log for the first two oligomers of a set of 123 Simulating a spectrum with calculation of an isotopic cluster for each oligomer There are 123 oligomers Calculating sub spectrum for each Computing isotopic cluster for oligomer 1 formula C82H123N22025 Validating formula Success mono m z 1815 9 charge 1 fwhm 0 18159 increment 0 024212 Done computing the cluster Computing isotopic cluster for oligomer 2 formula C82H124N22025 Validating formula Success mono m z 908 455 charge 2 fwhm 0 0908455 increment 0 00605637 Done computing the cluster 92 CHAPTER 8 XPERTEDIT 210 datale 180 150 90 it J 744 747 750 753 756 m z Figure 8 18 Simulated spectrum for cleavage obtained oligomers This spectrum zoomed portion viewed in mMass has been simulated starting from a list of oligomers obtained by cleaving the horse apomyoglobin protein with trypsin The previous example dealt with the horse apomyoglobin that was cleaved with trypsin with 1 partial
97. e Purified Sequence text edit widget Also the user is provided with automatic purification procedures whereby it is possible to remove one or more classes of characters from the imported sequence Purification Options frame widget Checking one or more of the Nu merals or Spaces or Punctuation or LowerCase or Uppercase checkbuttons or even entering other user specified regular expressions in the Other RegExp line edit widget will elicit their removal from the imported sequence after the user clicks the Purify Initial Options button When the user is confident that almost all the erroneous characters have been removed Figure 8 10 on the next page she can click the Test Purified button which will trigger a re reading of the sequence in the Purified Sequence text edit widget If erroneous characters are still found they are tagged Note that for maximum flexibility the user is allowed an immediate and direct editing of the purified sequence in the Purified Sequence text edit widget that is that text edit widget is not read only Once the sequence if finally depured from all the invalid characters the user can select it in the text edit widget and paste it in the XpertEdit sequence editor This time the paste operation will be error free Note that if any sequence portion is currently selected it will be replaced by the one that is being pasted into the editor 81 massXpert Sequence Purification Initial Se
98. e different cases will be described from simple to more com plex SIMPLE FRAGMENTATION PATTERNS One simple example of polymer chain fragmentation is the formation of a frag ments with a nucleic acid DNA in this example The fragments obtained by a type fragmentation are described in Figure 3 9 on page 30 Bond cleavage occurs right before the sugar carbon linked oxygen of the phosphoester bond linking one deoxyribonucleotide to the next Thus the molecular weight of the fragment corresponds as illustrated to the sum of the monomer masses from the left end of the polymer up to and including the monomer being decomposed less one oxygen Thus the formula of the a fragmentation pattern is Therefore the definition of the a DNA fragmentation pattern is as described in Figure 6 9 were wee see that the Name of the fragmentation specification for a fragments is a that the Formula is O that the fragments encompass the LE for left end End of the polymer chain The Side chain value is set to 0 which will be explained later 94 CHAPTER 6 XPERTDEF MORE COMPLEX FRAGMENTATION PATTERNS In nucleic acids gas phase chemistry it often happens that not only fragmenta tion occurs at the level of the phospho ribose skeleton but also at the level of the nucleic base These fragmentation patterns are called abasic patterns The decomposition of the base occurs at the monomer position where the fragmenta tion occurs For example if a
99. e explicitly affirms your unlimited permission to run the unmodified Program The output from running a covered work is covered by this License only if the output given its content constitutes a covered work This License acknowledges your rights of fair use or other equivalent as provided by copyright law You may make run and propagate covered works that you do not con vey without conditions so long as your license otherwise remains in force You may convey covered works to others for the sole purpose of having them make modifications exclusively for you or provide you with facili ties for running those works provided that you comply with the terms of this License in conveying all material for which you do not control copy right Those thus making or running the covered works for you must do so exclusively on your behalf under your direction and control on terms that prohibit them from making any copies of your copyrighted material outside their relationship with you 167 Conveying under any other circumstances is permitted solely under the conditions stated below Sublicensing is not allowed section 10 makes it unnecessary Protecting Users Legal Rights From Anti Circumvention Law No covered work shall be deemed part of an effective technological measure under any applicable law fulfilling obligations under article 11 of the WIPO copyright treaty adopted on 20 December 1996 or similar laws prohibiting or restricting circ
100. e gt lt mnmchemgroup gt lt mnmchemgroup gt lt name gt C term COOH lt name gt lt pka gt 2 35 lt pka gt lt acidcharged gt FALSE lt acidcharged gt lt polrule gt right_trapped lt polrule gt lt mnmchemgroup gt lt monomer gt lt monomer gt lt code gt H lt code gt lt mnmchemgroup gt lt name gt N term NH2 lt name gt lt pka gt 9 6 lt pka gt lt acidcharged gt TRUE lt acidcharged gt lt polrule gt left_trapped lt polrule gt lt mnmchemgroup gt lt mnmchemgroup gt lt name gt C term COOH lt name gt lt pka gt 2 36 lt pka gt lt acidcharged gt FALSE lt acidcharged gt lt polrule gt right_trapped lt polrule gt lt mnmchemgroup gt lt mnmchemgroup gt lt name gt In ring NH lt name gt lt pka gt 6 lt pka gt lt acidcharged gt TRUE lt acidcharged gt lt polrule gt never_trapped lt polrule gt lt mnmchemgroup gt lt monomer gt lt monomer gt lt code gt I lt code gt lt mnmchemgroup gt lt name gt N term NH2 lt name gt APPENDICES lt pka gt 9 6 lt pka gt lt acidcharged gt TRUE lt acidcharged gt lt polrule gt left_trapped lt polrule gt lt chemgrouprule gt lt entity gt LE_PLM_MODIF lt entity gt lt name gt Acetylation lt name gt lt outcome gt LOST lt outcome gt lt chemgrouprule gt lt mnmchemgroup gt lt mnmchemgroup gt lt name gt C term COOH lt name gt lt pka gt 2 35 lt pka gt lt acidcharged gt FALSE lt acidcharged gt lt polrule gt right
101. e gt lt code gt L lt code gt lt formula gt C6H11NO lt formula gt lt mnm gt lt mnm gt lt name gt Isoleucine lt name gt lt code gt I lt code gt formula C6H11N0 formula mnm mnm lt name gt Serine lt name gt lt code gt S lt code gt lt formula gt C3H5N02 lt formula gt lt mnm gt lt mnm gt lt name gt Threonine lt name gt lt code gt T lt code gt lt formula gt C4H7N02 lt formula gt lt mnm gt lt mnm gt lt name gt Cysteine lt name gt lt code gt C lt code gt lt formula gt C3H5NOS lt formula gt lt mnm gt lt mnm gt lt name gt Methionine lt name gt lt code gt M lt code gt lt formula gt C5H9NOS lt formula gt lt mnm gt lt mnm gt lt name gt Arginine lt name gt APPENDICES 147 lt code gt R lt code gt lt formula gt C6H12N40 lt formula gt lt mnm gt lt mnm gt lt name gt Lysine lt name gt lt code gt K lt code gt lt formula gt C6H12N20 lt formula gt lt mnm gt lt mnm gt lt name gt Aspartate lt name gt lt code gt D lt code gt lt formula gt C4H5N03 lt formula gt lt mnm gt lt mnm gt lt name gt Glutamate lt name gt lt code gt E lt code gt lt formula gt C5H7NO3 lt formula gt lt mnm gt lt mnm gt lt name gt Asparagine lt name gt lt code gt N lt code gt lt formula gt C4H6N202 lt formula gt lt mnm gt lt mnm gt lt name gt Glutamine lt name gt lt code gt Q lt code gt lt for
102. e gt lt isotope gt lt mass gt 137 9052360000 lt mass gt lt abund gt 71 6980000000 lt abund gt lt isotope gt lt atom gt lt atom gt lt name gt Lanthanium lt name gt lt symbol gt La lt symbol gt lt isotope gt lt mass gt 137 9071140000 lt mass gt lt abund gt 0 0900000000 lt abund gt lt isotope gt lt isotope gt lt mass gt 138 9063550000 lt mass gt lt abund gt 99 9100000000 lt abund gt lt isotope gt lt atom gt lt atom gt lt name gt Gold lt name gt lt symbol gt Au lt symbol gt lt isotope gt lt mass gt 196 9665600000 lt mass gt lt abund gt 100 0000000000 lt abund gt lt isotope gt lt atom gt lt atom gt lt name gt Mercury lt name gt lt symbol gt Hg lt symbol gt lt isotope gt lt mass gt 195 9658120000 lt mass gt lt abund gt 0 1500000000 lt abund gt lt isotope gt lt isotope gt lt mass gt 197 9667600000 lt mass gt lt abund gt 9 9700000000 lt abund gt lt isotope gt APPENDICES lt isotope gt lt mass gt 198 9682690000 lt mass gt lt abund gt 16 8700000000 lt abund gt lt isotope gt lt isotope gt lt mass gt 199 9683160000 lt mass gt lt abund gt 23 1000000000 lt abund gt lt isotope gt lt isotope gt lt mass gt 200 9702930000 lt mass gt lt abund gt 13 1800000000 lt abund gt lt isotope gt lt isotope gt lt mass gt 201 9706320000 lt mass gt lt abund gt 29 8600000000 lt abund gt lt isotope gt lt iso
103. e gt Sodium lt name gt lt symbol gt Na lt symbol gt lt isotope gt lt mass gt 22 9897697000 lt mass gt lt abund gt 100 0000000000 lt abund gt lt isotope gt lt atom gt lt atom gt lt name gt Magnesium lt name gt lt symbol gt Mg lt symbol gt lt isotope gt lt mass gt 23 9850450000 lt mass gt lt abund gt 78 9900000000 lt abund gt lt isotope gt lt isotope gt lt mass gt 24 9858392000 lt mass gt lt abund gt 10 0000000000 lt abund gt lt isotope gt lt isotope gt lt mass gt 25 9825954000 lt mass gt 128 CHAPTER 11 APPENDICES lt abund gt 11 0100000000 lt abund gt lt isotope gt lt atom gt lt atom gt lt name gt Aluminium lt name gt lt symbol gt Al lt symbol gt lt isotope gt lt mass gt 26 9815413000 lt mass gt lt abund gt 100 0000000000 lt abund gt lt isotope gt lt atom gt lt atom gt lt name gt Silicon lt name gt lt symbol gt Si lt symbol gt lt isotope gt lt mass gt 27 9769284000 lt mass gt lt abund gt 92 2297000000 lt abund gt lt isotope gt lt isotope gt lt mass gt 28 9764964000 lt mass gt lt abund gt 4 6832000000 lt abund gt lt isotope gt lt isotope gt lt mass gt 29 9737717000 lt mass gt lt abund gt 3 0872000000 lt abund gt lt isotope gt lt atom gt lt atom gt lt name gt Phosphorus lt name gt lt symbol gt P lt symbol gt lt isotope gt lt mass gt 30 9737634000 lt mass gt lt abund gt 100 00000
104. e gt Titanium lt name gt lt symbol gt Ti lt symbol gt lt isotope gt lt mass gt 45 lt abund gt 8 lt isotope gt lt isotope gt lt mass gt 46 lt abund gt 7 lt isotope gt lt isotope gt lt mass gt 47 9526327000 lt mass gt 2500000000 lt abund gt 9517649000 lt mass gt 4400000000 lt abund gt 9479467000 lt mass gt lt abund gt 73 7200000000 lt abund gt lt isotope gt 131 lt isotope gt lt mass gt 48 9478705000 lt mass gt lt abund gt 5 4100000000 lt abund gt lt isotope gt lt isotope gt lt mass gt 49 9447858000 lt mass gt lt abund gt 5 1800000000 lt abund gt lt isotope gt lt atom gt lt atom gt lt name gt Vanadium lt name gt lt symbol gt V lt symbol gt lt isotope gt lt mass gt 49 9471613000 lt mass gt lt abund gt 0 2500000000 lt abund gt lt isotope gt lt isotope gt lt gt 50 9439625000 lt gt lt abund gt 99 7500000000 lt abund gt lt isotope gt lt atom gt lt atom gt lt name gt Chromium lt name gt lt symbol gt Cr lt symbol gt lt isotope gt lt mass gt 49 9464630000 lt mass gt lt abund gt 4 3450000000 lt abund gt lt isotope gt lt isotope gt lt mass gt 51 9405097000 lt mass gt lt abund gt 83 7890000000 lt abund gt lt isotope gt lt isotope gt lt mass gt 52 9406510000 lt mass gt lt abund gt 9 5010000000 lt abund gt lt isotope gt lt isotope gt lt mass gt 53 938882200
105. e in the Resolution line edit widget It is possible to set the FWHM directly gaussian or lorentzian Kind of curve that is calculated for each peak in the cluster The gaussian curves have a steeper ascending and descending segments than the lorentzian curves Experiment with both to find the best one 67 Points Set the number of points desired to make the curve of a single isotopic peak Entering 100 means that there will be 50 points on the left of the centroid of the isotopic peak and 49 on its right Increment Interval between any two points of the curve making the isotopic peak This value is calculated on the basis of m z Points and Resolution Max Peaks Maximum number of peaks in the isotopic pattern This allows a degree of optimization when calculations are too long to perform by limiting the number of isotopic peaks in the pattern to the set value the number of peaks in the isotopic peaks pattern increases exponentially with the numer of atoms Output File Button to click so as to choose a file in which all the data are to be stored for later plotting of the isotopic peaks pattern spectrum Locale If checked the results should be displayed or written to file using the current locale It might be useful not to check this check box widget in case the plotting program does not understand numerical values as produced by the currrent locale For example some plotting programs do not understand values like 140 00
106. e other is avg the user will be alerted about this point 1Note that if the oligomer is a fragmentation oligomer the tri protonated analyte is con verted to the canonical oligomer bearing a single charge 114 CHAPTER 9 XPERTMINER T masskpert mz Lab protein t letter Working lists Default ionization Perform matches between two input lists Input 1 list Input 2 list Unitary formula Unitary charge Tolerance trypsin mass spec H 1 tryspin massxpert AMU 001 lonization level 1 5 Perform matches Actions on a single list Substrate list and modality Input Input 2 Perform computation in place masskpertimzlab x db 2 mzlab 2 massxper mz Lab trypsin mas Vryspin massxpert trypsin mass spec Vrypsin mass spec vs tryspin massxpert miz z 2 mz 2 also CN II 4506450041 B 427831644 1 228373793 2 mzi 21 z2 Eror 2 113 08448 1 1 522 82456 3 4105 19 1 4105 19 1 0 1 779 92562 1 5 912 12871 T 2053 1 rs 410519 1 0 662 36596 1 2 956 56827 2 1369 07 3 410519 1 0 2 888 42151 chi 1 371 38145 3 4273 32 1 4279 32 1 0 27253493 1 YO 224118844 1 214016 2 427832 1 0 489 29378 1 1 121 09863 2 1427 11 3 427932 1 0 140063877 1 74773503 3 211308 1 211308 1 0 1 889 80748 i on 2 295 17823 1 1057 05 2 211309 1 0 132465974 1 114809303 2 705037 3 211308 1 0 922 51506 1 765 73129 177933 i 177993 1 0 3 052 47664 1 3 027 51647 1 890 467 2 177993 1 0 2 965 44461 1 151426215 2 593 98 3
107. ed gt lt polrule gt right_trapped lt polrule gt lt mnmchemgroup gt lt mnmchemgroup gt lt name gt Lateral COOH lt name gt lt pka gt 4 25 lt pka gt lt acidcharged gt FALSE lt acidcharged gt lt polrule gt never_trapped lt polrule gt lt chemgrouprule gt lt entity gt MONOMER_MODIF lt entity gt lt name gt AmidationGlu lt name gt lt outcome gt LOST lt outcome gt lt chemgrouprule gt lt mnmchemgroup gt lt monomer gt lt monomer gt lt code gt F lt code gt lt mnmchemgroup gt lt name gt N term NH2 lt name gt lt pka gt 9 6 lt pka gt lt acidcharged gt TRUE lt acidcharged gt lt polrule gt left_trapped lt polrule gt lt chemgrouprule gt lt entity gt LE_PLM_MODIF lt entity gt lt name gt Acetylation lt name gt lt outcome gt LOST lt outcome gt lt chemgrouprule gt lt mnmchemgroup gt lt mnmchemgroup gt lt name gt C term COOH lt name gt 156 CHAPTER 11 lt pka gt 2 35 lt pka gt lt acidcharged gt FALSE lt acidcharged gt lt polrule gt right_trapped lt polrule gt lt mnmchemgroup gt lt monomer gt lt monomer gt lt code gt G lt code gt lt mnmchemgroup gt lt name gt N term NH2 lt name gt lt pka gt 9 6 lt pka gt lt acidcharged gt TRUE lt acidcharged gt lt polrule gt left_trapped lt polrule gt lt chemgrouprule gt lt entity gt LE_PLM_MODIF lt entity gt lt name gt Acetylation lt name gt lt outcome gt LOST lt outcome gt lt chemgrouprul
108. ed gt FALSE lt acidcharged gt lt polrule gt never_trapped lt polrule gt This element indicates that what ever the position of the monomer bearing the chemical group in the poly mer sequence left end right end or middle the chemical group is to be evaluated lt chemgrouprule gt This element provides further details on the chemistry that the chemical group at hand might be involved in lt entity gt MONOMER_MODIF lt entity gt This element indicates that the supplementary data in the current lt chemgrouprule gt element are per taining to the chemical group only in case the monomer bearing the chemical group is chemically modified lt name gt AmidationAsp lt name gt This is the modification by which the monomer should be modified in order to have the lt chemgrouprule gt element effectively evaluated lt outcome gt LOST lt outcome gt This element actually indicates that if the monomer bearing the chemical group is modified with an Ami dationAsp chemical modification then the chemical group should not be evaluated any more for the electrical charge or pI cal culations since reacting a carboxylate group with an amino group produces an amide group which is not easily chargeable at physiolog ical pH values At this point we should have made it clear how the charge calculations can be configured for the different monomers in the polymer chemistry definition As usual the more
109. eflect improvements in the graphical display of the chem ical pad buttons as programmed in the chem pad conf configuration files april 2009 the 1st Although not visible in the documentation I wanted to publically extend my warm thanks to Lionel lie Mamane who helped me along these last months with the Debian packaging of massXpert Note that this work also proved useful for other areas in the project february 2009 the 20th Updated the XpertEdit chapter to show how to configure the options about the number of decimals to be used for display of numerals in the program february 2009 the 5th Updated the XpertEdit chapter to show the sim plified polymer sequence editing feature whereby editing of the sequence might be performed by clicking on monomer items in the list of all the monomers defined in the polymer chemistry definition Fixed small bug in the documentation of about multi region selection behaving as oligomers or residual chains december 2008 the 11th Updated the XpertEdit chapter to show the feature by which it is now possible to force the calculation engine to take into account the left right end modification s when calculating the masses of a sequence region that does not encompass the left right end of the polymer sequence This new feature was essential in trying to perform full simulations of the molecular heterogeneity of the telokin protein Rusconi et al 1997 Biochemistry Added a paragraph about max count o
110. elect from one of the repositories a package that also contains the MinGW package qt win opensource 4 3 0 mingw exe When the installer asks if MinGW should be installed say Yes Once the installation of the Qt libraries has been performed the system menu will have a menu Qt by Trolltech Qt 4 2 3 Build Debug Libraries Select that menu and answer yes to the question that is asked in a console window This will build the libraries in the Debug mode so that it will be possible to compile massXpert later Once that compilation is finished continue with the build steps for massXpert To unpack the source tarball use the 7zip package http www 7 zip org download html Free Software GNU LGPL license to extract the source to any location of your choice At this point the steps to make the software are similar to what described above using the CMake program for MS Windows which is by the way graphical and not command line To install the software you should probably become administrator and issue the following command make install lt At this point the software should be installed Note that in this case no shortcut to the program is installed the user might want to do that manually SOFTWARE PACKAGE RELOCATION As mentioned earlier the massXpert software package might be relocated by copying its system directories in other places than the ones it was built for When the massXpert software program is run the first thing
111. elections and regions Multi region Multi selection Residual chains Mor Modifications Cross links Tonization Unitary Formula Unitary charge 1 S Tonization level 1 Io mo OoAOSm c rroe 0 lQc zumo mJmu or xmzTn m Ic 00000 HI3 o0oOI mr z 5 mo zoor mJ uocmrI o m I XOoooo0r ummlImT o cIWH A M E T W T K T R A F G RIV E Y R E G Q 4240 40 EIS GVC KTD KSK VVH FLT PTI POL RVV DS CVP LIP QEE VTE QLG MTS MAC MGN ECL Figure 8 3 The XpertEdit module This figure shows a polymer sequence displayed in an XpertEditor window Multi selection If checked the sequence editor allows not only the selection of multiple regions at any given time but also the selection of totally or partially overlapping regions Oligomers When multiple regions are selected each selected region behaves like an oligomer that is it gets its left and right end caps added if the corresponding calculation engine configuration item is activated Residual chains When multiple regions are selected the different re gions behave like residual chains the left and end caps are added only once if the corresponding calculation engine configuration item is activated Monomers Modifications If checked the monomer modifications will be taken into account Cross links If checked the cross links in the polymer sequence
112. elow for a detailed explanation Here are some examples of more complex cleavage patterns Trypsin K R K P Trypsin cuts right of a K and right of a R But it does not cut right of a K if this K is immediately followed by a P EndoAspN D EndoAspN cuts left of a 52 CHAPTER 6 XPERTDEF Hypothetical T YS PGT HYT MNOP K MNOP Hypo thetical cuts after T if it is followed by YS and also cuts after T if preceded by PG and followed by HYT Also Hypothetical cuts prior to if M is followed by NOP and if M is not preceded by Please do note that the letters in the examples above correspond to monomer codes and not to monomer names If for example we were defining a Trypsin cleavage specification pattern in a protein polymer chemistry definition with the standard 3 character monomer codes we would have defined it this way Trypsin Lys Arg Lys Pro Now comes the time to explain in more detail what the Left Code and Left Formula along with the Right siblings are for For this we shall consider that we have the following polymer sequence 1 monomer codes THISMWILLMBECUTMANDTHATMALSO If that sequence had been cleaved us ing CyanogenBromide and if the cleavage had been total that would have generated the following oligomers THISM WILLM BECUTM ANDTHATM ALSO But if there had been partial cleavages one or more of
113. emgroup gt lt name gt N term NH2 lt name gt lt pka gt 9 6 lt pka gt lt acidcharged gt TRUE lt acidcharged gt lt polrule gt left_trapped lt polrule gt lt chemgrouprule gt lt entity gt LE_PLM_MODIF lt entity gt lt name gt Acetylation lt name gt lt outcome gt LOST lt outcome gt lt chemgrouprule gt lt mnmchemgroup gt lt mnmchemgroup gt lt name gt C term COOH lt name gt lt pka gt 2 35 lt pka gt lt acidcharged gt FALSE lt acidcharged gt lt polrule gt right_trapped lt polrule gt lt mnmchemgroup gt lt monomer gt lt monomer gt lt code gt C lt code gt lt mnmchemgroup gt 154 CHAPTER 11 lt name gt N term NH2 lt name gt lt pka gt 9 6 lt pka gt lt acidcharged gt TRUE lt acidcharged gt lt polrule gt left_trapped lt polrule gt lt chemgrouprule gt lt entity gt LE_PLM_MODIF lt entity gt lt name gt Acetylation lt name gt lt outcome gt LOST lt outcome gt lt chemgrouprule gt lt mnmchemgroup gt lt mnmchemgroup gt lt name gt C term COOH lt name gt lt pka gt 2 35 lt pka gt lt acidcharged gt FALSE lt acidcharged gt lt polrule gt right_trapped lt polrule gt lt mnmchemgroup gt lt mnmchemgroup gt lt name gt Lateral SH2 lt name gt lt pka gt 8 3 lt pka gt lt acidcharged gt FALSE lt acidcharged gt lt polrule gt never_trapped lt polrule gt lt mnmchemgroup gt lt monomer gt lt monomer gt lt code gt D lt code gt lt mnmchemgroup gt
114. en in this figure if so desired definition window that shows up the user accomplishes two different tasks Define the name of the polymer chemistry definition Define singular data like the left cap and the right cap of the polymer the ionization rule governing the default ionization of the polymer sequence Define the atoms needed to operate the different polymer chemistry enti ties these are plural data Define all the polymer chemistry entities needed to work on polymer se quences all these are also plural data The definition of the atoms and of all the chemical entities belonging to a given polymer chemistry are collectively called a polymer chemistry definition The polymer chemistry definition window that shows up is shown in Figure 6 2 on the facing page THE ATOMS The definition of the atoms is performed through the user interface shown in Figure 6 3 on page 46 Atoms button in the polymer chemistry definition win dow In this dialog the user defines chemical elements atoms as entities made of isotopes at least one isotope per atom logically The design of this dialog window follows the general design for all the dia log windows related to the definition of plural data in the polymer chemistry definition The leftmost list widget Atoms lists the final object as defined and available in the polymer chemistry definition in this case the atoms while the second list widget Isotop
115. ent Furthermore we can also see that a fragmentation is not a cleavage because the fragment that is generated is absolutely not necessarily what we call a polymer in the sense that the fragment might not be capped the same way as the precursor polymer is that is the fragment is not in its finished polymerizaton state The two observations above should make clear to the reader that calculating masses for fragments is a more difficult process than what was described above for the oligomers Indeed while it was simple to calculate the mass of an oligomer by simply adding the masses of its constitutive monomer units plus the left and right caps plus ionization here there is no chemical formalism generally applicable to all the fragment types This is why the specification of the fragmentation is left to the user s responsibility By looking at Figure 3 8 the reader should have noticed that the fragment naming scheme takes into consideration the fact that the fragment bears the left or the right end of the precursor polymer or none also Indeed the number ing of fragments holding the left end of the precursor polymer sequence begins at the left end and for fragments that hold the right end at the right end Thus the third fragment of series a a3 would involve monomers 1 3 and the third fragment of series y y3 would involve monomers 6 4 in the fig ure these left to right and right to left directions are symbolized using
116. ent The structure of the data is first described in a section of the document that is called the Document Type Definition DTD and the data follow in the same file One of the big advantages of using such XML format in massXpert is that it is a text format and not a binary one This means that any data in the massXpert package is human readable even if the XML syntax makes it a bit difficult to read data it is actually possible Try to 41 read of the polymer chemistry definition XML files that are shipped with this software package and you ll see that these files are pure text files the same applies for the mxp XML polymer sequence files The advantages of using text file formats with respect to binary file formats are The data in the files are readable even without the program that created them Data extraction is possible even if it costs work Whenever a text document gets corrupted it remains possible to extract some valid data bits from its uncorrupted parts With a binary format data are chained from bit to bit loosing one bit lead to automatic corrup tion of all the remaining bits in the file Text data files are searchable with standard console tools sed grep which make it possible to search easily text patterns in any text file or thousands of these files in one single command line This is not possible with binary format simply because reading them require the program that knows how to decode the da
117. ent telling what action should be taken when encountering the lt entity gt on the chemgroup Valid values are either LOST or PRESERVED UNDERSTANDING By EXAMPLE Let us take some examples in order to make sure we actually understand the pro cess of describing how an electrical net charge is calculated for a given polymer sequence and at any given pH value Let us see the example of the aspartate amino acid of which the lateral chain is nothing but CHCOOH lt monomer gt lt code gt D lt code gt lt mnmchemgroup gt lt name gt N term NH2 lt name gt lt pka gt 9 6 lt pka gt lt acidcharged gt TRUE lt acidcharged gt lt polrule gt left_trapped lt polrule gt lt chemgrouprule gt lt entity gt LE_PLM_MODIF lt entity gt lt name gt Acetylation lt name gt lt outcome gt LOST lt outcome gt lt chemgrouprule gt lt mnmchemgroup gt lt mnmchemgroup gt lt name gt C term COOH lt name gt lt pka gt 2 36 lt pka gt lt acidcharged gt FALSE lt acidcharged gt lt polrule gt right_trapped lt polrule gt lt mnmchemgroup gt lt mnmchemgroup gt lt name gt Lateral COOH lt name gt lt pka gt 3 65 lt pka gt lt acidcharged gt FALSE lt acidcharged gt lt polrule gt never_trapped lt polrule gt lt chemgrouprule gt lt entity gt MONOMER_MODIF lt entity gt lt name gt AmidationAsp lt name gt lt outcome gt LOST lt outcome gt lt chemgrouprule gt lt mnmchemgroup gt lt monomer gt We
118. eoxy ribose sugar ring of the left monomer The bond that is formed is a phosphodiester bond with release of a pyrophos phate group PP Note that the sugar and nitrogenous bases are schematically represented in this figure Uracile As for proteins nucleic acids are polar polymers the polymerization process is polar from left to right sometimes left is up and right is down in certain vertical representations found mainly in textbooks This manual is not to teach biochemistry which is why the structure of the monomers is not described in atomic detail However since it is important to understand how the polymerization occurs Figure 3 3 represents the polymer ization reaction mechanism between a nucleotide and another one to yield a dinucleotide That reaction is a trans esterification A nucleic acid has a left end 5 end often this end is phosphorylated and a right end 3 end hy droxyl end The trans esterification reaction is the attack of the phosphorus of the new deoxy nucleotide triphosphate by the 3 OH of the right end of the elon gating nucleotidic chain Upon trans esterification an inorganic pyrophosphate PP is released and the formation of a phosphodiester bond between the two nucleotides yields a dinucleotide The elongation of the nucleic acid polymer is a simple repetition of this esterification reaction so that the chain growth is always in the 5 253 direction This is achieved in the living cells by wh
119. er This calculation 65 amp massXpert m z ratio calculator 6 x Initial status Formula C1209H1865N3180366S6 lonization rule Formula H Charge 1 Level 1 Mono m z 26 886 54241 Avg m z 26 903 11223 Target ionization status Formula H Starting level 1 Charge 1 Ending level 20 Actions Calculate To Clipboard v lon charge family Charge Mono Avg 1 26 886 54241 26 903 11223 2 13 443 77512 13 452 06009 3 8 962 85269 8 968 37604 4 6 722 39147 6 726 53401 5 5 378 11474 5 381 42880 6 4 481 93026 4 484 69199 7 3 841 79848 3 844 16570 8 3 361 69965 3 363 77098 9 2 988 28945 2 990 13064 10 2 689 56128 2 691 21837 11 2 445 14733 2 446 65379 12 2 241 46904 2 242 84996 13 2 069 12587 2 070 40058 14 1 921 40315 1 922 58682 15 1 793 37680 1 794 48156 16 1 681 35374 1 682 38946 17 1 582 50986 1 583 48466 AS 18 1 494 64864 1 495 56929 v Figure 7 5 The m z ratio calculator The m z calculator is rather straight forward to use Given some initial parameters the results are displayed in the lon Charge Family treeview widget 66 CHAPTER 7 XPERTCALC nassXpert Spectrum calculator Y Input data Log Results Input data Feedback m z Input data Formula C737H1148N18t 78 10 Will use the resolution Processing m z 1 733 58706 ET e gaussian _ lorentzian Points 100 Actions Resolution Increment 0 00231145 Output file Locale
120. er Serine Thr Threonine Asp Aspartate Asn Asparagine Calculation Engine Avg 205 1888918755 Gly Glycine Val Valine Calculation Engine Leu Leucine Monomer List Figure 8 6 Multi character code sequence editing in XpertEdit This figure shows the process by which it is made possible to edit polymer sequences with a monomer code set that allows more than one character per code the monomers see chapter 6 section 6 on page 47 It was noted also that it is not because the number of allowed characters is 3 for example that all the monomer codes of the polymer chemistry definition must be defined using three characters 3 is the maximum number of characters that may be used MULTI CHARACTER MONOMER CODES This section deals with the editing of a polymer sequence for which monomer codes can be made of more than one character Figure 8 6 shows the case of a polymer sequence for which the polymer chemistry definition allows three characters to define monomer codes The example is based on the following real world situation the user wants to edit the sequence by insertion at the cursor point of a new Aspartate monomer of which the user knows only that its code starts with an A The cursor is located after the first Ala monomer at position 1 panel Ist After keying in panel 186 no seq
121. er is trying to modify a monomer that is not a target of the mod ification at hand it will complain as shown in the Messages text edit widget of Figure 8 11 In this example indeed the user tried to modify monomer Isoleucine with Phosphorylation which is not possible because modification Phosphorylation has been defined a not having monomer Isoleucine as any of its targets Another situation where target limitations might show up is when trying to modify a monomer more than authorized by the Max count num ber of times that monomer might be modified at once with that modification For example when working of methylation of proteins it might happen that lysyl residues get methylated more than one at a time tri methylation occurs often in histones If the chemical modification was defined in XpertDef with a max count of 2 and a third chemical modification is asked on a given target monomer then the program refuses to perform the modification To override this limitation check the Override target limitations checkbox widget The general concept about this is the Override target limitations checkbox widget is unchecked by default so that the user does not do mistakes without knowing However flexibility is desirable and the Override target limitations checkbox widget can be checked if required As a result of the monomer modification the monomer vignette gets modi fied Figure 8 11 shows one phosphorylated Seryl residue at position 8 a
122. er the program non free The precise terms and conditions for copying distribution and modification follow TERMS AND CONDITIONS 0 Definitions This License refers to version 3 of the GNU General Public License Copyright also means copyright like laws that apply to other kinds of works such as semiconductor masks The Program refers to any copyrightable work licensed under this Li cense Each licensee is addressed as you Licensees and recipients may be individuals or organizations To modify a work means to copy from or adapt all or part of the work in a fashion requiring copyright permission other than the making of an exact copy The resulting work is called a modified version of the earlier work or a work based on the earlier work A covered work means either the unmodified Program or a work based on the Program To propagate a work means to do anything with it that without permis sion would make you directly or secondarily liable for infringement under applicable copyright law except executing it on a computer or modifying a private copy Propagation includes copying distribution with or with out modification making available to the public and in some countries other activities as well To convey a work means any kind of propagation that enables other parties to make or receive copies Mere interaction with a user through a computer network
123. ern Gluc Cleavage rule Name Homoseryl Left end Right end Code Code M Formula Formula CH2S O Apply ade Remove Add Ir Remove Move up Move down Move up gt Move down Validate Figure 6 8 XpertDef cleavage specifications definition Each cleavage specification is defined using a name a cleavage pattern and any number of cleavage rules Pattern M Sequence specificity of the cleavage agent In this case the cleavage agent cleaves the protein right after Methionyl residues Cleavage rule T his groupbox allows the definition of the cleavage rules that might be added to the cleavage specification Left Code and Left Formula Empty This is a special case for those cleavage agents that not only cut a polymer sequence usually it is a hydrolysis but that also modify the substrate in such a way that must be taken into account by massXpert so that it computes correct molecular masses for the resulting oligomers These rules are optional However if Left Code is filled with something then it is compulsory that Left Formula be filled with something valid also and conversely Right Code and Right Formula M and 25 03 respectively Same explanation as above This cleavage rule stipulates that upon cleav age of a protein using cyanogen bromide the methionyl residue that gets effectively cleaved must be converted to a homoseryl residue See b
124. es lists the objects that are defined in order to actu ally make the selected object in the first list widget thus atoms are made of isotopes We see that two isotopes were defined in order to create the Carbon atom To add a new atom the user clicks the Add button below Atoms list widget which triggers the insertion of a new row in the list widget The Details groupbox on the right side of the dialog window now shows Type name as the name of the atom and Type symbol as its symbol The list of isotopes is empty because we still did not define any First thing to do is to actually give the atom a name 45 massXpert Polymer Chemistry Definition protein EIER Name protein 1 letter Singular entities Caps Ionization rule Formula Left H Charge Right OH Level Plural entities Modifications Correctly opened file 5 Figure 6 2 XpertDef polymer chemistry definition window All the polymer chemistry entities are defined in this window The different buttons dealing with atoms monomers modifications cross linkers cleavage and frag mentation specifications open up specific dialogs see below and a symbol The are no length limitations to any of the new data but a reasonable limit is 3 characters for the symbol the first being uppercase and all the remaining ones lowercase Use only alphabetic characters that is a zA Z Once these two data are set cli
125. existent in the program each time a new uppercase letter is keyed in it is automatically validated and the corresponding monomer is created in the sequence ERRONEOUS MONOMER CODES The typing error detection system triggers immediate alerts whenever the code beign keyed in is incorrect This is described in Figure 8 7 on the following page If the user enters an uppercase character not matching any monomer code currently defined in the polymer chemistry definition or a lowercase character as the first character of a monomer code the program immediately complains 78 CHAPTER 8 XPERTEDIT File Edit Chemistry r Masses Sequence Name Ir Sequence 32 r Whole Sequence Mono 3 461 5510319600 Avg 3 463 6948014356 r Selected Sequence Mono 230 1140810400 Avg 230 2415241385 Calculation Engine Monomer List Gly Glycine Ala Alanine Val Valine Leu Leucine llezIsoleucine Ser Serine Figure 8 7 Bad code character in XpertEdit sequence editor This figure shows the feedback that the user is provided by the code editing engine when a bad character code is keyed in in the right line edit widget below the sequence In this case the monomer code is not put into the left text widget which means it is simply ignored If the user starts keying in valid monomer character codes like for example we did earlier with As and that she wants to erase these c
126. f chem ical modifications of a given monomer at once in the XpertDef chapter and another one in the XpertEdit chapter to explain its working september 2008 the 11th Finally indexed the whole document Per formed some minor modifications so that the documentation system does not produce HTML files anymore the HTML production was not really worth it anyways august 2008 the 5th Updated the user manual with a bunch of updated screen shots july 2008 the 30th Updated the XpertMiner chapter to illustrate the m z z mass list matching feature july 2008 the 8th Updated the XpertEdit chapter to illustrate the new multi cleavage feature july 2008 the 1st Updated the XpertEdit chapter to illustrate the new multi region and multi selection features may 2008 the 29th Changed the install instructions for the Mac OS X system may 2008 the 27th Added a chapter about XpertMiner to document the new features in that module Some fixes here and there may 2008 the 26th Modified the documentation to reflect switch to version 3 of the GNU General Public License april 2008 the 25th The installation chapter was updated to illustrate the installation of the software in the Mac OS X system april 2008 the 24th The installation chapter was updated to reflect the changes in the way the package might be installed the package is now relocatable provided the user indicates where the directories are located april 20
127. f each sequence and the calculations for each sequence FORMULZ AND CHEMICAL RE ACTIONS Any user of massXpert will inevitably have to perform two kinds of chemical simulations Define the formula of some chemical entity Define a given chemical reaction like a protein monomer modification for example While the definition of a formula poses no special difficulty the definition of a chemical reaction is less trivial as detailed in the following example The lysyl residue has the following formula 12 0 If that lysyl residue gets acetylated the acetylation reaction will read this way An acetic acid molecule will condense onto the amine of the lysyl side chain This can also read An acetyl group enters the lysyl side chain while a hydrogen atom leaves the lysyl side chain water is lost in the process The representation of that reaction is NH R NH CO CH H20 When the user wants to define that chemical reaction she can use that represen tation 2 or even the more brief but chemically equivalent In massXpert the chemical reaction representation is considered a valid formula THE massXpert FRAMEWORK DATA FORMAT All the data dealt with in massXpert are stored on disk as XML formatted files XML is the eXtensible Markup Language This language allows to describe the structure of a docum
128. f the analyte when these m z values were obtained These ionization data are entered in the lonization Rule frame which contains one line edit widget and two spin box widgets The Formula line edit widget lets the user indicate the ionization agent for us it is a protonation The Charge and Level widgets let the user indicate what is the charge brought by the Formula and the number of such ionization event In the example the protonation brings one 1 positive charge and the m z value corresponds to a mono protonation of the analyte With all these data the m z ratio calculator can reverse compute the molecular mass of the analyte not the ion mass That molecular mass will then be used to perform the requested m z ratio calculations Target loniza tion Status frame which behaves identically to the one described above The computed m z ratios are displayed in a treeview widget lon Charge Family It is possible to use the results to create a full spectrum out of the different m z values calculated Select Calculate spectrum from the Actions menu drop down list See next section for details Note that in this case the m z group box in the Input data group box are make inactive as the data are made available directly in the dialog window using the data computed here THE ISOTOPIC PEAKS CALCULATOR It is sometimes useful to predict or calculate a posteriori the isotopic peaks pattern of a given analyte also called an isotopic clust
129. fering access from a designated place gratis or for a charge and offer equivalent access to the Correspond ing Source in the same way through the same place at no further charge You need not require recipients to copy the Corresponding Source along with the object code If the place to copy the object code is a network server the Corresponding Source may be on a dif ferent server operated by you or a third party that supports equiv alent copying facilities provided you maintain clear directions next to the object code saying where to find the Corresponding Source Regardless of what server hosts the Corresponding Source you re main obligated to ensure that it is available for as long as needed to satisfy these requirements e Convey the object code using peer to peer transmission provided you inform other peers where the object code and Corresponding Source of the work are being offered to the general public at no charge under subsection 6d 169 A separable portion of the object code whose source code is excluded from the Corresponding Source as a System Library need not be included in conveying the object code work A User Product is either 1 a consumer product which means any tangible personal property which is normally used for personal family or household purposes or 2 anything designed or sold for incorporation into a dwelling In determining whether a product is a consumer prod uct doubtful cases sh
130. ften chargeable groups for example the amino group of amino acids is such that it gets protonated positively charged at a pH inferior to its pKa Similarly the carboxylic acid group of amino acids is deprotonated negatively charged at physiological pH SOME THEORY FIRST For the non biochemist reader amino acids involved in the formation of proteins have always at least two chemical groups that are of inverted electrical charge at physiological pH values see Figure 8 24 The amino group called has a typical pKa value of 9 6 This means that at physiological pH values between 6 5 and 7 5 the amino group will find the environment rather acidic and will thus be protonated leading to a positively charged species The carboxylic group called aCOOH has a typical pKa value of 2 35 This means that at physiological pH values the carboxylic group will be in a rather basic environment and will thus be deprotonated leading to a negatively charged species aCOO7 It should be clear that at physiological pH values the two a chemical groups have a net charge of 0 But proteins are charged and this is because some of the twenty common amino acids have other chemical groups beyond the two others already described Indeed some amino acids have lateral chains that bear groups that might be charged depending on the pH seryl residues have an alcohol group that has a pKa of 13 for example that means that it is alm
131. g any patent licenses granted under the third paragraph of section 11 However if you cease all violation of this License then your license from a particular copyright holder is reinstated a provisionally unless and until the copyright holder explicitly and finally terminates your license and b permanently if the copyright holder fails to notify you of the violation by some reasonable means prior to 60 days after the cessation Moreover your license from a particular copyright holder is reinstated permanently if the copyright holder notifies you of the violation by some reasonable means this is the first time you have received notice of violation of this License for any work from that copyright holder and you cure the violation prior to 30 days after your receipt of the notice Termination of your rights under this section does not terminate the li censes of parties who have received copies or rights from you under this License If your rights have been terminated and not permanently rein stated you do not qualify to receive new licenses for the same material under section 10 Acceptance Not Required for Having Copies You are not required to accept this License in order to receive or run a copy of the Program Ancillary propagation of a covered work occurring solely as a consequence of using peer to peer transmission to receive a copy likewise does not require acceptance However nothing other than this License grants you per
132. g dialog windows are easily filtered using the mechanism illustrated in Figure 8 21 97 Filtering on the data is easily performed by entering the options in the Filtering options group box Figure 8 21 page 96 For any filtering operation only one criterium can be used that is for example filtering can occur only on the basis of the monoisotopic mass or of the average mass but not on both masses For example if one wanted to filter a huge set of data against a specific monoisotopic mass of 850 plus or minus 3 atomic mass units it would simply be a matter of setting the monoisotopic mass to be 850 with a tolerance of 3 AMU in the corresponding line edit widgets contained in the Filtering options group box To perform that filtering action first set the tolerance value 3 in its line edit widget and next set the monoisotopic mass value to be 850 in the corresponding line edit widget While the cursor is still in the Mono line edit where 850 was entered press the keyboard key combination Ctrl ENTER The filtering will be immediate and the table view will show the data that passed the filter Note that the combo box widget holding the unit of the tolerance in the example that unit is AMU that is atomic mass unit and the line edit widget where the tolerance value proper is set 3 in the example do not trigger any filtering by themselves these widgets are only useful in conjunction with other oligomer data Mono Avg Error li
133. g how it actually works This directory contains the following kinds of files protein 1 letter xml the polymer chemistry definition file This is the file that is read upon selection of the corresponding polymer chemistry definition name in XpertDef If the polymer chemistry definition is not yet registered with the system described later then open that file by browsing to it by clicking the Cancel button svg files scalar vector graphics files used to render graphically the se quence in the sequence editor For example arginine svg contains the graphical representation of the arginine monomer There are such graph ics files also for the modifications like for example the sulphation svg contains the graphical representation of the sulphation modification Fig ure 10 1 shows two examples of svg files belonging to two distinct polymer chemistry definitions chem pad conf configuration file for the chemical pad in the XpertCalc module monomer dictionary file establishing the relationship between any monomer code of the polymer chemistry definition and the graphical svg file to be used to render graphically that monomer in the sequence editor modification dictionary file establishing the relationship between any monomer modification and the graphical svg file to be used to render graphically that modification onto the modified monomer in the sequence editor See chapter 6 page 43 3See section 8 page 83
134. g right of the cleavage location In this case the user would have to analyse the situation and provide massXpert with the proper chemical reaction by stating something analog to if and only if they have a Xyz monomer at their left end This introduction to polymer cleav age abstraction should be enough to later delve into the cleavage specification definition as massXpert conceives it and that is thoroughly detailed at page 50 POLYMER FRAGMENTATION In a fragmentation process the bond that is broken is not necessarily the inter monomer bond Indeed fragmentations are oft times high energy chemical pro cesses that can affect bonds that belong to the monomers internal structure This is one of the reasons why fragmentations do differ from cleavages they are specific of the polymer type in which they occur Hydrolyzing a protein and an oligosaccharide is just the same process from a chemical point of view But fragmenting a protein or an oligosaccharide are truly different processes because the way that the fragmentation happens in the polymer sequence is so much dependent on the nature of each monomer that makes it Another peculiarity of the fragmentations compared with the cleavages that 26 CHAPTER 3 BASICS IN POLYMER CHEMISTRY were described above is the fact that there is no cleaving molecule starting the process Instead a fragmentation process is often initiated by an intra molecu lar electron doublet rearragement that propagate
135. g with fragmentation data in the form of textual data It is not necessary to check this check box when dropping in the input m z list data obtained by fragmenting a sequence in massXpert because in that case the program knows that the oligomers are actually fragmentation oligomers and the check box gets checked automatically WORKING ON ONE INPUT M Z LIST Once an input m z list has been filled with data it becomes possible to perform simulations on these data Because there might be any number of input m z lists open at any given time it is necessary to identify the input m z list onto which to perform these simulations The selection of the input m z list is performed in two steps first the user indicates which list of input m z lists will contain the input m z list of interest select either Input 1 or Input 2 in the Substrate list and modality group box widget second in that list of input m z lists select the input m z list by its name If no list is selected then no simulation might be performed AVAILABLE CALCULATIONS There are a number of operations that might be performed all of which are selectable in the Actions on a single list group box widget The simulations are organized into two groups Formula based actions which involve processing the input m z lists with formulas that is chemical entities represented using formulas Apply formula will perform the same as above but starting from a formula This is where it
136. gra 1 massxpert 1 5 0 data pol chem defs protein 1 letter protein 1 letter xml c progra 1 massxpert 1 5 0 data pol chem defs protein 3 letters protein 3 letters xmil i H Figure 8 2 Selection of the polymer chemistry definition When creating a new polymer sequence it is necessary to first indicate of what polymer chem istry definition the polymer sequence will be This window lists all the polymer chemistry definition currently available on the system user starts editing a sequence the characters entered at the keyboard or pasted from the clipboard will be interpreted using the polymer chemistry definition that was selected in the initialization window described above Now of course editing a polymer sequence is not enough for a mass spec trometric oriented software suite what we want is compute masses The mass calculation process is immediately visible on the right hand side of the sequence editor shown in Figure 8 3 The Masses frame box widget contains two items Whole Sequence A frame box widget displaying the Mono and Avg masses of the whole polymer sequence irrespective of the current selection Selected Sequence A frame box widget displaying the Mono and Avg masses of the currently selected region of the polymer sequence The user may change the mass calculation engine configuration at any point in time using the widgets in the Calculation Engine tool box that contains the following configurable parameters
137. gure 7 3 Interface of the chemical pad This figure shows that the chem ical pad is very similar to what a numerical calculator would display Here the user has programmed a number of chemical reactions program their calculator This programming involves the definition of how a chemical pad or chempad may be arranged exactly the same way as a desktop calculator would display its numerical keypad The chemical pad can be shown hidden by using the Show Chemical Pad check box widget An example of such a chemical pad is shown in Figure 7 3 where protein 1 letter polymer chemistry definition associated chempad is featured As shown the user has programmed a number of chemical reactions that may be applied to the masses in the XpertCalc calculator window by simply clicking on their respective button see Figure 7 3 The configuration of the chemical pad is very easy as shown in the code below chempad columns 3 color aliceblue 240 248 255 color antiquewhite 250 235 215 colorfaqua 0 255 255 chempadgroup Generic chempadkey protonate Hi adds a proton chempadkey hydrate H201 adds a water molecule 0 1 01 1 an hydroxyl group chempadkey acetylate H1 C2H301 adds an acetyl group chempadkey phosphorylate A H H2P03 add a phosphate group chempadkey sulfide bond H2 oxydizes with loss of hydrogen chempadgroup Hexoses amp amp midnightblue chempadkey Res 1bRE He
138. haracters because she changed her mind she must not use the key because this key will erase the monomer left of the cursor point in the polymer sequence The way that the user has to remove the characters currently displayed in the left line edit widget below the sequence is to key in the key once for each character For example let s say you have already keyed in and s In this case the left line edit widget displays these two characters As Now if the user changes his mind not willing to enter Asp monomer code anymore but Gly instead all she has to do is to key in the key once for the s character which disappears and once more to remove the remaining A character At this point it is possible to start fresh with the Gly monomer code by keying in sequentially 6 and finally SIMPLIFIED EDITING When the monomer codes of a given polymer chemistry definition are too nu merous or too long to remember one simplified editing strategy is by using the list of available monomers located on the right side of the sequence editor wid 79 Sequence motif to find MetAlaMetlleSerGly Options Clear history Figure 8 8 Finding a sequence motif in the polymer sequence The first iteration should be performed by clicking onto the Find button and each following iterations should be performed using the Next button get labelled Monomer list The items in the list are act
139. hat the chem ical group should only be taken into account in the eventuality that the monomer bearing it code D is the left end monomer of the polymer sequence This can easily be understood as this chemical group is respon sible for the establishment of the inter monomer bond towards the left end of the polymer sequence lt chemgrouprule gt This element provides further details on the chemistry that this chemical group might be involved in lt entity gt LE_PLM_MODIF lt entity gt This element indicates that the supplementary data in the current lt chemgrouprule gt element are pertaining to the chemical group only in case the polymer sequence is left end modified that is with a permanent left end mod ification and the monomer code D is located at the left end of the polymer sequence that is it is the first monomer of the sequence for which the electrical charge or pI calculation is to be performed lt name gt Acetylation lt name gt This element goes further in the detail of the potential chemistry of the aNH chemical group if the left end permanent modification is Acetylation then the current chem grouprule element can be further processed otherwise it should be abandoned lt outcome gt LOST lt outcome gt This element actually indicates what should be done with the chemical group for which the chemgrouprule is being defined What we see here is If the aNH2 chemical group
140. he Oligomers table view along with the name of the cleavage agent which it arose from The Cleavage Details tab widget displays the mass calculation engine configuration at the time the last cleavage was performed one red led means that the related feature was off conversely a green led means that the feature was on In our example the mass calculation for the oligomers did not account for the monomer modifications nor for the left right ends of the polymer nor for the cross links When the user triggers a cleavage the mass calculation engine configuration currently set in the sequence editor is used for the calculation of the mass of the oligomers obtained per the cleavage This process allows an easy change in the mass calculation engine configuration between one cleavage and another so as to allow comparison of masses obtained for the same cleavage but with different mass calculation engine configurations Finally one last note if the list of monoisotopic or average masses are desired in the form of a text list right clicking onto the table iew widget will allow copying to the clipboard either the monoisotopic or the average masses Also it is possible to either export the data to the clipboard or to a file or even to drag the displayed oligomer items in a text editor Only the selected items in the tree view widget will be exported For oligomer data filtering please refer to section 8 page 96 SPECTRUM CALCULATION It is possible to
141. he bond formed by condensation of two amino acids is an amide bond also called in protein chemistry a peptidic bond The elongation of the protein is a simple repetition of the condensation reaction shown in Figure 3 1 granted that the elongation always proceeds in the described direction a new monomer arrives to the right end of the elongating polymer and elongation is done from left to right Now we should point at a protein chemistry specific terminology issue we have seen that a protein is a polymer made of a number of monomers called amino acids In protein chemistry there is a subtlety once a monomer is polymerized into a protein it is no more called a monomer it is called a residue We may say that a residue is an amino acid less a water molecule From what we have seen until now we may define a protein this way A protein is a chain of residues linked together in an orderly polar fashion with the residues being numbered starting from 1 and ending at n from the first residue on the left end to the last one on the right end This definition is still partly inexact however Indeed from what is shown in Figure 3 2 there is still a problem with the extremities of the residual chain what about the amino 18 CHAPTER 3 BASICS IN POLYMER CHEMISTRY D a Ry Rn Figure 3 2 End capping chemistry of the protein polymer A protein is made of a chain of residues and of two caps The left cap is the N termi
142. he cross linking reaction Note that the formula of the CFP Chromophore cross linker is Nul that is there is no chemical reaction defined for the cross linker per se When modifica tions are defined their number must match the number of monomers involved and their order must match the order with which the monomers are cross linked If no modification is defined then the chemical reaction that occurs upon cross linking might be defined in the formula of the cross linker THE CLEAVAGE SPECIFICATIONS It is common practice in biopolymer chemistry at least to cut a polymer into pieces using molecular scissors like the following proteases for proteins nucleases for nucleic acids glycosidases for saccharides For each different polymer type the molecular scissors are specific Indeed a protease will not cleave a polysaccharide This is why cleavage specifications be long to polymer chemistry definitions In the example of Figure 6 8 on the next page the definition of the CyanogenBromide cleavage specification is detailed this organic reagent cleaves right of methionyl residues The CyanogenBro mide cleavage specification is qualified as so Name CyanogenBromide Name of the cleavage agent 51 massXpert Cleavage definitions Cleavage specifications Cleavage rules Details Identity Homosenyl Trypsin Chymotrypsin EndoLysC EndoAspN Patt
143. his figure shows that the user can calculate the charges positive negative and net beared by the polymer sequence either the whole sequence or the current selection by setting the pH value at which the computation should take place It is also possible to calculate the isoelectric point by clicking onto the Isoelectric Point button Note that the computations might involve the permanent left right modifica tions of the polymer sequence as well as the monomer chemical modifications To configure the way net charge or pl calculations are performed use the calculations engine configuration of the sequence editor window GENERAL OPTIONS One of the options that are valued most by users is to be able to set the number of decimal places used to diplay numbers The settings should apply in a distinct 106 CHAPTER 8 XPERTEDIT massXpert Isoelectric Point Calculator Input Data Actions Whole Sequence Selected Sequence Isoelectric Point To Clipboard X Chemical Groups Tested Point pl Figure 8 25 Acido basic computations net charges This figure shows the options that can be set for the calculation of the charges beared by the polymer sequence manner depending on the different entities for which numerical values are to be displayed The following are the default values and recommended ones Atoms and all related entities isotopic masses isotopic ab
144. his is useful when the simulations that need to be performed are sequential in kind To have a new list created uncheck Perform computation in place check button widget INTERNAL WORKINGS When an operation is performed on the items of an input m z list say we want to make sodium adducts that would be a formula H 4 Na of all the items in the list the process involves the following steps as detailed below for one single item of the list which has data pair 334 341 3 and protonation as ionization agent Convert the tri protonated analyte into a non ionized analyte thus getting M 1000 Compute the mass of the H Na formula 21 98 Da Add 1000 21 98 Reionize to the initial charge state 341 67 3 WORKING ON Two INPUT M Z LISTS It is possible to perform calculations on two input m z lists These calcula tions are called matches The m z z pairs of two different input m z lists might be matched Typically a match operation would involve data from the mass spectrometer and data from a massXpert based simulation cleavage or fragmentation for example In order to perform a match operation the first input m z list the data from the mass spectrometer should be selected by its name in the Input 1 List list and the second input m z list the data from the simulation should be selected by its name in the Input 2 List list Note that if the two input m z lists are not of the same type one is mono and th
145. hould also get your employer if you work as a programmer or school if any to sign a copyright disclaimer for the program if necessary For more information on this and how to apply and follow the GNU GPL see http www gnu org licenses The GNU General Public License does not permit incorporating your pro gram into proprietary programs If your program is a subroutine library you may consider it more useful to permit linking proprietary applica tions with the library If this is what you want to do use the GNU Lesser General Public License instead of this License But first please read http www gnu org philosophy why not lgpl html 176 CHAPTER 11 APPENDICES Index Ecole Polytechnique 2 XpertCalc 59 67 chemical entities 61 isotopic peak 64 m z calculator 63 module invocation 59 programming 61 recorder 63 result masses 60 seed masses 60 XpertDef 43 53 atoms 44 average mass 45 new atom 44 new isotope 45 caps 46 left 46 right 46 cleavage specifications 50 cleavage rule 51 definition 50 left code 51 name 50 pattern 51 right code 51 cross linkers 49 definition 49 fragmentation specifications 52 complex patterns 54 simple patterns 53 ionization rule 46 charge 46 formula 46 level 46 modifications 48 formula 48 name 48 targets 48 monomers 47 name 44 46 plural data 44 saving the definition 58 singular data 44 XpertEdit 69 105 177 code completion 77
146. ided with a window where a number of cleavage specifications are listed Figure 8 16 page 89 along with options that allow customizing the production of oligomers The cleavage specifications are listed in the Available cleavage agents list widget by looking into the polymer chemistry definition corresponding to the polymer sequence to be cleaved The program knows for example that the polymer sequence to be cleaved is of the protein 1 letter chemistry type and thus will list all the cleavage specifications that were defined in that polymer chemistry definition The user selects the cleavage specification of interest and sets other useful parameters like the number of partial cleavages that the cleaving agent may yield for example Entering 0 means that the cleavage reaction will yield the set of oligomers corresponding to a total cleavage of the polymer sequence no missed cleavages partial cleavages 0 Also the user might indicate that the oligomers computed during the cleavage should be ionized according to the current ionization rule displayed in the main window and in the specified range Finally when the window is opened the Oligomer coordinates group box widget lists the coordinates of the currently selected region of the polymer sequence Either leave the values as they are shown or check the Whole sequence check box widget In the first case the cleavage will occur only inside the selected region of the polymer sequence that i
147. ific packages At the moment the only distribution specific packages being prepared are the Debian GNU Linux and Fedora core packages The naming of the packages are according to the following schema massxpert 3 1 0 bin tar gz The bin suffix indicates that the package is a binary package Source packages would use the src suffix or none at all exactly the same way massxpert 3 1 0 src tar gz 8 CHAPTER 2 MASSXPERT INSTALLATION INSTALL FROM A BINARY TARBALL To install a binary tarball simply issue the following command as root shell prompt tar xvzf massxpert version bin tar gz C P This command installs the package to directory usr local which means that the program is now available for all to use Version 3 1 0 of the massXpert software installs the following files and directories usr local bin massxpert this is the binary executable program itself usr local share massxpert pol chem defs polymer chemistry defini tion files usr local share massxpert pol seqs polymer sequence files usr local share massxpert locales Qt linguist based translation files usr local share doc massxpert COPYING license file of the massXpert software usr local share doc massxpert usermanual user manual HTML and PDF formatted files Upon installation if all the dependencies are already installed on the sys tem the user might start the massxpert program right away by executing th
148. igations under this License and any other pertinent obligations then as a consequence you may not convey it at all For example if you agree to terms that obligate you to collect a royalty for further conveying from those to whom you convey the Program the only way you could satisfy both those terms and this License would be to refrain entirely from conveying the Program Use with the GNU Affero General Public License Notwithstanding any other provision of this License you have permission to link or combine any covered work with a work licensed under version 3 of the GNU Affero General Public License into a single combined work and to convey the resulting work The terms of this License will continue to apply to the part which is the covered work but the special requirements of the GNU Affero General Public License section 13 concerning interaction through a network will apply to the combination as such Revised Versions of this License The Free Software Foundation may publish revised and or new versions of the GNU General Public License from time to time Such new versions will be similar in spirit to the present version but may differ in detail to address new problems or concerns Each version is given a distinguishing version number If the Program specifies that a certain numbered version of the GNU General Public Li cense or any later version applies to it you have the option of following the terms and conditions either
149. iguration settings 12 Peptidie bond formation 22 ROUES 17 End capping chemistry of the protein polymer 18 Phosphodiester bond 19 A nucleic acid is a capped nucleotide chain 20 Osidic bond formation s a s s soea s ace 21 saccharidic polymer is a capped osidic residue chain 21 Protein cleavage by water and cyanogen bromide 24 Protein fragmentation gt s vo iocs 99 3 x o a 27 DNA fragmentation 22 30 Select one polymer chemistry definition fle 44 XpertDef polymer chemistry definition window 45 XpertDef atom definition 46 XpertDef monomers definition 47 XpertDef monomer mass differences 48 XpertDef modifications definition 49 XpertDef cross linkers definition 50 XpertDef cleavage specifications definition 51 XpertDef fragmentation rules definition 53 XpertDef fragmentation specifications definition 55 XpertDef fragmentation rules definition 56 Selecting a polymer chemistry definition for use with 60 Interface of the XpertCalc module 61 Interface of the chemical pad 62 The XpertCalc recorder window 64 The m z ratio calonlator o acs sr ee t o mg 65 The isotopi
150. ime one selection overlapping with another or not is added or removed masses are recalculated for the current selection The way the multi region selections and the multi selection regions are handled from the mass calculation standpoint is configured as follows Regions are oligomers In this configuration each selection behaves as an oligomer and thus should normally be capped on both its left and right ends This is typically the situation when the user wants to simulate the formation of a cross linked species arising from the cross linking of two oligomers each oligomer is capped on both its ends Regions are residual chains In this configuration each selection behaves as a residual chain and thus the oligomer resulting from the multi region selections is capped on its left and right ends only once This situation is typically encountered when simulating partial cleavages by first selecting an oligomer checking its mass and then continuing selection to simulate a longer oligomer resulting from a partial cleavage Also the situation might be encountered when there are multiple repeated sequence motifs in a polymer sequence and mass data are difficult to analyze POLYMER SEQUENCE MODIFICATION It very much often happens that the bio chemist uses chemical reactions to modify the polymer sequence she is working on Mass spectrometry is then of ten used to check if the reaction proceeded properly or not Further in nature che
151. in an output m z list to its corresponding polyemr sequence just activate the item while having a look at the polymer sequence whence the oligomers initially originated Each time an item is selected its corresponding sequence region will be selected in the polymer sequence 10 Data Cus tomization In this chapter the user will be walked trough an example of how new polymer chemistry definition data can be generated and included in the automatic data detection system of massXpert that is how new polymer chemistry definitions should be registered with the system Customization is typically performed by the normal user not the Admin istrator nor the Root of the machine and as such new data are typically stored in the user s home directory On UNIX machines the home direc tory is usually the home username directory where username is the logging user name On MS Windows that directory is typically the C Documents and Settings username once again with username being the logon user name In the next sections we will refer to that home directory be it on UNIX or MS Windows machines as the directory as this the standard envi ronment variable describing that directory in GNU Linuz When massXpert is executed it automatically tries to read data config uration files from the home directory in the massxpert directory Once this is done it reads all the data configuration files in the installati
152. is de fined using a name a targets specification and a chemical formula H2PO3 The Phosphorylation is being defined as having S T Y targets only that means that when the user will try to modify non seryl or non threonyl or non tyrosinyl monomers the program will complain that these monomers are not targets of Phosphorylation There is however and for maximum flexibility the possibility to override these target limiting data when modifying monomers When the polymer is modified with this modification its masses will change ac cording to the net mass of this Phosphorylation reaction THE CROSS LINKERS Polymers are often either chemically or biochemically modified by intercon necting monomers from the same polymer sequence In the protein reign one classical example of intra sequence cross linking is the formation of disulfide bonds Another wonderful example is the formation of the fluorophore in the fluorescent proteins there is a chemical reaction involving the side chains of three consecutive residues going on resulting in the formation of a complex intra sequence cross link Each side chain of the three monomers involved are chemically modified Cross linkers are defined in the dialog window shown in Figure 6 7 This dialog window is opened by clicking onto the CrossLinkers button The formation of cross link between one or more monomers often involves chemical reactions to occur at the level of the engaged monomers Cross linke
153. is phos phorylated However oft times the oligonucleotides are synthesized chemically without the 5 end phosphate group thus ending in hydroxyl This special case should be accounted for by applying to all the fragments that bear the left end of the precursor polymer the following chemical reaction HPO3 This chemical reaction should be applied in addition to the chemical reaction that yields the fragment per se Exactly as done earlier for the protein fragments the mathematical expres sions used to calculate the mass of different series of nucleic acid fragments are 30 CHAPTER 3 BASICS IN POLYMER CHEMISTRY All the fragments below bear one negative charge not formally represented on the sequence fragments because it can be floating at any valid place 9 Bl B2 5 HO 0 OH H O v 0 O v 0 T e N O v 0 m lt di w cl qi Bl B4 al s HO P o Io 4 OH 3 71 OH Bl B4 b1 5 Ho P 0 4 yl OH B4 cl 5 HO P O o 4 Pes 3 1 OH B1 o B4 dl 5 Ho P O tS ce geo 3 wl OH OH OH Canonical monomer Normally the left end of a nucleic acid after capping is SS ig 505 5 P o 3 OH 5 HO P 0 3 OH H Thus if 5 OH is required subtract from left end bearing fragments like a b c d Figure 3 9
154. it does is check whether it can find all its configuration data in the system directories where they belong configuration data chemistry definition data plugins localization files translation of the software If any of its attempts fails the user is provided with the dialog window shown in Figure 2 1 where he is invited to locate all the system directories that are part of the massXpert software distribution Once the settings are saved the program can continue its execution successfully The directories that are checked upon startup of the program are The data directory where the polymer chemistry definition files in pol chem defs and the polymer sequence files in pol seqs are located 12 CHAPTER 2 MASSXPERT INSTALLATION General concepts The massXpert software program s components have been built and should be located in the following system places the binary program in usr local bin the data in usr local share massxpert the plugins in usr local lib massxpert plugins the localization files in usr local share massxpert locales the user manual in usr local share doc massxpert usermanual However it appears that the configuration on this system is not typical The software package might have been relocated You are given the opportunity to locate the massXpert software main directories Should be usr local share massxpert Jusr local share massxpert Browse Should be usr loca
155. ity gt lt name gt Phosphorylation lt name gt APPENDICES 161 lt outcome gt LOST lt outcome gt lt chemgrouprule gt lt mnmchemgroup gt lt monomer gt lt monomer gt lt code gt T lt code gt lt mnmchemgroup gt lt name gt N term NH2 lt name gt lt pka gt 9 6 lt pka gt lt acidcharged gt TRUE lt acidcharged gt lt polrule gt left_trapped lt polrule gt lt chemgrouprule gt lt entity gt LE_PLM_MODIF lt entity gt lt name gt Acetylation lt name gt lt outcome gt LOST lt outcome gt lt chemgrouprule gt lt mnmchemgroup gt lt mnmchemgroup gt lt name gt C term COOH lt name gt lt pka gt 2 35 lt pka gt lt acidcharged gt FALSE lt acidcharged gt lt polrule gt right_trapped lt polrule gt lt mnmchemgroup gt lt mnmchemgroup gt lt name gt Lateral alcohol lt name gt lt pka gt 13 lt pka gt lt acidcharged gt FALSE lt acidcharged gt lt polrule gt never_trapped lt polrule gt lt chemgrouprule gt lt entity gt MONOMER_MODIF lt entity gt lt name gt Phosphorylation lt name gt lt outcome gt LOST lt outcome gt lt chemgrouprule gt lt mnmchemgroup gt lt monomer gt lt monomer gt lt code gt V lt code gt lt mnmchemgroup gt lt name gt N term NH2 lt name gt lt pka gt 9 6 lt pka gt lt acidcharged gt TRUE lt acidcharged gt lt polrule gt left_trapped lt polrule gt lt chemgrouprule gt lt entity gt LE_PLM_MODIF lt entity gt lt name gt Acetylation lt
156. ive if double clicked an item will see its corresponding monomer code inserted in the sequence at the current cursor location This list thus makes it easy to visually edit the polymer sequence without having to remember all the codes in the polymer chemistry definition FINDING SEQUENCE MOTIFS Finding sequence motifs in the polymer sequence is performed by selecting the Edit Find Sequence menu item The dialog window is shown in Figure 8 8 When performing the first search in a polymer sequence the Find button should be used This will trigger a search starting at the beginning of the polymer sequence For each successive search the Next button should be used Each searched sequence motif will be stored in a history list that is made available by dropping down the combo box widget where the sequence motif is entered The Clear history button will erase all the searched sequence motifs from the history thus resetting it IMPORTING SEQUENCES Very often the user will make a sequence search on the web and be provided with a polymer sequence that is crippled with non code characters That web output might either be saved in a text file for future reference or copied to the clipboard for immediate use in massXpert The two cases are reviewed below IMPORTING FROM THE CLIPBOARD XpertEdit provides a convenient way to spot non valid characters in a text and to let the user purify the imported sequence A clipboard imported seque
157. k Cancel which will trigger the system s file selection dialog to open for you to browse to the location where the polymer sequence file is stored The process is identical to the normal polymer sequence file opening see below The second way to start an XpertEdit session is by creating a new polymer sequence XpertEdit New Sequence menu The program immediately asks to select a polymer chemistry definition as shown in Figure 8 2 The drop down widget lists all the polymer chemistry definitions currently registered on the system If the polymer chemistry definition is not listed clicking onto Cancel will let the user browse the disk in search for a polymer chemistry definition file Once the polymer chemistry definition has been selected and successfully parsed by the program the user is presented with an empty sequence editor The third way to start an XpertEdit session is by opening an existing poly mer sequence file Once the sequence file has been opened the user is presented with a sequence editor as represented in Figure 8 3 At this point when the 1Note that once the sequence is saved the polymer chemistry definition file must be reg istered or the sequence file will not be loadable This is described in a later chapter 71 Select a Polymer Chemistry Definition or Click Cancel to Browse Polymer Chemistry Definition c progra 1 massxpert 1 5 0 data pol chem defs protein 1 letter protein 1 letter xml c pro
158. l lib massxpert plugins Jusr local lib massxpert plugins Browse Should be usr local share massxpert locales Jusr local share massxpert locales Browse Save settings Erase Figure 2 1 massXpert configuration settings Upon running the massXpert software program it might detect that its system directories are not located where they were planned to be the package directories might have been moved for example In this case the user is provided with the dialog window shown here where he is invited to locate all the system directories that are part of the massXpert software package Once the settings are saved the program can continue its execution successfully 13 The plugins directory where the plugins which are dynamically linked libraries are located The locales directory where the translation files are located The directories listed above might be moved on the filesystem however their contents might not be changed If there is a need to customize the data that should be done carefully by changing the contents of the files but not the structure of the directories For example it is perfectly safe to add new polymer chemistry definitions or to change files belonging to any polymer chemistry definition but it is not safe to move files around without knowing what you do THE USER MANUAL Whatever the package you used to install massX
159. le massXpert comes with no warranty of any kind The general policy for directing questions comments feature requests massXpert program and or massXpert documentation bug reports should be self explanatory by looking at the addresses below massxpert maintainer massxpert org massxpert bugs massxpert org massxpert webmaster massxpert org massxpert request massxpert org To direct any comment s to the author through snail mail use the following address D Filippo RUSCONI Charg de recherches au CNRS CENTRE NATIONAL DE LA RECHERCHE SCIENTIFIQUE UMR CNRS 5153 UR INSERM 565 USM MNHN 0503 Mus um national d Histoire naturelle 43 rue Cuvier F 75231 Paris CEDEX 05 France said earlier massXpert is the successor to the GNU polyxmass project which it inherits all the original features while still integrating new interesting developments mass pert Installation In this chapter the installation process will be described for GNU Linux sys tems for the MS Windows system and for the Mac OS X system Note that the massXpert software package is built to be located in cer tain places on the destination computer s filesystem on the disk How ever beginning with version 1 7 5 the software package is relocatable Please read section 2 page 11 THE GNU Linux PLATFORM The installation of massXpert can be performed using the source code tarball the binary tarball or binary distribution spec
160. libc so 6 gt lib i686 cmov libc so 6 0xb70ba000 libaudio so 2 gt usr lib libaudio so 2 0xb70a4000 libXt so 6 gt usr lib libXt so 6 0xb7054000 libXfixes so 3 gt usr lib libXfixes so 3 0xb704f000 libgthread 2 0 so 0 gt usr lib libgthread 2 0 so 0 0xb704a000 librt so 1 gt lib i686 cmov librt so 1 0xb7041000 libglib 2 0 s0 0 gt usr lib libglib 2 0 30 0 Oxb6fa1000 libexpat so 1 gt usr lib libexpat so 1 0 06 81000 libXau so 6 gt usr lib libXau so 6 0xb6f7d000 libXdmcp so 6 gt usr lib libXdmcp so 6 0xb6f78000 lib ld linux so 2 0xb7f2b000 libpcre so 3 gt usr lib libpcre so 3 0xb6f58000 As visible on the first lines of the output above the main dependency that might not be available on your system especially if not running the KDE environment are the libQt libraries These should be very easily installable as they consti tute the very core of a highly popular desktop environment used on GNU Linux computers called KDE Kommon Desktop Environment INSTALLING FROM A SOURCE TARBALL The source is built using the CMake program http www cmake org The build of the software takes place in another directory than the source directory The steps are easy Unpack the source tarball with the following command as normal user shell prompt tar xvzf massxpert 3 1 0 src tar gz P This command unpacks the tarball to the current directory in a subdirec tory named massxpert 3
161. lt atom gt lt atom gt lt name gt Hector lt name gt lt symbol gt Hec lt symbol gt lt isotope gt lt mass gt 100 0000000000 lt mass gt lt abund gt 100 0000000000 lt abund gt lt isotope gt lt atom gt lt atom gt lt name gt Rutenium lt name gt lt symbol gt Ru lt symbol gt lt isotope gt lt mass gt 95 9075960000 lt mass gt lt abund gt 5 5400000000 lt abund gt lt isotope gt lt isotope gt lt mass gt 97 9052870000 lt mass gt lt abund gt 1 8700000000 lt abund gt lt isotope gt lt isotope gt lt mass gt 98 9059371000 lt mass gt lt abund gt 12 7600000000 lt abund gt lt isotope gt lt isotope gt lt mass gt 99 9042175000 lt mass gt lt abund gt 12 6000000000 lt abund gt lt isotope gt lt isotope gt lt mass gt 100 9055810000 lt mass gt lt abund gt 17 0600000000 lt abund gt lt isotope gt lt isotope gt lt mass gt 101 9043480000 lt mass gt lt abund gt 31 5500000000 lt abund gt lt isotope gt lt isotope gt lt mass gt 103 9054220000 lt mass gt lt abund gt 18 6200000000 lt abund gt lt isotope gt lt atom gt lt atom gt lt name gt Rhodium lt name gt lt symbol gt Rh lt symbol gt lt isotope gt lt mass gt 102 9055030000 lt mass gt lt abund gt 100 0000000000 lt abund gt lt isotope gt APPENDICES 139 lt atom gt lt atom gt lt name gt Palladium lt name gt lt symbol gt Pd lt symbol gt lt isotope gt lt mass gt 101
162. luding a cross claim or counterclaim in a lawsuit alleging that any patent claim is infringed by making using selling offering for sale or importing the Program or any portion of it Patents A contributor is a copyright holder who authorizes use under this License of the Program or a work on which the Program is based The work thus licensed is called the contributor s contributor version A contributor s essential patent claims are all patent claims owned or controlled by the contributor whether already acquired or hereafter ac quired that would be infringed by some manner permitted by this Li cense of making using or selling its contributor version but do not in clude claims that would be infringed only as a consequence of further modification of the contributor version For purposes of this definition control includes the right to grant patent sublicenses in a manner con sistent with the requirements of this License Each contributor grants you a non exclusive worldwide royalty free patent license under the contributor s essential patent claims to make use sell offer for sale import and otherwise run modify and propagate the con tents of its contributor version In the following three paragraphs a patent license is any express agree ment or commitment however denominated not to enforce a patent such as an express permission to practice a patent or covenant not to sue for pa
163. lved in the development of the K Desktop Environment KDE To all the readers who helped me with this manual vi Contents 1 Preface Project History lt s co sec acos o Typographical Conventions Program Availability Technicalities Organization Of This Manual massXpert s Licensing Contacting The Author 2 massXpert Installation The GNU Linux Platform Install From A Binary Tarball Installing From A Source Tarball Installing A Binary Package The Mac OS X Platform The MS Windows Platform Installing A Binary Package Installing From A Source Tarball Software Package Relocation The User Manual 3 Basics in Polymer Chemistry Polymers Where Everywhere Various Biopolymer Structures Nucleic Acids Saccharid s To Sum UP 2 sa me Das sa sei Polymer Chain Disrupting Chemistry Polymer Cleavage Polymer Fragmentation 4 Basics in Mass Spectrometry Ion Production The Source 5 massXpert Generalities General massXpert Concepts On Formule And Chemical Reactions The massXpert Framework Data Format vii 10 10 10 11 11 13 15 15 16 17 18 20 22 22 23 25 33 34 34 35 viii CONTENTS General Chemical Entity Naming Policy 41 6 XpertDef 43 Whe Atoms MC
164. ly as if the modification had been selected from the list of available modi fications But because the modification has a name not known to the polymer chemistry definition the editor cannot modify the monomer vignette with a predefined transparent raster image Thus as seen on Figure 8 12 the modi fied residue gets visually modified using the default transparent raster image 4 interrogation marks one at each corner of the monomer vignette square It is perfectly feasible to modify a single monomer more than once with the same modification or not for example a tri methylation with a methylation modification This is why when the window depicted in Figure 8 11 shows up the two lists at the right hand side show the monomers currently modified and the modification s that are currently set to these modified monomers Selecting one item from the Modified monomers list will show only the modifications set to that monomer in the Modifications list If all the modifications in the polymer sequence are to be displayed then checking the All modifications check box widget will trigger the display of all the modifications set to any monomer in the whole polymer sequence Unmodification of monomers is easily performed by selecting any number of items from the Modifications list and clicking the Unmodify button 86 CHAPTER 8 XPERTEDIT Polymer modifications Left end Acetylation Right end MyModif massXpert Polymer Modifi
165. massXpert will be accurate For the program to be able to cope with a variety of possibly very different polymers it had to be written using some abstraction layer in between the mass calculations engine and the mere description of the polymer sequence This ab straction layer is implemented with the help of polymer chemistry definitions which are files describing precisely how a given polymer type should behave in the program and what its constitutive entities are The way polymer chemistry definitions are detailed by the user is the subject of a chapter of this book see menu XpertDef of the program However in order to give a quick overview here is a simple situation a user is working on two polymer sequences one of chemistry type protein and another one of chemistry type dna The protein sequence reads ATGC and the dna sequence reads CGTA Now imagine that 39 40 CHAPTER 5 MASSXPERT GENERALITIES the user wants to compute the mass of these sequences How will massXpert know what formula hence mass each monomer code corresponds to There must be a way to inform massXpert that one of the sequences is a protein while the other is a DNA oligonucleotide this is done upon creation of a polymer se quence the programs asks of what chemistry type the sequence to be created is Once this chemical parentage has been defined for each sequence massXpert will know how to handle both the graphical display o
166. mer will be the mass of the monomer at position 1 less the mass of a CO plus the mass of a proton The mass calculation for these special internal fragments is expressed imm H NUCLEIC ACID FRAGMENTATION The fragmentations that can be obtained with nucleic acids are numerous and it is more complicated than with proteins to describe them fully The main reason for this is that there are a big number of fragmentation combinations because of the loss of nitrogenous bases from the skeleton The mechanisms by which this loss happens are fairly complex and I am not going to detail any of them Figure 3 9 on the next page shows the most common fragmentations without taking into consideration the potential loss of bases An example of fragment is given for each fragment series pretty the same way as we did before for proteins Note that the fragment representations are aimed at helping the reader to figure out what the product ion is not taking into account where the negative charge lies on the fragment since this charge can float around at every de protonatable group All the fragments shown bear one and one only negative charge The reader might have noticed at the bottom of Figure 3 9 on the follow ing page that a provision is made in the case the fragmented molecular species are not 5 end phosphorylated but 5 end hydroxylated Indeed the canonical monomer is such that upon polymerization and left capping the 5 end
167. mical modifications of biopolymer sequences are very often encountered For example protein sequences get often modified as a means to regulate their func tion phophorylations for example or acetylations methylations Nucleic acid sequences are very often and extensively modified with modifications such as methylation 2 Selection here is thus used to collectively represent all multi region selections and multi selection regions at any given time in the polymer sequence editor 83 It is thus crucial that massXpert be able to model with high precision and flexibility the various chemical reactions that can be either made in the chemistry lab or found in nature The massXpert program provides two different chemical modification processes A process by which monomers belonging to the polymer sequence can be individually modified A process by which the whole polymer sequence can be modified either on its left end or on its right end or even on both ends SELECTED MONOMER S MODIFICATION There are a number of manners in which monomers can be modified in a poly mer sequence Figure 8 11 on the following page shows the simplest manner the user first selects the monomer vignette to be modified and calls the Chem istry Modify Monomer s menu A window shows up where all the modifica tions currently available in the polymer chemistry definition are listed Because a monomer vignette was initially selected in the e
168. mination ofthe compositions 98 Different pKa values for a number of amino acids chemical groups100 Acido basic computations net 106 meLab widow Pa ea eee 445445 108 mzLab s empty input m z list dialog window 109 mzLab s data filled input m z list dialog window 110 mzLab s m only textual data filled input m z list dialog window 111 mzLab s m z textual data filled input m z list dialog window 111 mzLab s match operation output list dialog window 114 The polymer chemistry definition directory 118 List of Tables 3 1 Comparison of three common biopolymers xiii LIST OF TABLES Preface This manual is about the massXpert mass spectrometric software suite a soft ware program that aims at letting users predict analyze mass spectrometric data on bio polymers As such this manual is intended for people willing to learn how to install and use this software package Mass spectrometry has gained popularity across the past ten years or so Indeed developments in polymer mass spectrometry have made this technique appropriate to accurately measure masses of polymers as heavy as many hun dreds of kDa and of any chemical type There are a number of utilities sold by mass spectrometer constructors with their machines usually as a marketing plus that allow predicting analyzing mass spectrometric dat
169. mission to propagate or modify any covered work These actions infringe copyright if you do not accept this License Therefore by modifying or propagating a covered work you indicate your acceptance of this License to do so Automatic Licensing of Downstream Recipients Each time you convey a covered work the recipient automatically receives a license from the original licensors to run modify and propagate that work subject to this License You are not responsible for enforcing com pliance by third parties with this License An entity transaction is a transaction transferring control of an organi zation or substantially all assets of one or subdividing an organization or merging organizations If propagation of a covered work results from an entity transaction each party to that transaction who receives a copy of the work also receives whatever licenses to the work the party s prede cessor in interest had or could give under the previous paragraph plus a right to possession of the Corresponding Source of the work from the pre decessor in interest if the predecessor has it or can get it with reasonable efforts You may not impose any further restrictions on the exercise of the rights granted or affirmed under this License For example you may not impose 172 11 CHAPTER 11 APPENDICES a license fee royalty or other charge for exercise of rights granted under this License and you may not initiate litigation inc
170. mselves while fragmentation oligomers are charged by themselves the charge that the fragmentation oligomer gets upon its creation is intrinsic to it thanks to the fragmentation pattern that gave rise to it It is thus of crucial importance for the faithfulness of the computations that the laboratory be fed with identified oligomers This is the reason why the 111 massXpert mz Lab protein 1 letter Working lists Default ionization Input 1 list Input 2 list Unitary Formula Unitary charge an H Tonization level Actions on a single list massXpert mz Lab m only list Document WordPad m only list mz 1 234 56000 1 345 67000 Figure 9 4 mzLab s m z textual data filled input m z list dialog window See text for details massXpert mz Lab protein 1 Ietter Working lists Default ionization Input ist monly ist Unitary formula Unitary charge 1 Tonization evel 1 massXpert mz Lab m z list 2 Document WordPad Edt Insert Format OSH 123456000 1 f Westem 34567000 1 ee 2 6172800 2 1 Sou Figure 9 5 mzLab s m z z textual data filled input m z list dialog window See text for details 112 CHAPTER 9 XPERTMINER input m z list dialog windows have a Fragments check box widget that the user must check if dealin
171. mula gt C5H8N202 lt formula gt lt mnm gt lt mnm gt lt name gt Tryptophan lt name gt lt code gt W lt code gt lt formula gt C11H10N20 lt formula gt lt mnm gt lt mnm gt lt name gt Phenylalanine lt name gt lt code gt F lt code gt lt formula gt C9H9N10 lt formula gt lt mnm gt lt mnm gt lt name gt Tyrosine lt name gt lt code gt Y lt code gt lt formula gt C9H9N102 lt formula gt lt mnm gt lt mnm gt lt name gt Histidine lt name gt lt code gt H lt code gt lt formula gt C6H7N30 lt formula gt lt mnm gt lt mnm gt lt name gt Proline lt name gt 148 CHAPTER 11 APPENDICES lt code gt P lt code gt lt formula gt C5H7N101 lt formula gt lt mnm gt lt monomers gt lt modifs gt lt mdf gt lt name gt OnAnyMonomer lt name gt lt formula gt Hec lt formula gt lt targets gt lt targets gt lt mdf gt lt mdf gt lt name gt OnNoMonomer lt name gt lt formula gt Hec lt formula gt lt targets gt lt targets gt lt mdf gt lt mdf gt lt name gt Phosphorylation lt name gt lt formula gt H H2P03 lt formula gt lt targets gt S T Y lt targets gt lt mdf gt lt mdf gt lt name gt Sulphation lt name gt lt formula gt H HS03 lt formula gt lt targets gt S T Y lt targets gt lt mdf gt lt mdf gt lt name gt Oxidation lt name gt lt formula gt 0 lt formula gt lt targets gt M lt targets gt lt mdf gt lt mdf gt
172. n 86 Monomer 87 Sequence Cleavage 88 Spectrum calculation e s 2229224229 s 90 Oligomer Fragmentation ees 92 Mass Searching o aoed s anaoa ee e d a orem RR 93 Oligomer Data Filtering eser or 96 m z Ratio Calculation 0 0 0 66604 97 Monomeric And Elemental Compositions 97 pH pland Charges e roc scored carini ee ae 3 97 Ionized Group s In Monomers 99 Ionized Group s In Modifications 105 pH pI and Charge Calculations 105 General IE cuu os cede ms ea ReaD 105 CONTENTS 9 XpertMiner XpertMiner Invocation e e c me soie a ee a a ea mzLab Mining m z ratios 35535555 Creating A New Input m z List Working On One Input m z List Working On Two Input m z Lists Tracing The Data oa 8 aise eet 10 Data Customization 11 Appendices The Protein Chemistry Definition File One Example Polymer Sequence File The pka ph File gt s csore soe matora ee oe GNU General Public License Text Index 107 107 107 108 112 113 114 115 123 123 152 153 164 177 CONTENTS List of Figures 6 1 6 2 6 3 6 4 6 5 6 6 6 7 6 9 6 10 6 11 7 1 Tod 7 3 7 4 7 6 Tu 8 1 8 2 massXpert conf
173. n extremely reliable pumping technology aimed at maintaining for long periods of time with no sudden interruption otherwise the detector might suffer seriously a good vacuum in the conduit in which ions must flow during operation THE ANALYZER Once an ion has been generated in the gas phase its mass should be measured This is a complex physical process Depending on the mass spectrometer design the mass measurement is based on more or less complex physical events Mag netic mass spectrometers are usually thought of as pretty complex devices this is also the case for the Fourier transform ion cyclotronic resonance devices An analyzer like the time of flight analyzer is much simpler I will refrain from try ing to explain the physics of the mass measurement just limit myself to saying that at some stage of the mass measurement process forces are exerted on the ions by electric magnetic fields incidentally this explains why it is so important that an analyte be ionized otherwise it would not be subject to these fields The ionized analytes submitted to these forces have their trajectory modified 35 in such a way that the detector should be able quantify this modification Roughly this is the measurement process WHAT IS REALLY MEASURED Prior to entering into some detail it seems necessary to make a few definitions unified mass scale IUPAC amp IUPAP 1959 1960 agreed upon scale with 1 u equal to 1 12 the
174. nal proton and the right cap is the C terminal hydroxyl Altogether the residual chain enclosed here in the blue polygon and both the H and OH red colored caps do form a complete protein polymer in its finished state group on the left end of a protein the amino group sits right onto the first amino acid of the protein and what about the carboxyl group of the right end of a protein the carboxyl group sits right onto the last amino acid of the protein Because these groups lie at the extremities of the residual chain they remained unreacted during the polymerization process But because we are simulating a residual chain using residues and not amino acids we still need to put the residual chain in its finished state by capping the left end with a proton cap so as to complete the amino group and the right end with a hydroxyl cap so as to complete the carboxyl group The capping of the residual chain extremities ensures that the polymer is in its finished state and that it cannot be elongated anymore The proton is the left cap of the protein polymer and the hydroxy is the right cap of the protein polymer Now comes the question of unambiguously defining the structure of a protein It is commonly accepted that the simple ordered sequence of each residue code in the protein from left to right constitutes an unambiguous description of the protein s primary structure that is its sequence Of course proteins have three dimensional stru
175. name gt lt outcome gt LOST lt outcome gt lt chemgrouprule gt lt mnmchemgroup gt lt mnmchemgroup gt lt name gt C term COOH lt name gt 162 CHAPTER 11 lt pka gt 2 35 lt pka gt lt acidcharged gt FALSE lt acidcharged gt lt polrule gt right_trapped lt polrule gt lt mnmchemgroup gt lt monomer gt lt monomer gt lt code gt W lt code gt lt mnmchemgroup gt lt name gt N term NH2 lt name gt lt pka gt 9 6 lt pka gt lt acidcharged gt TRUE lt acidcharged gt lt polrule gt left_trapped lt polrule gt lt chemgrouprule gt lt entity gt LE_PLM_MODIF lt entity gt lt name gt Acetylation lt name gt lt outcome gt LOST lt outcome gt lt chemgrouprule gt lt mnmchemgroup gt lt mnmchemgroup gt lt name gt C term COOH lt name gt lt pka gt 2 35 lt pka gt lt acidcharged gt FALSE lt acidcharged gt lt polrule gt right_trapped lt polrule gt lt mnmchemgroup gt lt monomer gt lt monomer gt lt code gt Y lt code gt lt mnmchemgroup gt lt name gt N term NH2 lt name gt lt pka gt 9 6 lt pka gt lt acidcharged gt TRUE lt acidcharged gt lt polrule gt left_trapped lt polrule gt lt chemgrouprule gt lt entity gt LE_PLM_MODIF lt entity gt lt name gt Acetylation lt name gt lt outcome gt LOST lt outcome gt lt chemgrouprule gt lt mnmchemgroup gt lt mnmchemgroup gt lt name gt C term COOH lt name gt lt pka gt 2 36 lt pka gt lt acidcharged gt FALSE lt aci
176. nce is systematically parsed When invalid characters are found the window de picted in Figure 8 9 on the following page is presented to the user for her to 80 CHAPTER 8 XPERTEDIT massXpert Sequence Purification Initial Sequence r Purified Sequence I100ATGCATGCATGCATGCATGCATGCATG CAUGCanotherSilly Text Purification Options Spaces Punctuation Remove Tagged From Initial Test Purified Lowercase Uppercase Purify Initial Options Reset To Initial Others RegExp Pes ie Figure 8 9 Clipboard imported sequence error checking If a sequence that is imported through the clipboard to the XpertEdit sequence editor con tains invalid characters the user is provided with a facility to purify the se quence This facility is provided to the user through the window depicted in this figure make appropriate adjustments in this example we tried to copy from clip board the following sequence 100 ATGCATGC ATGCATGC ATGCATGC ATGCAUGC anotherSilly Text As soon as a character does not correspond to any valid monomer code it is tagged and the sequence is presented to the user in a text edit widget Initial Sequence with the all the improper characters tagged by underlining At that point if the user clicks the Remove Tagged From Initial button all the tagged characters will be automatically removed and the purified sequence will show up in th
177. nd gt lt isotope gt lt atom gt lt atom gt lt name gt Nitrogen lt name gt lt symbol gt N lt symbol gt lt isotope gt lt mass gt 14 0030740000 lt mass gt lt abund gt 99 6320000000 lt abund gt lt isotope gt lt isotope gt lt mass gt 15 0001090000 lt mass gt lt abund gt 0 3680000000 lt abund gt lt isotope gt lt atom gt lt atom gt lt name gt Oxygen lt name gt lt symbol gt 0 lt symbol gt lt isotope gt lt mass gt 15 9949146000 lt mass gt lt abund gt 99 7570000000 lt abund gt lt isotope gt lt isotope gt lt mass gt 16 9991306000 lt mass gt lt abund gt 0 0380000000 lt abund gt lt isotope gt 127 lt isotope gt lt mass gt 17 9991594000 lt mass gt lt abund gt 0 2050000000 lt abund gt lt isotope gt lt atom gt lt atom gt lt name gt Fluorine lt name gt lt symbol gt F lt symbol gt lt isotope gt lt mass gt 18 9984032000 lt mass gt lt abund gt 100 0000000000 lt abund gt lt isotope gt lt atom gt lt atom gt lt name gt Neon lt name gt lt symbol gt Ne lt symbol gt lt isotope gt lt mass gt 19 9924391000 lt mass gt lt abund gt 90 4800000000 lt abund gt lt isotope gt lt isotope gt lt mass gt 20 9938453000 lt mass gt lt abund gt 0 2700000000 lt abund gt lt isotope gt lt isotope gt lt mass gt 21 9913837000 lt mass gt lt abund gt 9 2500000000 lt abund gt lt isotope gt lt atom gt lt atom gt lt nam
178. ne edit widgets depending on the dialog window the filtering occurs cleavage fragmentation or mass search In our example thus the filtering would be spoken like this Only show the oligomers for which the monoisotopic mass is 850 plus or minus 3 atomic mass units To exit the data filtering mode simply uncheck the Filtering options check box and all the initial data will be displayed irrespective of any data in the line edit boxes described above M Z RATIO CALCULATION In electrospray ionization a given polymer sequence might be charged a large number of times The tool shown in Figure 8 22 on the next page shows how to compute a range of m z ratios starting from one m z value for a given charge and a given ionization agent It is also possible to switch ionization agent on the fly MONOMERIC AND ELEMENTAL POSITIONS The Chemistry Determine Compositions menu triggers the window shown in Figure 8 23 The elemental composition is determined using the calculations engine configuration currently set in the polymer sequence editor window PKA PH PI AND CHARGES When preparing biochemical experiments very often users need to know how many charges a given polymer sequence will bear at any given pH Equally important is the ability to know at which pH value the polymer sequence will 98 CHAPTER 8 XPERTEDIT massXpert m z Ratio Calculator Initial status Mono m z 140 877 9472396402 Avg m z 1
179. next page As detailed for the cleavage of polymers these fragmentation specifi cations are listed by looking into the polymer chemistry definition corresponding to the polymer sequence of which an oligomer is to be fragmented The user selects the fragmentation specification s of interest set the ion ization range required for the generated fragment oligomers the same as for polymer cleave and clicks the Fragment button Upon successful termination of the fragmentation reaction the generated fragments are displayed in the Oligomers table view widget As detailed for the cleavage of polymer sequences the Details frame widget displays data about the fragments generated and the way masses were calculated for them Finally one last note if the list of monoisotopic or average masses are desired in the form of a text list right clicking onto the table view widget will allow copying to the clipboard either the monoisotopic or the average masses Also it is possible to either export the data to the clipboard or to a file or even to drag the displayed oligomer items in a text editor For oligomer data filtering please refer to section 8 page 96 MASS SEARCHING It may happen that the scientist needs to know if some arbitrary sequence region would have a given mass massXpert allows for mass searching operations in the polymer sequence This is done by using the menu Chemistry Mass Search The window illustrated in Figure 8 20 on page 95
180. nition should reside in a same directory exactly the same way as the files pertaining to a given polymer chemistry definition are shipped in massXpert altogether in one directory The name of the new polymer chemistry definition should be unambiguous with respect to other registered polymer chemistry definitions The way a polymer chemistry definition is registered is by created a per sonal polymer chemistry definition catalogue file which must comply with two requirements Be named xxxxx pol chem defs cat with xxxxx being a discretionary string this might well be your name for example The requirement is that pol chem defs cat be the last part of the filename Please DO NOT USE spaces punctuation or diacritical signs in your filenames RE STRICT yourself to ASCII characters between a z 0 9 _ and 5 5 Be located in the HOME massxpert pol chem defs directory and have the following format dna path to definition directory dna dna xml In this example the dna polymer chemistry definition is being registered as a file dna xml located in the dna directory itself located in the path to definition directory directory Note that if a new polymer chemistry definition should be made available system wide then it is logical that its directory be placed along the ones shipped with massXpert and a new local catalogue file might be created to register the new polymer chemistry definition At this point the new polymer
181. nization level range Trypsin v 1 21 3 To Clipboard Oligomers 17 30 850 954 1 23 1 121 127 Filtering options Partial Details Sequence Cleavage details Polymer Monomers Tonization Left cap Right cap Modifications Unitary charge Formula H Left modif Right modif Cross links di Figure 8 21 Oligomer data filtering This figure shows how oligomer data can be filtered The Filtering options group box contains four line edit widgets where filtering might be triggered Partial Mono Avg Charge The filtered data are displayed in the same window this examlple for polymer sequence cleavage oligomer data Finally one last note if the list of monoisotopic or average masses are desired in the form of a text list right clicking onto the table view widget will allow copying to the clipboard either the monoisotopic or the average masses Also it is possible to either export the data to the clipboard or to a file or even to drag the displayed oligomer items in a text editor For oligomer data filtering please refer to section 8 page 96 OLIGOMER DATA FILTERING Oligomer generating simulations like polymer sequence cleavages or fragmenta tions or mass searches produce a very large amount of data It is often desirable to be able to filter quickly some specific data out of these bunch of data In all three simulations mentioned above the results that are displayed in the correspondin
182. not in the formation of inter monomer bonds while the monomer is polymerized into the polymer sequence The value left trapped means that the chemical group ceases to be involved in charge calculations as soon as it has a monomer at its left end The value right trapped means the same as above but when a monomer is polymerized at its right end For a chemical group that is left trapped we understand that it is only effectively evaluated if it is at the left end of the polymer sequence since in this case it does not have a monomer at its left side Conversely a chemical group that has a lt polrule gt element with value right trapped will be evaluated only if the monomer is actually the right end monomer in the polymer sequence Finally the typical lateral chains of amino acids have a lt polrule gt ele ment with a value never trapped as these chemical groups do not take part in the formation of the inter monomer bond there can be none one or more lt chemgrouprule gt element s for each chemgroup A chemgrouprule element should contain the following there must be an entity element that indicates what is the chem ical entity being dealt with in the current chemgroup element Valid values for this element are PLM MODIF PLM MODIF MODIF there must be lt name gt element naming chemical entity properly 102 CHAPTER 8 XPERTEDIT there must be an lt outcome gt elem
183. ns has been refactored to reflect the rewriting of the corresponding code Added a small section about m z ratio calculation that was missing although the feature was added a long time ago september 2007 the 22nd The new multi charged cleavage and frag mentation oligomers have been documented august 2007 the 19th Switched back to version 2 of the GPL in the Appendices chapters as massxpert cannot be licensed otherwise the Qt libraries are licensed using version 2 of the GPL without the or any later version at your option wording july 2007 the 28th Updated the XpertDef chapter modifications to show the new targets feature Updated the XpertEdit chapter to show the new monomer modification dialog july 2007 the 19th Added explanation on the arbitrary formula based polymer sequence ends modification july 2007 the 13th Revision of the whole document for a better printed output iv july 2007 the 10th Added a section to the XpertEdit chapter about the data mining mass list lab feature added recently Mentioned the installa tion of Debian packages june 2007 the 30th Switched the project and all accompanying docu mentation and other data files to GPL version 3 mid june 2007 Start of the writing by taking inspiration of the GNU polyxmass manual To MARTA CECILIA To all the admirable people acting in the Free Software Movement for a better and more ethical computing world To all invo
184. of a chain of osidic residues blue boxed formula and of two caps red colored atoms The left cap is the proton group that belongs to the non reducing end of the polymer The right cap is the hydroxyl group that belongs to the reducing end of the polymer end Historically this was observed with monosaccharides also called monoses which reduced cupric Cu ions thus getting oxydized themselves on the carbonyl when in the open ring aldehydic form Figure 3 5 shows the polymerization reaction between a sugar and another one 2 glucose monomers actually to yield a maltose disaccharide The poly merization mechanism is a simple condensation The elongation of the saccha ridic polymer is simple repetition of this condensation reaction so that the chain growth is always in the same orientation from the non reducing end to the reducing end The conventional representation of a polysaccharide involves showing the non reducing end on the left and the reducing end on the right horizontally Figure 3 6 shows a simple way to formalize what a saccharidic polymer is The top formula is the representation of the monomer The bottom formula represents a polysaccharide with the repetitive elements boxed there are n monomers polymerized The atoms shown in red outside the boxed repetitive elements are the saccharidic polymer caps Thus we see clearly that in the case of polysaccharides the left cap is a proton and the right cap is a hydroxyl
185. of that numbered version or of any later version published by the Free Software Foundation If the Program does not specify a version number of the GNU General Public License you may choose any version ever published by the Free Software Foundation If the Program specifies that a proxy can decide which future versions of the GNU General Public License can be used that proxy s public state 174 CHAPTER 11 APPENDICES ment of acceptance of a version permanently authorizes you to choose that version for the Program Later license versions may give you additional or different permissions However no additional obligations are imposed on any author or copyright holder as a result of your choosing to follow a later version 15 Disclaimer of Warranty THERE IS NO WARRANTY FOR THE PROGRAM TO THE EXTENT PERMITTED BY APPLICABLE LAW EXCEPT WHEN OTHERWISE STATED IN WRITING THE COPYRIGHT HOLDERS AND OR OTHER PARTIES PROVIDE THE PROGRAM AS IS WITHOUT WARRANTY OF ANY KIND EITHER EXPRESSED OR IMPLIED INCLUDING BUT NOT LIMITED TO THE IMPLIED WARRANTIES OF MER CHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE THE ENTIRE RISK AS TO THE QUALITY AND PERFORMANCE OF THE PROGRAM IS WITH YOU SHOULD THE PROGRAM PROVE DEFECTIVE YOU ASSUME THE COST OF ALL NECESSARY SER VICING REPAIR OR CORRECTION 16 Limitation of Liability IN NO EVENT UNLESS REQUIRED BY APPLICABLE LAW OR AGREED IN WRITING WILL ANY COPYRIGHT HOLDER OR ANY OTHER
186. on direc tory typically on GNU Linux that would be the configuration data in the usr local share massxpert directory or on MS Windows the c Program Files massxpert directory 1 Although MS Windows pathnames use a back slash in this book these are composed using forward slashes for a number of valid reasons The reader only needs to replace back slashes with the forward variety 115 116 CHAPTER 10 DATA CUSTOMIZATION We said above that massXpert tries to read the data configuration files from the home directory But upon its very first execution right after installation that directory does not exist and in fact massXpert creates that directory for us to populate it some day with interesting new data The HOME massxpert directory should have a structure mimicking the one that was created upon installation of the software that is it should contain the following two directories pol chem defs plugins Those are the directories where the user is invited to store her personal data In order to start a new definition one might simply copy there one of the polymer chemistry definitions that are shipped with massXpert What should be copied An entire polymer chemistry definition directory like for example the following usr local share massxpert pol chem defs protein 1 letter or C Program Files massxpert data pol chem defs protein 1 letter Once that polymer chemistry definition is copied one may start studyin
187. ong to the polymer sequence per se and are not removed from it even if the polymer sequence is edited by removing the left end monomer or the right end monomer This is why these modifications are polymer modifications and not monomer modifications The way in which a polymer sequence is modified using polymer modifications is much easier than the previous monomer modifications case The modification window is opened by choosing the Chemistry Modify Polymer menu The Figure 8 13 shows that window The modification is absolutely easy to perform with a clear feedback provided to the user by listing the permanent modifica tions in two line edit widgets located in front of the Target checkbuttons Left End and Right End Note that as a convenience for the user it is possible to modify the polymer sequence using an arbitrary modification in the form of a combination of a name 87 massXpert Monomer Cross link Creation of cross links Cross link details Yiewing removal of cross links Cross linkers Name Comment Cross linked monomers Cross links CFP chromophore CFP chromophore Tj67 CFP chromophore 67 68 69 4 DisulfideBond wjea Modifications Targets positions 6 69 Chromo O FoR Chromo H3 67198169 Chromo H v All cross links Cross link m Uncross link Figure 8 14 Cross linking of monomers This figure shows the window in which monomers can be cross linked together A cross link
188. ost always uncharged form ROH at physiological pH values The lateral chain 100 ARG LYS HIS BASIC RESIDUES ACIDIC RESIDUES GLY CHAPTER 8 XPERTEDIT 9 6 2 35 POLAR SIDE CHAINS CH CH CH2 NH C NH ASN y CH CO NH NH N 10 53 CH CH CH CH NH GUN cu cH co NH Q a CH C N 13 8 CH ie NH 5 6 0 2 THR CH CH 5 EM 3 65 2 CH COOH 101 EE y 4 25 CH CH COOH 83 PE CH SH NON POLAR SIDE CHAINS H 5 ci PRO N c cooH gt 3 HC CH CH CH CH2 _ 7 A am CH2 CH CH3 w Ne Me NH CH Figure 8 24 Different pKa values for a number of amino acids chemical groups All of the twenty amino acids are represented here which each amino acid s lateral chain fully represented Above each chemical group for which the value makes sense from a biological perspective the pKa value is indicated 101 of lysine has a pKa of 10 53 which means that at pH values below this pKa value the eNH2 gets protonated introducing a positive charge in the protein Similarly amino acids glutamate and aspartate do have a lateral chain ended with a yCOOH and respectively Their pKa values are below 4 5 and thus the group
189. otope gt lt atom gt lt atom gt 136 CHAPTER 11 lt name gt Rubidium lt name gt lt symbol gt Rb lt symbol gt lt isotope gt lt mass gt 84 9117996000 lt mass gt lt abund gt 72 1700000000 lt abund gt lt isotope gt lt isotope gt lt mass gt 86 9091836000 lt mass gt lt abund gt 27 8300000000 lt abund gt lt isotope gt lt atom gt lt atom gt lt name gt Strontium lt name gt lt symbol gt Sr lt symbol gt lt isotope gt lt mass gt 83 9134280000 lt mass gt lt abund gt 0 5600000000 lt abund gt lt isotope gt lt isotope gt lt mass gt 85 9092732000 lt mass gt lt abund gt 9 8600000000 lt abund gt lt isotope gt lt isotope gt lt mass gt 86 9088902000 lt mass gt lt abund gt 7 0000000000 lt abund gt lt isotope gt lt isotope gt lt mass gt 87 9056249000 lt mass gt lt abund gt 82 5800000000 lt abund gt lt isotope gt lt atom gt lt atom gt lt name gt Yttrium lt name gt lt symbol gt Y lt symbol gt lt isotope gt lt mass gt 88 9058560000 lt mass gt lt abund gt 100 0000000000 lt abund gt lt isotope gt lt atom gt lt atom gt lt name gt Zirconium lt name gt lt symbol gt Zr lt symbol gt lt isotope gt lt mass gt 89 9047080000 lt mass gt lt abund gt 51 4500000000 lt abund gt lt isotope gt lt isotope gt lt mass gt 90 9056442000 lt mass gt lt abund gt 11 2200000000 lt abund gt lt isotope gt APPENDICES 137 l
190. p gt lt mnmchemgroup gt lt name gt C term COOH lt name gt lt pka gt 2 35 lt pka gt lt acidcharged gt FALSE lt acidcharged gt lt polrule gt right_trapped lt polrule gt lt mnmchemgroup gt lt monomer gt lt monomer gt lt code gt M lt code gt lt mnmchemgroup gt lt name gt N term NH2 lt name gt lt pka gt 9 6 lt pka gt lt acidcharged gt TRUE lt acidcharged gt lt polrule gt left_trapped lt polrule gt lt chemgrouprule gt lt entity gt LE_PLM_MODIF lt entity gt lt name gt Acetylation lt name gt lt outcome gt LOST lt outcome gt lt chemgrouprule gt lt mnmchemgroup gt lt mnmchemgroup gt lt name gt C term COOH lt name gt lt pka gt 2 35 lt pka gt lt acidcharged gt FALSE lt acidcharged gt lt polrule gt right_trapped lt polrule gt lt mnmchemgroup gt lt monomer gt lt monomer gt lt code gt N lt code gt lt mnmchemgroup gt lt name gt N term NH2 lt name gt lt pka gt 9 6 lt pka gt lt acidcharged gt TRUE lt acidcharged gt lt polrule gt left_trapped lt polrule gt lt chemgrouprule gt lt entity gt LE_PLM_MODIF lt entity gt lt name gt Acetylation lt name gt lt outcome gt LOST lt outcome gt lt chemgrouprule gt lt mnmchemgroup gt APPENDICES 159 lt mnmchemgroup gt lt name gt C term COOH lt name gt lt pka gt 2 35 lt pka gt lt acidcharged gt FALSE lt acidcharged gt lt polrule gt right_trapped lt polrule gt lt mnmchemgroup gt l
191. pe Atom Mass 12 0000000000 l Mono 12 0000000000 Abund 98 9300000000 Apply Avg 12 0107358964 validate add Remove Move up Move down Add Remove Move up Move down Figure 6 3 XpertDef atom definition Each chemical element must contain at least one isotope otherwise it does not have any raison d tre the other polymer chemical entities These are often defined using chemical formulas which explain why it is necessary to first define the atoms The following are the data that need to be entered so as to obtain a usable polymer chemistry definition The polymer chemistry definition Name protein 1 letter Name of the poly mer chemistry definition Caps Chemical capping reactions that should happen on the left end Left and on the right end Right of the polymer sequence Left H Left capping of the polymer sequence Right OH Right capping of the polymer sequence Polymer lonization rule This rule describes the manner in which the poly mer sequence should be ionized by default when the mass is calculated This rule actually holds two elements Formula H Chemical reaction that ionizes the polymer sequence In the example all the polymer sequences of polymer chemistry defini tion protein 1 letter are protonated by default Charge 1 Charge that is brought by the chemical agent ionizing the polymer the formula above In the e
192. pe gt lt mass gt 38 9637079000 lt mass gt lt abund gt 93 2581000000 lt abund gt lt isotope gt lt isotope gt lt mass gt 39 9639988000 lt mass gt lt abund gt 0 0117000000 lt abund gt lt isotope gt lt isotope gt lt mass gt 40 9618254000 lt mass gt lt abund gt 6 7302000000 lt abund gt lt isotope gt lt atom gt lt atom gt 130 CHAPTER 11 APPENDICES lt name gt Calcium lt name gt lt symbol gt Ca lt symbol gt lt isotope gt lt mass gt 39 9625907000 lt mass gt lt abund gt 96 9410000000 lt abund gt lt isotope gt lt isotope gt lt mass gt 41 lt isotope gt lt isotope gt lt mass gt 42 lt abund gt 0 lt isotope gt lt isotope gt lt mass gt 43 lt abund gt 2 lt isotope gt lt isotope gt lt mass gt 45 lt abund gt 0 lt isotope gt lt isotope gt lt mass gt 47 lt abund gt 0 lt isotope gt lt atom gt lt atom gt 9586218000 lt mass gt lt abund gt 0 6470000000 lt abund gt 9587704000 lt mass gt 1350000000 lt abund gt 9554848000 lt mass gt 0860000000 lt abund gt 9536890000 lt mass gt 0040000000 lt abund gt 9525320000 lt mass gt 1870000000 lt abund gt lt name gt Scandium lt name gt lt symbol gt Sc lt symbol gt lt isotope gt lt mass gt 44 9559136000 lt mass gt lt abund gt 100 0000000000 lt abund gt lt isotope gt lt atom gt lt atom gt lt nam
193. pert binary or source the documentation got installed on your system look for a usermanual directory somewhere in the installed material The documentation that was installed is nothing but the document you are reading now It is available both in the form of HTML files and of one PDF file 14 CHAPTER 2 MASSXPERT INSTALLATION Basics in Polymer Chemistry This chapter will introduce the basics of polymer chemistry The way this topic is going to be covered is admittedly biased towards mass spectrometry and biological polymers Moreover the aim of this chapter is to provide the reader with the specialized words that will later be used to describe and explain the inner workings of the massXpert program This manual is not a crash course in biochemistry POLYMERS WHERE EVERYWHERE Indeed polymers are everywhere If you ask somebody to show you something polymeric he she will point you at the first plastic object in the vicinity Right plastic materials are made of hydrocarbon polymers We also have many differ ent polymers in our body Proteins are polymers complex sugars are polymers DNA the so called molecule of heredity is a huge polymer There are polymers in wine in wood Where Everywhere 15 16 CHAPTER 3 BASICS IN POLYMER CHEMISTRY The Oxford Advanced Learner s Dictionary of Current English gives for poly mer the following definition natural or artificial compound made up of large molecules whi
194. pertDef menu item from the program s menu It is possible to start a new polymer chemistry definition from scratch but it is certainly usually easier to first duplicate a polymer chemistry definition shipped with massXpert and then open that copy and edit it Please refer to chapter 10 page 115 for an explanation of how this is safely done To open a polymer chemistry definition the user may either select one that is already registered with the system and that appears listed in the drop down list widget shown in Figure 6 1 on the next page or click the Cancel button so as to open one definition file by browsing the filesystem In the polymer chemistry 43 44 CHAPTER 6 XPERTDEF Select a Polymer Chemistry Definition or Click Cancel to Browse PR Polymer Chemistry Definition c progra 1 massxpert 1 6 0 rc1 datafpol chem defs protein 1 letter protein 1 letter xml ci progra 1 massxpert 1 6 0 rc1 data pol chem defs protein 1 letter protein 1 letter xml cifprogra 1 massxpert 1 6 0 re1 data pol chem defs protein 3 letters protein 3 letters xml c progra 1 massxpert 1 6 0 rc1 data pol chem defs dnafdna xml ci progra 1 massxpert 1 6 0 rc1 data pol chem defs saccharide saccharide xml Figure 6 1 Select one polymer chemistry definition file It is possible to immediately select a polymer chemistry definition already registered with the system or open an arbitrary file by browsing the filesystem click the Cancel button hidd
195. prominent notices stating that it is released under this License and any conditions added under section 7 This requirement modifies the requirement in section 4 to keep intact all notices c You must license the entire work as a whole under this License to anyone who comes into possession of a copy This License will therefore apply along with any applicable section 7 additional terms to the whole of the work and all its parts regardless of how they are packaged This License gives no permission to license the work in any other way but it does not invalidate such permission if you have separately received it d If the work has interactive user interfaces each must display Appro priate Legal Notices however if the Program has interactive inter faces that do not display Appropriate Legal Notices your work need not make them do so 168 CHAPTER 11 APPENDICES A compilation of a covered work with other separate and independent works which are not by their nature extensions of the covered work and which are not combined with it such as to form a larger program in or on a volume of a storage or distribution medium is called an aggregate if the compilation and its resulting copyright are not used to limit the access or legal rights of the compilation s users beyond what the individual works permit Inclusion of a covered work in an aggregate does not cause this License to apply to the other parts of the aggregate
196. quence Purified Sequence 100ATGCATGCATGCATGCATGCATGCATG ATGCATGCATGCATGCATGCATGCATGCAG CAUGCanotherSilly Text CST Purification Options Numerals Spaces Punctuation jr Test Purified Lowercase _ Uppercase Purify Initial Options Reset To Initial Others RegExp Figure 8 10 Clipboard imported sequence purification There are a num ber of ways to purify a sequence Here the Remove Tagged From Initial button was clicked The purified sequence shows up in the Purified Sequence text edit widget IMPORTING FROM RAW TEXT FILES It might be of interest to be able to import a sequence from a raw file To this end the user is provided the menu File Import Raw that opens up a file selection window from which to choose the file to import The program then iterates in the lines of that file and checks their contents for validity If errors are found then the same process as described earlier for clipboard imported sequences is started The user can then purify the sequence imported from the file and finally integrate that sequence in the polymer sequence currently edited Note that if any sequence portion is currently selected it will be replaced by the one that is being imported MULTI REGION SELECTIONS massXpert implements a sophisticated multi region selection model Two selec tion modes are available Multi region selection mode In this
197. r this Free Software License dk dt Copyright 2006 2007 Filippo Rusconi This is the monomer_dictionary file where the correspondences between the codes of each monomer and their graphic file pixmap file called image used to graphicallly render them in the sequence editor are made dk The format of the file is like this Ahalanine svg where A is the monomer code and alanine svg is a resolution independent svg file Each line starting with a character is a comment and is ignored during parsing of this file This file is case sensitive See section 8 page 87 5See section 8 page 97 118 Fille Edt View Settings CHAPTER 10 DATA CUSTOMIZATION Help B lysine svg 5 methionine svg oxidation svg phenylalanine svg i phospho svg proline svg amp serine svg ry sulphation svg sulpho svg 8 threonine svg t tryptophan svg 8 tyrosine svg X Automatic preview File Edit View Settings Help 09000 Ihome rusconi devel massxpert data pol chem defs saccharide 8 allose svg altrose svg ij arabinose svg t erythrose svg ry erythrulose svg amp fructose svg galactose svg glucose svg 3 gulose svg 8 idose svg amp lyxose svg t mannose svg 5 methyl svg E KID X Automatic preview glucose svg 5 1 KB Scalable Vector Graphics Figure 10 1 The polymer chemis
198. re the full notice is found lt one line to give the program s name and a brief idea of what it does gt Copyright C lt year gt lt name of author gt This program is free software you can redistribute it and or modify it under the terms of the GNU General Public License as published by the Free Software Foundation either version 3 of the License or at your option any later version This program is distributed in the hope that it will be useful but WITHOUT ANY WARRANTY without even the implied warranty of MERCHANTABILITY or FITNESS FOR A PAR TICULAR PURPOSE See the GNU General Public License for more details You should have received a copy of the GNU General Public Li cense along with this program If not see http www gnu org licenses Also add information on how to contact you by electronic and paper mail If the program does terminal interaction make it output a short notice like this when it starts in an interactive mode lt program gt Copyright C lt year gt lt name of author gt This program comes with ABSOLUTELY NO WARRANTY for details type show w This is free software and you are wel come to redistribute it under certain conditions type show c for details The hypothetical commands show w and show c should show the appro priate parts of the General Public License Of course your program s com mands might be different for a GUI interface you would use an about box You s
199. rmula gt Nul lt formula gt lt modifname gt ProtonLoss lt modifname gt lt modifname gt ProtonLoss lt modifname gt lt clk gt lt crosslinkers gt lt cleavespecs gt lt cls gt lt name gt CyanogenBromide lt name gt lt pattern gt M lt pattern gt lt clr gt lt name gt Homoseryl lt name gt lt re mnm code gt M lt re mnm code gt lt re formula gt CH2S 0 lt re formula gt lt clr gt lt cls gt lt cls gt 150 CHAPTER 11 APPENDICES lt name gt Trypsin lt name gt lt pattern gt K R K P lt pattern gt lt cls gt lt cls gt lt name gt Chymotrypsin lt name gt lt pattern gt W V lt pattern gt lt cls gt lt cls gt lt name gt EndoLysC lt name gt lt pattern gt K lt pattern gt lt cls gt lt cls gt lt name gt EndoAspN lt name gt lt pattern gt D lt pattern gt lt cls gt lt cls gt lt name gt GluC lt name gt lt pattern gt E lt pattern gt lt cls gt lt cleavespecs gt lt fragspecs gt lt fgs gt lt name gt a lt name gt lt end gt LE lt end gt lt formula gt C101 lt formula gt lt fgr gt lt name gt a fgr 1 lt name gt lt formula gt H200 lt formula gt lt prev mnm code gt E lt prev mnm code gt lt curr mnm code gt D lt curr mnm code gt lt next mnm code gt F lt next mnm code gt lt comment gt comment here lt comment gt lt fgr gt lt fgr gt lt name gt a fgr 2 lt name gt lt formula gt H100 lt formula gt lt prev mnm code gt
200. rs defined in massXpertshould refer to these modifications as modification ob jects already available in the polymer chemistry definition Note that in some cases it is not necessary to define modifications to occur at the level of the cross linked monomers The example described in Figure 6 7 on the follow ing page corresponds to the cross linking reaction involved in the formation of the chromophore of the cyan fluorescent protein That reaction involves the three following monomers 9 Threonyl 99 Tyrosinyl 97 Glycyl Each monomer undergoes a distinct chemical modification 0 and respectively 50 CHAPTER 6 XPERTDEF massXpert CrossLinker Definitions CrossLinkers Modifications _ Details P chromophore GG Identity DisulfideBond Chromo H3 Chromo H CFP chromophore Formula Nul Apply Modification Name Chromo O Apply Validate Add Remove Add Remove Move up down Move up Move down Figure 6 7 XpertDef cross linkers definition Each cross linker is defined using a name a formula and either no modification or as many modifications as there are monomers involved in the formation of the cross link Three modifications were thus defined Chromo 0 Chromo H3 and Chromo H in that specific order as these modifications are going to be sequentially applied to their corresponding monomer in t
201. ry Click onto the Monomers button which triggers the opening of the dialog window shown in Figure 6 4 The way this dialog is operated is similar to what was described for the atom unless it is simpler because monomers are non deep objects there are no contained objects One data element is critical the number of characters that might be used to define the code of the element cannot be greater than the value entered in Code length spinbox widget The fundamental rule is the following The first character of a monomer code must be uppercase while the remaining characters if any must be lowercase That means that if Code length is 3 A Al Ala would be perfectly fine while Alan AL a would be wrong 1 Allowing more than one letter to craft monomer codes might seem trivial at first But that design decision triggered the requirement for non trivial algorithms throughout all the code of the of program This is easily understandable at least in the polymer sequence editor how are monomer codes keyed in if A and Ala are valid monomer codes in a polymer chemistry definition The magic is described in the chapter about XpertEdit see chapter 8 on page 69 48 CHAPTER 6 XPERTDEF Isoleucine Leucine 0 Asparagine Leucine 0 958863 Leucine Isoleucine 0 Asparagine Isoleucine 0 958863 Glutamate Lysine 0 94763 Aspartate Asparagine 0
202. s for Curr code A T and G are identical to the a B c one 57 unless the Curr code is A T and the formula to be removed is the formula of the corresponding DNA base The fragmentation rule based definition of fragmentation pattern a B yields identical results as for the more generalizable method described earlier EVEN MORE COMPLEX FRAGMENTATION PATTERNS Note that in saccharide chemistry the fragmentation patterns are extremely complex and often totally depend on the nature of the monomers local to the fragmentation site For example the fragmentation behaviour at position E in a sequence DEAR might be different than in a sequence DERA massXpert had to be able to model these complex situations and this is done using frag mentation rules where the local logic involves defining the Prev code and or the Next code for a given Curr code at which the fragmentation occurs For example one specific fragmentation pattern for fragmentation at in sequence DEAR might be defined this way Prev code D Curr code E Next code A In stead of that fragmentation rule one would have for fragmentation at in sequence DERA the following rule Prev code D Curr code E Next code R Note the change for Next code from A to R Also be aware that the Prev Curr and Next notions are polar that is they depend on the value of End that is LE or
203. s taking that region to be the actual polymer sequence of interest in the second case the cleavage will take place in the whole polymer sequence whatever the currently selected polymer sequence 89 _ massXpert Polymer cleavage vos Configuration of the cleavage Actions Available cleavage agents Cleave EndoAspN GluN Oligomer coordinates Typsin Stack oligomers Chymotrypsin Start 1 End 153 EndolysC Whole sequence ToClippoard EndoAspN zu 3 Gluc Partial cleavages 1 _ Withisequence CyanogenBromide ges EndoAspN Typsin lonization level range 1 Oligomers 123 items Part cleav Name Coords Mono Avg Charge Modif 0 0 1 2 1 1 16 1 815 90297 1 816 99053 1 False 0 0 1 2 2 1 16 908 45540 908 99923 2 False 0 0 1 2 3 1 16 605 97287 606 33547 3 False O 2 z 1 17 31 1 606 85529 1 607 78982 1 False 0 0 2 2 2 17 31 803 93156 804 39888 2 False 0 0 2 2 3 17 31 536 29031 536 60190 3 False 0 0 3 2 1 32 42 1 271 66358 1 272 42898 1 False 0 0 3 2 2 32 42 636 33570 636 71846 2 False 0 0 3 2 3 32 42 424 55974 424 81495 3 False 0 0 4 2 1 43 45 409 20871 409 45767 1 False 0 0 4 2 43 45 205 10827 205 23280 2 False 0 0 4 2 3 43 45 137 07479 137 15785 3 False 0 0 5 2 1 46 47 294 18177 294 37006 1 False 0 0 5 2 2 46 47 147 59480 147 68900 2 False e _ Filtering options Ctrl F Details Sequence Cleavage details GLSDGEWQQVLNVWGK Trypsin formula C82H123N22025
204. s very easy This is partly due to the very self explanatory graphical user interface of the module which is illustrated in Figure 7 2 XpertCalc can handle a number of items that are reviewed below Seed Masses The user may is not obliged to seed the calculation by setting masses manually in these line edit widgets the left line edit is for mono and the right one for avg both monoisotopic and average m z values need to be entered For example imagine that a mass spectrum analysis session ends up like this There is a peak with m z 1000 55 z 1 and another one roughly 80 Da more Is it possible that the analyte show ing up at m z 1000 55 is phopshorylated The massist would seed the calculator with mass 1000 55 and ask that one Phosphorylation modifica tion be added to it by setting 1 in front of the corresponding drop down widget Clicking onto Apply triggers the calculation with the resulting masses being displayed in the Result Masses line edit widgets We can see that the phosphorylation of our analyte shifts its m z value from 1000 55 to 1080 5163 Note that each time a calculation is triggered by clicking onto Apply the values already present in the Result Masses line edit widgets are transferred to the Seed Masses line edit widgets This provides a 1 level undo Result Masses Each time a calculation is triggered by clicking the Apply button or the chemical pad s buttons see below the newly obtained masses are di
205. s are negatively charged a physiological pH values When the net charge of a polymer sequence has to be computed for a given pH condition the program iterates in the sequence and for each monomer will check which one of its chemical group s is possibly charged For this to happen it is required that a number of data be known for each monomer s chemical group that might play a role in the determination of the polymer sequence s electrical charge Thus for each chemical group a number of data should be listed in the pka_ph_pi xml file please see that file in the chapter 11 on page 123 the chemical group s lt name gt element is required Examples uNH2 or eNH2 aCOOH the chemical group s lt pka gt element is optional but is the basis for the charge calculation Examples 9 6 for the aNH2 or 2 35 for the lt acidcharged gt element is required if the lt pka gt element is given This element is responsible for telling if the chemical group is charged positively when the pH is lower than pKa that is when the medium is acidic with respect to the pKa Examples an amine is positively charged when it is in its acidic form protonated a carboxylic acid is not charged when it is in its acidic form there can be none one or more lt polrule gt element s for each chem group The lt polrule gt element gives informations about the way the chemical group at hand might be trapped or
206. s data filled input m z list dialog window The mzLab s input m z list dialog window fills with data when result items are dragged and dropped onto it If the data dropped are a list of m z z pairs one pair per line like 1234 567 2 then the z value will be read from the dropped data 2 in this example This case is represented in Figure 9 5 on the facing page IMPOSING THE Mass TYPE MONO OR Ava When dropping data either from results windows cleavage fragmentation or mass search or from textual data it is necessary to inform the input m z list of what type the mass of interest is T hat is when dropping a line like 1234 56 1 is m z 1234 56 a monoisotopic m z or an average m z The type of the masses dropped in an input m z list is governed by the two radio buttons labelled Mono and Avg The one of the two radiobuttons that is checked at the moment the drop occurs determine the type of the m masses that are dropped It will be possible to check the other radio button widget once a first data drop occurred but then the user will be alerted about doing so IMPOSING THE OLIGOMER KIND When dropping data it is required that the laboratory know if the oligomers are cleavage mass search or fragmentation oligomers Indeed the way the calculations are performed is dependent on the kind of the oligomers used frag mentation oligomers are not equivalent to cleavage oligomers because cleavage oligomers are not charged by the
207. s jargon this logical condition is called a cleavage rule described later see page 50 Well all this sounds reasonable But what about the normal case when the cleavage is done using water Nothing special the mass of the oligomer is calculated by summing the mass of each monomer in the oligomer since the monomers are not modified this is easily done and the masses corresponding to the left and right caps these are defined in the polymer chemistry definition in our present case it would be a proton on the left end and a hydroxyl on the right end In this way the oligomer complies with its definition which states that it is a faithful polymer made of monomers and that it is in its finished state Yes but then how will massXpert manage to calculate the mass of the modified oligomer like our Oligomer 1 in the case of the cyanogen bromide mediated cleavage Simple enough in a first step it does exactly the same way as for the unmodified oligomer Next each oligomer is checked for presence or absence of a methionine residue on its right end If a methionine is found the mass corresponding to the C1H2S1 O1 chemical reaction is applied And that s it In the previous cyanogen bromide example the logical condition was involv ing the identity of the oligomers right end monomer but other examples can involve not the right end monomer but the left end monomer if some chemical modification was to occur to the monomer sittin
208. s more or less in the polymer structure to eventually break it Fragmentations are mainly a gas phase pro cess not some reaction that happens in solution as a result of putting in contact the polymer and some reagent It is precisely because no cleaving molecule is involved in the fragmentation process that the fragments are not necessarily capped like a normal polymer should be and this is another really important difference between cleavage and fragmentation The following examples should illustrate these concepts protein and nucleic acid fragmentation PROTEIN FRAGMENTATION There is a pretty important number of different kinds of fragments that can be generated upon fragmentation of peptides We are going to detail the most com mon ones the user is invited to use the massXpert fragmentation specification grammar to add less frequent or newly discovered fragmentation types As can be seen from Figure 3 8 the fragmentations do generate fragments of three categories the ones that include the left end of the precursor polymer a b c the ones that include the right end of the precursor polymer x y z and finally the special case in which the fragment is an internal fragment like the immonium ions When looking at the fragmentations described in the figure it becomes immediately clear why a fragmentation cannot be mistaken for a cleavage the ionization of the fragment is not necessarily due to the captation of a proton by the fragm
209. see that the code of the monomer for which acid basic data are being defined is D and that this monomer has three chemical groups that might bring elec trical charges These chemical groups are described by three lt mnmchemgroup gt elements that we will review in detail below see Figure 8 24 on page 100 The first lt mnmchemgroup gt element is related to the amino group of the amino acid 103 lt name gt N term NH2 lt name gt The name of the chemical group is not imme diately useful but will be used when reports are to be prepared for the calculation lt pka gt 9 6 lt pka gt This element is optional However of course if the chem ical group might be electrically charged the pKa value will be essential in order to compute the charge that is brought by this chemical group at any given pH lt acidcharged gt TRUE lt acidcharged gt This element is also optional how ever if the previous element is given then this one is compulsory Telling if the conjugated acid form is charged that is protonated is essential in order to know what sign the charge has to be when the chemical group is ionized The value TRUE indicates that when the pH is lower than the pKa the chemical group is charged thus protonated in the form Consequently if the pH is higher than the pKa then the chemical group is neutral in the form lt polrule gt left_trapped lt polrule gt This element indicates t
210. splayed in these line edit widgets The values that were displayed there previously are transferred to the Seed Masses line edit widgets thus providing a 1 level undo Formula This group box widget contains two widgets a line edit widget where the formula is typed and a count spin box widget where the user 61 massXpert Calculator protein 1 letter m Seed Masses Result Masses 1 000 5500000000 1 000 8500000000 1 080 5163322400 1 080 8299188736 r 1 Add To Result Remove From Result Add To Seed Remove From Seed Send To Result Clear Sendo Seed r Formula __ _ Polymer Chemistry Definition Entities Serine 0 Phosphoryla 1 Current Definition protein 1 letter Show Recorder Show Chemical Pad mz alculation Isotopic Pattern Calculation Figure 7 2 Interface of the XpertCalc module This figure shows that the XpertCalc polymer chemistry definition aware module can handle atoms formula monomers modifications and even polymer sequences for computing masses sets the number of times that the formula should be applied Setting the formula to 20 and the count to 2 would hydrate the analyte twice Polymer Chemistry Definition Entities This group box widget contains two drop down widgets and a line edit widget
211. ssXpert version but the Trolltech Qt framework see the About Qt help menu in massXpert Coding with Qt libraries has one big advantage it allows the developer to code once and to compile on the three main platforms available to day GNU Linux MacOSX MS Windows Another advantage is that Qt libraries are wonderful software technically and philosophically Free Software TYPOGRAPHICAL CONVENTIONS Throughout the book the following typographical conventions are used emphasized text is used each time a new term or concept is introduced shell prompt shows the prompt at which a command should be entered as non root Shell prompt shows the prompt at which a command should be entered as root this typography applies to commands that the user enters at the shell prompt along with eventual options lt symbolizes pressing the key this typography applies to an output resulting from entering a command at the shell prompt emacs lib tCore names of a program or of a library KDE The Gimp is the name of a generic software not a specific executable file usr local share massxpert usr bin massxpert are names of a direc tory or of a file http www gnu org is an URL Uniform Resource Locator 4 CHAPTER 1 PREFACE PROGRAM AVAILABILITY TECHNICAL ITIES The ancestor of massXpert GNU polyxmass was initially developed on a GNU Linux system RedHat distribution versions successively 6 0 7 0 7 2 7
212. stes the sequence from the clipboard into the se quence at point that is the current cursor location If the pasted sequence is found to contain characters not valid for the current poly mer chemistry definition the user is given a chance to revise the pasted sequence If one sequence region was selected it is replaced with the pasted sequence If more than one sequence region was se lected the operation cannot be performed and the user is informed Edit 95Find Sequence Finds a sequence motif in the polymer se quence Chemistry Figure 8 5 Chemistry Modify Monomer s Modify or unmodify one or more monomers in the polymer sequence Chemistry Modify Polymer Set or unset the left or right or both modification of the polymer sequence Chemistry Cross link Monomers Set cross links to monomers of the polymer sequence Chemistry Cleave Perform a chemical enzymatical cleavage of the polymer sequence Chemistry Fragment Perform the gas phase fragmentation of the currently selected oligomer Chemistry 9 Mass Search For any sequence having a mass matching the searched mass Chemistry Compute m z Ratios Starting from a given m z ratio and a given ionization status calculate a range of m z ratios with a given ionization agent Chemistry Determine Compositions Calculate the monomeric element composition of the whole polymer sequence or of the current selec tion Chemistry
213. t lt isotope gt lt isotope gt lt mass gt 77 9173040000 lt mass gt lt abund gt 23 7700000000 lt abund gt lt isotope gt 135 lt isotope gt lt mass gt 79 9165205000 lt mass gt lt abund gt 49 6100000000 lt abund gt lt isotope gt lt isotope gt lt mass gt 81 9167090000 lt mass gt lt abund gt 8 7300000000 lt abund gt lt isotope gt lt atom gt lt atom gt lt name gt Bromine lt name gt lt symbol gt Br lt symbol gt lt isotope gt lt mass gt 78 9183361000 lt mass gt lt abund gt 50 6900000000 lt abund gt lt isotope gt lt isotope gt lt mass gt 80 9162900000 lt mass gt lt abund gt 49 3100000000 lt abund gt lt isotope gt lt atom gt lt atom gt lt name gt Krypton lt name gt lt symbol gt Kr lt symbol gt lt isotope gt lt mass gt 77 9203970000 lt mass gt lt abund gt 0 3500000000 lt abund gt lt isotope gt lt isotope gt lt mass gt 79 9163750000 lt mass gt lt abund gt 2 2800000000 lt abund gt lt isotope gt lt isotope gt lt mass gt 81 9134830000 lt mass gt lt abund gt 11 5800000000 lt abund gt lt isotope gt lt isotope gt lt mass gt 82 9141340000 lt mass gt lt abund gt 11 4900000000 lt abund gt lt isotope gt lt isotope gt lt mass gt 83 9115064000 lt mass gt lt abund gt 57 0000000000 lt abund gt lt isotope gt lt isotope gt lt mass gt 85 9106140000 lt mass gt lt abund gt 17 3000000000 lt abund gt lt is
214. t NT re mnm code PCDATA gt NT le formula PCDATA gt NT re formula PCDATA gt NT comment PCDATA gt NT prev mnm code PCDATA gt NT curr mnm code PCDATA gt lt ELEMENT next mnm code PCDATA gt 7 lt polchemdefinition version 3 gt lt atomdefdata gt lt atom gt lt name gt Nullor lt name gt lt symbol gt Nul lt symbol gt lt isotope gt lt mass gt 0 0000000000 lt mass gt lt abund gt 100 0000000000 lt abund gt lt isotope gt lt atom gt lt atom gt lt name gt Decilor lt name gt lt symbol gt Dic lt symbol gt lt isotope gt lt mass gt 0 1000000000 lt mass gt lt abund gt 100 0000000000 lt abund gt lt isotope gt lt atom gt lt atom gt lt name gt Unitor lt name gt lt symbol gt Uno lt symbol gt lt isotope gt lt mass gt 1 0000000000 lt mass gt lt abund gt 100 0000000000 lt abund gt lt isotope gt 125 lt atom gt lt atom gt lt name gt Hydrogen lt name gt lt symbol gt H lt symbol gt lt isotope gt lt mass gt 1 0078250400 lt mass gt lt abund gt 99 9885000000 lt abund gt lt isotope gt lt isotope gt lt mass gt 2 0141017900 lt mass gt lt abund gt 0 0115000000 lt abund gt lt isotope gt lt atom gt lt atom gt lt name gt Helium lt name gt lt symbol gt He lt symbol gt lt isotope gt lt mass gt 3 0160293000 lt mass gt lt abund gt 0 0001400000 lt abund gt lt isotope gt lt isotope gt lt mass gt 4 002
215. t monomer gt lt monomer gt lt code gt P lt code gt lt mnmchemgroup gt lt name gt N term NH2 lt name gt lt pka gt 9 6 lt pka gt lt acidcharged gt TRUE lt acidcharged gt lt polrule gt left_trapped lt polrule gt lt chemgrouprule gt lt entity gt LE_PLM_MODIF lt entity gt lt name gt Acetylation lt name gt lt outcome gt LOST lt outcome gt lt chemgrouprule gt lt mnmchemgroup gt lt mnmchemgroup gt lt name gt C term COOH lt name gt lt pka gt 2 35 lt pka gt lt acidcharged gt FALSE lt acidcharged gt lt polrule gt right_trapped lt polrule gt lt mnmchemgroup gt lt monomer gt lt monomer gt lt code gt Q lt code gt lt mnmchemgroup gt lt name gt N term NH2 lt name gt lt pka gt 9 6 lt pka gt lt acidcharged gt TRUE lt acidcharged gt lt polrule gt left_trapped lt polrule gt lt chemgrouprule gt lt entity gt LE_PLM_MODIF lt entity gt lt name gt Acetylation lt name gt lt outcome gt LOST lt outcome gt lt chemgrouprule gt lt mnmchemgroup gt lt mnmchemgroup gt lt name gt C term COOH lt name gt lt pka gt 2 35 lt pka gt lt acidcharged gt FALSE lt acidcharged gt lt polrule gt right_trapped lt polrule gt lt mnmchemgroup gt lt monomer gt lt monomer gt lt code gt R lt code gt lt mnmchemgroup gt 160 CHAPTER 11 lt name gt N term NH2 lt name gt lt pka gt 9 6 lt pka gt lt acidcharged gt TRUE lt acidcharged gt lt polrule gt left_tr
216. t forth each polymer characteristics in such a manner as to introduce the way massXpert thinks polymers and to introduce specialized terminologies Once the basic chemistries of the different polymers have all been described we will enter a more complex subject that is of enor mous importance to the mass spectrometry specialist polymer chain disrupting chemistry We shall see that this terminology actually involves two kinds of chemistries cleavage on the one hand and fragmentation on the other hand While massXpert is basically oriented to linear single stranded polymer chemistries it can also be used to simulate highly complex polymer chemistries Biological polymers are the main focus of this manual however all the con cepts described here may be applied with no modification to synthetic polymer chemistries VARIOUS BIOPOLYMER STRUCTURES Biopolymers are amongst the most sophisticated and complex polymers on earth and it certainly is not a mistake to take them as examples of how monomers be these complex or not can assemble covalently into life enabling polymers In this section we will visit three different polymers encountered in the living world proteins nucleic acids and polysaccharides We shall be concerned with 1 the monomers structure 2 the polymerization reaction and 3 the final end capping reaction responsible for putting the polymer in its finished state 17 we ec a SPEHN CH GOOH R5 H5
217. t isotope gt lt mass gt 61 lt abund gt 3 lt isotope gt lt isotope gt lt mass gt 63 lt abund gt 0 lt isotope gt 9310586000 lt mass gt 1399000000 lt abund gt 9283464000 lt mass gt 6345000000 abund 9279680000 lt mass gt 9256000000 lt abund gt 133 lt atom gt lt atom gt lt name gt Copper lt name gt lt symbol gt Cu lt symbol gt lt isotope gt lt mass gt 62 9295992000 lt mass gt lt abund gt 69 1700000000 lt abund gt lt isotope gt lt isotope gt lt mass gt 64 9277924000 lt mass gt lt abund gt 30 8300000000 lt abund gt lt isotope gt lt atom gt lt atom gt lt name gt Zinc lt name gt lt symbol gt Zn lt symbol gt lt isotope gt lt mass gt 63 9291454000 lt mass gt lt abund gt 48 6300000000 lt abund gt lt isotope gt lt isotope gt lt mass gt 65 9260352000 lt mass gt lt abund gt 27 9000000000 lt abund gt lt isotope gt lt isotope gt lt mass gt 66 9271289000 lt mass gt lt abund gt 4 1000000000 lt abund gt lt isotope gt lt isotope gt lt mass gt 67 9248458000 lt mass gt lt abund gt 18 7500000000 lt abund gt lt isotope gt lt isotope gt lt mass gt 69 9253249000 lt mass gt lt abund gt 0 6200000000 lt abund gt lt isotope gt lt atom gt lt atom gt lt name gt Gallium lt name gt lt symbol gt Ga lt symbol gt lt isotope gt lt mass gt 68 9255809000 lt mass gt lt abund gt 60 1080000000 lt ab
218. t isotope gt lt mass gt 91 9050392000 lt mass gt lt abund gt 17 1500000000 lt abund gt lt isotope gt lt isotope gt lt mass gt 93 9063191000 lt mass gt lt abund gt 17 3800000000 lt abund gt lt isotope gt lt isotope gt lt mass gt 95 9082720000 lt mass gt lt abund gt 2 8000000000 lt abund gt lt isotope gt lt atom gt lt atom gt lt name gt Niobium lt name gt lt symbol gt Nb lt symbol gt lt isotope gt lt mass gt 92 9063780000 lt mass gt lt abund gt 100 0000000000 lt abund gt lt isotope gt lt atom gt lt atom gt lt name gt Molybdenum lt name gt lt symbol gt Mo lt symbol gt lt isotope gt lt mass gt 91 9068090000 lt mass gt lt abund gt 14 8400000000 lt abund gt lt isotope gt lt isotope gt lt mass gt 93 9050862000 lt mass gt lt abund gt 9 2500000000 lt abund gt lt isotope gt lt isotope gt lt mass gt 94 9058379000 lt mass gt lt abund gt 15 9200000000 lt abund gt lt isotope gt lt isotope gt lt mass gt 95 9046755000 lt mass gt lt abund gt 16 6800000000 lt abund gt lt isotope gt lt isotope gt lt mass gt 96 9060179000 lt mass gt lt abund gt 9 5500000000 lt abund gt lt isotope gt lt isotope gt lt mass gt 97 9054050000 lt mass gt lt abund gt 24 1300000000 lt abund gt lt isotope gt lt isotope gt lt mass gt 99 9074730000 lt mass gt 138 CHAPTER 11 lt abund gt 9 6300000000 lt abund gt lt isotope gt
219. t would be suitable to put the flexibility of massXpert at work by specifying that the generated oligomers should undergo the CH2S O formula only if they have M as their right end monomer so that C terminated oligomers are not chemically modified Thus the cleavage pattern might be safely defined M C THE FRAGMENTATION SPECIFICATIONS As previously discussed chapter 3 section 3 on page 25 specifying the frag mentation specifications of a polymer chemistry definition is not a trivial task 4Cleavage occurs at every possible position right of each monomer M 5This is a purely hypothetical situation that I never observed personally 53 massXpert Fragmentation Definitions Identity Fragmentation specifications Fragmentation rules Details Formula Side chain 0 End Comment FragRule Name Formula mE Local logic Prev code Curr code Next code Comment Appl Add Remove Add Remove Move up Move down Move up Move down FRR Validate Figure 6 9 XpertDef fragmentation rules definition Each fragmentation rule is defined using a name a formula and a local logic that is a set of logial conditions which must be verified for the fragmentation rule to be applied to the fragment In this section thre
220. tCalc module is easily called by pulling down the XpertCalc menu item from the massXpert program s menu The user is presented with a window to select the polymer chemistry definition that should be used for the calculations Figure 7 1 59 60 CHAPTER 7 XPERTCALC Select a Polymer Chemistry Definition or Click Cancel to Browse Polymer Chemistry Definition usrilocal share massxpert 1 5 0 pol chem defs protein 1 letter protein 1 letter xml Jusr locallshare massxpert 1 5 O pol chem defs protein 1 letter protein 1 letter xml usr local share massxpert 1 5 0 pol chem defs protein 3 letters protein 3 letters xml Jusr local share massxpert 1 5 0 pol chem defs dna dna xml Jusrilocalshare massxpert 1 5 0 pol chem defs saccharide saccharide xml Figure 7 1 Selecting a polymer chemistry definition for use with Xpert Calc This figure shows that the user can either select one already registered polymer chemistry definition listed in the drop down widget or browse the filesystem to select one polymer chemistry definition file Choosing a polymer chemistry definition allows to take advantage of all the chemical entities defined therein during the mass calculations AN EASY OPERATION Once the polymer chemistry definition has been correctly selected it is parsed by the XpertCalc module and its entities are automatically made available in the calculator window as shown in Figure 7 2 The way XpertCalc is operated i
221. ta as detailed below Data from the various simulations available in massXpert These simula tions are cleavages fragmentations and mass searches which all produce oligomers that are displayed in tree view widgets as shown in Figure 8 16 on page 89 or Figure 8 19 on page 94 or Figure 8 20 on page 95 Dragging data from these tree view widgets is performed simply by selecting the items of interest in the tree view widget and dragging them to the input m z list to be filled Figure 9 3 on the following page shows the data in the input m z list right after a data drop Data in the form of textual lines like will be the case when importing a m z or a m z pair list from the mass spectrometer s program There are two cases If the data dropped are in the form of a list of m z data without the z value one m z ratio value per line then the z value will be considered to be the charge that would result from the ionization of the analyte using the ionization rule detailed in the Default ionization group box widget see above This case is represented in Figure 9 4 on page 111 110 CHAPTER 9 XPERTMINER massXpert mz Lab List 1 centrin2 human PX List 1 centrin2 human mz 120 06607 60 53695 830 01436 553 67885 120 06607 60 53695 40 69391 651 33537 326 17160 217 78367 3 555 67270 1 778 34026 1 185 89612 5 138 72351 2 569 86567 1 713 57972 Mass type Mono Figure 9 3 mzLab
222. ta and the powerful console based tools would prove useless GENERAL CHEMICAL ENTITY NAM ING POLICY Unless otherwise specified the user is strongly advised not to insert any non alphanumeric non ASCII characters space in the strings that identify polymer chemistry definition entities This means that for example users must refrain from using non alphanumeric non ASCII characters for the atom names and symbols the names the codes or the formula of the monomers or of the modifications or of the cleavage specifications or of the fragmentation specifications Usually the accepted delimiting characters are and _ It is important not to cripple these polymer data for two main reasons So that the program performs smoothly some file parsing processes rely on specific characters like or for example to isolate sub strings from larger strings So that the results can be easily and clearly displayed when time comes to print all the data 42 CHAPTER 5 MASSXPERT GENERALITIES X pertDet Definition Of Polymer Chemistries After having completed this chapter the reader will be able to accomplish the very first steps needed to use massXpert s features at best the normal workflow indeed is to first make a polymer chemistry definition in order to be able to edit polymer sequences of that specific definition The XpertDef module is made available in massXpert by pulling down the X
223. tent infringement To grant such a patent license to a party means to make such an agreement or commitment not to enforce a patent against the party If you convey a covered work knowingly relying on a patent license and the Corresponding Source of the work is not available for anyone to copy free of charge and under the terms of this License through a publicly avail able network server or other readily accessible means then you must either 1 cause the Corresponding Source to be so available or 2 arrange to deprive yourself of the benefit of the patent license for this particular work or 3 arrange in a manner consistent with the requirements of this Li cense to extend the patent license to downstream recipients Knowingly relying means you have actual knowledge that but for the patent license your conveying the covered work in a country or your recipient s use of the covered work in a country would infringe one or more identifiable patents in that country that you have reason to believe are valid If pursuant to or in connection with a single transaction or arrangement you convey or propagate by procuring conveyance of a covered work and grant a patent license to some of the parties receiving the covered work authorizing them to use propagate modify or convey a specific copy of the covered work then the patent license you grant is automatically extended to all recipients of the covered work and works based on
224. ter of the analyti cal arsenal in the field of structural biology also of general polymer science It is now current procedure to use mass spectrometry to measure the mass of polypeptides oligonucleotides even complete transfer RNAs and saccharides amongst other complex biomolecules A mass spectrometer is usually described by giving to its three main different regions a name suggestive of their function the source where production of ionized analytes takes place the analyzer where the ions are electrically magnetically tortured the detector where the ions arrive are detected and counted 33 34 CHAPTER 4 BASICS IN MASS SPECTROMETRY ION PRODUCTION THE SOURCE Mass spectrometry can do nothing if the molecule to analyze the analyte is not in an electrically charged state The process of creating an ion from an un charged analyte is called ionization Most of the times the ionization is favored by adapting the sample s pH to a value lower than the isoelectric pH of the analyte which will elicit the appearance of charge s onto it In cases where the analyte cannot be charged by simple pH variations small molecule that does not bear any ionizable chemical group the ionization step might require on the massist s part use of starker ionization techniques like electronic impact ionization or chemical ionization In biopolymer mass spectrometry the pH strategy is usually considered the right w
225. the fragment is the LE left end The advantage of working this way is that we need not specify a fragmenta tion rule for each different monomer in the sequence see below for how this might be done Indeed by specifying Side chain to be 1 we indicate without knowing the monomer identity to the mass calculation engine that once the fragmentation has occurred in the polymer chain the mass of the monomer that got fragmented should be subtracted from the fragment mass That sub traction removes however too much material as we do not want to loose the skeleton we only want to loose the base adenine in our example This is why we ask in the fragmentation specification formula that the skeleton be added the C5H805P component of the formula Because the skeleton does not change along the polymer chain even if the base itself changes this com putation method is generalizable and because of this the polymer chemistry definition works This whole process of defining a fragmentation pattern that needs to know what monomer is being fragmented so as to compute the fragment masses cor rectly can be performed by using fragmentation rules This is described below 55 Fragmentation specifications Fragmentation rules Details identity Name Formula 0 CSHEOSP Side chain 4 End LE Comment abasic a fragment BASE FragPule Name Formula Local logic Prev code curr code
226. the monomer modification task was started then selecting Current selection would be required to modify all the monomers in the selection Alternatively if this is not what is required re selecting the right monomer in the sequence and selecting Current selection will ensure the modification applies only on the currently selected monomer 84 CHAPTER 8 XPERTEDIT d massXpert Monomer modification x Creation of modifications View remove modifications Available modifications Target Modified monomers Modifications Dehydroxylati Available monomers SSN orana Phosphorylation S 5 OnAnyMonomer G Glycine a OnNoMonomer 59 62 147 149 A Alanine Phosphorylation V Valine Sulphation Update L Leucine I Isoleucine Define modification Monomers of same code S Serine d Name Monomers from the list TeThreonine C Cysteine Eormula All monomers M Methionine Override target limitations co N lt 229 lt gt Targets oa ysne _ e v All modifications Modify Unmodify Messages Figure 8 11 Modification of a monomer in a polymer sequence This figure shows how the chemical modification of monomer s can be performed Note that there is one checkbox widget Override target limitations that requires explanation In the chapter about the definition of polymer chemistries chap ter 6 on page 43 the definition of modifications was detailed and the target notion was explicited If during a monomer modification massXpert detects that the us
227. the polymer chemistry definition is sophisticated the more sophisticated the computations are allowed 105 IONIZED GROUP S IN MODIFICATIONS In the excerpt from the pka ph pi xml file below we see that chemical mod ifications can also bring charges The example of the chemical modification Phosphorylation shows that when a monomer is phosphorylated two chemi cal groups are brought in the first has a pKa value of 1 2 that is it will always be deprotonated at physiological pH values the second has a pKa value of 7 that is it will be divided by half in a protonated not charged form and in an un protonated negatively charged form leading to a net electrical charge of 0 5 modif lt name gt Phosphorylation lt name gt lt mdf chemgroup gt lt name gt none_set lt name gt lt pka gt 1 2 lt pka gt lt acidcharged gt FALSE lt acidcharged gt lt mdfchemgroup gt lt mdfchemgroup gt lt name gt none_set lt name gt lt pka gt 6 5 lt pka gt lt acidcharged gt FALSE lt acidcharged gt lt mdfchemgroup gt lt modif gt At this point we should be able to study the way computations are actually performed in the XpertEdit module PH PI AND CHARGE CALCULATIONS The user willing to compute charges positive negative net or the isoelectric point for the current polymer sequence uses the menu Chemistry pKa pH which triggers the appearance of the window shown in Figure 8 25 on the next page T
228. the polymer structure is disrupted into separated pieces the fragments mainly because of energy dependent electron doublet rearrangements leading to bond breakage POLYMER CLEAVAGE We said above that upon cleavage of a polymer the cleaving molecule reacts with it and by doing so directly or indirectly dissolves an inter monomer bond A polymer cleavage always occurs in such a way as to generate a set of true polymers smaller in size than the parent polymer evidently which is why they are called oligomers Indeed let us take the example shown in Figure 3 7 where a tripeptide a very little protein containing methionyl residue at position 2 is submitted either to a water mediated cleavage hydrolysis upper panel or to a cyanogen bromide mediated cleavage lower panel The two cases presented in this figure are similar in some respects and different in others In the first case the molecule that is responsible for the cleavage is water while in the second case it is cyanogen bromide In both cases the bond that is cleaved is the inter monomer bond in protein chemistry this is a peptidic bond In both cases the Oligomer 2 has the same structure The structures of the Oligomer 1 species differ when produced using water or cyanogen bromide as the cleaving molecule The difference between hydrolysis and cyanogen bromide cleavage is in the gen eration of the Oligomer 1 species the cyanogen bromide cleavage has
229. ther you nor any third party retains the ability to install modified object code on the User Product for example the work has been installed in ROM The requirement to provide Installation Information does not include a requirement to continue to provide support service warranty or updates for a work that has been modified or installed by the recipient or for the User Product in which it has been modified or installed Access to a net work may be denied when the modification itself materially and adversely affects the operation of the network or violates the rules and protocols for communication across the network Corresponding Source conveyed and Installation Information provided in accord with this section must be in a format that is publicly documented and with an implementation available to the public in source code form and must require no special password or key for unpacking reading or copying Additional Terms Additional permissions are terms that supplement the terms of this Li cense by making exceptions from one or more of its conditions Additional permissions that are applicable to the entire Program shall be treated as 170 CHAPTER 11 APPENDICES though they were included in this License to the extent that they are valid under applicable law If additional permissions apply only to part of the Program that part may be used separately under those permissions but the entire Program remains governed by
230. this License without regard to the additional permissions When you convey a copy of a covered work you may at your option remove any additional permissions from that copy or from any part of it Additional permissions may be written to require their own removal in certain cases when you modify the work You may place additional permissions on material added by you to a covered work for which you have or can give appropriate copyright permission Notwithstanding any other provision of this License for material you add to a covered work you may if authorized by the copyright holders of that material supplement the terms of this License with terms a Disclaiming warranty or limiting liability differently from the terms of sections 15 and 16 of this License or b Requiring preservation of specified reasonable legal notices or author attributions in that material or in the Appropriate Legal Notices displayed by works containing it or c Prohibiting misrepresentation of the origin of that material or requir ing that modified versions of such material be marked in reasonable ways as different from the original version or d Limiting the use for publicity purposes of names of licensors or au thors of the material or Declining to grant rights under trademark law for use of some trade names trademarks or service marks or f Requiring indemnification of licensors and authors of that material by anyone who conveys the
231. three different pieces of information the matter transfer optional usually a formula like H1 the charge transfer net charge that is brought by the ionization agent the ionization level the number of ionization event 0 means no ioniza tion usually this would be 1 for a single ionization but might be as large as 30 if for example a protein was ionized by electrospray In this case the m z value would be computed this way with z 30 m M 30 1 00782 16959 30 2346 566 30 30 30 value In the next chapters of this manual massXpert will be described so as to let the user take advantage of its powerful capabilities In a first chapter some general concepts around the way the program behaves will be presented Next in the remaining part of this manual a chapter will be dedicated to each important massXpert function or characteristic 38 CHAPTER 4 BASICS IN MASS SPECTROMETRY mass X pert Generalities In this chapter I wish to introduce some general concepts around the massXpert program GENERAL massXpert CONCEPTS The massXpert mass spectrometry software suite has been designed to be able to work with every linear polymer Well in a certain way this is true A more faithful account of the massXpert s capabilities would be The massXpert software suite works with whatever polymer chemistry the user cares to define the more accurate the polymer chemistry definition the more
232. tions 69 70 CHAPTER 8 XPERTEDIT Select a sample sequence file or click Cancel to browse Sample sequence file C Program Files massxpert data pol seqs centrin 2 human mxp Files massxpert data pol segs centrin 2 human mxp Program Files massxpert data pol seqs cyan fluorescent protein C Program Filsmassxpert datajpol segsfkunitz nhibitor humanmeL_K__ Figure 8 1 Selection of a sample polymer sequence massXpert ships with a number of sample polymer sequences which are designed to allow easy demonstration of the XpertEdit features This selection dialog lists all the polymer sequence files that were shipped along with massXpert XpertEdit INVOCATION The XpertEdit module is easily called by pulling down the XpertEdit menu item from the massXpert program s menu The user may start the XpertEdit module by Opening a sample polymer sequence Creating a new polymer sequence Loading a polymer sequence from disk XpertEdit OPERATION In Medias Res The first manner to start an XpertEdit session is by opening a sample sequence out of the list of sequences that were shipped along with massXpert The XpertEdit Open Sample Sequence menu item opens the dialog box shown in Figure 8 1 The drop down widget in this dialog window lists all the polymer sequence files that were shipped along with massXpert Simply select one item and click OK To select another polymer sequence file clic
233. tope gt lt mass gt 123 9028250000 lt mass gt lt abund gt 4 7400000000 lt abund gt lt isotope gt lt isotope gt lt mass gt 124 9044350000 lt mass gt lt abund gt 7 0700000000 lt abund gt lt isotope gt lt isotope gt lt mass gt 125 9033100000 lt mass gt lt abund gt 18 8400000000 lt abund gt lt isotope gt lt isotope gt lt mass gt 127 9044640000 lt mass gt lt abund gt 31 7400000000 lt abund gt lt isotope gt lt isotope gt lt mass gt 129 9062290000 lt mass gt lt abund gt 34 0800000000 lt abund gt lt isotope gt lt atom gt lt atom gt lt name gt Iodine lt name gt lt symbol gt I lt symbol gt lt isotope gt lt mass gt 126 9044770000 lt mass gt lt abund gt 100 0000000000 lt abund gt lt isotope gt lt atom gt lt atom gt lt name gt Xenon lt name gt lt symbol gt Xe lt symbol gt lt isotope gt lt mass gt 123 9061200000 lt mass gt lt abund gt 0 0900000000 lt abund gt lt isotope gt lt isotope gt lt mass gt 125 9042810000 lt mass gt lt abund gt 0 0900000000 lt abund gt lt isotope gt APPENDICES 143 lt isotope gt lt mass gt 127 9035310000 lt mass gt lt abund gt 1 9200000000 lt abund gt lt isotope gt lt isotope gt lt mass gt 128 9047800000 lt mass gt lt abund gt 26 4400000000 lt abund gt lt isotope gt lt isotope gt lt mass gt 129 9035100000 lt mass gt lt abund gt 4 0800000000 lt abund gt lt isotope gt
234. tope gt lt mass gt 203 9734810000 lt mass gt lt abund gt 6 8700000000 lt abund gt lt isotope gt lt atom gt lt atom gt lt name gt Lead lt name gt lt symbol gt Pb lt symbol gt lt isotope gt lt mass gt 203 9730370000 lt mass gt lt abund gt 1 4000000000 lt abund gt lt isotope gt lt isotope gt lt mass gt 205 9744550000 lt mass gt lt abund gt 24 1000000000 lt abund gt lt isotope gt lt isotope gt lt mass gt 206 9758850000 lt mass gt lt abund gt 22 1000000000 lt abund gt lt isotope gt lt isotope gt lt mass gt 207 9766410000 lt mass gt lt abund gt 52 4000000000 lt abund gt lt isotope gt lt atom gt lt atomdefdata gt lt polchemdefdata gt lt name gt protein 1 letter lt name gt lt leftcap gt H lt leftcap gt lt rightcap gt 0H lt rightcap gt lt codelen gt 1 lt codelen gt lt ionizerule gt lt formula gt H lt formula gt lt charge gt 1 lt charge gt 145 146 CHAPTER 11 lt level gt 1 lt level gt lt ionizerule gt lt monomers gt lt mnm gt lt name gt Glycine lt name gt lt code gt G lt code gt lt formula gt C2H3NO0 lt formula gt lt mnm gt lt mnm gt lt name gt Alanine lt name gt lt code gt A lt code gt lt formula gt C3H5NO lt formula gt lt mnm gt lt mnm gt lt name gt Valine lt name gt lt code gt V lt code gt lt formula gt C5H9NO lt formula gt lt mnm gt lt mnm gt lt name gt Leucine lt nam
235. try definition directory Each monomer of the polymer chemistry definition ought to have a corresponding svg file with which it has to be rendered graphically should that monomer be inserted in the polymer sequence This example shows two svg files corresponding to two monomers each belonging to a different polymer chemistry definition 119 Ahalanine svg Chcysteine svg DAaspartate svg E glutamate svg F phenylalanine svg Giglycine svg H histidine svg I isoleucine svg Khlysine svg L leucine svg M methionine svg Nhasparagine svg P proline svg Q glutamine svg Rharginine svg S serine svg Ththreonine svg V valine svg W tryptophan svg Yhtyrosine svg What one sees from the contents of the file is that each monomer code has an associated svg file For example when the user has to key in a valine monomer she keys in the code and XpertEdit knows that the monomer vignette to show has to be rendered using the valine svg file For the monomer modification graphical rendering the situation is somewhat different as seen in the modification_dictionary file This file is part of the massXpert project The massXpert project is released in its entirety under the GNU General Public License and was started in the form of the GNU polyxmass project at the Centre National de la Recherche Scientifique FRANCE that granted me the formal authorization to publish it under this Free Software License 3k Copyright 2006
236. uence modification is visible in the sequence editor Instead an A character is now displayed in the left line edit widget under the sequence The reason of this apparently odd behaviour is that the polymer chemistry definition allows up to 3 characters to describe a monomer code If no monomer vignette is displayed in the polymer sequence that means that more than one monomer code start with an A character XpertEdit cannot figure out which monomer code was actually meant by the 77 user when keying in There is a way called code completion to know which monomer code s in the current polymer chemistry definition do start with the keyed in charac ter s currently A The user can always enter the code completion mode by hitting the key This is what is shown in the panel 1st right hand side Monomer List listview widget click on that Monomer List label to show that list if it is not already visible We see that in the current polymer chemistry definition four monomer codes start with an A character and these are Ala Arg Asp and Asn as highlighted in the code completion monomer list Because we now know that the code we are to key in is Asp we key in a 8 The result is shown in panel 2nd What we see here is that this time also nothing changed in the polymer sequence What changed is that the character string in the left line edit widget below the sequence is now As
237. ues Threonyl or Seryl Tryptophanyl or Tyrosinyl or Phenylalanyl Glycyl as shown in Figure 8 15 When cross linking with the fluorescent protein cross linker there must be three monomers involved as these are three modifications defined in the cross linker When any monomer involved in a cross linker is edited off a polymer se quence the cross link s it was involved in are automatically dissolved and de stroyed Destruction of a cross link might be performed by selecting the cross 88 CHAPTER 8 XPERTEDIT Figure 8 15 Graphical rendering of cross linked monomers This figure shows the three monomers TWG from cyan fluorescent protein cross linked together link in the Cross links list widget at the right hand side of the dialog window depicted in Figure 8 14 and by clicking the Uncross link button SEQUENCE CLEAVAGE It happens very often that polymer sequences get cleaved in a sequence specific manner These specific cleavages do occur very often in nature and are made by enzymes that do cleave biopolymer sequences like the glycosidases cleaving saccharides the proteases cleaving proteins or the nucleases cleaving nucleic acids But the scientist also uses purified enzymes or chemicals to perform such cleavages in the test tube massXpert must be able to perform those cleavages in silico It is a matter of having a polymer sequence opened in an editor window and selecting the Chemistry Cleave menu The user is prov
238. um up all what we have seen so far with polymer chain disrupting chemistries A polymer sequence gets cleaved into oligomers when a chemical reaction occurs in it at the level of one or more inter monomer bond s monomer specific chemical reactions can be modelled into the cleavage specification using at most one leftrighrule A polymer sequence gets fragmented into fragments when a bond break age occurs without the help of any exterior molecule at any level of the polymer structure with no limitation to the inter monomer bond monomer specific chemical reactions can be modelled into the fragmenta tion specification using any number of fragrules Oligomers are automatically capped on both ends using the rules de scribed in the precursor polymer s definition Fragments are capped automatically only on the end they hold if any using the rules described in the precursor polymer s definition Oligomers are automatically ionized if required by the user using the rules described in the precursor polymer s definition Fragments are never ionized automatically ionization gain loss of a charged group is necessarily integrated in the fragmentation specification Basics in Mass Spectrometry Mass spectrometry has become a buzz word in the field of structural biol ogy While it has been used for long to measure the molecular mass of little molecules its recent developments have brought it to the cen
239. umvention of such measures When you convey a covered work you waive any legal power to forbid cir cumvention of technological measures to the extent such circumvention is effected by exercising rights under this License with respect to the covered work and you disclaim any intention to limit operation or modification of the work as a means of enforcing against the work s users your or third parties legal rights to forbid circumvention of technological measures Conveying Verbatim Copies You may convey verbatim copies of the Program s source code as you receive it in any medium provided that you conspicuously and appropri ately publish on each copy an appropriate copyright notice keep intact all notices stating that this License and any non permissive terms added in accord with section 7 apply to the code keep intact all notices of the absence of any warranty and give all recipients a copy of this License along with the Program You may charge any price or no price for each copy that you convey and you may offer support or warranty protection for a fee Conveying Modified Source Versions You may convey a work based on the Program or the modifications to produce it from the Program in the form of source code under the terms of section 4 provided that you also meet all of these conditions a The work must carry prominent notices stating that you modified it and giving a relevant date b The work must carry
240. und gt lt isotope gt lt isotope gt lt mass gt 70 9247006000 lt mass gt lt abund gt 39 8920000000 lt abund gt lt isotope gt lt atom gt lt atom gt 134 CHAPTER 11 APPENDICES lt name gt Germanium lt name gt lt symbol gt Ge lt symbol gt lt isotope gt lt mass gt 69 9242498000 lt mass gt lt abund gt 20 8400000000 lt abund gt lt isotope gt lt isotope gt lt mass gt 71 9220800000 lt mass gt lt abund gt 27 5400000000 lt abund gt lt isotope gt lt isotope gt lt mass gt 72 9234639000 lt mass gt lt abund gt 7 7300000000 lt abund gt lt isotope gt lt isotope gt lt mass gt 73 9211788000 lt mass gt lt abund gt 36 2800000000 lt abund gt lt isotope gt lt isotope gt lt mass gt 75 9214027000 lt mass gt lt abund gt 7 6100000000 lt abund gt lt isotope gt lt atom gt lt atom gt lt name gt Arsenic lt name gt lt symbol gt As lt symbol gt lt isotope gt lt mass gt 74 9215955000 lt mass gt lt abund gt 100 0000000000 lt abund gt lt isotope gt lt atom gt lt atom gt lt name gt Selenium lt name gt lt symbol gt Se lt symbol gt lt isotope gt lt mass gt 73 9224771000 lt mass gt lt abund gt 0 8900000000 lt abund gt lt isotope gt lt isotope gt lt mass gt 75 9192066000 lt mass gt lt abund gt 9 3700000000 lt abund gt lt isotope gt lt isotope gt lt mass gt 76 9199077000 lt mass gt lt abund gt 7 6300000000 lt abund g
241. undances 10 pKa pH pl 2 Oligomers obtained via mass searches polymer cleavages oligomer frag mentations 5 Polymers 3 Note that modifying these values will allow immediate change of the way nu merals are displayed without needing to restart the program Only triggering a new cleavage or a new fragmentation will update the data display according to the new options set These options are stored on the disk and are permanent XpertMainer A Data Miner XpertMiner is a module that has been conceived as a repository of functionalities aimed at analyzing mass data data which might originate in the massXpert based simulations and or in the mass spectrometer massXpert as of version 1 7 9 only contains one miner functionality mzLab XpertMiner INVOCATION The XpertMiner module is easily called by pulling down the XpertMiner menu item from the massXpert program s menu Clicking on XpertMiner mzLab will the mzLab window as represented in Figure 9 1 on the following page mzLab MINING M Z RATIOS The kinds of data on which the features available in this laboratory will operate is lists of m z values in the form of a m z z pair The mass of the ion is represented by m while z is the charge of the ion With the two data in the pair the m z ratio and the z charge and knowing the ionization rule that ionized the analyte in the first place it is possible to perform any mass calculation on the m z
242. user is invited to select a filename File Save As Save the sequence in a new file File Import Raw Opens a text file and tries to import the se quence If invalid monomer code characters are found the user is given a chance to revise the imported sequence File Export to Clipboard Copies the sequence and all the data masses and calculation options to the clipboard in the form of simple text File Export to File Writes to file the sequence and all the data masses and calculation options to the clipboard in the form of simple text if a filename was already selected otherwise the user is invited to select a file into which the data are to be written File Select export file Invites the user to select a file into which the data are to be written Edit Copy Copies the current selected region s if any to the clipboard If there are more than one region currently selection then the user is informed that the copied sequence will correspond to these two sequences joined together Be aware that the order in which the region sequences are joined is the order in which the regions were selected and not the order in which the sequences appears in the whole polymer sequence 74 CHAPTER 8 XPERTEDIT Edit Cut Copies the current selection if any to the clipboard and removes it from the sequence Note that it is not yet possible to cut more than one selected region in one single operation Edit Paste Pa
243. version 3 as published by the Free Software Foundation This software is distributed in the hope that it will be useful but WITHOUT ANY WARRANTY without even the implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE See the GNU General Public License for more details You should have received a copy of the GNU General Public License along with this program If not see http www gnu org licenses A copy of the license is included in the appendix entitled GNU General Public License Text For more details see the file COPYING in the massXpert distribution files Revision History august 2011 the 29th Update the manual to describe a number of new features april 2010 the 29th Updated the section about the definition of monomers to document the new feature about computing the mass difference between any two monomers in the definition april 2010 the 27th Updated the section about the cleavages of polymer sequences XpertEdit chapter to document the new feature that allows to only perform a cleavage in the currently selected region of a polymer sequence june 2009 the 19th Updated the section about the chemical pad Xpert Calc chapter to reflect improvements in the use of the chemical pad but tons either immediate evaluation of the formula or mere insertion of the formula in the formula line edit widget june 2009 the 17th Updated the section about the chemical pad Xpert Calc chapter to r
244. with no transfer of a copy is not conveying An interactive user interface displays Appropriate Legal Notices to the extent that it includes a convenient and prominently visible feature that 1 displays an appropriate copyright notice and 2 tells the user that there is no warranty for the work except to the extent that warranties are provided that licensees may convey the work under this License and how to view a copy of this License If the interface presents a list of user commands or options such as a menu a prominent item in the list meets this criterion 1 Source Code The source code for a work means the preferred form of the work for making modifications to it Object code means any non source form of a work 166 CHAPTER 11 APPENDICES A Standard Interface means an interface that either is an official stan dard defined by a recognized standards body or in the case of interfaces specified for a particular programming language one that is widely used among developers working in that language The System Libraries of an executable work include anything other than the work as a whole that a is included in the normal form of packaging a Major Component but which is not part of that Major Component and b serves only to enable use of the work with that Major Component or to implement a Standard Interface for which an implementation is available to the public in source code form A
245. works By contrast the GNU General Public License is intended to guarantee your freedom to share and change all versions of a program to make sure it remains free software for all its users We the Free Software Foundation use the GNU General Public License for most of our software it applies also to any other work released this way by its authors You can apply it to your programs too When we speak of free software we are referring to freedom not price Our General Public Licenses are designed to make sure that you have the freedom to distribute copies of free software and charge for them if you wish that you receive source code or can get it if you want it that you can change the software or use pieces of it in new free programs and that you know you can do these things To protect your rights we need to prevent others from denying you these rights or asking you to surrender the rights T herefore you have certain respon sibilities if you distribute copies of the software or if you modify it responsi bilities to respect the freedom of others For example if you distribute copies of such a program whether gratis or for a fee you must pass on to the recipients the same freedoms that you received You must make sure that they too receive or can get the source code And you must show them these terms so they know their rights Developers that use the GNU GPL protect your rights with two steps 1 assert copyright on the software
246. would make no sense to phosphorylate a glycyl residue in a protein for example Click onto the Modifications button which triggers the opening of the dialog window shown in Figure 6 6 In the example shown the Phosphorylation modi fication is being defined A modification is defined by a Name a list of monomer codes that might be modified by this modification Targets a Max count de scribing the maximum number of times that modification can be applied to the target monomers and finally a Formula The formula is actually a chemical reaction as explained in section 5 chapter 5 page 39 The Phosphorylation reaction can thus be read like this The polymer looses a proton and gains 2A Targets datum is made of monomer codes separated by separators 3This feature is essential when working on methylation of proteins for example with arginyl and lysyl residues being multi methylated 49 massXpert Modification definitions Modifications Details Dehydroxylation Identity OnAnyMonomer 1 OnNoMonomer Name Phosphorylation Sulphation Targets 51 Oxidation Acetylation Methylation LysMethylation 2 Amidationclu aidan Le SulfideBond Carbamylation Dehydroalanine Validate Carbamidomethylation CarboxyMethylation count 1 BS Formula 2 ProtonLoss Chromo O Chromo H Move Move down Figure 6 6 XpertDef modifications definition Each modification
247. xample a protonation reaction brings a single positive charge Level 1 Number of times that the ionization must be performed by default on any polymer sequence of this chemistry definition In this example monoprotonation is set as the default ionization rule At this point time has come to deal with plural data The first chemical entities to deal with are monomers 47 amp massXpert Monomer definitions Monomers Details Glycine Identity Alanine Valine Name Serine Leucine Isoleucine Code 5 Threonine Formula C3HSNO2 Cysteine Methionine Apply Arginine m lysine Aspartate Masses Glutamate Asparagine Glutamine Tryptophan Phenylalanine Code length 1 Tyrosine Histidine Validate Proline 87 0320284000 87 0774643949 lt gt Calculate mass differences Add Remove Threshold 1 Mono mass Move up Move down Calculate _ Avg mass Figure 6 4 XpertDef monomers definition Each monomer is defined using a name a code and a chemical formula THE MONOMERS The monomers are the constitutive blocks of the polymer sequence In the massXpert s jargon monomer stands not for the molecule that may be used to perform a polymer synthesis it stands for this molecule less the chemical group s that were eliminated upon polymerization If this concept is not famil iar to the reader it might be useful to read chapter 3 on page 15 for an overview of polymer chemist
248. xose C6H1106 residue Hexose 1bRE lawngreen black chempadkey Res 1bRE Hexalditol C6H1206 residue Hexalditol 1bRE ol lawngreen black What this text file says is very simple That the buttons should be arranged in rows of three columns That colors might be defined using the RGB paradigm 3 numerical values in the range 0 255 to represent the intensity of the three red green and blue primary colors The colors might be later used to colorize some widgets 63 That buttons following the line chempadgroup Generic and until another such line will be grouped into a groupbox widget entitled Generic Note that a coloring specification might be optionally appended like the fol lowing chempadgroup Hexoses amp amp Fucose4 midnightblue in which case the background of the section groupbox will be colored That buttons are simply defined according to the following delimited line syntax chempadkey Res 1bRE Hexose C6H1106 residue Hexose 1bRE lawngreen black The first part is the simple delimitor chempadkey The second part Res 1bRE Hexose is the text string that will label the button in the chemical pad The third part C6H1106 is the formula that will be applied in the calculator whenever that button is clicked The fourth part residue Hexose 1bRE is the text string that will be displayed in a tooltip when ever the cursor remains over the button Finally the color specification lawngreen black

massXpert User Manual

Contents

Download Pdf Manuals

Related Search

Related Contents