Recommended DNA Isolation Kits
Contents
1. EEREZIXERE Figure2 Fragmented DNA Page3 Toto Lh Figure 4 SMRTbell Adapters o5 pATCTCTCTCTTTTCCTCCTCCTCCGTTGTTGTTGTTGAGAGAGAT 3 Figure5 Blunt Adapter 5 AAAAAAAAAAAAAAAAAATTAACGGAGGAGGAGGA 3 Figure 6 C2 Primer underlined sequence hybridizes to the hairpin loop and red portion contains 2 methoxy modifications to increase stability After the exonuclease and AMPure PB purification steps sequencing primer is annealed to the SMRTbell templates followed by binding of the sequence polymerase to the annealed templates Finally the sam ple is sequenced on the PacBio System Page4 DNA Quality Assaying the Quality of your Sample Pacific Biosciences template preparation process does not use ampli fication techniques As a result input DNA quality will be directly reflected in sequencing results Any DNA damage e g abasic sites nicks interstrand crosslinks or contaminants e g single stranded DNA RNA proteins dyes or salts present in the input material will impair performance of the system Therefore ensure that your DNA sample s double stranded Single stranded DNA will not be made into a SMRTbell template in this template preparation process and can interfere with quantitation and polymerase binding Has undergone a minimum of freeze thaw cycles Has not been exposed to high temperatures 65 C for 1 hour can cause a detectable decrease in2. The SMRTbell library should be quantitated via fluorescence either in single sample Qubit system or plate based Quant iT system for mats Follow all manufacturer s instructions and ensure that a double stranded DNA standard is used for the quantitation Page 28 PACIFIC ANNEAL SMRTBELL TEMPLATES BIOSCIENCES AND PRIMER Before You Begin Fragment DNA 10 kb Repair DNA Damage and DNA Ends Ligate Adapters Blunt Anneal Sequencing Primer to SMRTbell Templates Bind Polymerase to SMRTbell Templates Sequence Page 29 Primer Annealing and Polymerase Binding Binding Calculator Prior to sequencing primer must be annealed to the SMRTbell tem plate and then DNA polymerase is bound to the annealed templates A Binding Calculator is provided to assist with setting up the annealing and binding reactions and setting up the sample plate for sequencing The Calculator can be used in three different modes Volume to use In this mode the Calculator uses the entire sample specified to run the maximum number of SMRT Cells possible e of SMRT Cells In this mode the user specifies how many SMRT Cells to prepare and the Calculator determines the amount of sample necessary Loading Titration This mode allows the user to set up a loading titration of the bound complex to optimize data yield per SMRT Cell The Calculator suggests four concentrations around the recommended complex co
3. NAD re 100 X 0 5 uL 1X dNTP 0 5 uL 0 1 mM for 10 kb DNA Damage Repair 2 0 uL Mix Total Volume 1 50 0 uL If your input amount deviates from the inputs shown in this table adjust all reagent volumes proportionately Note that the DNA final concentra tion cannot exceed 100 ng uL 3 Mix the reaction well by pipetting or flicking the tube 4 Spin down tube contents with a quick spin in a microfuge 5 Incubate at 37 C for 20 minutes then return reaction to 4 C until ready for purification Page 17 Repair Ends PacBio Template Prep Kit is used to repair the ends of fragmented DNA or non phosphorylated 5 ends of PCR products in preparation for ligation with hairpin adapters Note that the tube caps are color coded for your convenience Use the following table to prepare your reaction then purify the DNA Tube Cap Stock DNA Damage Repaired M 50 uL End Repair Mix e 25 uL 1X 1 Mix the reaction well by pipetting or flicking the tube 2 Spin down contents of tube with a quick spin in a microfuge 3 Incubate at 25 C for 5 minutes return the reaction to 4 C Purify the DNA Perform the following steps at room temperature Note that you must use low adhesion LoBind microcentrifuge tubes during the entire template preparation process 1 Add 0 45X volume of AMPure PB beads to the End Repair reaction Before using mix the bead reagent well until the solution appears homogenous Pipette
4. Procedure you can add equal volumes of AMPure PB beads to the saved supernatant and repeat the AMPure PB bead purification steps to recover the DNA Wash beads with freshly prepared 70 ethanol Note that 70 ethanol is hygroscopic and should be prepared FRESH to achieve optimal results Also 70 ethanol should be stored in a tightly capped polypropylene tube for no more than 3 days a Do not remove the tube from the magnetic bead rack b Use a sufficient volume of 70 ethanol to fill the tube 1 5 mL for 1 5 mL tube or 2 mL for 2 mL tube Slowly dispense the 70 ethanol against the side of the tube opposite the beads Let the tube sit for 30 seconds c Do not disturb the bead pellet d After 30 seconds pipette and discard the 70 ethanol 9 Repeat step 8 above 11 12 13 Remove residual 7096 ethanol and dry the bead pellet a Remove tube from magnetic bead rack and spin to pellet beads Both the beads and any residual 70 ethanol will be at the bottom of the tube b Place the tube back on magnetic bead rack c Pipette off any remaining 70 ethanol Check for any remaining droplets in the tube If droplets are present repeat step 10 Remove the tube from the magnetic bead rack and allow beads to air dry with the tube caps open for 30 to 60 seconds Elute the DNA off the beads a Elute the DNA in 30 uL Elution Buffer Page 19 14 15 16 b Thoroughly resuspend beads by vortexing
5. Template Prep Buffer ATP Lo Mix before proceeding Ligase 30 U uL 1 0 uL 0 75 UluL a The Ligase Buffer should remain closed and on ice when not frozen Page 22 If your insert size or input amount deviates from this table you can cal culate the amount of annealed blunt adapter to be added to the reac tion using the following equation Be sure to keep a 32 5 fold excess of hairpin adapters and adjust the final volume such that the hairpin adapter concentration does not exceed 1 uM Total ug of DNA insert X 106 1 650 X 1 Insert size in bp X pico moles of DNA available for ligation X picomoles of DNA available for ligation X 32 5 Total excess annealed adapters Y Y 20 20 uM annealed adaptor stock Z total uL of annealed adaptor to be added to the reaction If scaling of the reaction volume is necessary keep the buffer and enzyme concentrations proportional to the recommended amounts shown above 1 Mix the reaction well by pipetting or flicking the tube 2 Spin down the tube contents with a quick spin in a microfuge 3 Incubate at 25 C for 15 minutes At this point the ligation can be extended up to 24 hours or cooled to 4 C for storage of up to 24 hours 4 Incubate at 65 C for 10 minutes to inactivate the ligase then return the reaction to 4 C You must proceed with adding exonuclease after this step Add Exonuclease Add exonuclease to remove failed ligation products and Incubate Tube
6. for 1 minute at 2000 rpm If the beads appear over dried or cracked let the Elution Buffer sit on the beads for 2 to 3 minutes then vortex again the tube down to pellet beads then place the tube back on the magnetic bead rack d Discard beads Optional Verify your DNA amount and concentration using Qubit Nanodrop or Qubit quantitation platform as appropriate Perform qualitative and quantitative analysis using a Bioanalyzer instrument Note that the Bioanalyzer instrument has different kits in its offering and the appropriate kit based on insert size should be used Dilute the samples appropriately before loading on the Bioanalyzer chip so that the DNA concentration loaded falls well within the detectable minimum and maximum range of the assay Refer to Agilent s users guides for specific information on the range of the specific kit you might be using Note that typical yield at this point of the process following End Repair and one AMPure PB bead purification step is approximately between 80 100 of the total starting material The end repaired DNA can be stored overnight at 4 C or at 20 C for longer duration Page 20 PACIFIC LIGATE ADAPTERS BIOSCIENCES Before You Begin Fragment DNA 10 kb Repair DNA Damage and DNA Ends Ligate Adapters Blunt Anneal Sequencing Primer to SMRTbell Templates Bind Polymerase to SMRTbell Templates Sequence Page 21 Bl
7. sequence quality e Has not been exposed to pH extremes lt 6 or gt 9 e Has 0 280 ratio of approximately 1 8 to 2 0 Does not contain insoluble material Does not contain RNA Has not been exposed to intercalating fluorescent dyes or ultraviolet radiation Does not contain chelating agents e g EDTA divalent metal cations e g 27 denaturants e g guanidinium salts phenol or detergents e g SDS Triton X100 CTAB Does not contain carryover contamination from the starting organism tissue e g heme humic acid polyphenols Prior to fragmentation we recommend one or more of the following quality assessments to ensure that the DNA is pure and of high molec ular weight Quantitative Assessment e Spectrophotometry NanoDrop9 Spectrophotometer For samples of concentration gt 10 20ng uL We recommend 60 280 ratio of approximately 1 8 to 2 0 Fluorimetry PicoGreen or Qubit Fluorimeter Qualitative Assessment Gel electrophoresis and densitometry compared to the appropriate size standards Sample DNA should be of high molecular weight and comparable in intensity to a similar mass of control DNA 5 Gel Smear A Field Inversion Gel Electrophoresis system can be used to evaluate the quality of gDNA and determine the sizes of sheared DNA and SMRTbell templates see figure below On a field inversion gel high quality gDNA should migrate as a single band
8. the productivity output of primary analysis can be used to select the optimal concentra tion for running a larger batch of SMRT Cells Choose the concentra tion that yields the most data output at an acceptable accuracy An underloaded SMRT Cell will generate less data see Figure 12 below An overloaded SMRT Cell may result in higher data output but with an impact on raw accuracy and read length due to multiple polymerase template complexes in the same ZMW see Figure13 m 50000 40000 e 30000 an 5 o 1000 LB ip 60000 e E ANN 50000 a 5 40000 amp LB 30000 E E 5 Fa Q 70000 80000 Q 50000 e a 40000 30000 50 100 150 200 On SMRT cell concentration pM Figure 12 Yield Mapped Reads with increasing On SMRT Cell Loading Concentration On SMRT Cell concentration is the final concentration of the diluted sample transferred to the SMRT Cell On plate concentration is the concentration of the sample in the 96 well plate and which is the value entered in the Binding Calculator Page 39 0 88 e 97 e 0 86 e 0 91 0 90 aa Oo amp 3 H d 00 1 m J 0 57 0 86 091 0 90 e e 0 89 C amp 0 88 8 50 100 150 200 On SMRT cell concentration pM Figure 13 Effects of loading to accuracy with increas
9. the reagent slowly since the bead mixture is viscous and precise volumes are critical to the purification process 2 Mix the bead DNA solution thoroughly Mix the beads with the End Repair reaction by pipetting up and down or inverting the tube until the solution is homogenous 3 Quickly spin down the tube for 1 second to collect the beads 4 Allow the DNA to bind to beads by shaking in a VWR vortex mixer at 2000 rpm for 10 minutes at room temperature Note that the bead DNA mixing is critical to yield After vortexing the bead DNA mixture should appear homogenous We recommend using a VWR vortex mixer with a foam microtube attachment see Overview section with part number If using other instrumentation ensure that the mixing is equally vigorous Failure to thoroughly mix the DNA with the bead reagent will result in inefficient DNA binding and reduced sample recoveries Page 18 5 Spin down the tube 1 second to collect beads 6 Place the tube in a magnetic bead rack until the beads collect to the side of the tube and the solution appears clear The actual time required to collect the beads to the side depends on the volume of beads added Slowly pipette off cleared supernatant and discard Avoid disturbing the bead pellet With the tube still on the magnetic bead rack slowly pipette off cleared supernatant and save in another tube Avoid disturbing the bead pellet If the DNA is not recovered at the end of this
10. tube Avoid disturbing the bead pellet If the DNA is not recovered at the end of this procedure you can add equal volumes of AMPure PB beads to the saved supernatant and repeat the AMPure PB bead purification steps to recover the DNA Wash beads with freshly prepared 70 ethanol Note that 70 ethanol is hygroscopic and should be prepared FRESH to achieve optimal results Also 70 ethanol should be stored in a tightly capped polypropylene tube for no more than 3 days a Do not remove the tube from the magnetic bead rack b Use a sufficient volume of 70 ethanol to fill the tube 1 5 mL for 1 5 mL tube or 2 mL for 2 mL tube Slowly dispense the 70 ethanol against the side of the tube opposite the beads Let the tube sit for 30 seconds c Do not disturb the bead pellet d After 30 seconds pipette and discard the 70 ethanol Page 13 9 Repeat step 8 above 10 Remove residual 70 ethanol and dry the bead pellet a Remove tube from magnetic bead rack and spin to pellet beads Both the beads and any residual 7096 ethanol will be at the bottom of the tube b Place the tube back on magnetic bead rack c Pipette off any remaining 70 ethanol 11 Check for any remaining droplets in the tube If droplets are present repeat step 10 12 Remove the tube from the magnetic bead rack and allow beads to air dry with the tube caps open for 30 to 60 seconds 13 Calculate appropriate volume of Elution Buffer a Fo
11. vortex mixer at 2000 rpm for 10 minutes at room temperature Note that the bead DNA mixing is critical to yield After vortexing the bead DNA mixture should appear homogenous We recommend using a VWR vortex mixer with a foam microtube attachment see Overview section with Catalog part number If using other instrumentation ensure that the mixing is equally vigorous Failure to thoroughly mix the DNA with the bead reagent will result in inefficient DNA binding and reduced sample recoveries 5 Spin down the tube for 1 second to collect beads 6 Place the tube in a magnetic bead rack until the beads collect to 7 8 side of the tube and the solution appears clear The actual time required to collect the beads to the side depends on the volume of beads added Slowly pipette off cleared supernatant and save in another tube Avoid disturbing the bead pellet Wash beads with freshly prepared 70 ethanol Note that 70 ethanol is hygroscopic and should be prepared FRESH to achieve optimal results Also 70 ethanol should be stored in a tightly capped polypropylene tube for no more than 3 days a Do not remove the tube from the magnetic bead rack Page 24 b Use a sufficient volume of 70 ethanol to fill the tube 1 5 mL for 1 5 mL tube or 2 mL for 2 mL tube Slowly dispense the 70 ethanol against the side of the tube opposite the beads Let the tube sit for 30 seconds c Do not disturb the bead pellet
12. you process a control sample first Using the DNA shearing methods and subsequent AMPure PB bead purification steps described below you should recover approximately 50 80 of your input DNA by mass Typical yields from pre purified DNA where smaller fragments are already eliminated are between 80 100 Page 12 Mix the bead DNA solution thoroughly Mix the beads with the DNA by pipetting up and down or inverting the tube until the solution is homogenous Quickly spin down the tube for 1 second to collect the beads Allow the DNA to bind to beads by shaking in a VWR vortex mixer at 2000 rpm for 10 minutes at room temperature Note that the bead DNA mixing is critical to yield After vortexing the bead DNA mixture should appear homogenous We recommend using a VWR vortex mixer with a foam microtube attachment see Overview section for part number If using other instrumentation ensure that the mixing is equally vigorous Failure to thoroughly mix the DNA with the bead reagent will result in inefficient DNA binding and reduced sample recoveries Spin down the tube for 1 second to collect beads Place the tube in a magnetic bead rack until the beads collect to the side of the tube and the solution appears clear The actual time required to collect the beads to the side depends on the volume of beads added With the tube still on the magnetic bead rack slowly pipette off cleared supernatant and save in another
13. ATCGCGTGACGCCCTGCGGGCCTGAGTAACCGTGCACGAAGGACACCCCGTTCGTGGCGGGGGTT GCCTCCGCGACGGTCGCCAACGTTGGGGGTCGGTGCATTCAGGCGACGAGGGACCGCTGGTTTCC GGAGAGCGGCCTGTGCTCACACAGGTGCGGTCCATGGGGCCTGTGGATCCGGTTCTCCCACGCGT AGCGCCGGCGTTAGCATGGACGCTAAATAAGTATACGCCGGCAAAGGGAGTGTAGGCCGGCCCGAG GGCAATCGCGGTTACCGGGGTGGGGGAGCTCCCCGCACCAGCCTTGATGTGGTGTGCGAGCGCTIT CTCTCTCTCTTT Insert sequence lowercase no color Hairpin stem sequence Hairpin loop sequence primer binding site in bold underline Site of first incorporation Page 50
14. ATGCTT AGACGTTGCATTATAAAAGTTTATGTACTAAGTATTTAAGACATTGGCATATGATTATAGCTTGACATTATT AAAAATTAATTAATTAAATCTCACACAATACTTATTCAAGACATTTTTACTAAGATAACCAAAGGAATGCG AACAAAATAATACTTAAAATATAAGACTTAGAAGTAATATGATCCAATAGTTACATATAGTACACTAAGTTC CTAAATTATATAACTTTAAAACAAAGTTACGAAATTTGGAAATAATTTTATTTAATCATATTTTCATAATAATG AAATACTGTTTATTTCAGTGGCGAAAAGAGATAATACGATTTTATAGTGATAGAATATCCTTGAAATATCTA AAGATAAAATTAGAAACTTTCTCTTTTCGCTGTAAAGCTATATGACTTAAAAATAACTTATACGCAAAGTA TATTGCAGTGGAAACCCAAGAGTATAGTAGCCATGTAATCTCGGGTTCGAAACTACACGCCGCGCACG TAGTCAGATGGTCTGAAACTTGTCTGGGGCTGTTTGTTGACGGATGGAGACTTCACTAAGTGGCGTC AGGCGATGCGCACACACGGGACTCAATCCCGTAGCATGTTATGTGTCGTTCGAAACTCGTGCGTTCG AGATTTACGCCACATTGCCGGCTGGTCCAAGGACGTTATCTACCAGATGATACGGTCCAATTCGTAAG TTTGACTCACATAGTCGCGAACCGCGGAGCTGGAGAACAATAATTACCGGATGATTAGTTGACCATAC GCACTATCATGCTCCGTGACTCAGTTTCCGCCATGGAGTTCTCACAGCCCCGTGTGTACCATAACTGC AGTAAGTAAGGACCTTGTTCGGAGGCCGACTCGTATTTCATATGATCTTAGTCTCGCCACCTTATCGCA CGAATTGGGGGTGTCTTTTAGCCGACTCCGGCACGATCCGCCGGGAAGTTACTCGACCAGTTGCGG GACGCCCTAGTATGTTCGTATTACGTTCGATGCGTAAGCACCCCAGAGATTTTTGGCGGACGTTTCGG TAAATCATAGTAGAACCGGAGCGGTAAAGCTATTGATAACACGCAGGGACGAGCCAGTCGTCTAAGCT CCTCAGGGGTACCGTTCGCCGGACTACAGCCTGTCCCCGGCGGCCGCAACTGGGCTGCGATCCAG Page 49 CCCCCGCTCCAAAAGGATGACTCGACCTTGCGCCTCGCGTACTCTGCTCTCGAGCTGTCTCCGTGG GCAATGCCGGCTCACGCTGTGGGGAACCCTGGACGCCCGGGCCGAGCCGACGTGGCCCCGCCCA GGCCTTTTCGTCGATCGCAGCTATGTACCCTGTGCTGGCCAGCGCTACTGCGCCGGCCATTAGCGGT GCGCTCTCGACTCGGCCCCAACGTAGACGGCGTCGCTGGCCGGATTCAAAGAAGTGAGCTACTACC
15. CGAACGTAATACGAACATACTAGGGCGTCCCGCAACTGGTCGAGTAACTTCCCGGCGGATCGTG CCGGAGTCGGCTAAAAGACACCCCCAATTCGTGCGATAAGGTGGCGAGACTAAGATCATATGAAATAC GAGTCGGCCTCCGAACAAGGTCCTTACTTACTGCAGTTATGGTACACACGGGGCTGTGAGAACTCCA TGGCGGAAACTGAGTCACGGAGCATGATAGTGCGTATGGTCAACTAATCATCCGGTAATTATTGTTCTC CAGCTCCGCGGTTCGCGACTATGTGAGTCAAACTTACGAATTGGACCGTATCATCTGGTAGATAACGT CCTTGGACCAGCCGGCAATGTGGCGTAAATCTCGAACGCACGAGTTTCGAACGACACATAACATGCT ACGGGATTGAGTCCCGTGTGTGCGCATCGCCTGACGCCACTTAGTGAAGTCTCCATCCGTCAACAAA CAGCCCCAGACAAGTTTCAGACCATCTGACTACGTGCGCGGCGTGTAGTTTCGAACCCGAGATTACA TGGCTACTATACTCTTGGGTTTCCACTGCAATATACTTTGCGTATAAGTTATTTTTAAGTCATATAGCTTTA CAGCGAAAAGAGAAAGTTTCTAATTTTATCTTTAGATATTTCAAGGATATTCTATCACTATAAAATCGTATT ATCTCTTTTCGCCACTGAAATAAACAGTATTTCATTATTATGAAAATATGAT TAAATAAAATTATTTCCAAAT TTCGTAACTTTGTTTTAAAGTTATATAATTTAGGAACTTAGTGTACTATATGTAACTATTGGATCATATTACT TCTAAGTCTTATATTTTAAGTATTATTTTGTTCGCATTCCTTTGGTTATCTTAGTAAAAATGTCTTGAATAA GTATTGTGTGAGATTTAATTAATTAATTTTTAATAATGTCAAGCTATAATCATATGCCAATGTCTTAAATACT TAGTACATAAACTTTTATAATGCAACGTCTAAGCATCCTTATAAGTTTAATTCCAATTCTATATAACACAAC ATCAAATTAAATACCGTGAGTAAAATTATTGAACAATTAATGGACATGGCAAAAAATAAATGATATGCCTG TGTCCGCGTGTATAGCAAGCATAATGCATACAGGTGTGCAGGGATTACTTTAGATAAGTTATATGTCAAA GCTACGTTGAGATGACCTAGACACGGGTCTCTCTCTTTICCTCCTCCTCCGTTGTTGTTGTTGAGAGA GACCCGTGTCTAGGTCATCTCAACGTAGCTTTGACATATAACTTATCTAAAGTAATCCCTGCACACCTG TATGCATTATGCTTGCTATACACGCGGACACAGGCATATCATTTATTTTTTGCCATGTCCATTAATTGTTC AATAATTTTACTCACGGTATTTAATTTGATGTTGTGTTATATAGAATTGGAATTAAACTTATAAGG
16. Cap Stock Reagent Color Conc Volume Ligated DNA 40 uL 100 U uL 1 0 uL ExoVII 10 1 0 uL Total Volume 42 uL 1 Spin down the tube contents with a quick spin in a microfuge 2 Incubate at 37 C for 1 hour then return the reaction to 4 C You must proceed with purification after this step Page 23 Purify SMRTbell Templates In this purification process there are three 3 distinct and consecutive AMPure PB bead purification steps The first two 2 steps are per formed using 0 45X volumes of AMPure PB beads and the final step can be performed using either 0 40X or 0 45X volumes of AMPure PB beads Perform all purification steps at room temperature to ade quately remove enzymes exonucleases ligases etc and ligation products smaller than 0 4 kb e g adapter dimers AMPure PB Size Selection and Purification Step 1 1 Add 0 45X volumes of AMPure PB beads to the exonuclease treated ligation reaction Before using mix the bead reagent well until the solution appears homogenous Pipette the reagent slowly since the bead mixture is viscous and precise volumes are critical to the purification process Mix the bead DNA solution thoroughly Mix the beads with the ligation reaction by pipetting up and down or inverting the tube until the solution is homogenous Quickly spin down the tube for 1 second to collect the beads 4 Allow the DNA to bind to beads by shaking in a VWRS
17. PACIFIC BIOSCIENCES Template Preparation and Sequencing Guide For Research Use Only Not for use in diagnostic procedures P N 000 710 821 13 Copyright 2010 2014 Pacific Biosciences of California Inc All rights reserved Information in this document is subject to change without notice Pacific Biosciences assumes no responsibility for any errors or omissions in this document PACIFIC BIOSCIENCES DISCLAIMS ALL WARRANTIES WITH RESPECT TO THIS DOCUMENT EXPRESS STATUTORY IMPLIED OR OTHERWISE INCLUDING BUT NOT LIMITED TO ANY WARRANTIES OF MERCHANTABILIT Y SATISFACTORY QUALITY NONINFRINGEMENT OR FITNESS FOR A PARTICULAR PURPOSE IN NO EVENT SHALL PACIFIC BIOSCIENCES BE LIABLE WHETHER IN CONTRACT TORT WARRANTY PURSUANT TO ANY STATUTE OR ON ANY OTHER BASIS FOR SPECIAL CONSEQUENTIAL INCIDENTAL EXEMPLARY OR INDIRECT DAMAGES IN CONNECTION WITH OR ARISING FROM THIS DOCUMENT WHETHER OR NOT FORESEEABLE AND WHETHER OR NOT PACIFIC BIOSCIENCES IS ADVISED OF THE POSSIBILITY OF SUCH DAMAGES Certain notices terms conditions and or use restrictions may pertain to your use of Pacific Biosciences products and or third party products Please refer to the applicable Pacific Biosciences Terms and Conditions of Sale and to the applicable license terms at http www pacificbiosciences com licenses html Trademarks Pacific Biosciences the Pacific Biosciences logo PacB io SMRT SMRTbell and Iso Seq are trademarks of Paci
18. be from the magnetic bead rack Use a sufficient volume of 70 ethanol to fill the tube 1 5 mL for 1 5 mL tube or 2 mL for 2 mL tube Slowly dispense the 70 ethanol against the side of the tube opposite the beads Let the tube sit for 30 seconds Do not disturb the bead pellet After 30 seconds pipette and discard the 7096 ethanol 9 Repeat step 8 above 10 Remove residual 70 ethanol and dry the bead pellet a Remove tube from magnetic bead rack and spin to pellet beads Both the beads and any residual 70 ethanol will be at the bottom of the tube b Place the tube back on magnetic bead rack c Pipette off any remaining 70 ethanol 11 Check for any remaining droplets in the tube If droplets are present repeat step 10 12 Remove the tube from the magnetic bead rack and allow beads to air dry with tube caps open for 30 to 60 seconds Page 26 13 14 Elute the DNA off the beads in 100 uL of Elution Buffer Vortex for 1 minute at 2000 rpm Verify your DNA amount and concentration with either a Nanodrop or Qubit quantitation platform reading If recovery is sufficient to allow for an additional 2596 loss in the final AMPure PB purification step more if the library contains a high number of small fragments and it is desirable to increase the stringency of size selection consider using 0 40X volumes of AMPure PB beads This will remove most fragments 1 5 kb which will dominate loading if presen
19. ce The primer is tailed with a poly A sequence The poly A tail is required for MagBead loading but is not required and does not impact diffusion loading o AAAAAAAAAAAAAAAAAAT TAAC GGAGGAGGAGGA 3 Page 31 SMRTbell molarity calculation In calculating SMRTbell molarity we use the following formula Insert concentration ng ul 1 000 000 Insert concentration in Mean insert size bp 650 nM or fmol uL The detailed calculation is Insert Concentration ng uL 1 mol basepairs 1g 1015 fmol fmol nM Mean insert size bp 650 0 109 1 uL base pairs Note that the Binding Calculator can also be used to convert ng ul to nM and nM to ng ul Page 32 PACIFIC BINDING POLYMERASE TO BIOSCIENCES TEM PLATES Before You Begin Fragment DNA 10 kb Repair DNA Damage and DNA Ends Ligate Adapters Blunt Anneal Sequencing Primer to SMRTbell Templates Bind Polymerase to SMRTbell Templates Sequence Page 33 Binding Reaction DNA Internal Control Complex Identity and Amount Overview In the binding reaction step DNA sequencing polymerases are bound to the primer annealed SMRTbell templates Reaction Conditions The reaction takes place in the presence of a buffer DTT and nucleo tides to stabilize the complex For polymerase binding incubation at 30 for 30 minutes is sufficient Ratio of Polymerase to Template for Binding The stoichiometric opt
20. ction Note Calls attention to an item that may be of interest but is not critical to the process Important Calls attention to an item that is necessary for proper operation of a step WARNING Indicates you should proceed with appropri ate caution This guide describes an optimized procedure for preparing your DNA template for sequencing on the PacBio System This Blunt End Liga tion protocol is suitable for all libraries greater than 250 bp amplicons and offers a total preparation time of approximately four hours SMRTbell template is a double stranded DNA template capped by hairpin loops at both ends The SMRTbell template is structurally linear and topologically circular Some advantages of the SMRTbell structure include the generation of both sense and antisense sequence from a single molecule and the ability to achieve high single molecule accu racy through circular consensus sequencing approaches By avoiding the use of intramolecular ligation this method of forming circular templates is similarly efficient across a wide range of insert sizes This allows a single methodology to support all applications Page2 Template Preparation Process In addition to generating circular templates the hairpin adapters pro vide two additional benefits First they provide a universal primer bind ing site and initiation sequence Second they protect the ends of the DNA fragments Exonucleases can there
21. d After 30 seconds pipette and discard the 7096 ethanol 9 Repeat step 8 above 10 Remove residual 70 ethanol and dry the bead pellet a Remove tube from magnetic bead rack and spin to pellet beads Both the beads and any residual 70 ethanol will be at the bottom of the tube b Place the tube back on magnetic bead rack 11 Check for any remaining droplets in the tube If droplets are present repeat step 10 12 Remove the tube from the magnetic bead rack and allow beads to air dry with tube caps open for 30 to 60 seconds 13 Elute the DNA off the beads in 50 uL Elution Buffer Mix until homogenous then vortex for 1 minute at 2000 rpm a Thoroughly resuspend beads by vortexing for 1 minute at 2000 rpm If the beads appear over dried or cracked let the Elution Buffer sit on the beads for 2 to 3 minutes then vortex again b Spin the tube down to pellet beads then place the tube back on the magnetic bead rack c Discard beads 14 The eluted DNA in 50 uL of Elution Buffer should be taken into the second 0 45X AMPure PB bead purification step AMPure PB Size Selection and Purification Step 2 1 Add 22 5 uL 0 45X volume of AMPure PB beads to the 50 uL of eluted DNA from the first AMPure PB bead purification step above Before using mix the bead reagent well until the solution appears homogenous Then pipette the reagent slowly since the bead mixture is viscous and precise volumes are critical to the purifica
22. e 30 To Access the Calculator Primer Annealing You can access the Calculator by downloading it from the web at http calc pacb com or http calc PacificBiosciences com Be sure to always check for updates The Calculator is best viewed using Firefox or Chrome browsers Overview In this step sequencing primer is annealed to both ends of the SMRT bell template Primer annealing requirements vary depending on the library insert size and loading method e g Diffusion or MagBead For example SMRTbell templates with an average insert size of 500 bp for diffusion loading require less primer and polymerase compared to a 10 kb library using the MagBead loading method To achieve efficient loading of SMRTbell templates and to maximize yield per SMRT Cell PacBio has optimized the ratio of primer to tem plate specific to a library insert size range Although the ratio can be customized the recommendation is to use the default settings See the Pacific Biosciences Binding Calculator Parameters Quick Reference Card for a summary of the recommended primer to template ratio Reaction Conditions The Primer 5 uM and 10X Primer Buffer are included in the Template Prep Kit Before adding the primer to the SMRTbell template the primer must go through a melting step at 80 This avoids exposing the sample to heat The template and primer mix can then be incu bated at 20 C for 30 minutes and cooled to 4 C indefinitely Primer Sequen
23. e seal until it is ready to be placed on instrument Do not keep at room temperature after thawing e Do not keep the unsealed plate exposed to air Place the septa mat on plate immediately 3 Place the reagent plate on a VWR Microplate Shaker and shake for 1 minute at 1200 rpm 4 If precipitates are present in any of the filled wells mix thoroughly by vigorously vortexing until the solution is clear 5 Spin the plate in a centrifuge briefly at 2000 rpm 6 Peel the foil seal off the plate as shown 7 Place the supplied Septa mat on the plate 8 Using a roller further press down the Septa mat onto the plate Dilute Your Bound Complex Load your samples on to a Sample plate Place the white Septa mat on the plate and press down with a roller to ensure a tight fit Spin your sample plate down for 30 seconds at 2000rpm Place on the instrument At the instrument open the Reagents Samples drawer You can either press the illuminated Open button on the instrument Reagents Sam ples drawer or the Open button on the touchscreen User Interface Page 41 Load your Reagents on to the Instrument 1 When the drawer opens lift up the metal door covering the Reagents slots Lift here 2 Place your reagent plate in the Reagent slot Note that there are 2 slots if you have only one plate you can place it in either slot The Barcode Scanner will locate the plate 3 Remove the OS Enzyme from the re
24. ed with all reagents and enzymes stored at 20 C The Template Prep Kit uses a number of different enzymes and improper storage of these enzymes can lead to reductions in their catalytic efficiency and drops in either library recovery or eventual sequencing yield For example using inactive ligase will compromise the ligation step and lead to little or no library recovery Page 47 When the Sheared Library is the Wrong Size Make sure to optimize shearing conditions While this guide makes certain recommendations about shearing conditions it is also important to verify conditions effective for shearing your particular DNA sample on your shearing device Verify that the input DNA used for shearing is high molecular weight DNA at the appropriate concentration for your shearing device If the input DNA is damaged this can lead to smaller insert sizes and difficulty in generating large insert size libraries Additionally the concentration of the input DNA can also alter the shear size When Library Yield is High but Sequencing Yield from the Library is Still Low Properly quantify SMRTbell libraries before annealing sequencing primer Run a Bioanalyzer gel from Agilent following manufacturer s loading recommendations Sheared libraries are comprised of a distribution of fragment sizes around a targeted size and molarities are best approximated using the Bioanalyzer software Check the level of adapter dimer contaminati
25. eparing your library using the Mag Bead station see Pacific Biosciences Procedure amp Checklist Prepar ing MagBeads for Sequencing The Procedure can be found on our Customer Portal or our website Page 37 Loading Concentration Recommendations Loading Titration Diffusion Loading Diffusion loading is a method by which SMRTbell templates are immo bilized at the bottom of the ZMWs by the process of diffusion Poly merase bound SMRTbell templates are diluted with Complex Dilution Buffer loaded on a 96 well plate and subsequently transferred to a SMRT Cell for diffusion loading The Complex Dilution Buffer and DTT used for dilution prior to loading in the instrument are supplied in the DNA Polymerase Binding kit The diluted samples should be used as soon as they are prepared During a sequencing run the required diffusion time is 30 minutes for SMRTbell templates up to 3 kb in size and 1 hour for SMRTbell tem plates greater than 3 kb Complex Reuse Feature Note that this feature is available for diffusion loading only The bound complex used for immobilization on one SMRT Cell may be reused on several subsequent SMRT Cells allowing for greater data output for a given amount of input DNA When Complex Reuse is selected on the RS Remote up to two additional SMRT Cells can be immobilized using the diluted complex from the first SMRT Cell this is limited by both evaporation and the volume recovery capabilities of the inst
26. er Buffer 1 10 in water Then perform an additional AMPure PB bead purification step using e g for a 10 kb library use 0 45X AMPure PB beads However do not shake in a VWR vortex mixer at 2000 rpm room temperature for more than 10 minutes as adapter dimers may bind to the beads After the ethanol wash resuspend the beads in 1X Primer Buffer Calculate the appropriate volume of Elution Buffer and elute the DNA off the beads Perform an OD ggj go calculation to recalculate molarity before setting up the Annealing and Binding reaction Then repeat the Primer Annealing steps using the Sample Preparation Calculator see the Anneal and Binding sections of this Guide When DNA Quality is Suspected to be Sub Optimal Ensure that the concentration of AMPure PB beads is appropriate for the size of the library being prepared For example 250 bp libraries should be purified with 1 8X volume of AMPure PB beads if less than this amount is used then library yield will suffer The ends of the DNA insert fragments should not be labeled in order to allow the hairpin adapter insert DNA ligation reactions to proceed For instance 5 FAM labeled PCR products can not be used as the input DNA for making SMRTbell templates A failure at the ligation step will lead to little or no library after the exonuclease treatment as partially ligated products are degraded The PacBio Template Prep Kit should be properly handl
27. etween the primer poly A tail and the oligo dT on the magnetic bead surfaces Then the SMRTbell bound Mag beads are washed thoroughly with MagBead Binding and MagBead Wash Buffers to remove unwanted molecules such as excess primer and polymerases The washed SMRTbell MagBead sample is trans ferred to a 96 well plate loaded on the instrument and subsequently transferred to a SMRT Cell for immobilization MagBead loading is enabled by a built in MagBead station that moves the MagBeads around the surface of the SMRT Cell Typically SMRTbell templates greater than 1 kb are immobilized at the bottom of the ZMWs whereas shorter SMRTbell templates such as adapter dimers are not In addition to removal of excess polymerase primer adapter dimers and short insert SMRTbell templates MagBead loading offers the additional advantage of requiring significantly lower sample input amounts This increases the amount of sequencing data that can be achieved from a sample MagBead loading is recommended for librar ies greater than 1 kb The Binding Calculator provides concentration recommendations per library size for loading See the Pacific Biosciences Binding Calculator Parameters Quick Reference Card for a summary of the recom mended MagBead loading concentrations MagBead bound samples are stable for 24 hours It is highly recom mended to use MagBead bound SMRTbell templates immediately fol lowing preparation For more specific information on pr
28. fic Biosciences in the United States and or certain other countries All other trademarks are the sole property of their respective owners Pacific Biosciences of California Inc 1380 Willow Road Menlo Park CA 94025 www pacificbiosciences com Notice of Equipment Class Korea For Class A 0 212712 9 S8 Aa 77 BA TOA FE ASNE 0 BS FAHM 2 88 9 ASA AS SRLS LE For Class B 0 7 7 7PSS Ba TAQAR 24 FE 2 80 14 ASCE AS SALE op BE MSAA Ap T eL PACIFIC BEFORE YOU BEGIN BIOSCIENCES Before You Begin Fragment DNA 10 kb Repair DNA Damage and DNA Ends Ligate Adapters Blunt Anneal Sequencing Primer to SMRTbell Templates Bind Polymerase to SMRTbell Templates Sequence Page 1 Overview Trained Personnel User Attention Words and Symbols Template Preparation Protocols SMRTbell Templates The PacBio System includes the Instrument the accompanying kits needed for DNA template preparation and sequencing on the instru ment and the software used to set up runs and analyze data Any personnel carrying out the procedures described herein must be trained in proper and safe laboratory practices Throughout Pacific Bio sciences documentation the words you or user refer to and assume properly trained individuals Throughout this guide user attention words and symbols appear that may require a particular level of awareness or a
29. fore be used to degrade failed ligation products and templates containing internal nicks leaving behind only those templates that are suitable for single molecule sequencing The SMRTbell template preparation method creates a circularized template for use with multiple sequencing protocols A single stream lined protocol is used to create different insert size libraries by altering the fragmentation conditions Amplicons can also be used in the same size ranges as input DNA This template preparation protocol can be used for all modes of on instrument sequencing Template preparation can be complete in 3 6 hours with minimal hands on time Note that the time requirements scale with the number of samples The first step in the generation of a SMRTbell library is production of appropriately sized double stranded DNA fragments These fragments can be generated by random shearing of DNA or by amplification of target regions of interest The SMRTbell library itself is produced by ligating universal hairpin adapters onto double stranded DNA frag ments The hairpin dimers formed during this process are removed at the end of the protocol using a magnetic bead purification step with size selec tive conditions Adapter dimers are also efficiently removed using PacBio s MagBead kit The final step of the protocol is to remove failed ligation products through the use of exonucleases Figure 1 Double stranded DNA n
30. frigerator or ice 4 Replace the cap with a tube septa Be careful not to remove the barcode collar the Machine Vision System will read the barcode Page 42 5 Place the tube in the left slot encircled by your reagent plate location 6 Remove the blue cap from the SMRT Cell Oil tube 7 Replace the cap with a tube septa Place the SMRT Cell Oil tube in the right hand reagent slot Note that the SMRT Cell Oil tube is slightly larger and will fit only in that slot Mmm OS Enzyme tube location SMRT Cell Oil tube location 8 Gently close the metal door Load your samples and mixing plate on to the Instrument 9 Lift up the metal door covering the Sample and Mixing slots Page 43 10 Place your sample plate in the slot labelled Sample 11 Place a 384 well mixing plate Eppendorf LoBind Deepwell plates in the slot labeled Mixing 12 Gently close the metal door 13 Press the Close button on the touchscreen User Interface optionally press the Close button on the instrument Load the SMRT Open the SMRT Cells Tips drawer You can either press the illumi Cells and Tips nated Open button on the instrument SMRT Cells Tips drawer or the Open button on the touchscreen User Interface Load your SMRT Cells Tips on to the Instrument Page 44 1 When the drawer opens place the appropriate number of SMRT Cell 8Pacs determined previously during project planning
31. imum for the polymerase template ratio is 2 polymerases bound to each template molecule one to each hairpin adapter To maximize loading efficiency binding ratios per library size have been optimized and appear as the default setting in the Binding Calculator The ratio can be modified in the Optional section of the Cal culator however it is highly recommended that the default parameters be used See the Pacific Biosciences Binding Calculator Parameters Quick Reference Card for a summary of the recommended ratios of polymerases to templates for each library Note that MagBead loading and Diffusion loading require different polymerase to template ratios Storage of Polymerase SMRTbell Complexes Once the polymerase SMRTbell template complex is formed it should either be immediately used or stored at 4 C for up to 3 days Yield may be impacted if stored longer than 7 days If longer storage time is desired it is best to store the complex in the Complex Storage Buffer supplied in the Binding Kit The glycerol based storage buffer allows the complex to withstand freezing temper ature 209 for more than 30 days while minimizing the poly merase s loss of activity The Binding Calculator provides instructions for preparing complexes for long term storage The DNA Internal Control Complex available from Pacific Biosci ences provides a means for independent determination of any prob lems that may occur during binding and the sequenci
32. ing On SMRT Cell Concentration Overloading affects raw accuracy and read length Required Sample sample volume to load in a well of a 96 well sample plate is Well Volumes dependent on the desired number of SMRT Cells loading concentra tion and loading method See the Pacific Biosciences Binding Calcula tor Parameters Quick Reference Card for a summary of required sample well volumes During a run the automated pipettor takes an aliquot of the sample for dilution before delivering it to a SMRT Cell for immobilization To ensure accurate pipetting the pipettor requires dead volumes of 5 uL for diffusion loading and 10 uL in the sample plate for MagBead load ing The dead volumes are factored in the required volumes in the Pacific Biosciences Binding Calculator Parameters Quick Reference Card Prepare Your Thaw the following kit components accordingly Reagent Plates Page 40 Prepare Your Sample Plate Load Your Reagent Mixing and Sample Plates 1 OS Enzyme Remove the OS Enzyme from the reagent package Keep at 20 C at all times When ready to use spin down the tube for 5 seconds replace cap with tube septa and place on the reagent drawer of the instrument 2 Reagent plate The reagent plate can be thawed overnight at 4 C Thaw an additional 15 minutes at room temperature before using Note the following precautions which may impact reagent performance Do not thaw in hot water Do not remove plat
33. insert size should be used Dilute the samples appropriately before loading on the Bioanalyzer chip so that the DNA concentration loaded falls well within the detectable minimum and maximum range of the assay Refer to Agilent Technologies guides for specific information on the range of the specific kit you might be using Note that typical yield at this point of the process i e post shearing and after one AMPure PB bead purification step is approximately 50 80 The sheared DNA can be stored for up to 24 hours at 4 C or at 209C for longer duration Page 15 PACIFIC REPAIR DNA DAMAGE BIOSCIENCES AND DNA ENDS Before You Begin Fragment DNA 10 kb Repair DNA Damage and DNA Ends Ligate Adapters Blunt Anneal Sequencing Primer to SMRTbell Templates Bind Polymerase to SMRTbell Templates Sequence Page 16 Repair DNA For sheared DNA libraries and PCR products greater than 2 kb any Damage damage generated during DNA extraction and PCR amplifica tions must be repaired using the DNA Damage Repair reagents pro vided by Pacific Biosciences Common types of damage may include abasic sites cytosine deamination and oxidation Note that DNA dam age repair is optional for insert sizes less than 2 kb 1 Thaw the kit components on ice 2 In a LoBind microcentrifuge tube add the following reagents Tube Reagent Cap ce Volume Final Conc onc Color DNA Damage Repair 1X Buffer
34. into the SMRT Cells tray Place this end in first 2 Place tip boxes in the slots Be sure to remove the lid and tape from the tip boxes 3 Gently close the drawer door 4 Press the Close button on the touchscreen User Interface optionally press the Close button on the instrument Page 45 WARNING Pinch Point Do not place fingers inside drawers as they are closing PINCH POINT Keep hands and fingers clear Front View Start Your Run Before starting your run press Scan on the RS touch screen in order for the instrument to scan the contents of the drawers Once the con tents have been scanned the Start button will be enabled After press ing Start the UI will prompt you to verify that certain steps have been performed prior to sequencing Waste has been emptied Verify that the Waste bin is less than half full Nitrogen supply is within range Locate your facility s N2 tank supply gauge and verify that the supply is gt 80 psi preferably gt 100 120 psi Refer to the RS Remote online help systems for more information Page 46 PACIFIC TROUBLESHOOTING BIOSCIENCES Troubleshooting When Adapter Dimers May Be Cause of Low Yield Low Library Yields If you suspect that the low yield is due to adapter dimers then you can try re purifying the library Use MagBead loading Increase the current annealed template volume to 50 uL using 1X Primer Buffer dilute the Prim
35. n magnetic bead rack Pipette off any remaining 70 ethanol Page 27 SMRTbell Library Quality Assessment 11 Check for any remaining droplets in the tube If droplets are present repeat step 10 12 Remove the tube from the magnetic bead rack and allow beads to air dry with tube caps open for 30 to 60 seconds 13 Elute the DNA off the beads in 10 uL of Elution Buffer Vortex for 1 minute at 2000 rpm 14 Verify your DNA amount and concentration with either a Nanodrop or Qubit quantitation platform reading For general library yield expect 20 total yield from the Damage Repair input If your yield concentration is below 12ng uL use the Qubit system for quantitation To estimate your final concentration ng of DNA going into Damage Repair X 0 2 ___ of Elution Buffer ng uL 15 Perform qualitative and quantitative analysis using a Bioanalyzer instrument Note that typical DNA yield at this point of the process at the end of library preparation is between approximately 5 20 of the total starting DNA amount Successful sequencing of a SMRTbell library depends on an under standing of template molarity This requires accurate quantitation and sizing of the final library Size distribution can be measured by running 30 ng of the sample using an Agilent Bioanalyzer 12000 chip Typical library yields will require at least a 1 10 dilution prior to analysis on the Bioanalyzer instrument to ensure reliable quantitation
36. ncentration on the sample plate however the user can customize the titration range for their sample After selecting the appropriate mode enter the following information note that tool tips can be found by placing the cursor on each attri bute Protocol Select the loading method MagBead or Diffusion Binding Kit Select the appropriate sequencing polymerase Preparation Protocol Select the library scale used to prepare the sample Long Term Storage Enables options for complexes to be stored long term at 20 C DNA Control Complex Allows for DNA Internal Control use Complex Reuse For diffusion loading only The instrument re uses the sample for a total of up to three uses Standard Concentration Selecting No allows sample calculations with volumes and concentrations that do not meet standard requirements Once the sample details are selected additional parameters may be modified in the Calculator s Custom Parameters section Concentration on Plate Use the default recommendation as a starting point Note that this can be modified to maximize yield per SMRT Cell DNA Control Complex Ratio to Template Use the default recommendation This is the percentage of DNA Internal Control to add to the sample Polymerase Template Ratio Use the default recommendation For applications which may require a ratio other than the default values contact your FAS Primer Template Ratio Use the default recommendation Pag
37. nd tubes used for all reactions 1 5 mL VWR Eppendorf DNA LoBind tubes used for all reactions Ethanol absolute Vortex Genie with plate shaking attachment Plate centrifuge Minifuge Aerosol resistant filter tips Molecular Biology Grade H50 Page8 Vendor Bio Rad HSP9601 Pacific Biosciences Pacific Biosciences Pacific Biosciences Vendor Axygen PCR SP Roller Any Major Laboratory Supplier Allegra Eppendorf PN 5415D VWR PN 37000 700 Invitrogen 123 21D Bio Rad 0 2 mL flat cap PCR tube cat 0201 VWR tube strip with individually attached bubble caps cat 82006 634 Molecular BioProducts 0 2 mL PCR tube flat cap cat 3412 Molecular BioProducts 0 2 mL PCR strip tube cat 3418 Eppendorf PN 80077 236 Eppendorf PN 80077 230 Sigma Aldrich VWR Catalog No 14005 824 Any Major Laboratory Supplier Any Major Laboratory Supplier Any Major Laboratory Supplier Any Major Laboratory Supplier Source Sample Isolation kits Qiagen Blood and Cell Culture DNA Maxi Kit PN 13362 Blood and Cell Culture DNA Midi Kit PN 13343 Qiagen Large Construct Kit PN 12462 e QlAquick PCR Purification Kit PN 28104 Page9 PACIFIC FRAGMENT DNA BIOSCIENCES Before You Begin Fragment DNA 10 kb Repair DNA Damage and DNA Ends Ligate Adapters Blunt Anneal Sequencing Primer to SMRTbell Templates Bind Polymerase to SMRTbell Templates Se
38. ng run These controls are SMRTbell templates already bound with the polymerase They are added to the sample before loading on the instrument See the Pacific Biosciences Binding Calculator Parameters Quick Refer ence Card for a summary of the DNA Internal Control Complex recom mendations Page 34 Loading Bias The amount of DNA Internal Control Complex to add to experimental templates is determined by the sample insert size and chosen chemis try The Binding Calculator automatically recommends the amount of DNA Internal Control Complex to add to achieve the total number of reads between 500 1000 reads per SMRT Cell Loading of SMRTbell templates into ZMWs is size dependent Small inserts load better than large inserts This is particularly important when sequencing different PCR amplicon sizes It is highly recom mended to select amplicons of the same size 10 to minimize loading bias When sequencing large insert libraries e g 20 kb library for generat ing long read lengths it is highly recommended to perform a size selection step to eliminate short SMRTbell templates that will preferen tially load The figure below demonstrates loading bias of various insert sizes generated from a 18 5 kb plasmid restriction digest o N o LI Q c 5 c o o 59 o 2 0 2 5 3 0 3 5 4 0 4 5 Insert Size kbp Figure 11 ZMW Loading Bias for Various Inser
39. of approximately 50 kb Lane 1 Assaying high molecular weight DNA is critically important for constructing large insert libraries e g 20 kb libraries 30kb 20kb ET c c V un A m Figure 7 Sizes of Sheared DNA DNA Input The 10 kb procedure described in this guide has been optimized to Requirements produce a 10 kb SMRTbell library with an input amount of 5 ug For all other insert sizes download the Procedures from the Customer Portal or www smrtcommunity com SampleNet Note that depending upon the quality of your sample approximately 20 sample loss is to be expected as a result of the shearing and con centration process Therefore be sure to have sufficient amounts of starting DNA in order to have the required amount of starting material for the DNA Damage Repair reaction Page6 Scaling Up Reactions Please note that all reaction volumes are concentration dependent and each can be scaled with the input amount of sheared DNA If pre paring larger amounts of DNA scale all the reaction volumes propor tionally For example if the input amount is double the amount of DNA we recommend carrying out the reaction with double of every compo nent and double the total volume PacBio Kits and Kits and SMRT Cell 8Pacs for Sequencing Experiments on the SMRT Cells PacBio System Required Item Template Prep Kit DNA Polymerase Binding Kit DNA Sequencing Kit DNA Internal Contr
40. ol Complex MagBead Kit MagBead Buffer Kit AMPure PB Kit SMRT Cell 8Pac SMRT Cell Oil Source Pacific Biosciences Pacific Biosciences Pacific Biosciences Pacific Biosciences Pacific Biosciences Pacific Biosciences Pacific Biosciences Pacific Biosciences Pacific Biosciences Specific Lab Required Equipment for Successful Template Preparation Equipment and Related Consumables Required Shearing Device Item g TUBE microcentrifuge tubes Covaris S2 System 1 sample or Covaris E Series 96 samples For Covaris devices miniTube holders and clear mini Tubes will also be needed and or e Hydroshear Shearing Device Bioanalyzer Instrument Agilent 2100 Bioanalyzer DNA 1000 DNA 7500 DNA 12000 DNA Kits and or High Sensitivity DNA Kit NanoDrop Series 2000 2000c 3300 8000 or Qubit Quantitation Platform Fluorometer and Quant iT Assay Kits Page Vendor Covaris Hydroshear Agilent Technologies PN 2100 Agilent Technologies Thermo Scientific Invitrogen PN Q32857 General Lab Item 96 well plates semi skirted Plate Septa Tube Septa AMPure PB Beads Recommended DNA Isolation Kits Item Axygen Sealing Film Roller or Septa Roller Speedball Roller Allegra 6KR Centrifuge Microcentrifuge 1000 16000 RCF Strip tube Centrifuge Magnetic Particle Concentrator 0 2 mL PCR tubes can be used for all reactions 0 5 mL VWR Eppendorf DNA LoBi
41. on Because of an intrinsic loading bias that favors the immobilization of smaller DNA template sizes in the SMRT Cells the amount of hairpin dimers in your sample should be kept as low as possible ideally 196 adapter dimer levels approaching 2 or higher will significantly decrease sequencing yields We strongly encourage performing at least a double AMPure PB bead purification step prior to performing the primer template annealing reactions when automating the library preparation procedure using a robotic platform a triple purification process may be necessary Page 48 PACIFIC APPENDIX e BIOSCIENCES Internal Control Complex Sequence TCCTCCTCCTCCGTTGTTGTTGTTGAGAGAGAGAAGCGCTCGCACACCACATCAAGGCTGGTGCGG GGAGCTCCCCCACCCCGGTAACCGCGATTGCCCTCGGGCCGGCCTACACTCCCTTTGCCGGCGTAT ACTTATTTAGCGTCCATGCTAACGCCGGCGCTACGCGTGGGAGAACCGGATCCACAGGCCCCATGGA CCGCACCTGTGTGAGCACAGGCCGCTCTCCGGAAACCAGCGGTCCCTCGTCGCCTGAATGCACCGA CCCCCAACGTTGGCGACCGTCGCGGAGGCAACCCCCGCCACGAACGGGGTGTCCTTCGTGCACGG TTACTCAGGCCCGCAGGGCGTCACGCGATGGTAGTAGCTCACTTCTTTGAATCCGGCCAGCGACGC CGICTACGTTGGGGCCGAGTCGAGAGCGCACCGCTAATGGCCGGCGCAGTAGCGCTGGCCAGCAC AGGGTACATAGCTGCGATCGACGAAAAGGCCTGGGCGGGGCCACGTCGGCTCGGCCCGGGCGTCC AGGGTTCCCCACAGCGTGAGCCGGCATTGCCCACGGAGACAGCTCGAGAGCAGAGTACGCGAGGC GCAAGGTCGAGTCATCCTTTTGGAGCGGGGGCTGGATCGCAGCCCAGTTGCGGCCGCCGGGGACA GGCTGTAGTCCGGCGAACGGTACCCCTGAGGAGCTTAGACGACTGGCTCGTCCCTGCGTGTTATCA ATAGCTTTACCGCTCCGGTTCTACTATGATTTACCGAAACGTCCGCCAAAAATCTCTGGGGTGCTTACG CAT
42. quence Page 10 Shearing DNA Shearing DNA Using a Covaris g TUBE Shearing Device 5 kb Insert Sizes Optional Shearing DNA Using a Hydroshear Shearing Device 10 kb Insert Sizes Our large insert size protocols have been validated using DNA frag mented with the Covaris g TUBE device With any system there will be some variation in the distribution of the sheared fragments In addition some DNA will be lost during the shearing process itself Depending on the quality of your starting material and the selected method of shearing you may expect to lose 20 of the starting mass of your DNA sample The most up to date guidance on how to use the g TUBE device along with recommended centrifuges and centrifugation speeds can be found the g TUBE device user manual available for download from the Covaris web site e After the first centrifuge spin check the upper chamber for residual liquid Re spin if necessary e If there is still liquid in the chamber after 2 spins use a 20 uL pipettor and pipette up and down several times Then spin the tube down again After shearing determine the approximate size range by loading 30 ng of DNA on to the Bioanalyzer 12000 chip or by running a low percent agarose gel Check quantitation on a Nanodrop system Note that fragments sheared using the g TUBE device are greatly dependent on gDNA quality and size and may range from 6 kb to 20 kb A Hydroshear Shea
43. r 10 kb libraries ngX0 5 pL of Elution Buffer needed The minimum DNA concentration required to proceed to the next step End Repair is 140 ng uL with preferred mass of at least 5 ug 14 Add Pacific Biosciences Elution Buffer volume calculated in step 13 above to your beads a Thoroughly resuspend beads by vortexing for 1 minute at 2000 rpm If the beads appear over dried or cracked let the Elution Buffer sit on the beads for 2 to 3 minutes then vortex again b Spin the tube down to pellet beads then place the tube back on the magnetic bead rack c Perform concentration measurements Verify your DNA concentration using a Nanodrop or Qubit quantitation platform If the DNA concentration is estimated to be equal to or below 12 ng uL a Qubit system reading is required When performing a Qubit system reading ensure that your sample is within the range of the Qubit kit you are using For proper concentration calculations incorporate the dilution factor used when diluting your sample to be within range of the Qubit kit and the dilution factor when diluting your sample with the working solution The latter part of this dilution factor can be calculated automatically by the Qubit system d Discard the beads Page 14 15 16 Perform qualitative and quantitative analysis using a Bioanalyzer instrument Note that the Bioanalyzer instrument has different kits in its offering and the appropriate kit based on
44. ring Device can also be used to shear DNA sam ples However because Hydrodynamic shearing performance can vary with each shearing assembly we recommend optimizing the shearing whenever a new shearing assembly is used The sheared DNA can be stored for up to 24 hours at 4 C or 2 months at 20 C Page 11 Sheared 10 kb DNA Distribution on a Bioanalyzer Instrument AMPure PB Purification Steps Throughout this Guide Concentrate DNA The FU 45 Figu For graph below shows an example of fragment size distribution Y 50 300 500 700 1000 2000 5000 17000 re 8 Fragment Size Distribution for 10 kb all 10 kb purification and concentration steps you must use 0 45X AMPure PB beads For your convenience the guide details these requirements in each section Perform the following steps at room temperature to concentrate your DNA sample Note that you must use low adhesion LoBind microcentrifuge tubes during the entire template preparation process 1 Add 0 45X volume of AMPure PB magnetic beads to the sheared DNA Before using mix the bead reagent well until the solution appears homogenous Pipette the reagent slowly since the bead mixture is viscous and precise volumes are critical to the purification process Consistent and efficient recovery of your sample is critical to successful SMRTbell library preparation If using this protocol for the first time we strongly recommend that
45. ru ment Complex reuse is available for all Standard sequencing insert sizes It is not available for MagBead loading The recommended loading concentration on SMRT Cells is dependent on the preferred loading method and library size When the library size concentration volume and required number of SMRT Cells are entered in the Binding Calculator an optimal on plate concentration is recommended by default See the Pacific Biosciences Binding Calcu lator Parameters Quick Reference Card for a summary of the recom mended loading recommendations optimized for library sizes and chemistry It is highly recommended to perform loading titrations to achieve maxi mum performance per SMRT Cell The optimal loading concentration may vary by sample Slight varia tions are cumulative in large projects spanning tens or hundreds of SMRT Cells and a pilot experiment with a loading titration is recom mended to maximize overall yields The data that is generated in the pilot run can be included in any downstream analyses along with larger optimized data sets The Binding Calculator facilitates setting up the complex dilutions on the sample plate to titrate loading concentrations The calculator will generate four dilutions around the recommended concentration The Page 38 user can make these dilutions from the same bound complex run the four samples in a pilot loading titration run After the run has completed and the data processed
46. t Otherwise proceed to the third 0 45X volumes of AMPure PB bead purification step Note that yield from 0 40X is typically 10 lower than 0 45 volumes of AMPure PB bead purification AMPure PB Size Selection and Purification Step 3 1 Add 45 uL 0 45X volume or 40 uL 0 40X volume of AMPure PB beads to the 100 uL of eluted DNA Note that for 0 40X volume it is critical to accurately pipet the desired volume of AMPure PB bead solution there is a steep drop off in recovery for concentrations 0 40X 2 Mix the bead DNA solution thoroughly 3 Quickly spin down the tube for 1 second to collect the beads Do not pellet beads Allow the DNA to bind to beads by shaking in a VWR vortex mixer at 2000 rpm for 10 minutes at room temperature Spin down the tube for 1 second to collect beads Place the tube in a magnetic bead rack to collect the beads to the side of the tube Slowly pipette off cleared supernatant and save in another tube Avoid disturbing the bead pellet Note It is especially important to save the supernatant for 0 40X volumes of AMPure PB purification steps in case of low recovery Wash beads with freshly prepared 70 ethanol Repeat step 8 above 10 Remove tube from magnetic bead rack and spin to pellet beads Remove residual 70 ethanol and dry the bead pellet Both the beads and any residual 70 ethanol will be at the bottom of the tube Place the tube back o
47. t Sizes Relative loading as 9o of total sequencing ZMWs versus insert size from a SMRTbell size ladder A restriction digestion of an 18 5 kb plasmid generated an equimolar distribution of fragments from 160 bp to 4251 bp The resulting fragments were converted to SMRTbell templates via a modified blunt end ligation protocol which retains all fragment sizes 75 bp The SMRTbell size ladder was sequenced using standard protocols Page 35 PACIFIC SEQUENCING BIOSCIENCES Before You Begin Fragment DNA 0859 Repair DNA Damage and DNA Ends Ligate Adapters Blunt Anneal Sequencing Primer to SMRTbell Templates Bind Polymerase to SMRTbell Templates Sequence Page 36 Sequencing Diffusion vs MagBead Loading Overview Prior to sequencing the template polymerase complex must be trans ferred to a 96 well sample plate with concentrations and volumes specified by the Binding Calculator This section provides background information for preparing the bound complex for sequencing Two options are available for loading The options are dependent on the library size Library sizes 1 kb must be loaded using diffusion loading MagBead loading is highly recommended for libraries gt 1 kb MagBead Loading During MagBead loading SMRTbell templates are immobilized to the bottom of the ZMWs by paramagnetic beads First SMRTbell templates are captured by MagBeads through a hybridization process b
48. tion process 2 Mix the bead DNA solution thoroughly Mix the beads with the ligation reaction by pipetting up and down or inverting the tube until the solution is homogenous 3 Quickly spin down the tube for 1 second to collect the beads Page 25 4 Allow the DNA to bind to beads by shaking in a VWR vortex mixer at 2000 rpm for 10 minutes at room temperature Note that the bead DNA mixing is critical to yield After vortexing the bead DNA mixture should appear homogenous We recommend using a VWR vortex mixer with a foam microtube attachment see Overview section with Catalog part number If using other instrumentation ensure that the mixing is equally vigorous Failure to thoroughly mix the DNA with the bead reagent will result in inefficient DNA binding and reduced sample recoveries 5 Spin down the tube for 1 second to collect beads 6 Place the tube in a magnetic bead rack until the beads collect to the side of the tube and the solution appears clear The actual time required to collect the beads to the side depends on the volume of beads added 7 Slowly pipette off cleared supernatant and save in another tube Avoid disturbing the bead pellet 8 Wash beads with freshly prepared 70 ethanol Note that 70 ethanol is hygroscopic and should be prepared FRESH to achieve optimal results Also 70 ethanol should be stored in a tightly capped polypropylene tube for no more than 3 days Do not remove the tu
49. unt End Ligation of SMRTbell Templates Blunt End Ligation Reaction During this step blunt hairpins are ligated to repaired fragment ends Figure 9 Repaired Fragment Ends LE 4 auba FA Re y UM YU 20 uo Dp CU mS pos TN ES E tapes ITI Figure 10 Blunt Hairpin Adapters and Insert DNA Ready for Ligation To ligate the hairpins SMRTbell templates to the DNA fragments you will need BLUNT hairpin adapters These are shipped as 20 uM oligonucleotide stock and are pre annealed This reaction can be scaled for the number of library samples being prepared In a LoBind microcentrifuge tube on ice add the following reagents in the order shown note that you can add water to achieve the desired DNA volume If preparing a Master Mix ensure that the adapter is NOT mixed with the ligase prior to introduction of the inserts Add the adapter to the well with the DNA All other components including the ligase should be added to the Master Mix Tube Cap Stock Final DNA End Repaired BEEN 29uL to 30 uL Blunt Adapter 20uM 20 uM 1 0 uL 0 5 uM Mix before proceeding
Download Pdf Manuals
Related Search