Home

Adeno-X™ Adenoviral System 3 User Manual

Contents

1. Xhol Xhol 21309 Nhel 21309 Nhel 17664 17664 Figure 11 pAdenoX PRLS DsRedExpress Linear Vector and pAdenoX PRLS ZsGreen1 Linear Vector maps PT5177 1 www clontech com 061213 Clontech Laboratories Inc A Takara Bio Company Page 31 of 34 Adeno X Adenoviral System 3 User Manual Appendix B Multiple Fragment Cloning into pAdenoX Vectors The full capabilities of adenoviral delivery can now be realized through the ability of In Fusion to efficiently and seamlessly assemble all the necessary expression elements into an adenoviral vector The protocol is simply an extension of the single fragment protocol Figure 2 all that is required is that the primers for the individual PCR products share 15 bases of homology with the adjacent fragment see Figure 12 Any polyA signal Any promoter Your gene e g EF1a U6 or tissue specific EN ITR wh ITR DsRed Express Figure 12 Multiple fragment cloning in the Universal Red System Perform the In Fusion reaction for multiple fragment cloning as follows NOTES e Whether you are cloning in 2 or 3 fragments use 50 ng of each PCR insert in a total rxn volume of 10 ul e Due to the complex nature of the cloning colony number will decrease compared to cloning of single inserts 1 Prepare 0 2 ml PCR tubes to set up the In Fusion reaction Reagent Volume ul per sample Reagent Cloning Reaction Control Reaction PCR inserts 50 ng each
2. Target Cells rhe int ehe UR RE SEE DRE Pe th een E RE e esent RE ERR abe Xa DR e ER bus 23 B Analyzing Beta Galactosidase Expression in Infected Cells esee 24 C Protocol Inducible Expression using Tet On 3G annassa 24 XE SREGCTENCES eccna insna AE E A E EE O EAE o eE A R E AA R A E E 26 P dM colo ren D 27 Appendix A Adeno X Adenoviral Systems 3 Vector Information eeeessesesseeseeeeeeeeeeen eene renes 30 Appendix B Multiple Fragment Cloning into pAdenoX Vectors eeeeessesseeseeeeeeeenee nennen ener enne 32 Appendix C Expected Fragment Sizes for Nhel or Xhol digest of pAdenoX Vectors eseeeeeenrene 33 PT5177 1 www clontech com 061213 Clontech Laboratories Inc A Takara Bio Company Page 2 of 34 Adeno X Adenoviral System 3 User Manual Table of Figures Figure 1 Constructing recombinant adenovirus with In Fusion technology n aaa 6 Figure 2 In Fusion primer design example eese nnne tnter entrent en rennen eren ness nre nenne 14 Figure 3 PCR screening of clones using Adeno X Screening Primer Mix 3 essere 17 Figure 4 Restriction analysis of pAdenoX DNA 18 Figure 5 Observing the cytopathic effect when culturing
3. deionized HO 7 0 Additional deionized H2O 0 5 Linearized pAdenoX vector 200 ng ul 1 1 Adeno X Control Fragment 50 ng ul 0 2 5X In Fusion HD Enzyme Premix 2 2 Total volume per rxn 10 10 2 Incubate the reaction for 15 min at 50 C then place on ice 3 Proceed with the Transformation Procedure in Section VIII A You can store the cloning reactions at 20 C until you are ready PT5177 1 www clontech com 061213 Clontech Laboratories Inc A Takara Bio Company Page 32 of 34 Adeno X Adenoviral System 3 User Manual Appendix C Expected Fragment Sizes for Nhel or Xhol digest of pAdenoX Vectors Table 3 Expected Fragment Sizes bp from an Nhel or Xhol digest of pAdenoX Vectors The fragment sizes are based on circular vectors lacking an insert The shaded values will differ based on the size of the insert that is cloned Vector Linear Nhel Xhol 36043 687 595 3848 1445 4731 2466 pAdenoX Tet3G 16435 3623 10342 3320 10094 14500 34209 687 595 2683 1445 3848 2466 pAdenoX CMV 10342 3320 16649 3837 8046 14500 35866 687 595 3848 1445 4340 2466 pAdenoX ZsGreen1 10342 3320 16649 3837 9703 14500 35857 687 595 1503 1445 2828 2466 pAdenoX DsRedExpress 3848 3320 10342 3837 16649 9694 14500 32665 687 595 2683 1445 3848 2466 pAdenoX PRLS 10342 5613 15105 8046 14500
4. n 9 Harvest recombinant adenovirus Figure 1 Constructing recombinant adenovirus with In Fusion technology DNA sequences can be rapidly transferred as PCR products to any pAdenoX vector using the In Fusion cloning method In this example your gene of interest is amplified with 15 bp extensions that are homologous to the ends of the linearized adenoviral vector The PCR product is then purified and mixed with the linearized adenoviral vector of choice in the In Fusion reaction Following the reaction a portion of the mixture is transformed into E coli Stellar Competent Cells and screened Once a PCR positive clone is identified the recombinant pAdenoX vector is amplified purified and subsequently linearized with the restriction enzyme Pacl then transfected into Adeno X 293 cells for viral rescue and amplification Adeno X GoStix can be used to determine the status of adenovirus rescue PT5177 1 www clontech com 061213 Clontech Laboratories Inc A Takara Bio Company Page 6 of 34 Adeno X Adenoviral System 3 User Manual List of Components For storage conditions refer to the Certificate of Analysis supplied with each component PT5177 1 061213 Each kit includes sufficient reagents to perform 10 reactions A Adeno X Expression System 3 Choose from the following 7 different system formats Cat No System Name 631180 4 Adeno X Adenoviral System 3 Tet On 3G Inducible 632269 Adeno X Adenoviral System 3 CMV 632268 Aden
5. TATAACGGTC gt 5 GACGCGTAAC TATAACGGTC In Fusion GGAGAAAGAG GTAATGAAAT 3 3 CTGCGCATTG ATATTGCCAG Cloning Site CCTCTTTCTC CATTACTTTA 5 lt CCTCTTTCTC CATTA 5 x Sequence to be added to 5 end of reverse primer Figure 2 In Fusion primer design example 1 General Primer Design Guidelines The required forward reverse primer designs are as follows Forward Primer gtaactataacggtc 111 222 333 444 555 666 777 888 Reverse Primer attacctctttctcc LLL NNN NNN NNN NNN NNN NNN NNN 111 first 3 nucleotides of your gene sequence This is likely to be the start codon if you are using the Tet On 3G system or any CMV System 222 second 3 nucleotides etc LLL reverse compliment of the last 3 nucleotides of your sequence e g the stop codon NNN reverse compliment of the end of your sequence Specific Primer Design Example Using the lacZ Gene Forward Primer gtaactataacggtc atg tcg ttt act ttg acc aac aag Reverse Primer attacctctttctcc tta ttt ttg aca cca gac caa c Letters in italics are specific for the lacZ gene and include a start codon atg at the start of the Forward Primer sequence and a stop codon faa at the end of the reverse complement of the Reverse Primer sequence Note these primers were used to amplify the control fragment supplied with your kit Amplify the sequence that you wish to clone by PCR using CloneAmp HiFi Premix If you amplified your PCR product from a p
6. and store at 20 C in the dark Use within one year e Tetracycline Free Fetal Bovine Serum Contaminating tetracyclines often found in serum will significantly elevate basal expression when using Tet On 3G The following functionally tested tetracycline free sera are available from Clontech www clontech com Clontech Laboratories Inc A Takara Bio Company Page 8 of 34 Adeno X Adenoviral System 3 User Manual Cat No Serum Name 631106 Tet System Approved FBS 500 ml 631107 Tet System Approved FBS 50 ml 631367 Tet System Approved FBS 3 x 500 ml 631101 Tet System Approved FBS US Sourced 500 ml 631105 Tet System Approved FBS US Sourced 50 ml 631368 Tet System Approved FBS US Sourced 3 x 500 ml F Determination of Adenoviral Titers e Adeno X Rapid Titer Kit Cat No 632250 e Adeno X qPCR Titration Kit Cat No 632252 e Adeno X GoStix Cat No 632270 G Purification of Adenovirus Adenoviral stocks are produced using Adeno X 293 cells and virus is harvested when the cytopathic effect CPE is considered to be complete Because the virus is harvested from the cell lysate it is very important to purify the virus away from the cell debris present in the lysate Contaminating cellular DNA proteins and membrane fragments can be cytotoxic to target cells even in small amounts Therefore we recommend purifying your adenoviral vectors using one of the kits mentioned below The Adeno X Maxi and Mega Purification Kits ut
7. com Clontech Laboratories Inc A Takara Bio Company Page 21 of 34 Adeno X Adenoviral System 3 User Manual PT5177 1 061213 11 12 When gt 50 of the cells have detached from the plate prepare a viral stock by following Steps 5 9 Name this stock Primary Amplification and store at 20 C e The Primary Amplification stock is suitable for infecting target cells as described in Section X We suggest you evaluate the function of this viral stock before preparing High Titer Stock Section IX C e The presence of your recombinant construct can be verified by PCR or Western blotting Section IX D Determine the adenoviral titer using the Adeno X Rapid Titer Kit Cat No 632250 which enables you to determine adenoviral titer using an anti hexon antibody cell staining assay Download a free copy of the User Manual PT3651 1 at www clontech com manuals to learn more about this product Alternatively you can use Adeno X GoStix Cat No 632270 to test the quality of the lysate in just 2 20 min The GoStix can indicate the level of amplification achieved and help to determine if further amplification is required C Protocol Amplifying Recombinant Adenovirus Preparing High Titer Stocks Prepare high titer stocks of recombinant adenovirus according to the following protocol NOTE The probability of producing replication competent adenovirus RCA although low increases with each successive amplification RCA is produced
8. later Since the recombinant PT5177 1 www clontech com 061213 Clontech Laboratories Inc A Takara Bio Company Page 3 of 34 Adeno X Adenoviral System 3 User Manual PT5177 1 061213 pAdenoX DNA used for transfecting Adeno X 293 cells originated from an individual bacterial clone the rescued recombinant adenovirus does not require additional plaque purification Available Adeno X System 3 Formats Adeno X Adenoviral System 3 is available in seven formats including the most advanced tetracycline inducible expression system constitutive expression systems with or without fluorescent reporters and universal systems that allow you to clone and express an entire expression cassette of your choice Cat No Product Description 631180 Adeno X Adenoviral System 3 Tet On 3G Inducible Tightly controlled doxycycline inducible expression System on a single vector Clone your gene of interest downstream of Clontech s Prre3q promoter located in the E1 region of the adenoviral genome Our highly sensitive Tet On 3G transactivator cassette is inserted into the E3 region of the adenoviral backbone 632269 Adeno X Adenoviral System 3 CMV Constitutive expression of your gene of interest from a CMV promoter 632268 Adeno X Adenoviral System 3 CMV Red Constitutive expression of your gene of interest from a CMV promoter located in the E1 region of the adenoviral genome A DsRed Express fluorescen
9. template for each 50 ul PCR reaction e Human Genomic DNA 5 ng 200 ng e cDNA 1 ng 200 ng e Plasmid DNA 10 pg 1 ng Consider the following guidelines when amplifying your gene of interest e For the Tet On 3G System or any CMV System in most cases the final amplified sequence will consist of a gene of interest from start to stop codon flanked by 15 bp of pAdenoX sequence e For the Universal Systems in most cases the amplified sequence will consist of an entire expression cassette containing a promoter gene or shRNA sequence and polyA signal flanked by 15 bp of pAdenoX sequence e It is also possible to construct an expression cassette in any Universal System using multiple fragment cloning in a single reaction see Appendix B for details www clontech com Clontech Laboratories Inc A Takara Bio Company Page 13 of 34 Adeno X Adenoviral System 3 User Manual B PCR Primer Design In Fusion technology allows you to join two or more fragments e g a vector and insert or multiple fragments as long as they share 15 bases of homology at each end Therefore the PCR primers used to amplify your gene or PT5177 1 061213 expression cassette must be designed in such a way that each end of the PCR product generated shares 15 bp of homology with one end of the linearized pAdenoX vector Figure 2 A specific example is given using the lacZ gene Sequence to be added to 5 end of forward primer Vector Sequence 5 GTAAC
10. 34322 687 595 3848 1445 4340 2466 pAdenoX PRLS ZsGreen1 10342 5613 15105 9703 14500 34313 687 595 1503 1445 2828 2466 pAdenoX PRLS DsRedExpress 3848 5613 10342 9694 15105 14500 PT5177 1 www clontech com 061213 Clontech Laboratories Inc A Takara Bio Company Page 33 of 34 Adeno X Adenoviral System 3 User Manual Contact Us Customer Service Ordering Technical Support tel 800 662 2566 toll free tel 800 662 2566 toll free fax 800 424 1350 toll free fax 800 424 1350 toll free web www clontech com web www clontech com e mail orders clontech com e mail tech clontech com Notice to Purchaser Clontech products are to be used for research purposes only They may not be used for any other purpose including but not limited to use in drugs in vitro diagnostic purposes therapeutics or in humans Clontech products may not be transferred to third parties resold modified for resale or used to manufacture commercial products or to provide a service to third parties without written approval of Clontech Laboratories Inc Your use of these products and technologies is subject to compliance with any applicable licensing requirements described on the product s web page at http www clontech com It is your responsibility to review understand and adhere to any restrictions imposed by such statements Clontech the Clontech logo Adeno X CalPhos CloneAmp GoStix In Fusion Stellar Terra and Tet O
11. A 4 ul Pacl Restriction Enzyme 10 units ul 2 ul Total Volume per rxn 40 ul Prepare 10X BSA by diluting a small aliquot of 100X BSA with sterile deionized water 1 10 P Each 40 ul digest yields enough DNA to transfect one 60 mm culture plate The transfection protocol is given in Section IX B To transfect larger cultures scale the digest proportionally Mix contents and spin the tube briefly in a microcentrifuge Incubate at 37 C for 2 hr Confirm that the Pac digestion is complete by analysis on a 1 agarose gel The plasmid portion of the recombinant pAdenoX vector will migrate at 3 kb while the adenoviral genome will not enter the gel but will remain at the top of the lane Add 60 ul 1X TE Buffer pH 8 0 and 100 ul phenol chloroform isoamyl alcohol 25 24 1 Vortex gently Spin the tube in a microcentrifuge at 14 000 rpm for 5 min at 4 C to separate phases Carefully transfer the top aqueous layer to a clean sterile 1 5 ml microcentrifuge tube Discard the interface and lower phase Add 400 ul 95 ethanol 25 ul 10 M NH4OAc or 1 10 volume 3 M NaOAc and 1 pl glycogen 20 mg ml Vortex gently Spin the tube in a microcentrifuge at 14 000 rpm and 4 C for 5 min Remove and discard the supernatant Wash the pellet with 300 ul 70 ethanol Spin in a microcentrifuge at 14 000 rpm for 2 min Carefully aspirate off the supernatant Air dry the pellet for 15 min at room temperature Dissolve the DN
12. A precipitate in 10 ul sterile 1X TE Buffer pH 8 0 Proceed with Section IX B or store at 20 C www clontech com Clontech Laboratories Inc A Takara Bio Company Page 19 of 34 Adeno X Adenoviral System 3 User Manual B Protocol Transfecting Adeno X 293 Cells with Pac I Digested Adeno X DNA PT5177 1 061213 1 Plate Adeno X 293 cells at a density of 1 2 x 10 cells per 60 mm culture plate approximately 100 cells mm 12 24 hr before transfection a For best results cells should be 50 70 confluent display a flat morphology and adhere well to the plate prior to transfection Be sure to include a transfection control i If you constructed a positive control vector i e pAdenoX LacZ which contains the Adeno X Control Fragment Section VILD seed sufficient plates to produce this virus as well It is designed as a cloning control but will express LacZ in the Tet On 3G and CMV Systems so LacZ expression can be assayed in these control vectors using any standard X Gal staining protocol e g see Ausubel et al 1995 H The transfection efficiency of any of the ZsGreenl or DsRed Express containing pAdenoX vectors can be monitored via fluorescence microscopy 2 Incubate the plate s at 37 C in a humidified atmosphere maintained at 5 CO 3 Transfect each 60 mm culture plate with 10 pl of Pacl digested Adeno X DNA Clontech recommends the calcium phosphate transfection method for transfecting large pla
13. Cloning Procedure for Adenoviral DNA teret teret tentent 13 A PCR Amplification ot nseit ies erro e Irt pe rope Rae ST dee Ug Le Du EI E M iR DR ER ORE RETE REEL E 13 B PCR Primer Design usan 14 C Protocol Spin Column Purification of PCR Fragments eee enne rennen enne nennen 14 D Protocol In Fusion Cloning of Purified PCR Fragments ananassa 15 VIII Transformation Screening amp Purification of Recombinant Adenoviral Constructs a 16 A Protocol Transformation Using Stellar Competent Cells u 16 B Protocol PCR Colony Screening of Clones Using the Terra PCR Kit 16 C Protocol Purifying Recombinant Adenoviral DNA Midi Scale eene 18 IX Producing Recombinant Adenovirus eese apanapaq nennen tente tenente aaa en erinnere 19 A Protocol Preparing Recombinant pAdenoX DNA for Transfection nennen 19 B Protocol Transfecting Adeno X 293 Cells with Pac I Digested Adeno X DNA see 20 C Protocol Amplifying Recombinant Adenovirus Preparing High Titer Stocks sees 22 D Protocol Evaluating Recombinant Virus Confirmation of Construct sess nennen 23 X Infecting Target Cells with Adenovirus amp Analyzing Gene Expression eese 23 A Protocol Intectmg
14. Clontech Laboratories Inc Adeno X Adenoviral system 3 User Manual PT5177 1 Cat Nos 631180 632264 632265 632266 632267 632268 amp 632269 Published 6 12 2013 Clontech Laboratories Inc A Takara Bio Company 1290 Terra Bella Avenue Mountain View CA 94043 USA U S Technical Support tech clontech com United States Canada Asia Pacific Europe Japan 800 662 2566 1 650 919 7300 33 0 1 3904 6880 81 0 77 543 6116 Adeno X Adenoviral System 3 User Manual Table of Contents Ll Introdtiction amp Protocol OV rVIew uu qa n a iere Drs a Saa eee neben ere eret ego ledge 3 IL List of C Ompotients iecit terree eee tha eei cepe bee pei ee Rae d c Ee e eT CE poe esc e Lue ec eoe epe epe puede a data aene 7 HI Additional Materials Requited iHe tie be erret HL ER n b EUH de sheet en ae 7 IV Satety amp Handling Of AdenovIruses oie tern rre Re est neta tege a po eee ee spunsedeasavcngeanuagaddhaoteceassasbes 9 V General Considerations Preparing Recombinant pAdenoX Adenoviral DNA eene 10 VIL Cell Culture Guidelines uuu E 11 A General Guidelines for Adeno X 293 Cells esee een rennen erstens nennen 11 B Protocol Maintaining Adeno X 293 Cells in Culture eee ceeceseceseeeeeeeseeeeneeeaeeeaeecaaecsaecaecsaeenseeeeesseeeneeesaes 12 C Protocol Preparing Frozen Cultures of Adeno X 293 Cells sees 13 VII In Fusion
15. Company Page 20 of 34 Adeno X Adenoviral System 3 User Manual PT5177 1 061213 10 Figure 5 Observing the cytopathic effect when culturing adenovirus Your post transfection or post amplification Sample Ks DT 0 5 20 min mEn Figure 6 The Adeno X GoStix protocol takes only 2 20 minutes One week later transfer the cells and medium to a sterile 15 ml conical centrifuge tube Do not use trypsin Infected cells that remain attached to the bottom or sides of the culture plate can be dislodged into the medium by gentle agitation Centrifuge the suspension at 1 500 x g for 5 min at room temperature Resuspend the pellet in 500 ul sterile PBS Lyse the cells with three consecutive freeze thaw cycles Freeze the cells in a dry ice ethanol bath thaw the cells by placing the tube in a 37 C water bath Do not allow the suspension to reach 37 C Vortex the cells each time after thawing After the third freeze thaw cycle briefly centrifuge to pellet debris Transfer the lysate to a clean sterile centrifuge tube and either store at 20 C or use immediately in Step 10 Infect a fresh 60 mm culture by adding 250 ul 50 of the cell lysate from Step 9 Add the lysate directly to the medium and incubate as normal CPE should be evident within one week NOTE If no CPE appears after one week the viral titer of the cell lysate from Step 9 may have been too low Amplify the titer by repeating Steps 5 10 www clontech
16. Dox ES Dox 180 000 4 160 000 140 000 120 000 100 0002 sn sOMop a s 80 000 60 000 4 Luciferase expression RLU 40 000 V OR 20 000 Multiplicity of infection M O 1 Figure 7 Induced luciferase expression in HeLa cells infected with increasing amounts of Adeno X Tet On 3G Luciferase virus HeLa cells were infected with varying M O Ls of pAdenoX Tet On 3G adenovirus that expresses luciferase After 4 hours the media was replaced with fresh media doxycycline 1ug ml Cells were harvested 72 hr later and assayed for luciferase activity Maximal expression increases with increasing M O I which also results in a slight increase in background expression PT5177 1 061213 www clontech com Clontech Laboratories Inc A Takara Bio Company Page 25 of 34 Adeno X Adenoviral System 3 User Manual XI References Aiello L Guilfoyle R Huebner K amp Weinmann R 1979 Adenovirus 5 DNA sequences transcribed in transformed human embryo kidney cells HEK Ad5 or 293 Virology 94 460 469 Ausubel F M Brent R Kingston R E Moore D D Seidman J G amp Struhl K Eds 1995 et seq Current Protocols in Molecular Biology John Wiley amp Sons Inc NY Becker T C Noel R J Coats W S Gomez Foix A M Alam T Gerard R D amp Newgard C B 1994 Use of recombinant adenovirus for metabolic engineering of mam
17. User Manual PT5177 1 061213 D Replication Incompetent Adenovirus Provides Added Safety amp Control To accommodate DNA inserts and to produce a replication incompetent adenoviral vector extensive portions of the Early Regions 1 E1 and 3 E3 of wild type adenovirus have been deleted from the Ad5 genome in our pAdenoX vectors enabling you to ligate up to 8 kb of foreign DNA into these vectors without adversely affecting the efficiency of viral particle formation see Table I in Section VII D for pAdenoX vector capacities Because the E1 elements have been eliminated an early passage Adeno X 293 cell line is required to propagate and titrate recombinant adenoviruses derived from Adeno X Viral DNA Graham et al 1977 Aiello et al 1979 Adeno X 293 cells stably express the Ad5 E1 genes that are essential for replication and transcription of Adeno X Viral DNA The Adeno X genome carries the remaining coding information necessary to produce fully functional viral particles The E3 region of the adenoviral genome is nonessential for adenovirus replication In addition to creating room for DNA inserts E1 region deletion restricts the cytopathic activity of the recombinant adenoviral particles produced by this system Graham ef al 1977 This valuable safety feature means that when you clone your expression cassette into Adeno X Viral DNA you produce an infectious but replication incompetent adenovirus which propagates only in those cell
18. adenovirus n rene nennen nennen 21 Figure 6 The Adeno X GoStix protocol takes only 2 20 Minutes eee ceeeceseceseeeseeeseeeeseeeaeesseecsaecsaeceaecsaeesseeeeeeeseeeeeeeees 21 Figure 7 Induced luciferase expression in HeLa cells infected with increasing amounts of Adeno X Tet On 3G Luciferase virus 25 Figure 8 pAdenoX Tet3G Linear Vector and pAdenoX CMV Linear Vector maps eese 30 Figure 9 pAdenoX DsRedExpress Linear Vector and pAdenoX ZsGreen1 Linear Vector maps 30 Figure 10 pAdenoX PRLS Linear Vector Imap u aaah rennen eren nest nesn tenete tenente tenerent nennen 31 Figure 11 pAdenoX PRLS DsRedExpress Linear Vector and pAdenoX PRLS ZsGreenl Linear Vector maps 31 Figure 12 Multiple fragment cloning in the Universal Red System sees 32 Table of Tables Table 1 Theoretical pAdenoX Vector Capacities essen nennen SEKE E eren eren nennen 15 Table 2 Expected Results of PCR Colony Screening Analysis essent ren eren 17 Table 3 Expected Fragment Sizes bp from an Nhel or XhoI digest of pAdenoX Vectors seen 33 l Introduction amp Protocol Overview A Summary Adeno X Adenoviral System 3 is the most advanced commercially available adenoviral gene delivery system providing by far the simplest fastest and most efficient method for constructing recombinant adenovi
19. atories Inc A Takara Bio Company Page 29 of 34 Adeno X Adenoviral System 3 User Manual Appendix A Adeno X Adenoviral Systems 3 Vector Information Screening primer In Fusion forward Cloning Site ITR Y A TRE3G SV40 polyA signals pUC AAN Screening primer ori reverse Amp xb Xhol 35252 05640 Xhol 3220 Xhol 32289 5686 Xhol pAdenoX Tet3G UP Xhol Nhel 27847 36043 bp 7726 Nhel 8239 SV40 polyA signals Tet On 3G Transactivator Screening primer In Fusion forward Cloning Site SV40 polyA signals Screening primer reverse Pacl Xhol bel piel 33204 23592 33214 Xhol Xhol 30241 5686 pAdenoX CMV 5 Xhol 25799 34209 bp 7726 Nhel 8239 P Nhel ee 23116 Nhel 22429 En Q226 Nhel 18581 18581 Figure 8 pAdenoX Tet3G Linear Vector and pAdenoX CMV Linear Vector maps Screening primer n Fusion Screening primer n Fusion forward Cloning Site forward Cloning Site m A uN cwvit SV40 polyA signals CMV IE SV40 polyA signals DU AM M lt N Screening primer n Wi Screening primer reverse reverse ITR 34852 Xhol ITR 2 22 22 T Xhol 3220 3220 Pac 31920 Xhol Xhol 31889 5686 31898 5686 AdenoX Xhol Xhol p 7131 pAdenoX ZsGreen
20. cubate overnight and purify as in Section VIII C Restriction enzymes do not cut DNA prepared from large scale liquid culture Inhibition of enzyme activity by contaminants derived from the bacterial culture Remove all traces of culture medium from the bacterial pellet before beginning the NucleoBond purification protocol PT5177 1 061213 www clontech com Clontech Laboratories Inc A Takara Bio Company Page 28 of 34 Adeno X Adenoviral System 3 User Manual B Producing Recombinant Adenovirus Description of Problem Possible Explanation Solution No viral particles were produced Poor transfection efficiency Check the transfection efficiency using a suitable control plasmid We normally observe transfection efficiencies in the range of 20 30 when we transfect a 60 mm plate with 5 ug of pAdenoX plasmid DNA The Adeno X 293 cell culture used for transfection may be too dense e Adjust seeding density of cells to optimize confluency at time of transfection e Check for abnormal growth characteristics and morphology e Start a fresh culture of low passage cells e g p 50 For best results the Adeno X 293 cells used in transfections should be at low passage and approximately 50 7096 confluent at the time of transfection Too little or too much pAdenoX DNA used Titrate the amount of Pac I digested Adeno X recombinant DNA needed to achieve maximal transfectio
21. d by R L Freshney 2005 Wiley Liss e Current Protocols in Molecular Biology ed by F M Ausubel et al 1995 et seq John Wiley amp Sons Inc Growing Cells e Adeno X 293 cells should be grown in a monolayer preferably in plastic tissue culture dishes or flasks Under optimum growth conditions 37 C 5 CO2 293 cells double about every 36 hr e To maintain consistency do not passage cells indefinitely For best results we recommend you use slower growing early passage Adeno X 293 cells for transfection and titration procedures www clontech com Clontech Laboratories Inc A Takara Bio Company Page 11 of 34 Adeno X Adenoviral System 3 User Manual PT5177 1 061213 3 Preventing Contamination To prevent contamination work with media and uninfected cells in a vertical laminar flow hood using sterile technique Keep this hood free of virus to prevent accidental infection of the stock cultures ideally use another hood for all virus work All virus contaminated materials including fluids must be autoclaved or disinfected with 10 bleach or a chemical disinfectant before disposal B Protocol Maintaining Adeno X 293 Cells in Culture 1 To thaw Adeno X 293 cells place the vial of frozen cells in a 37 C water bath until just thawed Sterilize the outside of the vial with 70 EtOH For maximum viability upon plating remove DMSO as follows a b c d Add 1 ml complete medium prewarmed to 37 C Trans
22. down 3 From the 40 ul suspension do the following a Transfer 20 ul of the suspension into 5 ml of liquid LB Medium containing 100 pg ml ampicillin LB Amp Incubate at 37 C with shaking for 6 8 hr This will be used for later amplification of positive colonies b Analyze 5 ul of each clone by setting up a PCR Master Mix as follows Reagent Volume Reagent ul per sample Deionized H2O 7 Adeno X Screening Primer Mix 3 10 uM 0 5 Template bacterial culture 5 Terra PCR Direct Red Dye Premix 12 5 Total volume per rxn 25 4 Begin thermal cycling using the following parameters 1 cycle 98 C for 2 min 30 cycles 98 C for 10 sec 68 C for 3 min 1 cycle 68 C for 5 min www clontech com Clontech Laboratories Inc A Takara Bio Company Page 16 of 34 Adeno X Adenoviral System 3 User Manual 5 Analyze 5 ul of each PCR reaction on a 1 2 agarose gel e Expected band sizes for clones containing the Adeno X Control Fragment and for the parental vector alone non recombinant are shown for all of the available pAdenoX vectors in Table 2 e The expected band size for successful cloning of your gene of interest will be the size of your gene sequence added to the expected size of the non recombinant band shown in Table 2 e g for a 3 kb fragment cloned into pAdenoX ZsGreenl the expected size of the recombinant will be 4 9 kb 3 kb 1 9 kb e Figure 3 shows the screening results for clones obtained when the Adeno X Control Fra
23. e infection The seeding density will depend on the growth characteristics of your cell line NOTE Always use filtered pipette tips when handling viruses and cells Positive control infection If you constructed a lacZ adenoviral control be sure to seed enough plates to allow for this infection The next day remove the growth medium and add 1 0 ml of virus diluted to achieve the desired M O I to the center of each plate Tip the plates to spread the virus evenly Cover the plates and incubate the cells in a humidified CO 596 incubator at 37 C for 4 hours to allow the virus to infect the cells Add fresh complete growth medium with or without 10 1 000 ng ml doxycycline Incubate in a humidified CO incubator at 37 C NOTES 1 Doxycycline must be added to the medium at least every 48 hr to regulate gene expression 2 For most experiments 100 ng ml of Dox will induce high levels of expression You can determine empirically which is the minimal amount required for maximal induced expression 3 Asa general rule very high M O I s will yield higher maximal expression in the presence of Dox Figure 7 but also higher background expression in the absence of Dox For the tightest control we recommend that you test a range of M O I s for each new cell line that you use Analyze gene expression at different time points following viral infection In general Dox induced expression peaks 24 48 hr after infection 200 000 No
24. evaluate the phenotype of an infected cell line e To infect some lymphoid cell lines you may need to use higher M O I s e g 1 000 ifu cell To infect the maximum number of cells use the smallest volume needed to cover the cells PT5177 1 www clontech com 061213 Clontech Laboratories Inc A Takara Bio Company Page 23 of 34 Adeno X Adenoviral System 3 User Manual Infect your target cells as follows B C 1 Plate target cells on 6 well plates 12 24 hr before infection The seeding density will depend on the growth characteristics of your cell line NOTE Always use filtered pipette tips when handling viruses and cells Positive control infection If you constructed a lacZ adenoviral control be sure to seed enough plates to allow for this infection The next day remove the growth medium and add 1 0 ml of virus diluted to achieve the desired M O I to the center of each plate Tip the plates to spread the virus evenly Cover the plates and incubate the cells in a humidified CO 596 incubator at 37 C for 4 hours to allow the virus to infect the cells Add fresh complete growth medium Incubate in a humidified CO incubator at the temperature appropriate for your cell line Analyze gene expression at different time points following viral infection In general detectable levels of your gene product should be evident 24 48 hr after infection Analyzing Beta Galactosidase Expression in Infected Cells The expres
25. fer mixture to a 15 ml tube Add 5 ml complete medium and mix gently Repeat The final volume should be 12 ml Centrifuge at 125 x g for 10 min Remove supernatant Gently resuspend cells in 10 ml complete medium DMEM supplemented with 100 units ml penicillin G sodium 100 ug ml streptomycin 4 mM L glutamine and 10 fetal bovine serum Transfer cells in 10 ml of growth medium to a 100 mm culture plate Cells should be split every 2 4 days when they reach 80 90 confluency Do not seed cells too sparsely or allow them to become over confluent Split the cells as follows a b Remove the medium and wash the cells once with sterile PBS containing no Ca or Mg Add 1 2 ml of trypsin EDTA solution and treat for 1 3 min just long enough to detach cells do not expose cells to trypsin for extended periods Then add 5 10 ml of complete growth medium to stop trypsinization and resuspend the cells gently but thoroughly Transfer the desired number of cells to a 100 mm plate containing 10 ml of medium Gently rock the plate to distribute cells www clontech com Clontech Laboratories Inc A Takara Bio Company Page 12 of 34 Adeno X Adenoviral System 3 User Manual Vil PT5177 1 061213 C Protocol Preparing Frozen Cultures of Adeno X 293 Cells We recommend you prepare frozen aliquots of early passage Adeno X 293 cells to ensure a renewable source of cells 1 Expand the cell line in the desired number of flas
26. ge numbers of background colonies containing no cloned insert Contamination of the In Fusion reaction by a plasmid with the same antibiotic resistance as the pAdenoxX cloning vector If your insert was amplified from a plasmid closed circular DNA may have been carried through purification and contaminated the cloning reaction 8 To ensure the removal of any plasmid contamination we recommend linearizing the template DNA before performing PCR b If you spin column purify your insert treating the PCR product with Dpnl before purification will help to remove contaminating template DNA Plates were too old or contained the incorrect antibiotic Make sure that your antibiotic plates are fresh 1 month old Confirm that the antibiotic is compatible with the pAdenoX vector 3 Clones Contained the Incorrect Insert Description of Problem Possible Explanation Solution Large number of colonies contained the incorrect insert Your PCR product contained nonspecific sequences If your PCR product is not a single distinct band then it may be necessary to gel purify the PCR product to ensure cloning of the correct insert Restriction analysis of DNA prepared from large scale culture reveals more bands than expected DNA contamination Retransform a fresh aliquot of competent E coli Inoculate a 5 ml culture incubate 6 8 hr then immediately transfer 2 3 ml to 100 ml of fresh LB Amp In
27. gment was inserted into the pAdenoX PRLS DsRed Express vector Table 2 Expected Results of PCR Colony Screening Analysis Expected Band Sizes When Cloning the Adeno X Control Fragment 3 0 kb Vector Recombinant Non recombinant pAdenoX Tet3G 4 7 kb 1 7 kb pAdenoX CMV 4 9 kb 1 9 kb pAdenoX DsRed Express 4 9 kb 1 9 kb pAdenoX ZsGreen1 4 9 kb 1 9 kb pAdenoX PRLS 3 4 kb 0 4 kb pAdenoX PRLS DsRed Express 3 4 kb 0 4 kb pAdenoX PRLS ZsGreen1 3 4 kb 0 4 kb M 1 kb 1 35 1 07 0 87 0 60 0 31 2 3 4 b 6 7 8 9 10 11 12 amp Recombinant lt Parental Figure 3 PCR screening of clones using Adeno X Screening Primer Mix 3 The Adeno X Control Fragment was cloned into the pAdenoX PRLS DsRedExpress vector as described in Section VILD and 12 randomly chosen colonies were subjected to PCR using the Adeno X PCR Screening Primer Mix 3 Then 5 ul of each sample was analyzed on a 1 2 agarose gel Expected sizes for positive clones and the parental vector were 3 4 and 0 4 kb respectively In this example 9296 11 12 of the clones were positive for the control insert M DNA size marker Phi X174 HaellI Lambda HindIII PT5177 1 061213 www clontech com Clontech Laboratories Inc A Takara Bio Company Page 17 of 34 Adeno X Adenoviral System 3 User Manual C Protocol Purifying Recombinant Adenoviral DNA Midi Scale 1 PT5177 1 061213 After you ide
28. he Adeno X Rapid Titer Kit see Section IX B Step 12 Expected titer 10 10 ifu ml For quicker qualitative titer determination use Adeno X GoStix To produce a greater quantity of high titer adenovirus use the cell lysate from the first amplification to infect larger cultures e g a series of T175 flasks www clontech com Clontech Laboratories Inc A Takara Bio Company Page 22 of 34 Adeno X Adenoviral System 3 User Manual 11 Depending on how you intend to use your recombinant adenovirus you may wish to refine your High Titer Stock by purification e Use the Adeno X Virus Purification Kit Cat Nos 631532 631533 amp 631032 With this kit adenovirus can be purified in less than 2 hours and no ultracentrifugation steps are necessary The purity is comparable to that achieved with CsCl centrifugation Download the User Manual PT3680 1 at www clontech com manuals to learn more about this product e Alternatively purify the viral particles on a CsCl gradient Please consult the following references for protocols on how to purify adenovirus using CsCl gradient centrifugation Hitt et al 1998 Hitt et al 1995 Graham amp Prevec 1991 Spector amp Samaniego 1995 and Becker et al 1994 D Protocol Evaluating Recombinant Virus Confirmation of Construct A number of different methods can be used to verify that the encapsidated adenoviral genome contains a functional copy of your gene e The preferred methods de
29. ilize a chromatography based approach that provides a rapid scalable and high yield alternative to CsCl based methods Cat No Product 631532 Adeno X Maxi Purification Kit 2 preps 631533 Adeno X Maxi Purification Kit 6 preps 631032 Adeno X Mega Purification Kit 2 preps IV Safety amp Handling of Adenoviruses The protocols in this User Manual require the production handling and storage of infectious adenovirus It is imperative to fully understand the potential hazards of and necessary precautions for the laboratory use of adenoviruses The National Institute of Health and Center for Disease Control have designated adenoviruses as Level 2 biological agents This distinction requires the maintenance of a Biosafety Level 2 facility for work involving this virus and others like it The virus packaged by transfecting Adeno X 293 cells with the adenoviral based vectors described here are capable of infecting human cells These viral supernatants could depending on your gene insert contain potentially hazardous recombinant virus Similar vectors have been approved for human gene therapy trials attesting to their potential ability to express genes in vivo For these reasons due caution must be exercised in the production and handling of any recombinant adenovirus The user is strongly advised not to create adenoviruses capable of expressing known oncogenes For more information on Biosafety Level 2 see the following reference e Biosafety i
30. ks or plates 2 When the desired number of flasks plates have reached 80 confluence wash the cells once with sterile PBS containing no Ca or Mg trypsinize add 2 4 volumes complete medium to dilute the trypsin and harvest the cells 3 Count your cells using trypan blue exclusion or other method and collect by centrifugation 500 x g for 10 min 4 Resuspend in 4 C Cell Freezing Medium at 1 2 x 10 cells ml Dispense 1 ml aliquots into labeled cryovials and place in a cell freezing container reduces temperature 1 C min at 80 C overnight Alternatively place the vials on ice or at 220 C for 1 2 hours transfer to an insulated container foam ice chest and place container in a 80 C freezer for several hours to overnight 6 Transfer vials to liquid nitrogen Two or more weeks later confirm the viability of frozen stocks by starting a fresh culture as described in Section VIB In Fusion Cloning Procedure for Adenoviral DNA For more detailed information regarding In Fusion cloning please refer to the In Fusion HD Cloning Kit User Manual PT5162 1 available at www clontech com manuals A PCR Amplification of Insert For the best results we recommend using our CloneAmp HiFi Premix Cat No 639298 which offers high fidelity efficient amplification of long gene segments gt 1 kb and automatic hot start for increased specificity and reduced background 1 Use the following amounts of
31. l 7131 Nhel DsRedExpress Xhol Xhol 27447 7726 2 i 35866 b SV40 polyA signals E 35857 bp Niel SV40 polyA signals_ P P 2 E DsRed Express 25944 ZsGreenl 25944 Nhel Nhel Pom ie 23116 Nhel Pow te 23116 Nhel 22429 22429 _ Xhol _ Xhol 22226 Nhel 22226 Nhel 18581 18581 Figure 9 pAdenoX DsRedExpress Linear Vector and pAdenoX ZsGreenl Linear Vector maps PT5177 1 www clontech com 061213 Clontech Laboratories Inc A Takara Bio Company Page 30 of 34 Adeno X Adenoviral System 3 User Manual In Fusion Screening primer Cloning Site forwar ITR Y Screening primer reverse Pacl 32287 Xhol Sho 32297 2303 29355 Pacl Xhol 29324 4769 pAdenoX PRLS 24882 32665 bp Nhel Nhel 22199 Nhel 21512 Xhol 21309 Nhel 17664 Figure 10 pAdenoX PRLS Linear Vector map In Fusion Cloning Site In Fusion Screening primer Cloning Site Screening primer orwari d orwart ITR ITR W Screening primer I Screening primer N reverse reverse ac 30972 pAdenoX PRLS xhoi pAdenoX PRLS Nhel Nhel SV40 polyA signals 26530 DsRedExpress iat SV40 polyA signals 26539 ZsGreenl Xhol 6809 6809 DsRedExpress dish 34313 bp Niel ZsGreenl 34322 bp Nhel Ue i 1322 P omia 7322 Nhel 22199 ie J Nhel 21512 J 21512
32. lasmid containing an ampicillin resistance marker we recommend digesting your PCR product with DpnI to remove any contaminating DNA template prior to spin column purification C Protocol Spin Column Purification of PCR Fragments 1 Following PCR amplification verify your results by analyzing a small portion of your PCR reaction on an agarose gel Spin column purify the remainder of your PCR product by NucleoSpin Gel and PCR Clean Up supplied see Section II B During purification avoid nuclease contamination and exposure of the DNA to UV light for long periods of time NOTE Although spin column purification results in increased cloning efficiency you can gel purify your PCR product if nonspecific background bands are observed in your PCR reaction www clontech com Clontech Laboratories Inc A Takara Bio Company Page 14 of 34 Adeno X Adenoviral System 3 User Manual 3 After purification proceed with the protocol for In Fusion Cloning of Spin Column Purified PCR Fragments Section VILD D Protocol In Fusion Cloning of Purified PCR Fragments When using this procedure the following amounts of spin column purified insert and vector are recommended for optimum cloning efficiency e If the PCR fragment is shorter than 0 5 kb maximum cloning efficiency may be achieved by using less than 50 ng of fragment e The Adeno X Control Fragment consists of a complete lacZ gene flanked by 15 bp of sequence homologous to the ends
33. malian cells Methods Cell Biol 43 161 189 Freshney R I 2005 Culture of Animal Cells A Manual of Basic Technique 5th Edition Wiley Liss Hoboken NJ Graham F L amp Prevec L 1991 Manipulation of Adenovirus Vectors Methods Mol Biol 7 109 128 Graham F L Smiley J Russel W C amp Nairn R 1977 Characterization of a human cell line transformed by DNA from human adenovirus type 5 J Gen Virol 36 59 72 Hitt M Bett A J Addison C L Prevec L amp Graham F L 1995 Techniques for human adenovirus vector construction and characterization Methods Mol Genetics 7 13 30 Hitt M Bett A J Addison C L Prevec L amp Graham F L 1998 Construction and propagation of human adenovirus vectors In Cell Biology A Laboratory Handbook Ed Celis J E Academic Press San Diego pp 500 512 Spector D J amp Samaniego L A 1995 Construction and isolation of recombinant adenoviruses with gene replacements Methods Mol Genet 7 31 44 Tamanoi F amp Stillman B W 1982 Function of adenovirus terminal protein in the initiation of DNA replication Proc Natl Acad Sci USA 79 2221 2225 PT5177 1 www clontech com 061213 Clontech Laboratories Inc A Takara Bio Company Page 26 of 34 Adeno X Adenoviral System 3 User Manual XII Troubleshooting A In Fusion Cloning 1 No or Few Colonies Obtained from Transformation Description of Problem Possible Expla
34. n Microbiological and Biomedical Laboratories BMBL 5th Edition December 2009 U S Department of Health and Human Services CDC NIH Available at http www cdc gov biosafety publications bmbl5 index htm PT5177 1 www clontech com 061213 Clontech Laboratories Inc A Takara Bio Company Page 9 of 34 Adeno X Adenoviral System 3 User Manual PT5177 1 061213 Biosafety Level 2 The following information is a brief description of Biosafety Level 2 It is neither detailed nor complete Details of the practices safety equipment and facilities that combine to produce a Biosafety Level 2 are available in the above publication If possible observe and learn the practices described below from someone who has experience working with adenoviruses A Practices e Perform work in a limited access area e Post biohazard warning signs e Minimize aerosols e Decontaminate potentially infectious wastes before disposal e Take precautions with sharps e g syringes blades B Safety Equipment e Biological safety cabinet preferably Class II i e a laminar flow hood with microfilter HEPA filter that prevents release of aerosols not a standard tissue culture hood e Protective laboratory coats face protection double gloves C Facilities e Autoclave for decontamination of waste e Unrecirculated exhaust air e Chemical disinfectants available for spills General Considerations Preparing Recombinant pAdenoX Adenoviral DNA When mai
35. n are trademarks of Clontech Laboratories Inc All other marks are the property of their respective owners Certain trademarks may not be registered in all jurisdictions Clontech is a Takara Bio Company 2013 Clontech Laboratories Inc This document has been reviewed and approved by the Clontech Quality Assurance Department PT5177 1 www clontech com 061213 Clontech Laboratories Inc A Takara Bio Company Page 34 of 34
36. n efficiency as a starting point we recommend using 2 5 ug of Adeno X linearized DNA for a 60 mm plate of Adeno X 293 cells 50 70 confluent High rate of cell death The protein encoded by your gene insert may be toxic to Adeno X 293 cells Try using the Adeno X Tet On 3G Expression System With this system you are able to modulate the expression of your gene C Infecting Target Cells with Adenovirus Description of Problem Possible Explanation Solution High rate of cell death The multiplicity of infection M O I may be too high Infect at a lower M O l Your gene insert may be toxic to host cells Try using the Adeno X Tet On 3G Expression System With this system you are able to modulate the expression of your gene The crude cell lysate was used for transduction Purify your adenoviral stock using our Adeno X Purification products Low expression of gene insert Low infection frequency of target cell population e Infect at higher M O I e hetiter adenovirus stock e Adjust seeding density of cells to optimize confluency at time of infection e Check for abnormal growth characteristics and morphology Establish fresh cultures if abnormalities are observed Target cells are not susceptible to infection by adenovirus Try using lentiviral or retroviral mediated gene delivery and expression PT5177 1 061213 www clontech com Clontech Labor
37. nation Solution Low transformation efficiency Transformed with too much In Fusion reaction Do not add more than 5 ul of the In Fusion reaction to 50 ul of competent cells Competent cells are sensitive to the In Fusion enzyme We recommend using Stellar chemically competent cells with the pAdenoX vectors Bacteria were not competent Check transformation efficiency You should obtain gt 1 x 10 cfu ug otherwise use fresh competent cells Use an alternate strain of E coli We recommend Stellar chemically competent cells Wrong antibiotic Plate on LB agar containing 100 ug ml of ampicillin Low quality DNA fragments Low DNA concentration in reaction The amount of PCR fragment used was too low Gel purification introduced contaminants The total volume of purified vector and insert should not exceed 5 ul When possible optimize your PCR amplification reactions such that you generate pure PCR products Primer sequences are incorrect Check primer sequences to ensure that they provide 15 bases of homology with the region flanking the insertion site as in Section VII B PT5177 1 061213 www clontech com Clontech Laboratories Inc A Takara Bio Company Page 27 of 34 Adeno X Adenoviral System 3 User Manual A In Fusion Cloning continued 2 Large Numbers of Colonies Contained No Insert Description of Problem Possible Explanation Solution Lar
38. nt Adenoviral Constructs A l 2 3 4 5 6 7 8 9 PT5177 1 061213 Protocol Transformation Using Stellar Competent Cells Add 1 5 ul of the In Fusion reaction mixture to 1 tube of Stellar cells 100 pl Incubate on ice for 30 min Heat shock for 45 sec at 42 C Incubate on ice for 2 min Add 900 ul SOC Medium and shake at 250 rpm at 37 C for 1 hr Spread 100 ul 10 of each transformation onto LB agar plates containing 100 ug ml ampicillin Centrifuge the remainder of each transformation reaction at 6 000 rpm for 5 min Discard the supernatant and resuspend each pellet in 100 ul of fresh SOC medium Spread each sample on a separate LB ampicillin plate Incubate all of the plates overnight at 37 C Pick individual well separated colonies from the plates for screening in Section VIILB NOTE On rare occasions after transformation and plating a mixture of small and large colonies may be observed In this case pick the smallest colonies for screening for the recombinant adenoviral vector Protocol PCR Colony Screening of Clones Using the Terra PCR Kit Use the following method to screen your clones for the presence of an insert using the Adeno X Screening Primer Mix 3 1 Using a sterile toothpick or pipette tip transfer a single randomly chosen colony into 40 ul of deionized H20 We typically screen about 5 8 colonies 2 Resuspend the colony by gently vortexing or pipetting up and
39. ntained in bacterial culture for long periods adenoviral plasmid DNA can become resistant to restriction digestion or produce smaller derivatives that eventually outgrow the original construct To avoid such aberrations always follow these guidelines A Use Stellar Competent Cells e Adeno X Adenoviral System 3 has only been validated for use with competent Stellar E coli cells We cannot guarantee cloning performance or plasmid stability when this system is used with other competent cells B Start with Fresh Cell Cultures e Start with freshly transformed cells Do not store frozen glycerol stocks of E coli cells containing adenoviral DNA e Always use fresh log phase cultures as your source of recombinant pAdenoX plasmid DNA e Do not store a culture at room temperature 4 C or on ice for long periods i e gt 24 hr before starting a purification or inoculating a second culture www clontech com Clontech Laboratories Inc A Takara Bio Company Page 10 of 34 Adeno X Adenoviral System 3 User Manual Vi PT5177 1 061213 C Minimize Culture Time e After plating transformants on LB Amp plates pick the resulting colonies as soon as possible i e within 24 hours Without delay amplify the clones in 5 ml of LB Amp liquid broth e Meanwhile perform PCR analysis If PCR confirms the presence of a recombinant pAdenoX construct transfer a portion of the corresponding 5 ml log phase culture to 100 ml of fresh LB Am
40. ntify a positive clone by PCR amplify the clone by inoculating 100 ml of liquid LB Amp Medium 100 ug ml ampicillin with 2 5 ml of fresh log phase culture e g the culture you set up in Section VIILB according to the guidelines specified in Sections V A amp V B Purify the plasmid using the NucleoBond Xtra Plasmid Midi Kit User Manual PT4011 1 available at www clontech com manuals e The expected yield is 30 50 ug plasmid DNA 100 ml of culture Restriction Analysis When you finish the NucleoBond Xtra Midi purification reconfirm the identity of your recombinant Adeno X plasmid via individual digestions with XhoI and Nhel See Appendix C for estimated sizes a For best resolution Digest 1 ug of adenoviral DNA for 3 hrs and then load half of the digest on a 15 x 5 em 0 8 1 agarose gel Run the gel at 30 V overnight b Typical results are shown in Figure 4 See Appendix A for plasmid maps and restriction sites M 1 2 kb Figure 4 Restriction analysis of pAdenoX DNA To demonstrate correct restriction digestion and band intensity of the adenoviral DNA pAdenoXPRLS DsRedExpress was digested with the indicated restriction enzymes according to the protocol and then subsequently analyzed on a 1 2 agarose gel Lane 1 XhoI Lane 2 Nhel Lane M DNA size marker Phi X174HaellI Lambda HindIII Sequence Analysis In addition to reconfirming the identity of your construct by restriction digest you may use these primers for se
41. o Company Page 7 of 34 Adeno X Adenoviral System 3 User Manual B PT5177 1 061213 PCR e CloneAmp M HiFi PCR Premix Cat No 639298 for In Fusion Cloning e Terra PCR Direct Red Dye Premix Cat No 639286 Mammalian Cell Culture Supplies e Adeno X 293 Cell Line Cat No 632271 Used to package and propagate the recombinant adenoviral based vectors produced with the Adeno X Expression System The Adeno X 293 Cell Line may be grown in DMEM Supplement the medium with 100 units ml penicillin G sodium 100 ug ml streptomycin 4 mM L glutamine and 10 fetal bovine serum e Dulbecco s Modified Eagle s Medium DMEM e Solution of 10 000 units ml penicillin G sodium and 10 000 ug ml streptomycin sulfate e Fetal Bovine Serum e Trypsin EDTA Phosphate Buffered Saline PBS without Ca and Mg e Cell Freezing Medium with or without DMSO Sigma Cat Nos C6164 or C6039 e Tissue culture plates and flasks e g 60 mm plates 6 well plates T75 amp T175 flasks e Trypan Blue Dye 0 4 e Doxycycline Cat No 631311 Transfection of pAdenoX DNA into Adeno X 293 Cells Clontech recommends using the calcium phosphate transfection method for transfecting large plasmids into Adeno X 293 cells e CalPhos Mammalian Transfection Kit Cat No 631312 Tet On 3G Inducible Expression for use with Cat No 631180 e 5g Doxycycline Cat No 631311 Dilute to 1 mg ml in double distilled H5O Filter sterilize aliquot
42. o X Adenoviral System 3 CMV Red 632266 4 Adeno X Adenoviral System 3 Universal 632265 Adeno X Adenoviral System 3 Universal Red 632267 Adeno X Adenoviral System 3 CMV Green 632264 Adeno X Adenoviral System 3 Universal Green B General System Components All systems listed in Section ILA contain the following 7 components 10 ul Linearized pAdenoX Vector DNA 200 ng ul 50 ul Adeno X Screening Primer Mix 3 10 uM 20 ul Adeno X Control Fragment 50 ng ul 10 rxns In Fusion HD Cloning Kit 10 preps NucleoSpin Gel and PCR Clean Up Kit also sold separately as Cat No 740609 10 10 rxns Stellar Competent Cells also sold separately as Cat No 636763 10 preps NucleoBond Xtra Midi Kit also sold separately as Cat No 740410 10 Additional Materials Required The following materials are required but not supplied A pAdenoX DNA Manipulations Ampicillin Amp Prepare a 50 mg ml stock solution Store at 20 C LB liquid and agar media Glycogen 20 mg ml Agarose Sterile deionized H O 10 M saturated solution ammonium acetate NH4OAc or 3 M sodium acetate NaOAc pH 5 2 Sodium dodecyl sulfate SDS Restriction endonucleases PacI XhoI amp Nhel New England Biolabs 1X TE Buffer 10 mM Tris HCl pH 8 0 1 mM EDTA Phenol chloroform isoamyl alcohol 25 24 1 Equilibrate with 100 mM Tris HCl pH 8 0 Ethanol 100 and 70 www clontech com Clontech Laboratories Inc A Takara Bi
43. of pAdenoX It is designed as a cloning control but the gene will also be expressed in the Tet On 3G and CMV Systems so lacZ expression can be assayed in these systems e To determine the largest PCR fragment that can theoretically be cloned into your linearized pAdenoX vector without adversely affecting viral function see Table I Table 1 Theoretical pAdenoX Vector Capacities Cloning Vector Capacity pAdenoX Tet3G 4 6 kb pAdenoX CMV 6 4 kb pAdenoX DsRed Express 4 8 kb pAdenoX ZsGreen1 4 8 kb pAdenoX PRLS 8 0 kb pAdenoX PRLS DsRed Express 6 4 kb pAdenoX PRLS ZsGreen1 6 4 kb Perform the In Fusion reaction as follows 1 Set up the In Fusion reactions in 0 2 ml PCR tubes Add the reagents in the order shown below Reagent Volume ul per sample Reagent Cloning Reaction Control Reaction Deionized H2O 5 5 Linearized pAdenoX vector 200 ng l 1 1 PCR insert 50 ng ul 2 0 Adeno X Control Fragment 50 ng ul 0 2 5X In Fusion HD Enzyme Premix 2 2 Total volume per rxn 10 10 2 Incubate the reactions for 15 min at 50 C then place on ice 3 Proceed with the Transformation Procedure in Section VIII A You can store the cloning reactions at 20 C until you are ready PT5177 1 www clontech com 061213 Clontech Laboratories Inc A Takara Bio Company Page 15 of 34 Adeno X Adenoviral System 3 User Manual Vill Transformation Screening amp Purification of Recombina
44. p broth to further amplify the selected clone e When this culture reaches log phase purify the recombinant construct using the NucleoBond Midi Scale procedure as described in Section VIILC NucleoSpin Kits or other miniprep spin columns should not be used to purify pAdenoX DNA Purify Adenoviral DNA Using NucleoBond Xtra Midi We strongly recommend the use of NucleoBond Xtra for all pAdenoX DNA purifications NucleoBond Xtra is the highest performing gravity based plasmid purification kit and is ideal for purifying intact large plasmids such as pAdenoX e The purified plasmid is high quality and transfection grade e Large plasmids such as pAdenoX 34 38 kb are sheared on miniprep spin columns but Nucleobond Xtra can purify intact plasmids as large as 300 kb e A NucleoBond Xtra 10 prep kit is supplied with your system but additional kits are available from Clontech Cat No Product Name Size 740410 10 NucleoBond Xtra Midi 10 Preps 740410 50 NucleoBond Xtra Midi 50 Preps 740410 100 NucleoBond Xtra Midi 100 Preps Cell Culture Guidelines A General Guidelines for Adeno X 293 Cells 1 References We recommend our Adeno X 293 cell line a slower growing more adherent line used to package and propagate the recombinant adenovirus based vectors produced with the Adeno X Adenoviral Expression System 3 For more information on mammalian cell culture we recommend the following references e Culture of Animal Cells Fifth Edition e
45. quencing of the cloning junctions e For PTrezc and Pcmy containing vectors located 3 of cloning site 5 tgtcacaccacagaagtaaggttcc 3 e For Universal vectors located 5 of cloning site 5 tagtetgecggaagtgtgatgttgc 3 e We also recommend sequencing with insert specific primers for further confirmation www clontech com Clontech Laboratories Inc A Takara Bio Company Page 18 of 34 Adeno X Adenoviral System 3 User Manual Producing Recombinant Adenovirus IX PT5177 1 061213 A Protocol Preparing Recombinant pAdenoX DNA for Transfection Before pAdenoX DNA can be packaged the recombinant plasmid must be digested with PacI to expose the inverted terminal repeats ITRs located at either end of the adenoviral genome see Adeno X Adenoviral Systems 3 Vector Information in Appendix A and release the adenoviral genome from the plasmid backbone The ITRs contain the origins of adenoviral DNA replication and must be positioned at the termini of the linear Ad DNA molecule to support the formation of the replication complex Tamanoi amp Stillman 1982 It is essential to achieve a complete Pacl restriction digestion in order to ensure efficient rescue of a recombinant retrovirus 1 10 11 12 13 14 In a sterile 1 5 ml microcentrifuge tube combine the following reagents Reagent Volume Sterile deionized HO 20 ul Recombinant pAdenoX Plasmid DNA 500 ng ul 10 ul 10X Pacl Digestion Buffer 4 ul 10X BS
46. ral vectors Instead of traditional homologous recombination or direct ligation based methods our procedure uses the In Fusion HD Cloning System which enables directional cloning of any PCR fragment or multiple fragments directly into the linearized adenoviral vector in a single 15 minute reaction No shuttle vector or additional treatment of the PCR fragment is required such as restriction digestion phosphorylation or blunt end polishing This new method now allows you to introduce any cassette into an E1 E3 deleted replication incompetent human adenoviral vector in just three days and is no more complex than standard plasmid cloning with In Fusion HD B Constructing Recombinant Adenovirus with the Adeno X System 3 To produce recombinant adenoviral vectors using In Fusion technology the In Fusion enzyme links your PCR generated sequence of interest with the prelinearized pAdenoX vector DNA efficiently and precisely by recognizing a 15 bp overlap at their respective ends This 15 bp overlap is engineered into the primers used for amplification of the desired sequence When the In Fusion reaction is complete it is used to transform competent Stellar E coli cells recommended and recombinant clones are identified by PCR and or restriction enzyme digestions The PacI linearized recombinant adenoviral DNA is then used to transfect a low passage Adeno X 293 cell line in order to rescue recombinant adenovirus which is harvested several days
47. sion of beta galactosidase in adherent cells infected with Adeno X LacZ can be observed by staining with X Gal using our Beta Galactosidase Staining Kit Cat No 631780 To quantify beta galactosidase expression we recommend using our Luminescent Beta Galactosidase Reporter System 3 Cat No 631713 Protocol Inducible Expression using Tet On 3G The following is a typical procedure for use with the Tet On 3G Inducible Adeno X Adenoviral System 3 Cat No 631180 General Considerations PT5177 1 061213 We recommend infecting target cells at an M O I of 10 100 ifu cell It is important to test multiple M O I s to ensure that the highest fold induction is achieved The M O I needed to efficiently transmit your gene of interest to a particular host cell population depends on the biological properties of the target cell line and therefore must be determined empirically An excessively high M O I can be toxic to cells however an extremely low M O I may not enable you to accurately evaluate the phenotype of an infected cell line To infect some lymphoid cell lines you may need to use higher M O I s e g 1 000 ifu cell To infect the maximum number of cells use the smallest volume needed to cover the cells www clontech com Clontech Laboratories Inc A Takara Bio Company Page 24 of 34 Adeno X Adenoviral System 3 User Manual Procedure i li lii lv Plate target cells on 6 well plates 12 24 hr befor
48. smids into Adeno X 293 cells using the CalPhos Mammalian Transfection Kit Cat No 631312 with the following transfection mix Reagent Volume Pacl digested pAdeno X DNA 0 5 ug ul 10 ul Sterile HO 209 ul Calcium solution 31 ul 2X HBS 250 ul Total 500 ul See the CalPhos Mammalian Transfection Kit User Manual PT3025 1 available at www clontech com manuals for a more detailed protocol One day later and periodically thereafter check for the cytopathic effect CPE Figure 5 Alternatively Adeno X GoStix can help rapidly 2 20 min determine the presence of virus in media post transfection using only 20 50 ul of sample Figure 6 Signal can often be visualized before the outward appearance of CPE NOTES Infected cells typically remain intact but round up and may detach from the plate These changes are collectively referred to as the CPE see Figure 5 The time it takes for CPE to appear depends on the transfection efficiency it may take up to two weeks for CPE to become evident Because adenovirus remains associated with cells until late in the infection cycle high titer virus is obtained by manually lysing cells with a series of freeze thaw cycles as explained below in Steps 5 9 It is best to harvest cultures demonstrating a late CPE phenotype see Figure 5 Do not change the medium until CPE is observed and the cells are harvested www clontech com Clontech Laboratories Inc A Takara Bio
49. t protein expression cassette is inserted into the E3 region of the adenoviral backbone Easily monitor transduction and virus production 632267 Adeno X Adenoviral System 3 CMV Green Constitutive expression of your gene of interest from a CMV promoter located in the E1 region of the adenoviral genome A ZsGreen1 fluorescent protein expression cassette is inserted into the E3 region of the adenoviral backbone Easily monitor transduction and virus production 632266 Adeno X Adenoviral System 3 Universal Use any promoter gene and polyA sequence Ideal for tissue specific expression or expression of shRNA or miRNA 632265 Adeno X Adenoviral System 3 Universal Red Use any promoter gene and polyA sequence Ideal for tissue specific expression or expression of shRNA or miRNA A DsRed Express fluorescent protein expression cassette is inserted into the E3 region of the adenoviral backbone Easily monitor transduction and virus production 632264 Adeno X Adenoviral System 3 Universal Green Use any promoter gene and polyA sequence Ideal for tissue specific expression or expression of shRNA or miRNA A ZsGreen1 fluorescent protein expression cassette is inserted into the E3 region of the adenoviral backbone Easily monitor transduction and virus production www clontech com Clontech Laboratories Inc A Takara Bio Company Page 4 of 34 Adeno X Adenoviral System 3
50. tect synthesis of the target protein e g Western blotting ELISA or a biochemical assay that specifically measures the enzymatic activity of the expressed protein If an antibody is not available Southern blotting can be used to confirm the presence of your gene e Alternatively PCR e g using the Adeno X Screening Primer Mix 3 or your own gene specific primers is a quick and efficient way to evaluate your construct A small aliquot e g 1 ul of viral stock can be sampled and used directly for PCR The high temperatures associated with PCR denature the viral coat proteins and expose the DNA for hybridization with the primers X Infecting Target Cells with Adenovirus amp Analyzing Gene Expression A Protocol Infecting Target Cells Follow these guidelines to optimize the M O I when infecting your target cells NOTE MOI multiplicity of infection is defined as the number of infectious units IFU per cell at the time of infection based on the adenovirus titer IFU ml as determined by the Adeno X Rapid Titer Kit Cat No 632250 e Werecommend infecting target cells at an M O I of 10 100 ifu cell e The M O I needed to efficiently transmit your gene of interest to a particular host cell population depends on the biological properties of the target cell line and therefore must be determined empirically e Anexcessively high M O I can be toxic to cells however an extremely low M O I may not enable you to accurately
51. types e g Adeno X 293 cells that express the El encoded trans complementing factors For all other somatic cell types susceptible to adenoviral infection exposure to your recombinant adenovirus leads to a transient non cytopathic i e non lytic infection The adenoviral genome in infected cells is neither replicated nor actively transcribed since the cell lacks the necessary transcription factors the E1 gene products Although the Ad genes remain inactive your gene insert is still expressed at high levels because it is independently controlled by an exogenous promoter e g the cytomegalovirus immediate early promoter Pcmv ic Expression of your gene from the Adeno X genome is independent of target cell proliferation or the presence of any other viral genes or promoters www clontech com Clontech Laboratories Inc A Takara Bio Company Page 5 of 34 Adeno X Adenoviral System 3 User Manual Primer Your m gene 2 1 Amplify your gene with 15 bp of homology to pAdenoX l Primer al Pas T SV40 poly A 2 Clone using In Fusion technology and Stellar Competent Cells Tet On 3G Transactivator 3 Perform colony PCR to verify correct clone s 4 Purify pAdenoX GOI using NucleoBond Xtra 5 Digest with Xhol Nhel to verify integrity ITR F4 ITR Pacl Your gene Pacl Ho j 6 Digest with Pacl to linearize 7 Transfect Adeno X 293 cells 8 Confirm the presence of adenovirus with Adeno X GoStix
52. when Adeno X DNA recombines with E1 containing genomic DNA in Adeno X 293 cells For this reason we suggest you save aliquots of early amplifications Use early amplification stocks whenever you need to produce additional quantities of adenovirus 1 Sa Du s 10 About 24 hours before infection plate Adeno X 293 cells in a T75 flask The cell monolayer should be 50 70 confluent when you infect Incubate the cells overnight at 37 C in a humidified atmosphere maintained at 5 CO On the following day replace the medium with 5 ml of fresh growth medium that contains adenovirus For best results infect the cells at a multiplicity of infection M O I 75 i e at 25 ifu cell For example if the T75 flask contains 5 x 10 cells add 2 5 x 10 ifu adenovirus Incubate for 90 min at 37 C in a humidified atmosphere maintained at 5 COs Remove the flask and add 10 ml of fresh growth medium Incubate for 3 4 days at 37 C in a humidified atmosphere at 5 COs Check for a cytopathic effect When 50 of the cells have detached transfer the suspension to a sterile 15 ml conical centrifuge tube Do not use trypsin Infected cells that remain attached to the bottom or sides of the flask can be dislodged into the medium by gentle agitation Isolate virus using the freeze thaw method described in Section IX B Steps 5 9 At Step 7 of Section IX B resuspend the pellet in 0 5 1 ml of PBS Determine the adenoviral titer using t

Download Pdf Manuals

Related Search

Related Contents

Benutzerhandbuch  Triton 730 Triton 850 Triton 1000 Triton 1000 Plus  CableWholesale VGA  Samsung HMX-R10BN Manuel de l'utilisateur  Raptor Gaming K2  e FRANÇAIS - DAEWOO Electronics France  Elo Touch Solution 1229L  DW-14 User Manual  Manual de instalación - Banco de la República  CAHIER DES PRESCRIPTIONS SPECIALES  

Copyright © All rights reserved. Failed to retrieve file