Home

PRIMERGY MS610取扱説明書

image

Contents

1. BIOS NM og J og I RAS 1 1 UO 15 35 1 1 1 1 ut Od 111111 1 1110111111 RAS 11 1 1 1 BIOSOOOO0000000000 OO000 RAS 1111111111 1 1 RAS 00000000 0 1 6 7 5 11010 0 0 1 gt 244000000 BIOS 1 1 ut 1 0000000000000 2 POST 1 Press F2 to enter setup U Server Boot Exit Item Specific Help System Time HH MM SS System Date MM DD YYYY Legacy Diskette A 1 44 1 25 MB 3 1 2 Lega
2. Fl Help fj Select Item Change Values F9 Setup Defaults Esc Exit gt Select Menu Enter Select Sub Menu F10 Save and Exit SSU a SSSIII Pol HDD A A e Hard Drive Enter Hard Drive SCSI AIC 7899 HDD OS PhoenixBIOS Setup Utility 1 AIC 7899 A 00 FUJITSU MAG3182MC 2 Other Bootable Device Fl Help fj Select Item Change Values F9 Setup Defaults Esc Exit lt gt Select Menu Enter Select Sub Menu F10 Save and Exit SCSI AIC 7899 HDD OS Boot Disk SCSI OS PhoenixBIOS Setup Utility 1 Other Bootable Device
3. 5 5 010 RAS 000000000000 67 449 uuunununununununununununununn ANE 1 OHOOOOOO ServerWizard CD E D 0000000 0 0 D UU U ServerWizard CD 1 D MS DOS 6 2 Startup Menu 1 ServerWizard 2 System Setup Utility SSU 3 SEL VIEWER 4 Basic BIOS Environment Support Tools 5 Basic DACCFG 6 SMM Utility Setup Test 7 RCI Utility 8 HDD firmware update 2 4 Basic BIOS Environment Support Tools 0 0 OOO Enter 0 0 uU mulu 3 D BIOS Environment Support Tools O0 0000000000000 4 130 N 0 0 00 A gt b Enter B X w bat Enter 4 000 8080000000000000000000000000
4. 00000 500000000000 50000000000000 00000 500000000000000 000000000000000 0000000000000 2 5000000000000 0000 8000000 40000000 000000000000000 00000000000 3 oo 5 000000000000000 000000000000000 000000040000000 000000 1 go scsigggg00 0 00000000000000000000000 SCSI ID utu 2 45600000 00 2000 30000 SCSHD HUU 3 45600000 55000000000000000 165 166 b 51 51 ao oOo oOo oOo ELTE oOo o ELE EVEI oOo 5 000000000000000 n ED TINH AN es iu 5 eS a 4 00000000000000000 M52000000000W gt Be00000000 3 ooo0000000000000000000000000000 1 00 oo oo SS oo aie EE oo oo ae oo oo oo oo oo oo oo oo Ex rj E oo oo oo oo oo
5. 1 000000000000000 2 0000000000000000000000000000000 0 3 0000000000000000000000000000000 4 0000000000 Rclgo0000 6 100 elo Timm ppm A cONFIGg 0 E 90 91 x 5 2 RA 5 os T 21 1 BE KH 196 197 5 98 LC r3 Pp m Moo m Oa O00 OF Ooo ag moO oOo L3 r4 ogo ug Bae Og noe 0p noe Ro ooo no ooo r poe Ro pERER 1 On s ono OD 0 22
6. Item Specific Help F9 Setup Defaults F10 Save and Exit 0000 LU LIU l PCI Configuration JD PME 0 L 1 1 JUD 0 PCI Disabled Enabled OU Delay on Option ROMs ggg ROM OOO Disabled 0 Enabled PCI Configuration PhoenixBIOS Setup Utility Change Values Enter Select Sub Menu Advanced PCI Configuration Embedded Video Controller gt Embedded Legacy SCSI Embedded Dual Ultral60 SCSI Embedded NIC Slot Slot Slot Slot S
7. Remap Memory Disabled Enabled 79 05 43 4 3 7 Security Security uu U H 1 1 UU PhoenixBIOS Setup Utility Security Server Boot Exit Item Specific Hel User Password is Clear P P Administrator Password is Clear Set User Password Enter Set Administrator Password Enter Password on boot Disabled Fixed disk boot sector Normal Secure Mode Timer 1 min Secure Mode Hot Key Secure Mode Boot Disabled Video Blanking Disabled Floppy Write Protect Disabled Fl Help Tl Select Item Change Values F9 Setup Defaults ESC Exit lt gt Select Menu Enter Select Sub Menu F10 Save and Exit User Password is
8. 5 4 3 3 0000 F1 Esc 00000 D 581111000 0 0 Enter lll F9 F10 OOOO p LE mm OOOO p cb mm OOOO p LE mm OOOO mm OOOO p LEE mm OOOO p Lb rr rc OOOO p LE mm OOOO p Lb mm OOOO p LE mm OOOO p Lb 56 O40 434 0 og II System Time System Date Legacy Diskette A Legacy Diskette B 10000000900008 80001 4 Primary IDE Master Primary IDE M
9. 195 58 IDD 00000 LO 0 0000 000 1 1 1 1 111 1 11111 01 11 1111110100 LI 111 111111 1 11 0 10 1 1 1 1 11111111 1 010 0 111111 111 1 5 6 59 D O00 Remote Cabinet Interface 0000000000000000 110 0010009008 81 11 110 1 101111 1 000000000000000 1 3 DO000000000000000000000000000000 4 p00000000000000 8 0 0 0 UD
10. gt 4 3 6 Advanced 0 LI 670 00 Integrated Peripheral Configuration 750000000 O gt 4 3 7 Security LE gt 800 D D 0 BL D 0 gt 4 3 9 Boot Jl 910 00 00 Boot Device Priority T 1 O 08200000000W gt 2820000000 E ooo CMOS RAMO 000 CMOSG 00 NVRAM 00000000 0000000000000000000000000 OOOO 000000000000000 0 438095111000000000000 53 5 432 oO L1 aBiosNOOOOOOOOOOOOOOOOOOOOOOOO 505 m
11. 5 0 0 6 0000800000 0000000000000000000 5 00000000000000000000 0 00 D 4 0000000000000000000000000000 1110188188181880080 08 1 0000 0520000000000 13800000000 3 eo 00000 OOO 0000000000000000000000000 01 5 6 U U 554 51110 100 0000 00010 000000000 56811 QO CD ROMI
12. PhoenixBIOS Setup Utility Server Boot Exit Item Specific Help F9 Setup Defaults F10 Save and Exit D Yes No No Disabled Disabled Change Values Setting items on this menu to incorrect values may ca se your system to malfunction y Integrated Peripheral Configuration Advanced Setup Warning gt PCI Configuration Advanced Chipset Control Reset Configuration Data Enable Sleep Button System Wakeup Feature Delay on Option ROMs Fl Help Tl Select Item ESC Exit lt gt Select Menu Enter Select p Sub Menu Reset Configuration Data Yes fL Yes BIOS 4 3 BIOS
13. oogRasSOOOOOOOOOOOOOOOOOOOOOOOO 11 1 0 00 RAS 000000000000 6 7RAS000000000 00O gt 2400000000000000 SCSID GP5 127 0 000000000000 LSCSII AN OO SCSI Select 0 0 000000 Host Adapter BIOS Con figuration Utility Reserves BIOS Space 70 0000 Dis abled scan bus OO OO D B ID J U OSCSIO 0 GP5 C1 000 m Scsi 000 SCSIQ 00000 L3 177 56 00000 00000 IDEJI DD 010 0 scs 0005000 z 5651 8 0 0 680 0 0000 N Wide SCSID O0
14. 95 O Send Start Unit SSS 00 OOU0 0 000000000000 0 uaa 4 000 00000000 0 sSSS EOOOOO 10000 1 100 0 I 1 10100 0 0 00 0 SCSIBIOS Enabled 1 11 101 00 11111111111111111110 5 1 1111111111101010101001001000100 00 0 O Enabled Write Back Cache SCSIGOOOOO0OGU000000000000000 Yes 110 O40 O BIOS Multiple LUN Support AIC 7899 000 00 0 Yes Include in BIOS Scan 0 O AIC 7880 5681 D
15. ORAS RAS 000000000000 6 7 RAS000000000 00 gt 24400000000000000 1 000000000000 000000 ServerWizard CD ugggggag 00000 000000000000000 B 2system Setup Utility 0 SSU T 116 4 1 000000 MS DOS 6 2 Startup Menu 1 ServerWizard 2 System Setup Utility SSU 3 SEL VIEWER 4 Basic BIOS Environment Support Tools 5 Basic DACCFG 6 SMM Utility Setup Test 7 RCI Utility 8 HDD firmware update 3 88 000000000000000 System Setup Utilitu File Preferences Help Topics Tasks N Available Tasks Task Description This item is a group Resources p dc MBA There is no description Boot Devices AE ls PHA Security SDR SDR Manager Preferences Color Mode Language Other Lam x 3e Sustem Setup Utility mSSUD OO 1 SSUDOOOOOOOO 900 00 00000 0 0000000000000000 2 0 000000000 00000000000 0880000000 45100000000000000 55 0 qnd 117
16. 2000 30000 868110 0000000000 D D 80810 D 00000 scsi 51 SCSI ID 2 45600000 3 45600000 111100 00 00 0 1 000 5 30 3 5 U IDEAHOO GOOD scsid 0005000 5650 00 0 680 00000 Narrow SCSIQ OOO 5000 160 Wide SCSI 1 O00 680 D Ultra 160 Wide SCSIB chO O00 6800 IDE 000000 s M Wide SCSI 6800 1 1 0 O50 0UU 156 050 000 0000 A el N N Wide SCSI ood 6800 Narrow SCSIQ O00 500 D IDE Pas Od u chi gt cho C1 8089 0008000008 inuina 5 OooOOOOOOOGO Nooo 1000000000 OOOO 1 0 00000000000000 n 157 5 5 L3 158 O50 00
17. OOOO OOOOOOO00000000000000 ISDN OO 0 00 8 0 010 000 0 00000 0 LAN 5 6 9 FAX D DDD 0 000000000000000 562 0 0 0 00000000 0 gt 171 10 0 0 0 000 0000 0000000000 OU oo OO FAXOOOOOG FMV FX533 Pclog 0 0 FAX 0 H 0 0 FMV EX533 I 0 0 0 OD ServerWizard CD FMV 53311111101010010100101 000 0 0 00 00000 ServerWizar CD DX Windows NT 4 0 Server 0 00 DXDRIVERSYDRIVERI0YDISKIYNTA4 Windows 2000 Server I 0 DXDRIVERSYDRIVERIOYDISKIYW2K 186 O50 187 56 B200000000000000 0
18. Fl Help Select Item Change Values F9 Setup Defaults Esc Exit gt Select Menu Enter Select Sub Menu F10 Save and Exit SCSI OS Other Bootable Device OS OS IER SCSI PCI HDD A zE Ax 43BIOSOOOOOOOOOOOOOOOO 93 Removable Devices Removable Devices Enter PhoenixBIOS Setup Utility Removable Devices Item Specific Help 1 Change Values F9 Setup Defaults Enter Select Sub Menu F10 Save and Exit
19. Select Menu Legacy Floppy Drives Help Tj Select Item Esc Exit F1 94 95 Item Specific Help F9 Setup Defaults F10 Save and Exit 4 3 10 Exit 1 Exit PhoenixBIOS Setup Utility Main Advanced Security Server Boot Exit Saving Changes Exit Discarding Changes Load Setup Defaults Load Custom Defaults Enter Save Custom Defaults Enter Discard Changes Save Changes Fl Help Select Item Change Values ESC Exit lt gt Select Menu Enter Select Sub Menu Exit Saving Changes CMOS BIOS Exit Discarding Changes BIOS
20. 9 0 00000 00000 5 35 SCA2 Single Connector Attachment2 5 3 0 0 3 GP5 HDH63 GP5BHDH63 36 4GB 10 000rpm 10 00 11 0 00000 8 9 1GB 10 000rpm 10 00 18 2GB 10 000rpm 1000 og 00000000000 1868 6 5 0 67 9GB GP5 HDH9A Ooo 0 0 553 1110 0 0 010 0000 159 GIENE J 3 EQ Em umn Bes oes Eo OOO Bee EX T GOGE E OOO D D
21. B 30 0000 00 B B DU X DI U ugggaggagaugaguagaagaggamaaguarearts2utalu PCID 000 A200300 GPs 144 6Ps5 145 0 010000 1000 OOOOO 0000000000000 00 GPSS622 GPSS633 GPS RIDC4 GPS 1 5 1 1110101 1 PCI IE 8 911000 0 1000 1 0 0 695 1230 00000 8 551 7899 RQO00000000 lU OOOO 990 00 7000000000 scsi 00 O0 8081 0 5 10 000000000080080 00000000000 00 O0 8081 0 0 Advanced Functions 0 0 0 258 1111010101010 0 1100010000 8 gt 2000000 D DU 176 O50 968 COCO GP5 144 GP5 146 J GPs 144 GP5 146 GP5 1480 00000000 ANE X uggagmugugaauusesinmug
22. 5 6 3 174 1 1110100010 0 000000 5 0 0 o00 r3 rr rnm nooo See oooo g0 EE o00 0 oooo oo0 0 oooo oooo ESTE FOF 1 Ez EZ CIECIE IE FEE E3 E3 EJ EE L3 L3 E3 C3 ES C3 E3 C3 gt oOo Ooo ETET Ooo CIELE 1 AGHA oOo oaan o L3 4 0000000000 10100000000000000 3 00000000000000 6 000000000000 00000000000000 UDDDDDDDDDDDDDD 000000000 00000000 7 00000000000000 10 000000 8 000000000000000 000000000000000000000000000 080
23. SCSI SCSI O Option ROM Scan ROM Enabled i ROM Disabled ROM 70 O Latency Timer PCI CI 0040h Default 0020h 0060h 0080h 00COh 00E0h O Embedded Dual Ultra 160 SCSI SCSI Ultra160 m Enter Embedded Dual Ultra 160 SCSI PhoenixBIOS Setup Utility Advanced Embedded Dual Ultra 160 SCSI Item Specific Help Embedded Dual Ultra 160 SCSI Enabled Option ROM Scan Enabled Latency Timer Default
24. OOOH 11 OOOO 11 OOOO 0 D 0 523 1 110 0 l OO 41 0 1 0000000000000 m0 522000000000000 gt 390000000 00000000 20000000000000000000000 000000000000000000000000000 OOOO 0 0000000000000000000000 0 5 142 pas 6 o ol 16960 7 pogo H ER BEER D000 1 T apaa 2 Di 1 1 7 1 m ls 5 200000000 OOOO s SS S 1 5 OS DODDOODODOOBOBRHOBEBOBDBOBHBOBUBBHEE DODODOOOO O gOB IOBHOBBHBUIBUHBOBOHO
25. Adaptec 210 7899 lt SCSISelect TM gt Utility vX XX AIC 7899 at Bus 01h Device 06h Channel A Would you like to configure the host adapter or run the SCSI Disk utilities Select the option and press Enter Press F5 to switch between color and monochrome modes Options Configure View Host Adapter Settings SCSI Disk Utilities Arrow keys to move cursor Enter to select option Esc to exit default T 5 11 1 11 01 0 1 0 D Enter Lu L 105 4 4 SCSI Select 4 4 4 Configure View Host Adapter Setting OOOO Configure View Host Adapter Setting 0O B BHB d DH 1 1 Configure View Host Adapter Setting 0000 eL 00000 Adaptec AIC 7899 lt SCSISelect TM gt Utility vX XX AIC 7899 at Bus 0lh Device 06h Channel A r Configuration SCSI Bus Interface Definitions Host Adapter SCSI ID SCSI Parity Checking Enabled Host Adapter
26. ODDOOBOOOOODGODOODOOOOOOODOOOO ODDOBDOBOOODGODOODOOOOOOODOOOO Di Di 71 au a m m 1 3 Ooooooooooooooooooooo Bo o o e ojolJoc 0000000000 nano o0 ooo uuo 0 0 poo ETTI Boos OOO B OES EI Ooo aaa ooo 2004 a SOO OOO AOS EJEXET SOOO 509 GODA EES eee 1301 gt BORG lt a pcnauguuuunuorumeuuuum ng oo a a fem at a gt 4 000
27. 45 LC Ooo D GP5 SM103 oo ou 5 610 8 11 1 1 20000000000000000000000g 0 og 2000000000 20000000000dg 20 00000000000 SA 02000000000 Lg 0000 O50 188 189 56 LO 00000000000 oo 3 3 5 53 3 3 ceu ag oooo oooo oooo oooo oooo oooo ooooo ooooo ooooo ooooo ooooo ooooo ooooo ooooo ooooo ooooo ooooo ooooo ooooo ooooo ooooo ooooo ooooo PCIO D GP5 SMB101 D 000000 8 1111110101010109100 0 D D D DD UUDUDDDUDDDDDUDDDDDDDDDUDUDDDDDDDDUDUUDUDUDSUD DUUDDDUDDDBDUDUDUDUDDDB
28. 000000000 MP configuration 5 11 EP PEF management 011 B DU 0 gt Service Partition 80011 000000 Sonico Partition 10000000000000000880 PERROOOO 0000000 00 8588 0 00 0 0000 00000 8550008009 e L3 mjog og System Management Console Redirection EMP configuration PEP PEF management Service Boot Service Partition Type System Event Logging Clear Event Log Assert NMI on PERR Assert NMI on SERR PRB 2 BSP Policy w Booth OOO D OO Boot time Diagnostic Screen Boot Device Priority Hard Drive Removable Devices 40 0 60 B Exit 1 D
29. 5 IRQ4 O Parallel port 00000000 N El UUUUUD uu uu Disabled OS Controlled OSOOOUU 1010 DD 111119 O Mode Parallel port Enabled 1 Hh 8 B 0 B D B B D D V UI E C D D HL HB BLU U B Ll ECP lH i i B d d uuu Bi directional uui EPP Output only 77 43805 Base I O address Parallel port EnabledQ 0 0 378700000000 8 Interrupt Parallel port Enabled 00 0000000000000000 RAO IRQ5 DMA channel Parallel port Mode EcPOOOOOOOOOOOOOOOOOOOGO 000 211110 0 DMA 1 Floppy disk controller Enabled 0000000
30. 7 70707 707 3 7 3 3 3 3 766 N LO C3 Ei noo Oooo EL ESTE ES nooo r JJ E 5 2 pj o 22000 nooo onooo 21 27 02772 d L3 aa 3 3 2 oa os es 2 11 1 1 14000 11 1 1 00 0 1 1 524 00 144 z D 90001 if K a E L3 kt a 2 1 pice ke emi A 5 oO FS i Ks Co 4 r3 hae r4 3 H ma E C3 EJEJEJEjEd oo ABT 22222 i oon a oo DOOCOOOOAOROO gung Foo Hoon oaoa L3 F3 aaa a E nmm oO 33 72 2 2222 2 2 2
31. 0 O00 VRM Voltage Regulator Module CPU D 1 2 CPUD CPUQO O03 O00 4 8181 Mismatch among Processors detected 00000 m 5611010000 FET Es BE oooo OU M52000000000 OU 3 0000 20000000 1 00000 2 00000 4 000000000000000000000 O50 00 150 CPU 3 L3 L3 C3 E E 88811 E El CJ
32. 80000 0000000800 1 000 00000 0000000000000000 88880800000000 OO Advanced 0 O O O Device Configuration 000 00000000D D DisasldOOOOOOOOOO OD 4 3 6 Advanced 0 0 00 gt 6700000000 5 0 ea 1 RoOOOOOOO r4 Du 00 LAN WAN LAN 1 oO 0000 509000 LAN GP5 181 0 0 GP5 183 LAND 0 GP5 185 LAND 0 GP5 186 LAN 0 GP5 187 VX GP5 163 ISDN O GP5 165 FAXO OO 0 0 FMV FX533 GP5 SMB101 56 BD scsin 000 0 0 00 scsin nn n PCI A B Bus PCI Hot Plug 0 0 0 0 0 0 80810 0 0 GP5 123 86810 0 0 GP5 127 86810 0 00 000 0 0 0 GP5 144 86810 0 00 00
33. Legacy Diskette A Legacy Diskette B Primary IDE Master Primary IDE Slave gt Processor Settings 14 Select Item lt gt Select Menu 4 3 5 Main BIOS UJ Main OOOO Advanced System Time System Date Language Fl Help ESC Exit System Time oooo System Date 2000 62 4 Legacy Diskette A Disabled 144 1 25MB 3 1 2 2 88MB 3 1 2 Legacy Diskette 81 B Disabled 8 1 44 1 25MB 3 1 2 2
34. Discard Changes N cMoSOOOOOOOOO 100000 Exit Discarding Changes 1000000000000000080 Load Setup Defaults 1 0 0 0 O 100000000000000008000 Load Custom Defaults 8 Save Custom Defaults O00 1000000000000000000 osi Save Changes gut 4 3 BIOS 61 1 1 1 1 Main PhoenixBIOS Setup Utility Security Server Boot Exit Item Specific Help HH MM SS MM DD YYYY 1 44 1 25 MB 3 1 2 Disabled CD ROM None English US F9 Setup Defaults F10 Save and Exit Change Values Enter Select gt Sub Menu 1 1 1 1 20 LL 20 T 20009 J OU
35. lU 58 0 8000000000 000 HOU 5000000000000000000000 At 00 000000000000000 500000 mim mim uaa une na OO D DU GP5 DT301 Narrow 0 0 00000 NarrowSCS GP5 DT401 Wide 0 Wide 80810 0 0 0 0 0 0 Narrow SCSI 10000000 l WideSCSI D U Narrow 1000 WideSCSI SCS OO GP5 1279 GP5 PD237 Narrow 0 0 00000 NarowScSiIDOHOOOO000000 OO GP5 DL201 Narrow 0 00000 NarowSCS OO 2380 200000 GPS5 DL351 Wide O 00000 Wide 00 230 200000 00 14000 CRMTIJU UU GP5 SL501 Narrow 0 0 00000 NarrowSCS 000000 GP5 ML301 Wide Wide SCSID 0 000000 Narrow SCSI 10000000 U WideSCSIFOOOO0000 Narrow SCSIQOOOOOOOOOOO 1000 WideSCSI 000 SCSIQ GP5 1279 0 OO GP5 DTA101 Narrow O 00000 NarowscsiIQ OO 2380 200000 GP5 DTA102 Wide 0 O 00000 Wide OO 230 200000 E 0 5
36. DMA TT IRQ TI Memory IT Portsd 00000000 Resource use 1 0 0 J 0 System Resource Usage 0 0 DMA 000 N o0 g 4500000000000000 000 55 0 121 0000000000 JD System Resource KS 0000 s 0 Er cL o Q D lt 02 j 00 On PCI uu Bus00 6001 OO 568 00000 AIC 7880 30800 Dev02 C1 0 OOOO 32bit 33MHz Bus00 Dev03 PCI C2 0 U 32bit 33MHz Bus00 Dev04 OO NIC 825590 30800 DevOC OO Video E RAGE IIc oo vo gt oo Q Qo 1 0 eyed or 30800 DevOF OO USB H1 D 1 Bus01 Dev05 B Bus PCI Hot Plug 1 1 LJ Bus01 Dev06 00 SCSI 00000 AIC 7899 Bus01 Dev08 PCI B1 O00 64bit 33MHz Bus01 Dev09 PCI B2 0 O O 64bit 33MHZ Bus01 DevOA PCI B3 O O 0 64bit 33MHzZ Bus01 DevOB PCI B4 O 0 64bit 33MHz Bus07 Dev07 PCI A Bus PCI Hot Plug U Bus07 DevOD PCI A1
37. Format Disk 00000000000000000000000000 0000900 900 0000000000000000 10000900 900 000 00900000000000 10900000000000080080 0000900900000000000000000 0000900900800000900000000000 000000 e Verify Media D gpsesipupnuaupuuunnapnnnpa upnpuudpnauguagnadunp 00000 E E oon Aa L 44 SCSI Select 000000000 115 45 O OOOOOOOOOOOSSUOOOO 0 00000 0 0000 0000000000000 000 DMA O0 81 06 0900000000000000 0 0000000000000 UD CMOSRAMUDDDDDDD 451 55 11101 100 SSUDOOO00 0 ServerWizrd COO DDD DD DD DD 452 55 1 11 sugna ngngngngngunnnnunun 55000 POSTO U0 osuugugouagagagagdadgddu
38. Load Setup Defaults OEM Load Custom Defaults Save Custom Defaults 43BIOSHO00000 Discard Changes CMOSHUUUUUUU Save Changes CMOS 4 4 SCSI Select 000000000 t 1 1 1 1 0 50 11 uuu 5 SCSI 00 DD D AIC 7880 Ultra Wide Narrow T 00000 0 O00 lU 000 5 00000 Alc 78999 1600 0000000000 SCSI 896 11111110110011010100000 4 4 1 50 0 000000000000 N SCSI Select 9 J u auc u LU uu URA p HH Oo OO DU 000 SUD 0000 OOOO 0000
39. Uu uut Boot Device Options OO AIC 7880 Adaptec AIC 7880 lt SCSISelect TM gt Utility vX XX AIC 7880 at Bus 00h Device 01h Configuration SCSI Bus Interface Definitions Host Adapter SCSI ID Boot Device Configuration Select SCSI peripheral from which to boot To view peripheral by ID select SCSI Disk Utilities from previous menu Boot SCSI ID I Options Listed Below Has NO EFFECT if MULTI LUN Support is Disabled Boot LUN Number BIOS Information Interrupt IRQ Channel I O Port Address SCSI Termination Level Arrow keys to move cursor Enter to select option Esc to exit default AIC 7899 Adaptec AIC 7899 lt SCSISelect TM gt Utility vX XX AIC 7899 at Bus 01h Device 06h Channel A Configuration scx Bus Interface Definitions Host Adapter SCSI ID Boot Device Configuration Select SCSI peripheral from which to boot To view peripheral by 12 select SCSI Disk Utilities from previous menu Boot Channel Boot SCSI ID Interrupt IRQ Channel I O Port Address SCSI Termination Level Arrow keys to move cursor Enter to select option Esc to exit default 111 10
40. set clear Administrator Password is Administrator OO OO sel D D D B D clear D Set User Password 1 UB uui Enter Set User Password 0 O Enter New Password JUD O Confirm New Password Enter New Password 0 00 Set Administrative Password 1 11 1 5 D Enter 0 et User Password 000000 00000 O oong Enter New Password O Confirm New Password Enter New Password 0 4
41. 00 OO SCSIQ 0 Jl GP5 1279 SCS 0 0 00 GP5 832 0 GP5 833 SCSID 00 0 U B FMB CBL831 c VAY 5 ta 2 a 5 2 Z gt oten a i 2227 0 0 FMV 6920 FMV 6957 0568000008 lU 5 8 0 5 832 0 0 O GP5 8337 0000000000000 O000000 FMV 692 FMV 695 Wide SCSI 000 50511 1 D 000 5081 11 0 gg Wide 86810 0 0 680000000000000000 0000 pgg 183 56 565 LANOOOOOOOOO OOOO 1 6 0 0 O 1700000000000000 og oo 10BASE 5 2 T GP5 181 10BASE 5 2 T LAN LANG 0 0 0 1000BASE SX GP5 183 1000BASE SX J LANG 0 0 100BASE TX
42. 5 1110 1 11010000000000000000000000 55 1 11 00010009008 gt 455 175 56 564 36511 0 5 5 56 2000000 1700000000000000 0000000000 sestggdd 5 10000000000008 0o00 DB OO GP5 123 8681 5 GP5 127 U GP5 DL351 GP5 ML301 GP5 DT401 0 00 4 50 SCSIOOOOOOO00000 6 SCSIOOOOOOO00000 8 0 D 6 5 1231 00 200 GP5 1270 00 300000000 00000000 5 0 00 00 00 0 0 5 14 0 GP5 146 00 200 GP5 148000 30000 SscSIQDOO0O00000000 GP5 144 GP5 146 GP5 148 0 00000
43. O COMI 00000000 100000000 Base I O address I O 000000 Interrupt IRQI O D 000000 D 000 von Auto uu uu Disabled OS Controlled OSOOOOUU 0100 DD O Base I O address COMI Enabled 0 0 0000000000000000 10 von nn 8 8 8 O Interrupt coMi Enabled 1 QOD D 3 O COM2 00000000 Interrupt IRQI I D D Base 1 0 address I O 0000 vo Auto uuu uuu Disabled D OS Controlled OSOOOOUU O40 76 O Base I O address COM2 Enabled 0 0000000000000000 8 8 8 O Interrupt COM2 EnabledQ 20 IRQI
44. O00 000 000 000 Ea 1 EA EJ zl L3 E DU 3 oo00000000000000000000000000000 1 L3 Oo Oo r3 Oo r3 oO r3 oO oO ua OG Cy L3 n Oo oo oo fp oo Lu 01 1090000 0 0 5 000020 0 oo oo oF LE oo 5 42 of SB E O O Op Ear L r E oo N O ag 3 0 0 3 0 0 1 160 2 oo0000000000000000000 1 5 7 00000000000000 6 3500000000000000000000000 5 00000000000000000000000000 2 2 66 4 35000000000000000000000000000000 161
45. OOOOO Set User Administrator Password 00000000000 0 5 00000000000 1 000 00000 0000000000 00000 0000 2 2000000000000000000000000 3 3000000000000000000000000000000 OOO200000000 000000000 0000000000000 OOOU000000000 User Administrator Password Is Cierp 1 000000000000000000000000000000000000 00000000 000000000000000000000000000 ooo 0 Password Clear 230000000000 00000000000000 420000000000 gt 510000000 00000000 Password 0 1 200000000 0000000000000000000000 00000000006 40800000000000000 nun 83 43805 4 3 8 Server H PhoenixBIOS Setup Utility Main Advanced Security Server Boot Exit 1 ific Hel System Management ie Help y Console Redirection gt EMP configuration gt PEP PEF management S
46. 000 0000 0 SCSI BIOS Enabled O 0 D D 0000 0000 uU Butt AIC 7880 1 56518105 I D BU U DU B DI U D Hi L1 0 DU u AIC 7899 4 000000 05 1 AIC 7899 0 0 0 1 D u D D D D Do C 0000 0 808110 00 00000 00000 Advanced Configuration Options SCSI BIOS 1 LI LUI LU LI 1 1 1 Etter 0 Advanced Configuration Options J O O AIC 7880 Adaptec AIC 7880 lt SCSISelect TM gt Utility vX XX AIC 7880 at Bus 00h Device 01h Configuration SCSI Bus Interface Definitions Host Adapter SCSI ID Advanced Configuration Options Reset SCSI Bus at IC initialization Enabled Display Ctrl A Message During BIOS Initialization Enabled Extended BIOS Translation for DOS Drives lt 6 Enabled Verbose Silent Mode Verbose Options Listed Below Have NO EFFECT if the BIOS is Disabled Host Adapter BIOS Disabled Scan bus Support Removable Disks under BIOS as Fixed Disks BIOS Support for Bootable CD ROM BIOS Support for Intl3 Extensions S
47. 350000000000 154 lU SI 552 OOOOUO02000000000000000000000000000000 una CD ROM CRMT U 1 4000 350000000000 111 1 1 scsi ID 3sOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOO 0000000000000 30 2000 1000 2000000 C1 1 CD ROM 2 1D 4 5 6 3 6 1 CD ROM 2 ID 4 5 6 3 ID 4 5 6 8 5 5 155 1 1 OODD sese
48. 000000000 1 D D D u D e Secure Mode Hot Key 2000 0 9 Secure Mode Timer uggauggaugaggagagagggugaaguggauaauugeaululdedtl Disable 00000000 2 5 10 20 Minutes 2 Hours 45100000000000000 55 0 125 Secure Boot Mode Disable 00000000 Enable Video Blanking Disable 00000000 Enable Floppy Write Protect 00000000 Enable Reset Power Switch Locking Enable 00000000 O40 126 4 6 BIOS SCSI SSU 1 1 B H D 1 D 1 SCSI Select 1 BIOS Environment
49. EMP Configuration EMP Emergency Management Port OO 00 EMP configuration D Enter OOOO OOOO DEMP Configuration 87 43805 PhoenixBIOS Setup Utility Server EMP Configuration Item Specific Help EMP Password Switch Disabled EMP ESC Sequence EMP Hangup Line String ATH Modem Init String ATE1Q0V1X4 amp D0S0 High Modem Init String 0 EMP Access Mode Disabled EMP Restricted Mode Access Disabled EMP Direct connect Modem Mode Direct connect System Phone Number Fl Help Select Item Change Values F9 Setup Defaults ESC Exit lt gt Select Menu Enter Select Sub Menu F10 Save and Exit EMF Emergency Management Port O EMP Password Switch Disabled EMP Enabled EMP O EMP ESC Sequence 0 EMP ESC O EMP Hangup Line String EMP Hangup Line String Modem Init String OQ
50. 0 PEF Blackout Period 16 PEP Enable Platform Event Paging Disabled Platform Event Paging Enabled Platform Event Paging PEP Blackout Period 0 PEP Page String PEP Page String Send Test Page Page String Press Enter Send Test Page Now PEF Filter Events PhoenixBIOS Setup Utility Change Values Enter Select Sub Menu Server PEF Filter Events Disabled 14 Select Item lt gt Select Menu PEF Filter Events PEP PEF management Enter il PEF Enable Fl Help ESC Exit O PEF Enable Disabled Enabled 90 91 4 3 9
51. 4 5 3 At I 000 18 00 0 0 Alt FAQ 8511 0000 Enter D gnpnadpadicaeegn 454 Preferences DO E DJ 1 u au Preferences Preferences 0 000 I I I D D Color D D Preference QOOOOOOOOOOOOOOOOOSSUOOOO Ej El oO oo oO oO Q 9 o Preferences 0 0 00 Model 000000 Mode D User ModeQ
52. 41 1 j u dut CONTENTS 4 1 GEA OAT sis RITU a casa a 50 4 2 BE gt ee bate nad 51 4 3 BIOS O D m B D E RESPETAR 53 4 4 SCSI Select PEE 97 4 5 1 JOSSUIOOOD 116 4 6 BIOS SCSI SSU J J RD eter doce dede 127 O45000000000000000000ssugo00M 11600000 1 1 0 00 50 0 Spee Ef Lm 3 5 ao Fo ooooo 80pm ooooo Fo oooooonf fmn 0 2o 2 2 2 QOOOOO000M 97000000 1 5 8
53. A gt b Enter B gt r bat Enter 4 gn i OU OU O40 128 OOOOOOOOOOOOO YIOOOOOOOOOOOOOGO Uu OOOOOOOOO 129 OoOOOOOOOOOOOOO already existed Don t turn off the system Do you want to overwrite it y n LL D HL Oo Data file has BIOS OU Wait a moment SUCCESS 4 6 BIOS SCSI SSU BIOS Environment Support Tools BIOS LH B D U D U U LI U 11 1 H ServerWizard CDQ 700 MS DOS D D RASO AEE PosroooosOOOOO O
54. 5 66 ISDN QU 0 562 00000 OO og og ISDNOOO GP5 165 PCID 0 6 5 165 00000 cP5 1630 000000000000000 cP 6s0000000000000Psu0000000000000000 567 1 vx 00000000000000 00000000000000000000 00000000 562000000000000 gt 0000 000 0000000 Oo un od 00000 vx GP5 163 PCI 0000 000000000000000000 O 6 5 1630 0 0 80 0 6 5 6500000000000000000 00 00 0 0 88 000 000000000000000000 5 68 ISDN 63 64 0 OOOOOISDNOG 63 06 00000000000000000000000 00000000000000000000 5620000000000000 O 1700000000000000 0000000000 ISPNOO 0000000000000 uu utu uu 63 64 000 GP5 161 PCID D ISDN Q 4 lU Pa0000000000000000000000rRQ000000000 000000000000000000000000 185 56
55. SCSI select 0O O0O000000000000000000000 0 Utility 0000000000000000 Yes JI I J Enter U I UU D utu SCSI Select 1 1 11 1 1 2 Please press any key to reboot 1 11 111111 1 111 1 58 8 1111 1 1 1 0000 goooo e scsi SelectQ 0000000000000 56511 nno 1411010000 102 442 SCSI Seet 00 Configure View Host Adapter Setting D 5 SCSI Disk Utilities 000000 0000 Adaptec AIC 7880 lt SCSISelect TM gt Utility vX XX Adaptec AIC 7880 SCSISelect TM Utility vX XX AIC 7880 at Bus 00h Device 01h r Configuration Adaptec AIC 7880 SCSISelect TM Utility vX XX AIC 7880 at Bus 00h Device 01h N 1 Select 8081 Disk and Press SCSI ID 0 SCSI ID 1 SCSI ID 2 SCSI ID 3 SCSI ID 4 SCSI ID 5 SCSI ID 6 BIOS Informati
56. ASOOOOOOOO I gt 24400000 SCSI Seet 0 0000000000000 0 R 44 SCSI Select 000000000 97 SCSI 56161 00000000000 SCSI Select AIC 7880 1 0000000 Post O Press Ctrl for SCSISelect TM Utility 0 0 DL 00000 D D 0 DD D D UU SCSI Seet 0 Adaptec AIC 7880 lt SCSISelect TM gt Utility vX XX AIC 7880 at Bus 00h Device 01h Would you like to configure the host adapter or run the SCSI Disk utilities Select the option and press lt Enter gt Press lt F5 gt to switch between color and monochrome modes Options Configure View Host Adapter Settings SCSI Disk Utilities Arrow keys to move cursor lt Enter gt to select option lt Esc gt to exit default 2 0000000 Erte 00000000 000000000000000000 Adaptec 210 7880 SCSISelect TM Utility vX XX AIC 7880 at Bus 00h Device 01h m Configuration SCSI Bus Interface Definitions Host Adapter SCSI ID SCSI Parity Checking Enabled Host Adapter SCSI Termi Enabled Additional Options Boot Device Options Press Enter SCSI Device Configuration Press Enter Advanced Configuration Options Press Enter lt 6 gt Reset to Hos
57. Fl Help TY Select Item Change Values F9 Setup Defaults ESC Exit lt gt Select Menu Enter Select Sub Menu F10 Save and Exit O Embedded Dual Ultra 160 SCSI SCSI Ultral60 m Enabled SCSI Disabled SCSI 4 3 BIOS 71 O Option ROM Scan ROM Enabled ROM 1 0 0 Disabled QQ ROM Latency Timer PCI 0o Default 0020h 0040h 0060h 0080h 00COh 00E0h
58. 5 1111111100 1 CMOS RAM 0 0 4050 0 NVRAM BIOS Basic Input Output System 1 MBIOSOOOOOO0000000 U 10 0 U U 0 D SBIOSOOOOOOOO000000000 53000000 00 1 SCSI Select B LU D 4 1 42 12 1 x 20 1 11
59. Fl Help J Select Item Change Values F9 Setup Defaults ESC Exit lt gt Select Menu Enter Select Sub Menu F10 Save and Exit O Embedded Video Controller Video Enabled 0 O0 O Video Disabled Video 69 5 43 Embedded Legacy SCSI SCSI Ultra Wide Enter Embedded Legacy SCSI PhoenixBIOS Setup Utility Advanced Embedded Lagacy SCSI Item Specific Help Embedded Lagacy SCSI Enabled Option ROM Scan Enabled Latency Timer 0040h Fl Help J Select Item Change Values F9 Setup Defaults ESC Exit Select Menu Enter Select Sub Menu F10 Save and Exit Embedded Legacy SCSI SCSI Ultra Wide T H
60. 58 1411010000 Security 000 1 uu User Password is Administrator Password is Set User Password Set Administrative Password 100000000000000000 Password on boot Fixed disk boot sector Dpugagaggagugaggagagggggum Secure Mode Timer aH m Exc er 5 gt ect ye UU Secure Mode Hot Key 1 000000000000000000 Fa p 5 L3 Secure Mode Boot Video Blanking 1 00000000000000000 0 Floppy Write Protect 4 3 BIOS JU l 59 IODD 1 1 Server System Management 00000000 onsole Redirection E D
61. C1 EI cPuUDO00 0000000000PU00000000000 0000 00000000000000000 0000000 0900 amp DD 151 54 1 00 000000000000000 2 10000000000 VvAMg 100000000 U 2 1 4000 d B B nne t 9 3 000000000 OU 4 0000008000000000000000000 1520 0000 0 gt 260000000 05 00000 Processor Settings O O O O Processor Retest IDD DD DD DD ceupnnBngatubn 0 4 3 5 Maing OOUM gt e200000000000000 wcPUDOOOOOO 2 OO 5000000 CPU
62. Change Values Enter Select Sub Menu Primary IDE Slave None Fl Help Select Item ESC Exit lt gt Select Menu Processor Settings Processor Settings PhoenixBIOS Setup Utility No Disabled Enabled 700 Mhz 6A0 2MB Change Values Enter Select Sub Menu Processor Settings Processor Retest Processor Serial Number Memory Cache Measured Processor Speed Processor 1 CPU ID Processor 1 L2 Cache Size Processor 2 CPU ID Processor 2 L2 Cache Size Processor 3 CPU ID Processor 3 L2 Cache Size Processor 4 CPU ID Processor 4 L2 Cache Size Fl Help Select Item ESC Exit lt gt Select Menu O Processor Retest Da ganagpeeunuugnuanaugapnguanmnud Yes O Processor Serial Number Disabled 1 DJ J J J Enabled u gau
63. 32 C3 3 3 L3 r3 r3r3 5
64. 00 1024 Enabled 00000000 10240 Disabled 124000008008000000008008008008008000000 O40 114 4 4 5 SCSI Disk Utilities 1 0000 SCSI Disk 0000 9 0 N 0 ES E OO EJ 000 Adaptec AIC 7899 lt SCSISelect TM gt Utility AIC 7899 at Bus xxh Device XXh Channel X Select SCSI Disk and Press Enter No device No device No device No device No device No device No device AIC 7899 No device No device No device No device No device No device SCSI ID 10 SCSI ID 11 SCSI ID 12 SCSI ID 13 SCSI ID 0 SCSI ID 1 SCSI ID 2 SCSI ID 3 SCSI ID 4 SCSI ID 5 SCSI ID 6 SCSI ID 7 SCSI ID 8 SCSI ID 9 6 0 SCSI ID 14 SCSI ID 15 No device No device Arrow keys to move cursor Enter to select option Esc to exit default
65. 152 O50 542 O00 4cPug BiosOOOOOOOOOOOOO 0000 0 D Main OOOO Processor Settings OU 000 cPUgGM54100000000000000M gt 490000000 0000 BOO 000 O000 Main 0000 Processor Settings Processor Retest Yes B Hd BB B E U D U U 0000000 CPUGOOOOGOOYesSOOOOOOOOO 153 54 55 1 1111111111 1 1 FE 00 3500000000000 oomo EEFE EET E 3 oo Ono On Ono Oo aog 1 On On Op Op Og 5 5 1 1111 O2000000000000000000000 SCSIQOOOO00000000000 sesiog
66. JOOOOOOOOOOOOOOOOOOOOOOOOOOO ANE 521 000000000000000 1 M310O000000000000000000000 gt 340000000 000000000058000000000000000000000 2 n T 79 136 5101010010 0090000 137 00000 52 8 1 01 1 1 1 0 c cl 3 5 3 d Ina d 7 gt gt gt inis r3 2 3 agoa r3 882 ool lt c3 L are c 4
67. O Embedded NIC LAN Enter 0 O Embedded NIC J 0 PhoenixBIOS Setup Utility Advanced Embedded NIC Item Specific Help Embedded NIC Enabled Option ROM Scan Enabled Fl Help Tl Select Item Change Values F9 Setup Defaults ESC Exit lt gt Select Menu Enter Select Sub Menu F10 Save and Exit 72 73 PCI Devices O Embedded NIC LAN LAN LAN O Option ROM Scan ROM Enabled ROM Disabled ROM PCI Devices Slot 1 8 PCI Enter
68. c gt gt ITELEILITLIETETEJ ooo CI eS cease G aes MA Zi EST EST 53 m oooooooo OOO L1 pa SSSSSSSS OOO oO 22222222 EN oo 10181 i Bese de qo Oo 1 55 ssesses 111 22 2 2 53 lt 32 E oange GG Oooo aza Ey E oo GROG 20 Eit Em rib o0 Er gt uam oo OOo O50 Se OS ooo gt 323 OOOO AD e PS 3 3 4 1 F3 30 02 OS 7 53 QU 2299550 Ot 2 2 8 262 Pg 9 222 1 00 r1 2838523 ee 4 A oa BUE 12 0 2 3 2 gt 2 t oo EC 0 c uut E ae ted psp ax a 3 3 2 2 r3 3 H oaoooo ow oo Ex TH 1 FZoonsAococno 1 22 eS Soe eee L1 GN SE pom AE Lie 5 oo ozo COCOCOCICICICICI Ou oax 3 3 3 3
69. oO aaa a p 200p o aa rira a m o 1 Esa Fi Esq tE Ti EY pooooootoooo Bond ooo a Oooo Ho Oooo 3333022222 2 Oooo ao A 22222 ra Oooo CIC Oooo oOo gt Nooo st LO 3 000000000000000 145 5 11101 Uu LC 1111 1 1 1 1 LEE Oo Oo oOo Oo 1 1 Ee 3 4151 EE 41 17 LSE ie Le Cal CES Oo L 0A 53 OO 111 1 1 111111 10 00 11 11 1 1 DIMM Dual In Line Memory Modules OO 00000000 531 00
70. Expert Intermediate Preferences 0 0 00 Language D 000000 Language D 00000000 Language JO 00000000000 M English United States 000 118 040000000 Preferences 0 000 Other QO D Othe 0 I Other Status Bar Enable OOOOO000 Status Bar Disable 455 0 lU 909 000 0900000000000000 O0 osroooooooooooooooooooooooooooooooog 1 SSU H D L 0 Available Tasks 0 0 0 0 0 Resources No D Resource Configuration Add in O 00 Resource Configuration Add in Devices PCI Card Bus 00 Dev 00 Multifunctiqg Controller E PCI Card Bus
71. ee se ee el scsi O O 605278 0000000000000 GP5S622 GP5S633 GP5 R1DC4 GP5 R1DC5 0 000 0 568 OO GP5 127 10 0000000000 0 0 0 D GP5S622 GP5S633 100000000 6 55622 3 55633 0 0 30 000 GP5S622 GP5S633 0 10 00000000 0 GP5S622 GP5S633 00 0000000000000000 e 000000000 0 0 GP5 R1DC4 GP5 R1DC5 0 300000000 868 0 0 D GP5S 8230 0 0 SCSI 0 0 GP5 127 GP5S 823 D DI 0 0 Oscsiggg1070000000000000000 D SCSIQ 0 0 GP5 127 30 0 D 19000000 DUDDDUDDDDDDU GP5 R1DC4 GP5 R1DCS pon ggonn de GP5 RTDCAGP5 R1DCS 0000 0 0000000 GP5 R1DC4 GP5 R1 DCS 0000000000000 0 GP5 R1DC4 GP5 R10C5 0 000 0000000000e 0 58651 B O 5 127 00 GP5 R1DC4A GP5 R1DC5 OOO O50 180 4 GP5 144 0 000000000
72. DODOOOODOOOOOOODOOOOOO DOOODOODOOOOODOODOOODOOO e oll e Sooscco50005SS000000o b r3 9 Cy io BEBEBEBBBEBEBEBEBSBBB gt L3 le DODOODODOOODOOOODOOOODO lol DODOOQOOOOOOGOOOOOODOODODDO 8 E B Dp 5 v Los lef ie fo ui 3 L3 c E EG Ej F 1 maa E73 73 3 1 E3 3 E3 6 L3 4 Ez ESI E sz G a G 3 EIE ees ESTE 3 r3 aa 1 T C3 r3 r4 DELE Oo Soa ELE E Oo 3 E3 L3 3 ooog aA y C3 ES EJ ooo gt ooo r3 3 2 E 1 ES FI SILES ESL eae aaa L3 r3 Ooo C3 1 m r3 1 oOo d EJ EXEJ EJ st 3
73. EMP PEP PEF management PEP PEF management Server Menu PEP PEF management Enter PEP PEF management PhoenixBIOS Setup Utility Server PEP PEF management Item Specific Help PEF Filter Events PEP Enable Disabled PEP Blackout Period 0 PEP Page String Send Test Page Press Enter Fl Help Tl Select Item Change Values F9 Setup Defaults ESC Exit lt gt Select Menu Enter Select Sub Menu F10 Save and Exit 4 3 BIOS 89 Item Specific Help F9 Setup Defaults F10 Save and Exit 255 PEF Filter Events B Test Page
74. 10000000000 0 lU 00 00000000000 0 0 000 2000000000000 PCIOOOO000 10000000000000000000g lU OCOODOCOOCOOOOOD ServerWizadQ 0000000000000 OOOO Serverwizard DDD D O ServerWizadQ 0 00000 9000 58 0 0 Unknown Card 00000000 191 1 1 5 6 1111111111 1 1 1 3000000000 20000000000 000000 0000000 1000000000000000000000000000 O000000000000000000000000000000000000 000000000000 ANSA 0 UUDDDDDDUDDDDUDDDDDUDDDDDUDDDD 2 D000000000000000000000000000 D00000000000000000000000 O000000000000000000000000000 0000 poo lU 00000000 000000 000000 100000000000000000000000000n 5 5 7 5 7 1 192 193 g 8
75. DI D RAS AEBS RAST 1 RAS 000000000000 6 7RASs000000000 00O gt 2440000000000000 0 LH E D L 1 PostgG RAMOOOOOOOOAOOOOOOOOOOOO 0000000 ServerWizard CD 0000000 MS DOS 6 2 Startup Menu 1 ServerWizard 2 System Setup Utility SSU 3 SEL VIEWER 4 Basic BIOS Environment Support Tools 5 Basic DACCFG 6 SMM Utility Setup Test 7 RCI Utility 8 HDD firmware update 2 4 Basic BIOS Environment Support Tools 0 0 0 0 Enter OO 3 O Bios EnvironmentSupport Tools 1 OOO
76. O High Modem Init String 16 16 O EMP Access Mode EMP UO u Disabled EMP i Pre Boot only Always Active EMP O EMP Restricted Mode Access EMP Disabled EMP Enabled EMP O EMP Direct Connect Modem Mode EMP U Direct Connection Modem Mode O System Phone Number
77. lt oO omgaan nA be ea 3 ee Co OICOCOCICICICICI Soe Se 5 5 5 5 5 5 5 22252 aaaaaaaa Co m 148 rrr Ep ESL EESTI 53 83 532 111110110 0 CPU 400 00000 oono 0 0 L3 OOO wcPUDOOOOOOGO lU 00 0000000 1 1 0 uu 700MHz L2 1MB GP5 FG20G VRM x 10 700MHz L2 2MB GP5 FG20H VRM x 10 OOO000 DO00000000000000000000s0000000000 0 44crup000 5 391 s4CPUOOOOOO 149 5 4
78. 0 O O 64bit G6MHz Bus07 DevOE PCI A2 D 0 O 64bit 66MHz 6 000000000000 ump System Resource Usage D D OO Resource List D 1 D 1 D D U U D Resource Configuration Add inQ Choice 000000 DMAIITI IRQOT Memory Poti 0 148 075 146 075 144 0 1 ag 5 511 1 O D DD Resource Configuration Add in O 0 O O Co processor O0000000000000 0 Disabled 0 D 0 BIOS 000000000000 00 Advance 0 D Integrated Peripheral Configuration COM 0 0 Parallel port O OO Disable T GOO e DU DU u uU M10 OO D D CO D 122 OOUUUU 456 00000 Boot 1 ssu Available Tasks 1 0
79. 000000000000000 4 0 0000000000 0 2 5 0 0000000 3 Ereg Enter QO0000 0 00 0 0 800000000 4 00000 4 bl Save Changes Mode 00 0 0000000 ScsiSetectQOOOOOOOOOOOOOOOOOOOO Oo 5 00000000000 Enter 1 Esc SCSI Select 0 SCSI Select 1 1 F5 SCSI Select 0000000000000000 000000 44 SCSI Select 000000000 11 SCSI Select 8 8 seet 0 0 00000000000000000000 1 55 00000000
80. 162 1100 0 000 0 OOO 510 0 000 000000 0000 80 000 0 080000000000000 0 gata 100 200 n A Narrow Narrow Narowscsigggdadd 2000 SCSI SCSI I D 0 B Wide SCSI Wide SCSI 100000000 Wide scsigoo0o0o000 oo og 2000 6 51 Od GP5 127 000 oc Narrow Wide SCSI Narrow SCSI OO Narrow SCSID scsi p 0o DI Wide SCSI SCSIQ GP5 127 LI 000 O OOOOOOOOOOOO Narrow 865 0 0 0 Wide SCSID 0 0 0 Narrow SCSI 50000000000 oooo CD ROM oot 5 o02 Narrow 80810 14 5 68 DD 003 Narrow SCSIQ 10 4 5 60 1 Cc scsi 0 0 0 5000 Denoon 080 OOO 1 Oo L1 B Widescsig nnnnnu e zu IDE Wide SCSI m SPN sesh ell 50668 gt wide SCSI 0 00 D 8 CD ROM Ultra 160 Wide Wide SCSI 0 e une SCSI A ch 0 D 0 D gt D IDst4 5 e Wide SCSIQ 0
81. Exit Discarding Changes Enter Configuration has not been saved Save before exiting 2 gt 10 0 Ente 0000 1 O Exit Exit Saving Changes I Yes BIOS u No JU BIOS O Exit Exit Discarding Changes I Yes 4 3 BIOS 55 D
82. GP5 185 100BASE TX 100BASE TXT GP5 186 100BASE TX Dual LAN LAN 0 0 100BASE TX GP5 187 100BASE TX IPsec GP5S634 4 1 11111 1 CANET CU D U D 7 LI D OOOO LANQ OOO OOOO 1 1 1 CU OO000 LAN Windows 2000 Server O Windows NT Server 4 0 OOOO 585 4 50000 LANI D LAND 0 0 GP5 183 LANI 0 0 GP5 187 GP5 185 LAN Driver 000 V5 1L20 Server Wizard CD D 0 GP5 185 LAN Driver 111 LAN GP5 181 GP5 185 GP5 0000000000 V5 1L10 ServerWizard CD 1 186 OO LAND OOOO 40005583 0000000 00000 uu LAND GPS 185 300000000000000000 0 UU D B 729757 003 4 7190 001 2 3000000000000000000000000000 GP5 18 000000000000 0 DU LANI OO GP5 185 000000 30000000000000000 s0 11010101 11 011111 0 184
83. aan 105 00000000000000 GP5 146 PC 00 Pn 112 00000000000000 ooo GP5 148 PC n 98 005 00000000000000 00000000000 GP5 FC101 PCI 2 00003 000000 GP5S634 PCI UD 1 LAND OO GP5 181 PCI nna 10BASE 5 2 T LAND OG GP5 183 PCI 1 1000BASE TX LAN OO 100BASE GP5 185 PCI 3 GP5 186 0000000 LAN TX 0000100000000 100BASE GP5 186 PCI 1 TX Dualg LAND 0 GP5 187 PCI 003 o O 100BASE TX IPsec 00003 100000 vx GP5 163 PCI oo 2 ISDND OO GP5 165 PCI 2 00003 0 80550103 PCI 1 5 GP5 SMB101 PCI gg 1 000000 m 0000000000 GP5 CP101 1 2000000 00000 FMV FX533 Pcl oo1 ISDN 0 G3 G4FAX GP5 161 PCI oo 4 PCIE DIL O B BI C C D 5 6 1 1 D E DE DB D D U E 169 000000 0 000000000000000000 0 ANE X uggggaguguuada PCI 0 C 1 C 2 1 A 2 B 1 B 2 B 3 B 4 GP5 SM103 scsiQ ODOO00000000 GP5 144 9 9 scsiQQOOOOOOOOOO GP5 146 9 9 scsiQQOOOOOOOOOO GP5 148 9 9 SCSI 0 O GP5
84. 110 0 5 Resource Configuration Add in i u vironment Support Tools OOO B Dl 0 O00 4 6 BIOS SCSI SSU UD 0000 poop T mn D DDD En DDD IT gt 2 Resource Configuration Add in Devices O Baseboard System Board O 120 040000000 Baseboard System Board Function System Group Sustem Identification and version Informat SSU Configuration File version Cancel BIOS Multiboot Group Hemory Subsystem Group On Board Disk Controllers Group Help 0n Board Communication Devices Group Floppy Drives Group LLIDE Dauicac Cran Resource Use 7 Memory N A Function 000 0 0 uade 6 000000000000000000000
85. 138 oooocodo 0 oooocoooocopoogoooooooooooo ooococoococoococoooooooooooo ODDOBBOOOOODGOBDOODOOOOOOODOOOO
86. 160 Initiate Wide Negotiation yes Enable Disconnection yes Send Start Unit Command Options Listed Below Have No EFFECT if the BIOS N C no no N C N C N C no no Enable Write Back Cache BIOS Multiple LUN Support Include in BIOS Scan Arrow keys to move cursor Enter to select option Esc to exit O Sync Transfer Rate MB Sec 0 416 7880 400000000000 5 10 0 13 4 16 0 20 0 26 8 0 4 4 SCSI Select AIC 7899 3 160000000000 ASYN 10 0 13 4 16 0 20 0 26 8 32 0 40 0 53 4 80 0 O Initiate Wide Negotiation OO 1 1 1 0000000000 O Enable Disconnection 0 5 1010 1 1 11 5 1 SCcSIQODOUOO0000000000000000
87. 80000 D UDD no a oa PCID 0 0 0 B 4 PCI 00 8 3 9 PCI 00 2 SEN PCI 00 8 1 i al PCI 0 A 2 PCI O00 A 1 0 S EC En 0000c S 8 1111011101 1 0 000 0 1 11 00 00019 00 0 21000000000 D u 0000000 8 8 8 DMAQ OOO 168 0 s0 1 1 1 0 00000 oo 0000 0 86810 D 0 6 5 123 PCI Dn 2 non scsiuna 86810 oo GP5 127 PC 3 000000 86810 00 nm GP5 144 PC
88. Boot Devices Multiboot Options Add in D D B D B D B D 0 Multiboot Options Add in Boot Device Priority Removable Devices Hard Drive Intel UNDI PXE 2 0 build 074 N Hard Drives Other Bootable Device Move Doun Boot Device Priority 2 3 00000000000 4 0000000000 0 Move Dow 0 00000000 5 Save 000000000 6 7 1 111 Close 0 00000000 123 45 437 590 0 1 1 0 0 Gadminstrato O0 000 Available Tasks 0 0 00O l Security HB D DO D Secrity 0 000000000000 hii platform require that a user password be set on the system Password changes take effect immediately option changes require a save and a reboot Admin Password User Password 810511 UID U I D D BIOS OOOOOOOOOOOOOOOOOOOOOOOOOOOOOOO 1 O Admin Password O O User P
89. OO sSsvOOOOOOOOOOOOOOOO Support Tools BIOS Environment Support Tools II 0 1 1 D 0 B B D D B D B H D D U BIOS Environment Support Tools 0 0 0 0 0 BIOS Environment Support 1 1 L1 L 1 B U HU U HU UU U DU 000 8 51010000 90 00000 00000 5090 000000000000000 00000 e e BIOS Environment Support Tools U BIOS Environment Support Tools D L3 5 EJ Ey BE oo EI U Q 0000 0000 BIOS Environment Support Tools 0000000000000000 O DIO D U OO ServerWizard CD BIOS Environment Support Tools NOOO 127 8 5 5 8 55 4 6 BIOS Environment Support Tools apu ServerWizard CD 70 0 MS DOS
90. Password on boot Disabled 00000000 Enabled Fixed disk boot sector Normal Write Protect Secure Mode Timer O00 3 3 22 22 oooga 0 0 0 Disabled 10000000000 20 5D 100 20 min 1 2hr 81 43805 Secure Mode Hot Key Backspace 0 00000 000000000000000 Delete AQ ZJ 0 9 Secure Mode Boot O000000 0 User Password is O Administrator Password is
91. ns Ultra 160 Wide pnaunumue D 1D 4 5 60 SCSI B ch 2 2 SCSI GP5 127 0 scsin 0 0 68 0 Wide SCSID 0 0 0 0 Wi PS 163 5 5 1 L 1 CO Narrow SCSIQ O O Widescsip TT OD O000000000 Wide SCSIQ mem Narrow SCSI IDED I D oo00 80000000000 ED EUM CD ROM 1 Ultra 160 Wide Narrow SCSI 0 9 9 9 2 8681 A ch 0 0 0 0 01100 ID84 5 6 Wide 808 0 gt 3 Ultra 160 Wide nennge ID 4 5 6 SCSI B ch 34 2 4 SCSI 00 GP5 127 l DD IDE D D 865 0 0 0 680 0 9 Wide SCSI OOOO 8 0 lt 00 O O gt O O 0 0 0 4 Se ae 1 1 1 5 1 164 0 SI
92. 0 107 4 4 SCSI Select O Boot Channel AIC 7899 0 T UU UU os 000 00000000 BFirst O Boot SCSI O0000 5 0000 O Boot LUN Number 007 epu 4 108 109 000 6 40 0 yes yes yes Utility 5 40 0 yes yes yes 4 40 0 yes yes yes is Disabled N C no yes 14 40 0 yes yes yes N C no yes 13 40 0 yes yes yes N C no yes 12 40 0 yes yes yes is Disabled N C N C N C no yes default 6 160 yes yes yes no yes no yes Device Configuration 651 2 40 0 yes yes yes 0 1 40 0 yes yes yes SCSI Device Configuration scsIQO 000 0000 000000000 Enter AIC 7880 Adaptec AIC 7880 lt SCSISelect TM gt SCSI Device Configuration SCSI Device ID Sync Transfer Rate MB Sec Initiate Wide Negotiation Enable Disconnection Send Start Un
93. 00 Dev 01 SCSI Controller PCI Card Bus 00 Dev 04 Ethernet Controller PCI Card Bus 00 Dev OC VG Controller PCI Card Bus 00 Dev OF Multifunction Controller PCI Card Bus 01 Dev 05 PCI Hot Plug Controller PCI Card Bus 01 Dev 06 Multifunction Controller PCI Card Bus 07 Dev 07 PCI Hot Plug Controller 4500000000000 0000000 55 0 119 86810 0 0 0 0 0 0 0 0 GP5 144 GP5 146 LAN OOOO 895 1868 0 0 D D 0 Resource Configuration Add inQ 0 0000 PCI E OO PCI OO0000 Bus Device 0 uu uuu GP5 144 146 PCI B1 Bus 02 Device 08 Co processor Bus 02 Device 09 RAID controller PCI A1 Bus 08 Device 08 Co processor Bus 08 Device 09 RAID controller PCI A2 Bus 09 Device 08 Co processor Bus 09 Device 09 RAID controller GP5 186 PCI B1 Bus 02 Device 04 Ethernet Controller Bus 02 Device 05 Ethernet Controller PCI B2 Bus 03 Device 04 Ethernet Controller Bus 08 Device 05 Ethernet Controller PCI B4 Bus 05 Device 04 Ethernet Controller Bus 05 Device 05 Ethernet Controller oo000000000000000 3 3 000 0000 4
94. 000000 000000 O Memory Cache 1 Disabled Enabled D UJU D 0000 0000 0000 0000 Oooo Oo L3 Oo Oo L3 Oo Measured Processor Speed 5 El 5 o OOOOOOOOOOOOOOOOOOOOOO O Processor L2 Cache Size 20 438095111000000000000 65 Language 1 1 D D English US D 0 EnglishUS O 11 10 0 D Francais D D u Italiano Deutsch Espanol Japanese 66 1411010000 IRQ 67 PCI 4 3 6 Advanced OO 0 Advanced
95. Device 06h Channel A Would you like to configure the host adapter or run the SCSI Disk utilities Select the option and press Enter Press F5 to switch between color and monochrome modes Options Configure View Host Adapter Settings SCSI Disk Utilities Arrow keys to move cursor Enter to select option Esc to exit default 4 4 SCSI Select 99 3 00 0 00 8 0 0 000000 1000000000000000000 Adaptec 210 7899 SCSISelect TM Utility vX XX AIC 7899 at Bus 0lh Device 06h Channel A m Configuration SCSI Bus Interface Definitions Host Adapter SCSI ID SCSI Parity Checking Enabled Host Adapter SCSI Termination Enabled Additional Options Boot Device Options Press Enter SCSI Device Configuration Press Enter Advanced Configuration Options Press Enter F6 Reset to Host Adapter Default BIOS Information Interrupt IRQ Channel I O Port Address SCSI Termination Level Arrow keys to move cursor Enter to select option Esc to exit default 100 141 1 10 0 0 0 SCSI Seet 1 000 0 00
96. Non Maskable Interrupt O HD D Disabled 00000000 D D U D D U Enabled NMID Assert NMI on LH 5 8 NMIG 111 1111111101 HH Disabled NMI I B BH B D Enabled 00000000 FRB 2 BSP Policy 000 FRB 20 0000000 Disabled Immediately Never Disabled Allow 3 Failures 000000 og og og N System Management D Enter 5 D U D U D D System Management 85 43805 PhoenixBIOS Setup Utility Server System Management Item Specific Help Board Part Number Board Serial Number System Part Number System Serial Number Chassis Part Number Chassis Serial Number BMC Revision 05810021 Fl Help Tl Select Item Change Values F9 Setup Defaults ESC Exit lt gt Select Menu Enter Select Sub Menu F10 Save and Exit Console Redirection Enter Console Redirection PhoenixBIOS Setup Utility Ser
97. OU Wait a moment Don t turn off the system SUCCESS Please re boot the system to validate the configuration 5 08000000000000000000000000000 8 Bou BIOS Environment Support Tools 1 BIOS Environment Support Tools BIOS OO00 OOOOU0000000000O OO00 1 1 0 000 BIOS Environment Support Tools 4 6 BIOS SCSI SSULn un 131 Write protect error writing drive A uuggugnnaugaagadaggdnpnamid dna Abort Retry Fail nnn Not ready writing drive A Abort Retry Fail IOS Environment Tools 0000000000 LJ LE LI 1 LE on o 2 A OOOO oO Oo I BIO ERROR This program doesn t run on this system ERROR Fail to
98. PhoenixBIOS Setup Utility Item Specific Help Change Values F9 Setup Defaults ESC Exit lt gt Select Menu Enter Select Sub Menu F10 Save and Exit Advanced PCI Devices Slot N Option ROM Scan Enabled Enable Master Enabled Latency Timer 0040h Fl Help TY Select Item O Option ROM Scan ROM Enabled ROM Disabled ROM 4 3 BIOS 1 00 PCI 1 Item Specific Help F9 Setup Defaults F10 Save and Exit O Enable Master PCI Hot Plug PCI Control Enabled Disabled O Latency Timer PCI PCI uu 0040h i Defaul
99. RAMOOOOOOOOOOOOOOOOO lU 11111 1 utu 4 RAMOOOOO 256MB GP5 RM25N 64MB DIMM RAMDI 0 0 0 512MB GPS RMSIN 128MB DIMM x 4 0 RAMOOOOO 1GB GP5 RMIN 256MB DIMM x 4 00 RAMO OOOO 2GB GP5 RM2N 512MB DIMM x 4 00 RAMA 0 0 4GB GP5 RM4N 1024MB DIMM x 4 0 000000 oo 00000000 0 641 ALD 00 DIMM oo pH 2 p A4 B10 B4 cig 4 146 uspnmpnanaagguuuulll 147 5300 ip 5 52 4 6 FERN 00000000000
100. SCSI Termination Enabled Additional Options Boot Device Options Press Enter SCSI Device Configuration Press Enter Advanced Configuration Options Press Enter XF6 Reset to Host Adapter Default BIOS Information Interrupt IRQ Channel I O Port Address SCSI Termination Level Arrow keys to move cursor Enter to select option Esc to exit default Host Adapter SCSI IDO LH D 0015 sestipggog SCSI Parity Checkingg Enabled 000000000 000000000000 OU Disabled 0000000000 1 0 Disabled 0000000000 1 4 106 Host Adapter SCSI Termination O00 1 1111111101 1 1 1 80 Enabled u putt 0000000000 Disabled
101. SCSI seet 1 1 1 1 1 1 1 1 1 1 1 0 1 01 0 0 0 0 0 Disabled SCSI Seet 1 1 1 1 1 1 1 1 1 1 1 0 1 01 0 0 0 0 0 0 uuu 112 1411010000 Extended BIOS Translation for DOS Drive gt 1 Gbyte LJ 1GB 1024MB 00000000000 SCSTE U BU U BU UU U UU HU U SCSIBIOS Q Enabled J Enabled 00000000 1GB Q00 1110 00 00000000250 0 00 0 108 1111111111 4100100000 00 OO Disabled OOOO uggaagagagagagagagagagagaggauu O Verbose Silent Mode Verbose BIOS Silent Host Adapter BlOS Configuration Utility Reserves BIOS Space QQ 0o N 0000000000 Enabled 1
102. create data file ERROR Fail to write 1st CMOS data into data file XX 00000000000000 0000000000 ERROR Fail to write 2nd 1111111101 111111 111010 110 10 CMOS data into data file XX ERROR Fail to write ESCD data into the data file XX ERROR Fail to write SEEPROM data into the data file XX ERROR Fail to open data file ERROR Fail to write 1st CMOS data into sysytem 1000000000 ERRORFalt wieznd 00 CMOS data into sysytem 80 00000000000000000 BIOS ERROR Fail to write ESCD data into
103. m 7 Hi 5 Oooo Ooo Ooo Ooo Ooo Oooo Ooo Ooo Ea EYE 4 00000000 5 0000000000000 5 00000000 OFFOOO 2 000000000000000000000 3 00000000000000 1 5 7 2 11 0 194 a e 3 0000000000000000 4 2 000000000000000000000000000000 orFnnpand 0 5 7 3 2 000 800000000 10 30000000000000 OFFOOOUO 00000000000 6
104. oo oo oo oof oo oo ooo oom BAF ooo ooo 2 000000000000000000000 167 5 909 2 oo00000000000000000000000000000 1 1 00 OOU0U r3 oo oO ooo r3 E3 EE ooo 53 EA JEJE a GH r3 oo ooo r3 Et EJ ooo o0 o ooo 5 EJ EJ m ooo oo Co Ooo Oo oo BY E r3 Est E E oO Ooo EI oo oo Eri oOo Ea oOo Lm r3 oo oO ooo oOo o rH ooo Lm o o0 ooo oOo El pt ooo oOo of OO Goo oo oo T OO goo oOo oog OO Ez 3 ono oOo ptr o Oo ma caHg E3r3 o 200p oo noo ooooo r1 OOD oo ooo ooo r3 ono E13 E3 oO oo 000 p pne mg ORG oo noo oo Poo o 220 oo noo oOooo ecd te oo Se aps 22 See 225 a oo ooo o 280 pooo oo a Sees BE n oO n nw tmb r3 oo m oO Lo EI a a 2 4H 1 EE EI E EEN EJ ES 1 oo 6 00 868000000000000000000 7 56 1 1 01 0 0 0 0 Ul 561 11 1 0
105. system file XX 11 111 1 1 ERROR Fail to write SEEPROM 0818 into sys tem XX 132 1411010000 133 11111 11111 11111111 11 11 51000 5 2 5 3 0 RAM 5 4 CPU 5 5000 5 7 5 8 5 9 RCI 1 51 CONTENTS 134 e A E e ERE imm 3 9 o 20 og I one oD oO EX dE Ex oo 2 mi o0 O rn oO IET F 350000000000 U
106. 0 uua Disabled O40 78 Advanced Chipset Control Enter ill Advanced Chipset Control PhoenixBIOS Setup Utility Advanced Advanced Chipset Control Item Specific Help Base RAM Step Every location Extended RAM Step Every location Remap Memory Disabled Fl Help Select Item Change Values F9 Setup Defaults ESC Exit lt gt Select Menu Enter Select Sub Menu F10 Save and Exit Base RAM Step POST Every location 1MB 1MB 1KB 1KB Extended RAM Step POST Every location 1MB 1MB 1KB 1KB No memory test
107. 0 680 0 Narrow SCSI 0 D 500 D Ultra 160 Wide SCSIA chO 0 0 800 Ultra 160 Wide SCSIB chO 000 680 D DED 0 000008 piget 80000000 M 0 B I N Wide SCSID O00 680 0 Narrow SCSIQ O00 5000 Ultra 160 Wide SCSIA h DD 0 0 6800 Ultra 160 Wide 8681 8 000 6800 09500 808 0 0 0 880 0000 20000000 O50 178 2 0000 5000 000 8050 Y X Wide 80810 6800 Narrow 5651 DD 6000 IDE 0 0 D cho 0000000000 GP5 144 GP5 146 GP5 148 808000 08800 0000 Eoo 8 80000 00 RON P C1 00 5651 0005000 0000 weg OOO Good u x Wide SCSI OOO 680 0 Narrow SCSIQ 0 500 1050 D ame good scsig 000000 GP5 144 GP5 5 5 000 680 0 SCSI 0 0 0O 680 0000 0000 0000000000 LL UU OO 5 6 179 L3 L3 3
108. 0 0 Disabled 00000000 10 008 050 10 0000 00 Enabled Video Blanking 0 User Password is O Administrator Password is 00 Disabled 00000000 0 00 Enabled Floppy Write Protect tr User Password isl O O Administrator Password 151 Disabled Enabled 00000 00000 040000000 82 Security Set User Password Set Administrator Password Oooo 1 000000000000000000000 2 2000000000000000000000 100000 D C1 0000 00000 00000 000 000 O00 O00 DU O00 DU o0 0 0 0 0 Ooo OCI OOOO
109. 0 0 0 GP5 146 86810 0 00 000 0 0 0 GP5 148 00000000000 GP5 FC101 000000 00000000000 GP5 SM103 1 1 1 NIC 2559 U U U Alc 78809 00 I E GP5 1230 00000 8081 0000 AIC 7899 0 lU scs 000000 D arc 7899 00000 Ac 7890 00000000000 5 172 173 56 13800000000 gt 52110100010000 010 0 0 1 1 00 CO 1 C3 ES C3 C3 m TR 4 A AN D BDundubd On
110. 0000 GP5 R1DC4 00000000000 GP5 R1DC5 0 0000 GP5 R1DC5 30 00 19000000 0 GP5 144 9 000000000000 GP5 R1DC4 One GP5 R1DC4 GP5 0 000 000 00 GP5 R1DC4 GP5 0 0 0 0 ch 808 10 00 1 ODD 0 GP5 1440 chi L er SCSID GP59 8320 0 0 0 els TE E E 868 GPs 14410 0000000000000000 GPS R1DC4 GP5 R1DC5 30 800000 0000000000000 240 pun lt 0000000 440 00000000000 Oo Oo Oo OO 181 56 65 GP5S622 GP5S633 GP5 R1DC4 GP5 R1DCS GP5S622 GP5S633 GP5 R1DC4 GP5 R1DCS GP5S 832 GP5S 832 9098 00 000110000 GP5 146 148 cho chi 805 1 0 1 0 00 GP5 144 cho ch1 182 5
111. 00000000000 lt 5 1 ESL ES EE BH EE see 3 E3 C3 ETETEJ 3 000000000000000000000000000000 OOOOOOOOOOOOOOOOOOOOOOOOO 5 141 UD OOO 5 2 0 BAO E EI LLL OOOO 0 3 3 3 Ep m noo C3 L3 OOo OOOOO Er RR i EST TI L3 C3 C3 C3 C3
112. 00000000000 3 M3200000000000000000000007 3500000000 1 400000000000 00000000 2 139 1 1 5 20 o00000000000000 oo0000000000000 or lef DOODODOO mm mm m m 0000000 Naam IDU IOOUU 3000 IODD m s521000000000000M gt 360000000 1 00000 000g 5 522 ESEEELEEI L3 EXE es TE L3 EI ELIT 51 1 0 1 oono 140 2 oo000000
113. 123 e 9 SCSI 0 O GP5 127 9 9 e GPS FC101 9 o LANQ GP5 183 LANQ GP5 181 _ 9 O 0 0 GP5 185 LAN OO GP5 187 0 0 4 GP5S634 LAN GP5 186 e 9 9 FAX 1 EL C FMV FX533 9 9 V X GP5 163 9 ISDNQ OO GP5 165 GP5 CP101 9 GP5 SMB101 ISDNQ 0 G3 G4FAX OOO GP5 161 9 9 e 00000000 170 0 S50 11111 111 1 1 1 562 000000000000 1 0 0000000000000000000000000000000000 O0 809 6 5 1650 000000 DU VXD 0560 nun dad 1
114. 88MB 3 1 2 Primary IDE Master Primary IDE Slave IDE 0 Enter Primary IDE Master Primary IDE Slave ill PhoenixBIOS Setup Utility Primary IDE Master CD ROM Item Specific Help Type Auto Multi Sector Transfers Disabled LBA Mode Control Disabled 32 bit 1 0 Disabled Transfer Mode FPIO 4 DMA 2 Ultra DMA Mode Mode 2 Fi Help Tl Select Item Change Values F9 Setup Defaults ESC Exit Select Menu Enter Select Sub Menu F10 Save and Exit 43BlOSOOOOOOOOOOOOOOOO 63 Item Specific Help F9 Setup Defaults F10 Save and Exit CPU Item Specific Help F9 Setup Defaults F10 Save and Exit PhoenixBIOS Setup Utility None
115. Boot 1 D Boot PhoenixBIOS Setup Utility Item Specific Help F9 Setup Defaults F10 Save and Exit Boot Device Priority Server Enabled Change Values Enter Select Sub Menu Main Advanced Security Boot time Diagnostic Screen gt Boot Device Priority y Hard Drive Removable Devices 14 Select Item gt Select Menu Fl Help ESC Exit Boot time Diagnostic Screen Boot Device Priority Enter 4 3 BIOS PhoenixBIOS Setup Utility Boot Device Priority Item Specific Help ATAPI CD ROM Drive Removable Devices Hard Drive Intel UNDI PXE 2 0 build 074
116. CSI Termination Lebel Arrow keys to move cursor lt Enter gt to select option lt Esc gt to exit default 44 SCSI Select 000000000 111 AIC 7899 Adaptec AIC 7899 lt SCSISelect TM gt Utility vX XX AIC 7899 at Bus 01h Device 06h Channel A Configuration ges Bus Interface Definitions Advanced Configuration Options Reset SCSI Bus at IC initialization Enabled Display Ctrl A Message During BIOS Initialization Enabled Extended BIOS Translation for DOS Drives lt 6 Verbose Silent Mode Options Listed Below Have NO EFFECT if the BIOS is Disabled Host Adapter BIOS Domain Validation Support Removable Disks under BIOS as Fixed Disks BIOS Support for Bootable CD ROM BIOS Support for Intl3 Extensions Arrow keys to move cursor Enter to select option Esc to exit default O Reset SCSI Bus at IC Initialization Enabled 00000000 5 5181051 2000 Disabled uult SscsrBIoS O Display gt Ctrl lt gt gt Message During BIOS Initialization O00000 59 LI D C D C D C D C UI U LU U LU C U U U Enabled 00000000
117. D D AIC 7899 1111 0 00 D O SCSI Select AIC 7880 00 00 0 0 Disabled scan bus Disabled Not bus uult 5 918105 1111111 010 O Domain Validationg AIC 7899 II 0 0 U D Domain Validation 0000000000000 Enabled 00000000 Domain Validation 0 0 0 00 Disabled Domain Validation 00000 D gpgapnpuscespaugpapnpnaabud Oo 44 SCSI Select 000000000 113 O Support Removable Disks Under BIOS as Fixed Disks UO SCSIBIOS sca SCSI BIOS Q Enabled O O 0000 D D O00 DU Oo 0 5 All Disks 500 Disabled 00000000 BIOS Support for Bootable CD ROM CDROM Disabled CD ROM HL DL D HB UH 1 D D U Enabled 00000000 BIOS Support for Int 13 Extensions
118. DDUDUDUDDDUDBDDDDUDUUDUDUDDBDBDUD 5 6 11 190 OSs 00000 000000 000000000 000000 000000000 yee ee eee neers FSi SIMS Sey oo i oo gt gt oOo O t oOo aos us oo 0 sem m z 7 m N gt gt one ea Sete 0000000 8 111111 1 1 5 6 12 gt 6 og BD BD GP5 FC101 1 111111 00 ROI UU 5 1011 11 1 5091011010 00 50511 5 6 13 1111111111 1 1 2 gt 5 og oo BD GPS CP101 m Oo Oo
119. E 1 NEAL 5 1 135 5 EJ T zz EI Ey oss r3 r3 L3 r3 L3 ET EJ r3 L3 r3 L3 r3 L3 r3 L3 zz E E d r3 r3 L3 r3 L3 E BS EI E Ed ET ESI ress Ez Ez OOo OOOO Oo OOOO rir Ooo 52 ake
120. Narrow SCSI 50 2 12 Ultra 160 Wide SCSI A 68 3 x2 13 Ultra 160 Wide SCSI B 68 14 4 VRM 15 5 LAN 16 IDE 6 USB 17 7 VGN 18 Aux power 8 19 9 PCI 20 CPU 10 Wide SCSI 68 42000000000 51 Og Password CMOS Clear Clear Y 1 8 1 2 28 3 3 1 2 23 Boot Option 000000 1 2 23 1 2 2 3 5 D d Baud Boot Option Recovery Y 1 2 519 ua Recovery Boot Password Clear CMOS Clear CMOSOOOOO00U0000000000000 oooo U 400 52 N 43 5 431
121. assword E E 0 EN Change Password H HH D DDD 1 D D 2 OOOOOOOOOOOOOOOOOOOO oKOOOOOOOOO 11 1 00 1 Admin Password O O O User Password DO E E E OU Change Password VU 0000000000 Co 2 OOOOOOOOOOOOOOOOOOOOOOOOOA O 3s OOUUUU Co 124 Hu 40 5 000000000 0000000000000000 Security D Options Security Options Hunu Securitu Options hii securitu options require that a user password be set for the system Option changes must be saved and a system reboot done before the changes take effect Secure Mode Hot Key Save Disable Secure Mode Timer 1 Minute Secure Boot Mode Disable Video Blanking N Disable Floppy Write Protect Disable Reset Power Switch Locking Enable
122. aster 00 000000 r3 Primary IDE Slave Primary IDE Slave 0 0 0 0 0 0 D 5 Processor Settings Processor Settings 000000000 i Language 57 43905 r3 B priu Advanced I 080008000800000000 0 og OO PCI Configuration U CI Configuration PCID O00 L3 L3 Og Oo Oo Og Oo Og Integrated Peripheral Configuration tegrated Perip Confi 2 A ation BR oe u Advanced Chipset Control rol gt Q gt 2 o a 3 os n oO 1 Reset Configuration Data Enable Sleep Button System Wakeup Feature Delay on Option ROMs 00 y Oo 2 prr 2 pum ip r3 B r3 B priu pnm r3 B primu r3 B priu pm a r3 B priu r3 B priu pnm a r3 B y
123. cy Diskette B Disabled y Primary IDE Master CD ROM y Primary IDE Slave None Processor Settings Language English US Fl Help J Select Item Change Values F9 Setup Defaults ESC Exit lt gt Select Menu Enter Select Sub Menu F10 Save and Exit 05 m BIOS 1 10 1 e1 1 51110000000000000 Main Advanced Security Server Boot Item Specific Hel Exit Saving Changes Exit Discarding Changes Load Setup Defaults Load Custom Defaults Enter Save Custom Defaults Enter Discard Changes Save Changes Fl Help Tl Select Item Change Values F9 Setup Defaults mm ESC Exit lt gt Select Menu Enter Select Sub Menu F10 Save and Exit 45 5 4 Exit Saving Changes Enter Save configuration changes and exit now
124. ervice Boot Disabled Service Partition Type 152 System Event Logging Enabled Clear Event Log No Assert NMI on PERR Disabled Assert NMI on SERR Enabled FRB 2 BSP Policy Allow 3 Failures Fl Help Tl Select Item Change Values F9 Setup Defaults ESC Exit lt gt Select Menu Enter Select Sub Menu F10 Save and Exit Service Boot Service Partition Boot Disabled Service Partition Boot Enabled Service Partition Boot Service Partition Type Service Partition Type 52 u Lu System Event Logging Disabled Enabled QQ uuu Clear Event Log 1 01 0 Yes Assert NMI on PERRO PERR 0 0 NMI
125. it Command Options Listed Below Have No EFFECT if the N C no yes 10 40 0 yes yes yes N C no yes 9 40 0 yes yes yes Enable Write Back Cache BIOS Multiple LUN Support Include in BIOS Scan SCSI Device ID Sync Transfer Rate MB Sec 40 0 Initiate Wide Negotiation yes Enable Disconnection yes Send Start Unit Command Options Listed Below Have No EFFECT if the N C N C N C no yes no yes Enable Write Back Cache BIOS Multiple LUN Support Include in BIOS Scan Arrow keys to move cursor Enter to select option Esc to exit Utility vX XX 5 160 yes yes yes 4 160 yes yes yes 3 160 yes yes yes 2 160 yes yes yes 1 160 yes yes yes AIC 7899 Adaptec AIC 7899 lt SCSISelect TM gt SCSI Device Configuration SCSI Device ID Sync Transfer Rate MB Sec Initiate Wide Negotiation Enable Disconnection Send Start Unit Command Options Listed Below Have No EFFECT if the BIOS is Disabled N C no no 14 160 yes yes yes N C no no 13 160 yes yes yes N C no no 12 160 yes yes yes is Disabled N C N C N C no no default no no no no N C no no 11 160 yes yes yes N C no no 10 160 yes yes yes N C no no 9 160 yes yes yes Enable Write Back Cache BIOS Multiple LUN Support Include in BIOS Scan SCSI Device ID Sync Transfer Rate MB Sec
126. led O Empty Bus Default Speed 66MHz Hot Plug PCI bus 33MHz 66MHz 0 33MHz 66MHz Integrated Peripheral Configuration IO Enter Integrated Peripheral Configuration PhoenixBIOS Setup Utility Advanced Integrated Peripheral Configuration Item Specific Help COMI Enabled Base I 0 Address 3F8 Interrupt IRQ 4 COM2 Enabled Base I 0 address 2F8 Interrupt IRQ 3 Parallel port Enabled Mode ECP Base I 0 address 378 Interrupt IRQ 7 DMA channel DMA3 Floppy disk controller Enabled Fl Help Tl Select Item Change Values F9 Setup Defaults ESC Exit lt gt Select Menu Enter Select Sub Menu F10 Save and Exit 4 8 BIOS BL 0 HH D HO D UL D UU D 75
127. lot Slot Slot Slot OAD CO ES Device Device Device Device Device Device Device Device Plug PCI Control 14 Select Item lt gt Select Menu PCI gt PCI PCI PCI PCI gt PCI PCI gt PCI PCI gt Hot Fl Help ESC Exit Enable Sleep Button System Wakeup Feature LAN Magic Packet 00 68 PCI Device Slot PCI PCI Device Slot PCIE EL DL EL CI LH PCI Device Slot 1 PCI C1 1 000 PCI Device Slot 2 PCI C2 000 PCI Device Slot 3 PCI A1 I 000 PCI Device Slot 4 PCI A2 1 000 PCI Device Slot 5 PCI B1 I 000 PCI Device Slot 6 PCI B2Q 000 PCI Device Slot 7 PCI B3 I 000 PCI Device Slot 8 PCI B4Q 000 Embedded Video Controller 00000 Video D Hu Enter Embedded Video Controller PhoenixBIOS Setup Utility Advanced Embedded Video Controller Item Specific Help Embedded Video Controller Enabled
128. on SCSI ID 7 Interrupt IRQ Che SCSI ID 8 I O Port Address SCSI ID 9 SCSI Termination Le 0 o o o o 44 SCSI Select 000000000 103 Configure View Host Adapter Setting 565119 Du 1 1 DU 56511 osOOOOOOOOOOOOOOOO scsI IDO JU lU D sesigg00000 000 BOSO uu 5 5 1 110000000000000 DD SCSI Bus Interface Definitions Host Adapter SCSI ID SCSI Parity Checking Host Adapter SCSI Termination Additional Options Boot Device Options SCSI Device Configuration Advanced Configurations Options SCSI Disk Utility 0 0 0 uu Select SCSI Disk and press 0 400 104 443 Maing 0 D 0 D DB Main 1 1 5081 Select 1 1 1 1 1 1111 1 1 iu uu
129. t 0020h 0060h 0080h 00COh 00E0h O Hot Plug PCI Control Hot Plug PCI 1 OOOO JU Enter ut PhoenixBIOS Setup Utility Advanced Hot Plug PCI Control Hot Plug PCI BIOS Support Enabled Resource Padding Level Minimum Empty Bus Default Speed 33 MHz Fl Help Select Item Change Values ESC Exit lt gt Select Menu Enter Select Sub Menu 74 O Hot Plug PCI BIOS Support BIOS Hot Plug PCI Enabled Hot Plug PCI Disabled Hot Plug PCI O Resource Psdding Level il Hot Plug PCI J i U Minimum Maximum Disab
130. t Adapter Default BIOS Information Interrupt IRQ Channel I O Port Address SCSI Termination Level Arrow keys to move cursor Enter to select option Esc to exit default Co 9 1 000000 SCSISelect TM Utility H Bus Device Channel Hl d H B B d d Hl B B I Press AQ for 1 1 uU Ctri A 111 111 Adaptec 210 7899 lt SCSISelect TM gt Utility vX XX You have an AIC 7899 Bus Device Channel SCSI host adapter in your system Move 01 06 A the cursor to the bus device channel of 01 06 B the one to be configured and press Enter lt F5 gt Toggle color monochrome N Oo L1 Bus Device Channel 00 0 0 Enter 0 0 0 0 2 0 0 0 SCSID 0 0 Bus Device Channel 01 06 A Ultra 160 Wide SCSI JOA 01 06 B Ultra 160 Wide SCSI B 11 SCSI Seet 1 1 1 1 11111 1 1 1 0 0 0 0 0 0 Adaptec 210 7899 lt SCSISelect TM gt Utility vX XX AIC 7899 at Bus 0lh
131. ver Console Redirection Item Specific Help Com Port Address Disabled Redirection disabled see help IRQ None Baud Rate 19 2K Flow Control CTS RTS4CD Fl Help Tl Select Item Change Values F9 Setup Defaults ESC Exit lt gt Select Menu Enter Select Sub Menu F10 Save and Exit O Com Port Address 00000 Disabled 00000000 3F8 2F8 8 O IRQ O Baud Rate OOO00 EMP 20000000 4 000000000 192K000000000 384K 115 2 9600 O Flow Control 1 CTS RTS CDG 000 No Flow Control D u DU 5 88501101000010000 CTS RTS XON XOFF

Download Pdf Manuals

image

Related Search

Related Contents

Aquarius iNtuition Mobile (AQMobile)  E1401-90009  HATR Flow-Through Cell  Manual de instalación Unidad de control de accesos  Manuel Utilisateur PAYBOX Saisie Manuelle  User Manual  Haier 34F5D TV Receiver User Manual  centre cuLtureL ! - Région Haute Normandie  

Copyright © All rights reserved.
Failed to retrieve file